YCOTAZXON
THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY & NOMENCLATURE
OCTOBER-—DECEMBER 2011
VOLUME 118
Homolaphlyctis polyrhiza Longcore, Letcher & T.Y. James, gen. & sp. nov.
(Fic. 4: zoospore ultrastructure, p. 439)
PETER LETCHER, artist
ISSN (ONLINE) 2154-8889
http://dx.doi.org/10.5248/118cvr
ISSN (PRINT) 0093-4666
MYXNAE 118: 1-465 (2011)
EDITORIAL ADVISORY BOARD
SEPPO HUHTINEN (2006-2012), Chair
Turku, Finland
HENNING KNUDSEN (2008-2013)
Copenhagen, Denmark
WEN-YING ZHUANG (2003-2014)
Beijing, China
Scott A. REDHEAD (2010-2015)
Ottawa, Ontario, Canada
SABINE HUHNDORE (2011-2016)
Chicago, Illinois, U.S.A.
PETER BUCHANAN (2011-2017)
Auckland, New Zealand
Published by
MycoTAaxon, LTD.
P.O. BOX 264, ITHACA, NY 14581-0264, USA
www.mycotaxon.com & www.ingentaconnect.com/content/mtax/mt
© MycotTaxon, LTD, 2011
MYCOTAXON
THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY & NOMENCLATURE
VOLUME 118
OCTOBER-—DECEMBER, 2011
EDITOR-IN-CHIEF
LORELEI L. NORVELL
[email protected]
Pacific Northwest Mycology Service
6720 NW Skyline Boulevard
Portland, Oregon 97229-1309 USA
NOMENCLATURE EDITOR
SHAUN R. PENNYCOOK
[email protected]
Manaaki Whenua Landcare Research
Auckland, New Zealand
BooK REVIEW EDITOR
ELSE C. VELLINGA
[email protected]
861 Keeler Avenue
Berkeley CA 94708 U.S.A.
CONSISTING OF I-XII + 465 PAGES INCLUDING FIGURES
ISSN 0093-4666 (PRINT) http://dx.doi.org/10.5248/118.cvr ISSN 2154-8889 (ONLINE)
© 2011. MycoTaxon, LTp.
IV ... MYCOTAXON 118
MY COTAXON
VOLUME ONE HUNDRED EIGHTEEN — TABLE OF CONTENTS
COVER SECTION
d 55g 001. ee RT Bia de, Pe IN EE eA, Weer) A Bot ee See a 2 oN Vili
1 cdg Faas ges Te at a Nicied MS IO Sea eee Mal SET ed WAN 1a Sle ore Ue ry RAS OF ibe
SUDMESSTON PIO CCLUTES 3 2g vi Pearizh Yat ct yas Med ie 8.9 apa WA gmOC LTA Loe tcheerich dk gg GE x
OTP TICE LOT Rose B ihe Soy inn send de Ole Se al, Jb etly vin, Syd Rea xi
RESEARCH ARTICLES
New records of Geastrum from Japanese sand dunes
Taiga Kasuya, Kentaro Hosaka, Haruo Sakamoto,
Akitomo Uchida, Tamotsu Hoshino & Makoto Kakishima
Discrimination of Gigaspora species by PCR specific primers and
phylogenetic analysis Gladstone Alves da Silva, Erica Lumini,
Valeria Bianciotto, Paola Bonfante & Leonor Costa Maia
Contribution to the taxonomy of Bovista in Mexico
Silvia Bautista- Hernandez, Teofilo Herrera,
Elvira Aguirre-Acosta & Martin Esqueda
Subulicystidium curvisporum sp. nov. (Hydnodontaceae, Basidiomycota)
from the Patagonian Andes
Sergio P. Gorjén, Alina G. Greslebin & Mario Rajchenberg
New records of smut fungi. 4. Microbotryum coronariae comb. nov.
Cvetomir M. Denchev & Teodor T. Denchev
Lentinus giganteus revisited: new collections from Sri Lanka and Thailand
Samantha C. Karunarathna, Zhu L. Yang, Olivier Raspé, Thida W. Ko Ko,
Else C. Vellinga, Rui-Lin Zhao, A.H. Bahkali, Ekachai Chukeatirote,
Jerome Degreef, Philippe Callac & Kevin D. Hyde
Diversispora clara (Glomeromycetes)— a new species from saline dunes
in the Natural Park Cabo de Gata (Spain)
Beatriz Estrada, Javier Palenzuela, José-Miguel Barea,
Juan Manuel Ruiz-Lozano, Gladstone Alves da Silva & Fritz Oehl
Asterophora salvaterrensis (Basidiomycota, Agaricales), a new species
from Galicia (Spain) Jaime B. Blanco-Dios
Amicodisca castaneae sp. nov. (Hyaloscyphaceae, Helotiales) on Japanese
chestnut bur Jae-Gu Han, Tsuyoshi Hosoya & Hyeon-Dong Shin
Pseudocercospora epidendri sp. nov. on the neotropical orchid,
Epidendrum secundum from Brazil
Meiriele da Silva & Olinto Liparini Pereira
Eremiomyces magnisporus (Pezizales), a new species from central Spain
Pablo Alvarado, Gabriel Moreno, José L. Manjén & Miguel A. Sanz
17
27
47
53
57
73
83
89
95
103
OCTOBER-DECEMBER 2011... V
Peziza paludicola, the correct binomial for P. udicola, nom. inval.
Gabriele Cacialli, Angela Lantieri & Gianfranco Medardi 113
Two new species of Corynespora from northeastern Uttar Pradesh, India
Raghvendra Singh & Kamal 123
New lichenicolous fungi records for Kyrgyzstan, Uzbekistan, and Ukraine
Olga Nadyeina & Mehmet Gokhan Halici 131
New records of Agaricales from Atlantic Forest fragments of Pernambuco,
Northeast Brazil
Felipe Wartchow, Leonor C. Maia & M. Auxiliadora Q. Cavalcanti 137
Tremelloscypha gelatinosa (Sebacinales) from tropical deciduous
Gymnopodium forests in southern Mexico
Victor M. Bandala, Leticia Montoya & Rafael Villegas 147
New records of polypores from southern Florida
J. Vlasak, J. Kout, J. Vlasak Jr., & L. Ryvarden 159
Paraphysoderma sedebokerense, gen. et sp. nov., an aplanosporic relative of
Physoderma (Blastocladiomycota)
Timothy Y. James, Yoram Hoffman, Aliza Zarka & Sammy Boussiba 177
Microcyclospora rumicis, a new species on Rumex crispus from Iran
Mahdi Arzanlou & Mounes Bakhshi 181
Mycena guldeniana - a new alpine species from Norway
Arne Aronsen & Brian A. Perry 187
Neolecta vitellina, first record from Romania, with notes on habitat
and phenology Vasilica Claudiu Chinan & David Hewitt 197
Epitypification, morphology, and phylogeny of Tothia fuscella
Haixia Wu, Walter M. Jaklitsch, Hermann Voglmayr & Kevin D. Hyde 203
Exserohilum neoregeliae sp. nov., a new pathogen of Neoregelia carolinae
Takuya Sakoda & Takao Tsukiboshi 213
Species of Rhytismataceae on Camellia spp. from the Chinese mainland
Jiang-Lin Chen, Ying-Ren Lin, Cheng-Lin Hou & Shi-Juan Wang 219
A new species of Coccomyces (Rhytismatales, Ascomycota)
from Mt Huangshan, China Guo-Jun Jia, Ying-Ren Lin & Cheng-Lin Hou 231
New records of poaceous rusts from Pakistan
A. Ishaq, N.S. Afshan & A.N. Khalid 237
New records of smut fungi. 5
Cvetomir M. Denchev, Teodor T. Denchev & Brian M. Spooner 245
A new species of Marasmius from northern Argentina
Bernardo Lechner & Leandro Papinutti 251
Arrasia rostrata (Basidiomycota), a new corticioid genus and species from Italy
Annarosa Bernicchia, Sergio P. Gorjén & Karen K. Nakasone 257
Cortinarius mikedavisii sp. nov. from northern California
Dimitar Bojantchev 265
VI ... MYCOTAXON 118
Observations on gasteroid Agaricomycetes from the
Brazilian Amazon rainforest Larissa Trierveiler-Pereira, Allyne
Christina Gomes-Silva & Iuri Goulart Baseia
Septobasidium saurauiae sp. nov. (Septobasidiaceae) and
S. pseudopedicellatum new to China Suzhen Chen & Lin Guo
Hallenbergia (Agaricomycetes), a new corticioid genus
G.S. Dhingra & Priyanka
Cylindrochytridium johnstonii is a member of the Cladochytriales
Rebecca A. Steiger, D. Rabern Simmons & Joyce E. Longcore
A contribution to the study of smut fungi of Israel
Kyrylo G. Savchenko, Vasyl P. Heluta, Solomon P. Wasser & Eviatar Nevo
Species of Rhytismataceae on Lithocarpus spp. from Mt Huangshan, China
Qian Zheng, Ying-Ren Lin, Sheng-Ming Yu & Li Chen
Aschersonia conica sp. nov. (Clavicipitaceae) from Hainan Province, China
Jun-Zhi Qiu, Yu-Bin Su, Chong-Shuang Weng & Xiong Guan
273
283
289
293
303
SEL
325
Clarkeinda trachodes (Agaricales, Basidiomycetes), first record from Bangladesh
Md. Iqbal Hosen & Z.W. Ge
Glomus cubense sp. nov., an arbuscular mycorrhizal fungus from Cuba
Y. Rodriguez, Y. Dalpé, S. Séguin, K. Fernandez, F Fernandez & R.A. Rivera
Two new species of Exserticlava and Spiropes on decaying wood
from Guangdong, China Shou-Cai Ren, Jian Ma & Xiu-Guo Zhang
Discovery of Geastrum xerophilum from the Neotropics
Bianca Denise Barbosa da Silva,
Julieth de Oliveira Sousa & Iuri Goulart Baseia
A preliminary ITS phylogeny of Melanoleuca (Agaricales),
with special reference to European taxa
Alfredo Vizzini, Roberto Para, Roberto Fontenla,
Stefano Ghignone & Enrico Ercole
Geastrum species from the Amazon Forest, Brazil Anileide Gomes Leite,
Hannah Kathren de Assis, Bianca Denise Barbosa da Silva,
Helen Maria Pontes Sotao & Iuri Goulart Baseia
Hypoderma siculum sp. nov. from Italy Angela Lantieri, Peter R. Johnston,
Duckchul Park, Henrik Lantz & Gianfranco Medardi
Tuber sinoalbidum and T: polyspermum — new species from China
Li Fan, Cheng-Lin Hou & Jin-Zhong Cao
Hymenochaete in China. 2. A new species and three new records
from Yunnan Province Shuang-Hui He & Hai-Jiao Li
Lichenological notes 3: Sarcogyne plicata in California
Kerry Knudsen & Jana Kocourkova
Homolaphlyctis polyrhiza gen. et sp. nov., a species in the Rhizophydiales
(Chytridiomycetes) with multiple rhizoidal axes
Joyce E. Longcore, Peter M. Letcher & Timothy Y. James
|
337
349
355
361
383
393
403
411
423
433
OcCTOBER-DECEMBER 2011... VII
Eutypella phaeospora, a new species on Chenopodiaceae
Jacques Fournier & Christian Lechat 441
New combinations in Lactifluus. 1. L. subgenera Edules, Lactariopsis,
and Russulopsis A. Verbeken, J. Nuytinck & B. Buyck 447
Validation of combinations with basionyms published by Fries in 1861
Scott A. Redhead, Joseph F. Ammirati, Lorelei L. Norvell,
Alfredo Vizzini & Marco Contu 455
BOOK REVIEWS AND NOTICES Else C. Vellinga (EpiToR) 459
NOMENCLATURE
Nomenclatural novelties proposed in volume 118 463
PUBLICATION DATE FOR VOLUME ONE HUNDRED SEVENTEEN
MYCOTAXON for JuLY-SEPTEMBER, VOLUME 117 (I-x + 1-519)
was issued on November 22, 2011
vul ... MYCOTAXON 118
ERRATA FROM PREVIOUS VOLUMES
VOLUME 114
p- 429, line 4
VOLUME 117
p-20, lines 34-35
p-21, lines 17-19
p-27, line 20
p-27, line 42
for: DANILo. B
read: DANILO B.
for: smooth under the light microscope, but with bacillate
ornamentation under SEM (Figs.1 c-d, 2c).
read: smooth (Fig. 2b).
for: yellowish to yellowish brown in KOH, smooth, subfusiform to
ellipsoid, slightly thick-walled (up to 0.7 um) (Fig. 2c).
read: yellowish to yellowish brown in KOH, subfusiform to ellipsoid,
slightly thick-walled (up to 0.7 um), smooth under the light
microscope, but with bacillate ornamentation under SEM
(Figs.1c-d, 2c).
for: Albee-Scott S. 2007.
read: Albee-Scott S. 2007.
for: Mycological Progress (Online First).
read: Mycological Progress 10: 389-398.
p.32, between Arthrobotrys latispora heading and Latin diagnosis:
add: MycoBANK MB 560938 (assigned post publication)
p-368, line 10" from bottom
for: MycoBaANnK 512114
read: MYCOBANK MB 560939 (assigned post publication)
OCTOBER-DECEMBER 2011 ...
REVIEWERS — VOLUME ONE HUNDRED EIGHTEEN
The Editors express their appreciation to the following individuals who have,
prior to acceptance for publication, reviewed one or more of the papers
prepared for this volume.
Vladimir Antonin
Boris Assyov
Dominik Begerow
Konstanze Bensch
Janusz Blaszkowski
Uwe Braun
Harold H. Burdsall, Jr.
Marina Capelari
Rafael F. Castafieda
Michael A. Castellano
Wen-Hsin Chung
Johannes C. Coetzee
Marco Contu
Vagner Gularte Cortez
Yu-Cheng Dai
Dennis Desjardin
Admir Jose Giachini
Sergio Pérez Gorjon
Bruno Tomio Goto
M. Gokhan Halici
Ian Robert Hall
Nils Hallenberg
Donald E. Hemmes
Cheng-Lin Hou
Seppo Huhtinen
Alfredo Justo Fernandez
Masoomeh
Ghobad-Nejhad
Admir Giachini
Alina G. Greslebin
Nils Hallenberg
Shuanghui He
Peter R. Johnston
Sergey Karpov
Taiga Kasuya
Ryan M. Kepler
Kerry Knudsen
Hanns Kreisel
Thomas Lzssge
D. Jean Lodge
Cristiano Losi
Guo-Zhong Lit
W. Wallace Martin
Eric H.C. McKenzie
John McNeill
Jamjan Meeboon
André August Remi de
Meijer
Jurgen Miersch
David W. Minter
Gabriel Moreno
Abdul Rehman Niazi
Lorelei L. Norvell
Fritz Oehl
Clark Ovrebo
Giovanni Pacioni
Omar Paino Perdomo
Shaun R. Pennycook
Sergio Pérez-Ortega
Donald H. Pfister
Martha J. Powell
Francois Rappaz
Scott A. Redhead
Jack D. Rogers
Ivan Sanchez-Castro
Conrad L. Schoch
Roger Graham Shivas
B.M. Sharma
Ewald Sieverding
Matthew E. Smith
Renata Gomes de Souza
Viacheslav Spirin
Sharon E. Standridge
Marcelo Aloisio
Sulzbacher
Haruki Takahashi
Zdenko Tkaléec
Kalman Vanky
Else C. Vellinga
Alfredo Vizzini
Michael Weif
Tim Wheeler
Merlin White
Meng Zhang
Tian-Yu Zhang
Wen-Ying Zhuang
IX
x ... MYCOTAXON 118
FOUR EASY STEPS TO SUCCESSFUL MYCOTAXON PUBLICATION IN 2012
Prospective Mycoraxon authors should download instructions PDF, review and
submission forms, and other helpful templates by clicking the ‘file download page’ link
on our INSTRUCTIONS TO AUTHORS page before preparing their manuscript. Below is a
summary of our “4-step’ publication process.
1—PEER REVIEW: Email formatted text and illustration files with a2012 MycoTaxon
Reviewer Comments Form to 2-3 experts for peer review. Authors should (i) ask
peer reviewers to return revisions and comment forms to BOTH authors and Editor-
in-Chief <[email protected]> and (ii) revise the files according to reviewer
suggestions before sending text files to the Nomenclature Editor for nomenclatural
review.
2—NOMENCLATURAL REVIEW: Email text files (wiTH tables & captions but No
artwork) to the Nomenclature Editor <[email protected]>
for accession and pre-submission review. The Email message MUST include
‘Mycotaxon’ on the subject line AND all peer reviewer names+Email addresses in
the message. The Nomenclature Editor will assign accession numbers and return
annotated files with a list of needed corrections to the authors and Editor-in-Chief.
3—FINAL SUBMISSION: After again consulting experts and revising manuscripts as
needed, send the (i) completed 2012 MycoTaxon submission form; (ii) separate
text files for main text, tables, and legends; and (iii) art files to the Editor-in-Chief
<[email protected]>. Only text and image files prepared for immediate
publication should be sent at this time. The Editor-in-Chief usually acknowledges
manuscripts and thanks expert reviewers within two weeks, but please wait at
least 14 days before sending a follow-up query (without attachments); this helps
us keep Email traffic to a minimum during Mycotaxon publication deadlines or
temporary closures of the editorial office.
4—FINAL EDITORIAL REVIEW & PRESS PREPARATION: Files not ready for publication
will be rejected or returned to authors for further revision; the Editor-in-Chief gives
tentatvely approved manuscripts a final grammatical and scientific review before
converting all files into publishable format. The PDF proof, bibliographic citation,
and nomenclatural entries are sent to all coauthors for final inspection prior to
publication. After PDF conversion, the Editor-in-Chief corrects only processing or
editorial errors prior to publication, but corrections of author errors are listed in
the Errata of a subsequent volume for no charge. If authors have selected the open
access option, they are asked to arrange payment of page charges with the Business
Manager <[email protected]> at this time.
MyYcoTAXxON LTD— www.mycotaxon.com
The Mycotaxon Webmaster <[email protected]> posts general and
subscription information, important announcements, and author forms and templates
on the official MycoTaxon site, which also hosts the regional mycobiota webpage for
free download of distributional annotated species lists.
MYCOTAXON ONLINE— www.ingentaconnect.com/content/mtax/mt
Mycotaxon publishes four ~500-page volumes a year. Both open access and
subscription articles are offered.
OCTOBER-DECEMBER 2011... XI
FROM THE EDITOR-IN-CHIEF
MycoTAxon 118 — Welcome to the (almost) on schedule October-December 2011
volume! Granted, you are reading this in 2012, but we have great hopes that the
hardcopies will be mailed in the first week of the first month of our new year. The year
2011 was the first where virtually all subscribers received their volumes entirely on-line.
Where once we believed that online publication would be speedier, we now understand
that our host service (INGENTACONNECT) needs almost a month to process a completed
volume for downloading on their site, slightly over the time it took Sheridan Press to
print and distribute our 2010 volumes. Nonetheless, 2012 will see each MycoTAxON
volume published within the months written on the cover.
In the meantime, please enjoy Volume 118’s 94 new taxa, names, typifications, and
validations proposed by 172 authors (representing 30 countries) in 50 research papers
reviewed by 83 experts. Color photos continue to illuminate, drawings are of such high
quality that that selecting only one cover drawing remains challenging (we are happy to
present our first cover chytrid in Mycotaxon 118), and the research published will be
consulted for years to come.
PUBLICATION DATES: NOMINAL AND ACTUAL — Nomenclatural priority is based on
the actual date of effective publication. The INTERNATIONAL CODE OF NOMENCLATURE
FOR ALGAE, FUNGI, AND PLANTS now permits effective publication in either printed or
electronic format. We expected electronic publication to shorten (considerably) the
time between a ppr’s leaving the editorial desk and publication. However, because we
still send hard copies to libraries well before the volume becomes visible online, the
actual publication date will be based on that earlier distribution date.
A short while ago we discovered that INGENTACONNECT was citing the first day
of the first month of a nominal quarter as ‘publication date’ Thus, the delayed 2011
January-March volume, actually published on May 9, is cited on the download page as
published on January 1, 2011. Plans are underway to correct the confusion, but until
then, the date of effective publication is most reliably found on our “volume listings:
publication history” publications webpage via www.mycotaxon.com. Remember that
MycoTaxon always cites the actual publication date of the previous volume in the cover
section of the next volume (see p. vii, this section).
MYCOTAXON IN 2012 AND BEYOND — I wish to thank our authors and expert reviewers,
the Editorial Advisory Board, and most especially the MycoTaxon staff (Nomenclature
Editor Shaun Pennycook, Book Review Editor Else Vellinga, Webmaster Noni Korf,
Business Manager Hannes Maddens, and Treasurer & Mentor Dick Korf) for helping
us continue to offer Mycotaxon, the most highly respected International Journal of
Fungal Taxonomy & Nomenclature.
With warm best wishes for the New Year,
Lorelei Norvell, Mycotaxon Editor-in-Chief
December 30, 2011
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/118.1
Volume 118, pp. 1-15 October-December 2011
New records of Geastrum from Japanese sand dunes
TAIGA KAsuyA', KENTARO HoSAKA?, HARUO SAKAMOTO?,
AKITOMO UCHIDA‘, TAMOTSU HOSHINO®* & MAKOTO KAKISHIMA!
‘Laboratory of Plant Parasitic Mycology, Graduate School of Life and Environmental Sciences,
University of Tsukuba, 1-1-1, Ten-nodai, Tsukuba, Ibaraki 305-8572, Japan
*Department of Botany, National Museum of Nature and Science,
4-1-1, Amakubo, Tsukuba, Ibaraki 305-0005, Japan
°443-6, Nakaarai, Ageo, Saitama 362-0052, Japan
‘Shiretoko Museum, 49-2, Hon-machi, Shari, Hokkaido 099-4113, Japan
National Institute of Advanced Industrial Science and Technology (AIST),
2-17-2-1, Tsukisamu-higashi, Toyohira-ku, Sapporo, Hokkaido 062-8517, Japan
°Graduate School of Life Science, Hokkaido University,
North 10 West 8, Kita-ku, Sapporo, Hokkaido 060-0810, Japan
* CORRESPONDENCE TO: [email protected]
ABSTRACT— Basidiomata of three earthstars —Geastrum campestre, G. corollinum,
G. hungaricum— were collected from sand dunes of the Japanese coasts. Those arenicolous
fungi are newly recorded for Japanese mycobiota. Descriptions, comments and illustrations
of basidiomata of the three fungi are provided.
Key worps— biogeography, coastal environment, gasteromycetes, Geastrales, taxonomy
Introduction
The genus Geastrum Pers. belongs to Geastrales, Phallomycetidae (Hosaka et
al. 2006) and includes currently about 50 taxa (Kirk et al. 2008). Most species of
the genus are known as saprobes and are distributed throughout all continents
except Antarctica. Several authors have systematically revised Geastrum
(Stanék 1958, Ponce de Leon 1968, Dorfelt & Miller-Uri 1984, Dorfelt &
Heklau 1987, Sunhede 1989). Several species have been recorded from multiple
continents, although their taxonomic identities are doubtful because there are
only a few molecular phylogenetic studies. Our preliminary morphological
and phylogeographical analyses of the globally distributed “G. triplex Jungh.”
indicate that the name represents an aggregation of multiple species (Kasuya
et al. 2011a). This suggests the possible existence of many cryptic species in the
genus.
2 ... Kasuya & al.
Although 18 Geastrum species have hitherto been recognized from Japan
(Imai 1936, Kawamura 1954, Ito 1959, Yoshimi & Hongo 1989, Sakamoto &
Kasuya 2008, Kasuya et al. 2009, 2011b), comprehensive taxonomical and
biogeographical studies of the genus have not yet been conducted. Therefore,
to clarify the geographical distribution, morphological variations, and
phylogenetic positions of Japanese Geastrum, we conducted morphological
and molecular phylogenetic analysis of the genus based on the materials from
multiple localities including Japan and other continents (Kasuya et al. 201 1a).
Several Geastrum species favor semiarid to arid environments, e.g., well-
drained sandy soils of coasts, deserts, and inland steppes. During our recent
floristic and taxonomic investigations of Japanese Geastrum (Sakamoto &
Kasuya 2008, Kasuya et al. 2009, 2011b), we recorded G. kotlabae V.J. Stanék,
G. minimum Schwein., and G. quadrifidum Pers. from coastal sand dunes of
Hokkaido and Honshu.
Some noteworthy Geastrum collections obtained by further fieldwork
conducted in sand dunes along the Japanese coasts include G. campestre,
G. corollinum, and G. hungaricum, which represent new distributional records
for Japan. We describe the Japanese collections of these three species with the
aid of illustrations showing morphological characters. We also compare them
with related taxa and discuss the biogeographical and ecological features of the
species.
Materials & methods
Fieldwork was carried out from September 2003 to October 2010 at three sites in
coastal sand dunes of Hokkaido and Honshu, Japan: (1) Minehama, Shari, Hokkaido
(43°55'34"N, 144°46'18"E); (2) Hitachi Kaihin Park, Hitachinaka, Ibaraki (36°23'54"N,
140°36'24"E); and (3) Fukude, Iwata, Shizuoka (34°39'51"N, 137°53'22"E). These sites
well preserve coastal vegetation dominated by poaceous and cyperaceous plants. For
morphological comparisons, we examined one additional G. corollinum specimen
collected from an inland area of Honshu.
The examined specimens are deposited in the mycological herbarium of the National
Museum of Nature and Science, Tsukuba, Ibaraki, Japan (TNS). Macroscopic characters
were described from dried and fresh material. For light microscopic observations,
freehand sections of the specimens were mounted in water, 3% (w/v) KOH, and 30%
ethanol solution on glass slides. Forty randomly selected basidiospores were measured
under a light microscope at 1000x magnification. Length measurements excluded the
apiculus; average dimensions + standard deviations are shown in brackets. The surface
features of basidiospores were also observed by scanning electron microscopy (SEM).
For SEM, a small portion of the gleba was dusted onto double-sided adhesive tape on a
specimen holder, coated with platinum-palladium using an E-1030 Ion Sputter Coater
(Hitachi, Tokyo, Japan), and examined with a S-4200 SEM (Hitachi, Tokyo, Japan)
operating at 20 kV.
Geastrum species new to Japan... 3
FIGURE 1. Geastrum campestre: macrocharacters (TNS-F-38710). A: Detailed structure of
expanded basidiomata. Note plicate peristome (black arrow) and short stalk (white arrow). B: The
mycelial layer of expanded basidiomata. C: Expanded and an unexpanded (arrow) basidiomata.
Scale bars = 20 mm.
Taxonomy
Geastrum campestre Morgan, Amer. Nat. 21: 1027, 1887, as “Geaster
campester’. Figs. 1-2
JAPANESE NAME: Hamabe-no-hida-tsuchigaki (coastal dune’s plicate earthstar, newly
named here).
UNEXPANDED BASIDIOMATA hypogeous to subhypogeous, depressed globose,
globose to subglobose when young, ca. 5-12 mm diam., surface encrusted
4 ... Kasuya & al.
with sand, whitish to slightly cineraceous. EXPANDED BASIDIOMATA 8-32 mm
across when dried, 15-37 mm across when wetted, exoperidium splitting into
6-8 rays, weakly to strongly hygroscopic, rays arched with straight to slightly
recurved tips in fresh state or when wetted, then partly or entirely covering
the endoperidial body when old or dried. MyceLiaL LAYER thin, whitish,
encrusted with sand and plant debris, persistent, attached to the fibrous layer for
a long time and without forming basal remnants attached to the basidiomata.
FIBROUS LAYER outer side almost completely covered with the mycelial layer,
whitish to grey. PSEUDOPARENCHYMATOUS LAYER persistent, pale beige in fresh
state, later becoming beige, reddish brown to dark brown. ENDOPERIDIAL BODY
stalked, depressed globose, globose to subglobose, 3-11 mm diam., with or
without apophysis. ENDOPERIDIUM pale brown, greyish brown to dark brown,
finely pruinate or almost smooth when old, but usually distinctly pruinose
or tomentose with whitish to beige crystalline material in fresh basidiomata,
with an indistinct circular area surrounding the peristome. PERISTOME
strongly plicate with 13-22 folds, almost concolorous or somewhat darker than
endoperidium, broadly conical to mammiform, distinctly delimited, 1-2.5 mm
long. STALK short but distinct, 0.5-1 mm long. COLUMELLA globose, ovoid to
club-shaped in mature state, persistent, distinct. MATURE GLEBA olivaceous
brown to brown.
MYCELIAL LAYER consisting of dimorphic hyphae: (1) 2-5 um thick, hyaline,
thick-walled, rarely branched; (II) 1.5-3.5 um thick, hyaline, thin-walled, with
clamp-connections, rarely branched. FiBRouUSs LAYER consisting of 2.5-6.5
um thick, hyaline, thick-walled hyphae. PsEUDOPARENCHYMATOUS LAYER
consisting of hyaline, yellowish brown to pale brown, thick-walled, almost
bladder-like but variously shaped cells. ENDOPERIDIUM consisting of dimorphic
hyphae: (I) 3.5-4.5 um thick, yellowish brown, brown to dark brown, thick-
walled, rarely dichotomously branched; (II) 2-4.5 um thick, hyaline to pale
yellowish brown, thin-walled, branched. HyPHAE OF THE COLUMELLA 2-6.5
um thick, hyaline, pale yellowish brown to pale brown, thick-walled, rarely
dichotomously branched. HyPHAE OF THE CAPILLITIUM hyaline to yellowish
brown, thick-walled, 2-8 um thick, tapered gradually towards subacute tips,
dichotomously branched, surface usually encrusted with numerous amorphous
remnants or crystalline materials but sometimes almost smooth. BAsrp1A
not seen. Basip1osporREs globose, densely verrucose, thick-walled, yellowish
brown, 4.1-[4.9+0.4]-5.7 um diam. excluding ornaments, 5-[5.5+0.3]-6.2 um
diam. including ornaments, verrucae conical to columnar-like, < 0.8 um high,
with flat, rounded to subacute apexes, basal apiculus prominent.
HABITAT AND DISTRIBUTION: Uncommon in Japan, where it is gregarious
on sand in coastal dunes in a warm-temperate zone near Carex kobomugi,
C. pumila, and Elymus mollis. Several fresh basidiomata were collected in
Geastrum species new to Japan... 5
FIGURE 2. Geastrum campestre: SEM micrographs (TNS-F-38710). A: Hypha of the capillitium
encrusted with amorphous remnants and crystalline materials. B: A basidiospore covered with
dense verrucae. C: Basidiospores with prominent apiculus. Scale bars: A = 3 um; B = 1.5um;
C=2 um.
September. Known from Japan (Ibaraki, new record), Europe (Sunhede 1989),
South Africa (Smith 1935), North America (Long & Stouffer 1948), Central
America (Esqueda et al. 2003), Hawaii (Gilbertson et al. 2001), and Australia
(Cunningham 1944).
SPECIMENS EXAMINED: JAPAN. IBARAKI PREFECTURE: Hitachinaka-shi, Nagasuna,
Hitachi Kaihin Park: September 26, 2004, H. Sakamoto, TNS-F-38710.
6 ... Kasuya & al.
COMMENTS: Geastrumcampestre is well characterized by hygroscopic exoperidial
rays, a mycelial layer encrusted with sand or debris, a stalked endoperidial body,
and a distinctly delimited, plicate peristome. The morphology of the Japanese
specimens agrees well with previous descriptions of G. campestre (Cunningham
1944, Long & Stouffer 1948, Sunhede 1989). However, the expanded Japanese
basidiomata are usually smaller (< 37 mm wide when wet) than European
specimens (< 65 mm wide, Sunhede 1989).
Geastrum kotlabae and G. pouzarii V.J. Stanék are morphologically and
ecologically very similar to G. campestre. All three species have hygroscopic
exoperidial rays and plicate peristomes and share similar habitats such as well-
drained, sandy soil. However, the endoperidial body of G. kotlabae is completely
sessile (Sunhede 1989, Sakamoto & Kasuya 2008). Basidiospores of G. pouzarii
are larger (5.5-7 um diam. including ornaments, Sunhede 1989) than those of
G. campestre. Moreover, the mycelial layer of both G. kotlabae and G. pouzarii
easily peels off at basidiome expansion (Sunhede 1989, Esqueda et al. 2003)
whereas that of G. campestre remains attached to the fibrous layer for a long
time. Geastrum berkeleyi Massee, which also produces stalked endoperidial
bodies and plicate peristomes, clearly differs from G. campestre by its non-
hygroscopic, much larger basidiomata (Kasuya et al. 2009).
Japanese material of G. campestre has been collected from sand dunes along
the Pacific Ocean coast in the warm-temperate area of Eastern Honshu. The
type specimen of G. campestre was collected from Nebraska, U.S.A., where it
grows on dry open grasslands or on litter under conifers or deciduous trees
(Long & Stouffer 1948). European and Australian specimens have been obtained
from well-drained, sandy soil near coasts (Cunningham 1944, Sunhede 1989),
and the species has been recorded from tropical deciduous forests in Mexico
(Esqueda et al. 2003) and dry mountain forests in Hawaii (Gilbertson et al.
2001). These facts suggest that G. campestre prefers dry, well-drained open land
but can grow in a variety of environments.
Geastrum campestre is known from all continents except Antarctica and its
habitats are diverse. As several morphological variations have been reported
(Sunhede 1989), G. campestre as currently defined may be a species complex.
Geastrum corollinum (Batsch) Hollds, Gasterom. Ung.: 65, 1904, as “Geaster
corollinus”. Fics. 3-4
JAPANESE NAME: Chijire-tsuchigaki (Curled earthstar, newly named here).
UNEXPANDED BASIDIOMATA usually epigeous, rarely subhypogeous,
subglobose, ovoid to onion-shaped with an umbo, 6.5-13 mm wide, 14-17.5mm
high including apical umbo, surface almost smooth to minutely wrinkled and
not encrusted with sand or plant debris, ochraceous to pale brown. EXPANDED
BASIDIOMATA 10-24 mm across when dried, 16-28 mm across when wetted,
Geastrum species new to Japan... 7
FIGURE 3. Geastrum corollinum: macrocharacters (TNS—F-38711). A: Two expanded basidiomata
with distinctly delimited, fibrillose peristomes. B: Two unexpanded basidiomata with almost
smooth surfaces. Note apical umbos (arrows). C: Expanded basidiomata showing hygroscopic
exoperidial rays. Scale bars: A = 10 mm; B-C = 15 mm.
exoperidium splitting into 5-10 rays, hygroscopic, partly or entirely covering
the endoperidial body and thus curled when dried, tips of the rays sometimes
become recurved downwards in fresh state. MYCELIAL LAYER thin, yellowish
8 ... Kasuya & al.
white, pale ochraceous to pale brown, smooth, without sand or plant debris,
visible when unexpanded, but soon disappeared when basidiome expand.
FIBROUS LAYER firm, persistently attached to the pseudoparenchymatous
layer, outer side ochraceous to pale brown. PSEUDOPARENCHYMATOUS LAYER
persistent, thin (>0.5 mm thick), pale beige in fresh state, later becoming
ochraceous, reddish brown to dark brown, coriaceous when wetted or young,
very hard when dried or old. ENDOPERIDIAL BoDy sessile, depressed globose,
globose to subglobose, 6-11.5 mm diam., without apophysis. ENDOPERIDIUM
pale brown to greyish brown, almost smooth when old, but usually pruinate with
whitish crystalline material in fresh or young basidiomata, with a circular area
surrounding the peristome. PERISTOME surface fibrillose, almost concolorous
or somewhat darker than endoperidium, broadly conical to mammiform,
distinctly delimited, 1-3.5 mm long. COLUMELLA cylindrical to club-shaped,
slender, sometimes indistinct. MATURE GLEBA Olivaceous brown to brown.
MYCELIAL LAYER consisting of dimorphic hyphae: (I) 2-4.5 um thick,
hyaline, thick-walled, rarely branched; (II) 2-3.5 um thick, hyaline, thin-
walled, with clamp-connections, branched. FiBRoUS LAYER consisting of
3.5-7 um thick, hyaline to pale yellowish brown, thick-walled hyphae.
PSEUDOPARENCHYMATOUS LAYER consisting of thick-walled, hyaline, yellowish
brown to reddish brown, almost bladder-like but variously shaped cells.
ENDOPERIDIUM consisting of dimorphic hyphae: (I) 3.5-6 um thick, hyaline
to pale yellowish brown, thick-walled, rarely dichotomously branched; (II)
1.5-4.5 um thick, hyaline to pale yellowish brown, thin-walled, branched.
HYPHAE OF THE COLUMELLA 2-7 um thick, thick-walled, surface smooth,
hyaline to pale yellowish brown. HYPHAE OF THE CAPILLITIUM 2-6.5 um thick,
thick-walled, pale yellowish brown to yellowish brown, curved, tapered gradually
towards subacute tips, rarely dichotomously branched, surface almost smooth
or sometimes encrusted with amorphous remnants and crystalline materials.
BASIDIA not seen. BASIDIOSPORES globose, densely verrucose, thick-walled,
yellowish brown to olivaceous brown, 3.5-[4+0.3]-4.5 um diam. excluding
ornaments, 4-[4.7+0.4]-5.5 um diam. including ornaments, verrucae conical
to columnar-like, < 0.7 um high, with flat, rounded to subacute apexes, basal
apiculus prominent.
HABITAT AND DISTRIBUTION: Uncommon in Japan, solitary to gregarious
on sand near Carex kobomugi and C. pumila in coastal dunes or on the ground
in broad-leaved forests in a warm-temperate area. Fresh and old basidiomata
were collected in July and December. Known from Japan (Shizuoka and Osaka,
new record), China (Zhou et al. 2007), Europe (Hollés 1904, Sunhede 1989),
South Africa (Bottomley 1948; Coetzee et al. 1997), North America (Coker &
Couch 1928), Central America (Esqueda et al. 2003) and Hawaii (Gilbertson
et al. 2001).
Geastrum species new to Japan... 9
FiGuRE 4. Geastrum corollinum: SEM micrographs (TNS-F-38711). A: Hypha of the capillitium
encrusted with amorphous remnants and crystalline materials. B: A basidiospore with apiculus
(arrow). C: Basidiospores with dense verrucae. Scale bars = 2 um.
SPECIMENS EXAMINED: JAPAN. SHIZUOKA PREFECTURE: Iwata-shi, Fukude: December
3, 2003, I. Asai, TNS-F-38711. OSAKA PREFECTURE: Katano-shi, Kaigake-no-michi:
July 31, 2011, Y. Kotera, TNS-F-550009.
CoMMENTs: Geastrum corollinum is diagnosed by hygroscopic exoperidial
rays, a smooth mycelial layer not encrusted with sand or debris, and a distinctly
delimited, fibrillose peristome. The morphology of the Japanese specimens
10 ... Kasuya & al.
agrees well with previous descriptions of G. corollinum (Hollés 1904, Dissing &
Lange 1962, Sunhede 1989). However, the pseudoparenchymatous layer of the
exoperidium of the Japanese material is thinner (< 0.5 mm thick) than that of
European material (0.5-1.5 mm thick, Sunhede 1989).
Geastrum floriforme Vittad. and G. hungaricum are morphologically similar
to G. corollinum. However, G. floriforme basidiomata are hypogeous when
unexpanded and have indistinctly delimited peristomes and the mycelial layer
is encrusted with sand or plant debris (Sunhede 1989). For comparison with
G. hungaricum, see description and comments below. Geastrum arenarium
Lloyd, which resembles G. corollinum macroscopically, differs in its mycelial
layer strongly encrusted with sand or plant debris (Sunhede 1989) and smaller
basidiospores of G. arenarium (3.5-4.5 um diam. including ornaments,
Sunhede 1986).
Japanese specimens of G. corollinum have been collected from coastal
sand dunes along the Pacific Ocean and under broad-leaved forests of warm-
temperate areas of Central Honshu. In Europe, the type locality of G. corollinum,
it has been obtained from various habitats, under deciduous trees (Dissing &
Lange 1962, Sunhede 1989), under Juniperus communis (Sunhede 1989), and
in sandy grasslands (D6rfelt et al. 1979) and coastal dunes (Eyndhoven 1937).
Chinese specimens have been collected from grasslands, grazed fields and under
Cryptomeria japonica or several salicaceous trees (Zhou et al. 2007). Geastrum
corollinum has also been recorded from tropical deciduous forests in Mexico
(Esqueda et al. 2003) and dry, coastal to montane forests in Hawaii (Gilbertson
et al. 2001). Ecologically, these facts suggest that the present fungus adapts to
varied environments. In Japan, further fieldwork is needed to clarify whether
the distribution of G. corollinum is limited to coastal sand dunes or not.
Geastrum corollinum has been recorded from all continents except
Antarctica. Given the variable morphological characters (Dissing & Lange
1962, Sunhede 1989) and diverse habitats, G. corollinum probably comprises a
species complex.
Geastrum hungaricum Hollds, Math. Természettud. Ertes. 19(5): 506, 1901,
as “Geaster hungaricus”. Fics. 5-6
JAPANESE NAME: Arechi-no-himetsuchiguri (dry wastelands earthstar, newly named
here).
UNEXPANDED BASIDIOMATA hypogeous to subhypogeous, depressed globose,
subglobose to ovoid, ca. 3-10 mm diam., surface encrusted with sand and plant
debris, whitish to slightly cineraceous. EXPANDED BASIDIOMATA 5-12 mm
across when dried, 13-17 mm across when wetted, exoperidium splitting into
6-11 rays, strongly hygroscopic, partly or entirely covering the endoperidial
body when dried, tips of the rays sometimes become curved downwards in
Geastrum species new to Japan... 11
FIGURE 5. Geastrum hungaricum: macrocharacters. A: An expanded basidioma (TNS-F-38713)
with distinctly delimited, fibrillose peristome. B: Expanded basidiomata (TNS-F-38712) showing
strongly hygroscopic exoperidial rays. Note basal remnants of the mycelial layer attached to
basidiomata with sand and plant debris (arrows). C: An expanded basidioma (TNS-F-38713) in
the natural habitat. Scale bars: A, C= 5 mm; B = 10 mm.
fresh state. MYCELIAL LAYER thin, whitish, with sand and plant debris, easily
peeling off and usually forming basal remnants attached to the basidiomata.
FIBROUS LAYER firmly, persistently attached to the pseudoparenchymatous
layer, outer side white. PSEUDOPARENCHYMATOUS LAYER persistent, cream
to pale beige in fresh state, later becoming pale brown, reddish brown to
12 ... Kasuya & al.
dark brown. ENDOPERIDIAL Bopy sessile, globose, subglobose to ovoid, 2-9
mm diam., without apophysis. ENDOPERIDIUM pale brown to greyish brown,
almost smooth when old, but usually pruinate with whitish to beige crystalline
material in fresh basidiomata, with a circular area surrounding the peristome.
PERISTOME surface fibrillose, almost concolorous or somewhat darker than
endoperidium, discoid to broadly conical, distinctly delimited, 0.5-1.5 mm
long. COLUMELLA cylindrical, slender, sometimes indistinct. MATURE GLEBA
olivaceous brown to brown.
MYCELIAL LAYER consisting of dimorphic hyphae: (I) 2-5.5 um thick,
hyaline, thick-walled, rarely branched; (II) 2-5 um thick, hyaline, thin-
walled, rarely with clamp-connections, sparsely branched. FIBROUS LAYER
consisting of 3-7.5 um thick, hyaline to pale yellowish brown, thick-walled
hyphae. PSEUDOPARENCHYMATOUS LAYER consisting of thick-walled, hyaline
to pale brown, almost bladder-like but variously shaped cells. ENDOPERIDIUM
consisting of 2.5-5 um thick, hyaline, pale yellowish brown to pale brown,
thick-walled hyphae encrusted with amorphous crystalline materials. HYPHAE
OF THE COLUMELLA 1-6 um thick, thick-walled, surface smooth, pale
yellowish brown. HYPHAE OF THE CAPILLITIUM 1-8 um thick, thick-walled,
pale yellowish brown to yellowish brown, tapered gradually towards subacute
tips, sometimes dichotomously branched, surface almost smooth or encrusted
with some amorphous remnants and crystalline materials. BastD1A not seen.
BasIDIospoREs globose, warty, thick-walled, olivaceous brown to dark brown,
4.3-[4.9+0.3]-5.3 um diam. excluding ornaments, 4.8-[5.4+0.3]-5.8 um
diam. including ornaments, warts radiating from the base of the apiculus and
connecting to adjacent verrucae thus showing wing-like, < 0.5 um high, with
rounded to subacute apexes, basal apiculus prominent.
HABITAT AND DISTRIBUTION: Uncommon in Japan, gregarious or solitary
on sand among mosses near Elymus mollis in coastal dunes in a cool-temperate
area. One fresh basidioma was collected in September; several overwintered,
old specimens were found in May. Known from Japan (Hokkaido, new record),
Mongolia (Dorfelt & Otto 1985), Russian Karachay-Cherkessia (Hollés 1904),
Hungary (Hollés 1904), Czech Republic (Stanék 1958), and Germany (Dorfelt
et al. 1979).
SPECIMENS EXAMINED: JAPAN. HOKKAIDO: Shari-gun, Shari-cho, Minehama: May 29,
2009, T. Hoshino and A. Uchida, TNS-F-38712; September 27, 2010, A. Uchida, TNS-
F-38713.
COMMENTS: Geastrum hungaricum, one of the smallest Geastrum species of
the genus, is well characterized by strongly hygroscopic exoperidial rays, an
endoperidium with a pruinose surface with whitish to beige crystalline material,
and a distinctly delimited, fibrillose peristome. The morphology of the Japanese
specimens agrees well with previous descriptions of G. hungaricum (Holl6s
Geastrum species new to Japan... 13
FIGURE 6. Geastrum hungaricum: SEM micrographs. A: Hypha of the capillitium sparsely
encrusted with amorphous remnants and crystalline materials (TNS-F-38712). B: A basidiospore
covered with dense verrucae (TNS-F-38712). C: A basidiospore with prominent apiculus
(TNS-F-38713). Note wing-like verrucae radiating from the base of the apiculus. Scale bars: A=3 um;
B-C = 1.5 um.
1904, Stanék 1958, Sunhede 1989), except that the basidiospores are slightly
narrower than in European materials (5-6 um diam. including ornaments,
Sunhede 1989).
14 ... Kasuya & al.
Two other small-sized earthstars, G. corollinum and G. floriforme, resemble
G. hungaricum. However, unexpanded basidiomata of G. corollinum are
epigeous, onion-shaped with an umbo, with brownish surfaces, and not
encrusted with sand or plant debris (Sunhede 1989; see also our description
of G. corollinum, above) and the expanded basidiomata are larger (< 23 mm
diam., Sunhede 1989). Geastrum floriforme clearly differs from G. hungaricum
by its indistinctly delimited peristome, smooth endoperidial surfaces, and
larger basidiospores (< 7 um diam., Sunhede 1989).
Japanese material of G. hungaricum was collected from a coastal sand dune
along the Sea of Okhotsk in the cool-temperate area of eastern Hokkaido, while
the type was collected from Hungary. In Europe it has been collected from
sandy, rocky or grazed ground (Hollds 1904, Stanék 1958, Sunhede 1989), and
Russian or Mongolian specimens were also found in semiarid areas (Hollds
1904, Dorfelt & Otto 1985), suggesting that G. hungaricum habitats are limited
to dry, sandy, stony or grazed ground in northern cool-temperate regions.
Acknowledgments
We thank Mr. Ikuo Asai (Saitama, Japan), Dr. Tsuyoshi Hosoya (National Museum of
Nature and Science, Japan) and Mr. Yuzo Kotera (Kyoto, Japan) for their collaborations
and suggestions to our study. The authors are also grateful to Dr. Don Hemmes
(University of Hawaii, U.S.A.) and to Dr. Vagner Gularte Cortez (Universidade Federal
do Parana, Brazil) for their critical reviews of the manuscript. Thanks are also owed to
Dr. Francisco D. Calonge (Madrid Botanical Garden, Spain) for his valuable comments
on this study. This research was financed in part by a JSPS grant-in-aid (No.222635) to
TK and a JSPS grant-in-aid for young scientists B (No. 21770096) to KH. This work is in
partial fulfillment of the requirements for the Ph.D. degree of TK.
Literature cited
Bottomley AM. 1948. Gasteromycetes of South Africa. Bothalia 4: 473-810.
Coetzee JC, Eicker A, van Wyk AE. 1997. Taxonomic notes on the Geastraceae, Tulostomataceae,
Nidulariaceae and Sphaerobolaceae (Gasteromycetes) sensu Bottomley, in southern Africa.
Bothalia 27: 117-123.
Coker WC, Couch NJ. 1928. The Gasteromycetes of the eastern United States and Canada. Chapel
Hill, University of North Carolina Press.
Cunningham GH. 1944. The Gasteromycetes of Australia and New Zealand. Dunedin, J.
McIndoe.
Dissing H, Lange M. 1962. Additional notes on the genus Geastrum in Denmark. Bot. Tidsskr. 58:
64-67.
Dorfelt H, Heklau H. 1987. Beitrage zur systematik der Geastrales. II. Feddes Repertorium 98:
357-368.
Dorfelt H, Miller-Uri C. 1984. Beitrage zur systematik der Geastrales. Feddes Repertorium 95:
701-711.
Dorfelt H, Otto P. 1985. Mykogeographisch interessante Gasteromyceten-Funde (V). Boletus 9:
43-48.
Geastrum species new to Japan... 15
Dorfelt H, Kreisel H, Benkert D. 1979. Die Erdsterne (Geastrales) der Deutschen Demokratischen
Republik. Hercynia 16: 1-56.
Esqueda M, Herrera T, Pérez-Silva E, Sanchez A. 2003. Distribution of Geastrum species from some
priority regions for conservation of biodiversity of Sonora, Mexico. Mycotaxon 87: 445-456.
Eyndhoven GL. 1937. Ubersicht iiber die Verbreitung der genera Geastrum, Myriostoma und
Astraeus in der Niederlanden. Med. Ned. Mycol. Ver. 24: 20-48.
Gilbertson RL, Desjardin DE, Rogers JD, Hemmes DR. 2001. Fungi from the mamane-naio
vegetation zone of Hawaii. Fungal Diversity 6: 35-69.
Hollés L. 1904. Die Gasteromyceten Ungarns. Leipzig, Oswald Weigel.
Hosaka K, Bates ST, Beever RE, Castellano MA, Colgan W, Dominguez LS, Geml J, Giachini AJ,
Kenney SR, Nouhra ER, Simpson NB, Spatafora JW, Trappe JM. 2006. Molecular phylogenetics
of the gomphoid-phalloid fungi with an establishment of the new subclass Phallomycetidae and
two new orders. Mycologia 98: 949-959. http://dx.doi.org/10.3852/mycologia.98.6.949
Imai S. 1936. Symbolae ad floram mycologicam Asiae Orientalis. I. Bot. Mag. Tokyo 50: 216-224.
Ito S. 1959. Mycological flora of Japan, vol. 2, no. 5. Tokyo, Yokendo.
Kasuya T, Yamamoto Y, Sakamoto H, Takehashi S, Hoshino T, Kobayashi T. 2009. Floristic study
of Geastrum in Japan: three new records for Japanese mycobiota and reexamination of the
authentic specimen of Geastrum minus reported by Sanshi Imai. Mycoscience 50: 84-93.
http://dx.doi.org/10.1007/s10267-008-0461-1
Kasuya T, Hosaka K, Kakishima M. 201la. Taxonomic reevaluation of the Geastrum triplex
complex (Geastraceae, Geastrales, Fungi) based on morphology, molecular phylogeny, and
phylogeography. 40, in: N Murakami (ed), East Asian botany: international symposium 2011
programs & abstracts. Tsukuba, the Japanese Society for Plant Systematics.
Kasuya T, Hoshino T, Takehashi S, Uchida A. 2011b. New records of two maritime basidiomycetes,
Tulostoma striatum and Geastrum quadrifidum in coastal dune of Eastern Hokkaido. Bull.
Shiretoko Mus. 32: 19-24.
Kawamura S. 1954. Icones of Japanese fungi, vol. VII. Tokyo, Kazama-shobo.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi,
10th edn. Wallingford, CAB International.
Long WH, Stouffer DJ. 1948. Studies in the gasteromycetes: XVI. The Geastraceae of the southwestern
United States. Mycologia 40: 547-585. http://dx.doi.org/10.2307/3755257
Ponce de Leon P. 1968. A revision of the family Geastraceae. Fieldiana Bot. 31: 301-349.
Sakamoto H, Kasuya T. 2008. First record of Geastrum kotlabae from sand dunes of Japanese coast.
Nippon Kingakukai Kaiho 49: 59-63.
Smith NJG. 1935. Notes on Geaster with special reference to the Eastern Cape. Rec. Albany Mus.
4: 256-282.
Stanék VJ. 1958. Geastraceae. 392-526, in: A Pildt (ed.), Flora CSR B-1, Gasteromycetes. Praha,
Ceskoslovenské Akademie.
Sunhede S. 1986. Notes on the type material of Geastrum arenarium. Windahlia 15: 35-43.
Sunhede S. 1989. Geastraceae (Basidiomycotina). Morphology, ecology, and systematics with special
emphasis on the North European species. Synopsis fungorum, vol. 1. Oslo, Fungiflora.
Yoshimi $, Hongo T. 1989. Gasteromycetidae. 193-228, in: R Imazeki, T Hongo (eds.), Colored
illustrations of mushrooms of Japan, vol. I]. Osaka, Hoikusha.
Zhou T, Chen Y, Zhao L, Fu H, Yang B. 2007. Geastraceae, Nidulariaceae. Flora fungorum
Sinicorum, vol. 36. Beijing, Science Press.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.17
Volume 118, pp. 17-26 October-December 2011
Discrimination of Gigaspora species by
PCR specific primers and phylogenetic analysis
GLADSTONE ALVES DA SILVA’, ERICA LUMINI”?, VALERIA BIANCIOTTO?,
PAOLA BONFANTE” & LEONOR CosTA MaIA?
"Departamento de Micologia, CCB, Universidade Federal de Pernambuco,
Av. Prof. Nelson Chaves, s/n. 50670-420 Recife, PE, Brasil
*Dipartimento di Biologia Vegetale dell’ Universita and Istituto per la Protezione delle Piante,
(Sezione di Torino) del CNR - Viale P.A. Mattioli 25, 10125 Torino, Italy
*CORRESPONDENCE TO: [email protected]
ABSTRACT — Species of arbuscular mycorrhizal fungi (AMF) are usually identified by
the morphological characteristics of their spores. However, considering the difficulties in
diagnosing their taxa, the construction of species-specific primers has been proposed as an
identification alternative. In this paper the problem of distinguishing different Gigaspora
species with slight morphological differences was solved using species-specific primers and
SSU and LSU rDNA sequence analyses of 18 AM fungal isolates comprising seven species.
Neighbor joining, maximum parsimony, and maximum likelihood analyses were performed
to evaluate the phylogenetic affiliation of the isolates, and a new reverse PCR primer (ALB1)
specific for Gigaspora albida was designed and tested with 11 Gigaspora isolates (four species).
The results confirmed misidentification of “G. albida’ FL 927 and ‘G. margarita’ BR 444 and
supported referring FL 927 to G. rosea and BR 444 to G. albida.
Key worps — phylogeny, ribosomal sequences, Glomeromycota
Introduction
There are approximately 220 species of arbuscular mycorrhizal fungi
(AMF) (Stockinger et al. 2010). Morphological differences in spore structure
are usually used to distinguish between individual species, but this requires
a great deal of experience (Morton 1993, Bentivenga & Morton 1994). More
practical methods are needed, so that AMF can be identified directly not
only in the rhizosphere, but also after host root colonization. DNA analytical
methods involving electrophoretic profiles (Wyss & Bonfante 1993), sequence
comparisons (Daniell et al. 2001, Husband et al. 2002, Mummey & Rillig 2007,
Stukenbrock & Rosendahl 2005), PCR-DGGE (Souza et al. 2004), species-
18 ... Silva & al.
specific primers (Gamper & Leuchtmann 2007, Geue & Hock 2004, Lanfranco
et al. 1995, 1999, 2001, Millner et al. 1998, 2001a, 2001b, Redecker 2000), and
DNA barcodes (Stockinger et al. 2010) are being developed that would allow
identification of individual AMF species in an ecological context. For example,
species-specific PCR primers could be used to discriminate morphologically
similar species or even to identify species within colonized roots. However, to
date only a small number of species-specific probes has been developed.
After Oehl et al. (2008) divided the Gigasporaceae into four families and
six genera, Morton & Msiska (2010) proposed dividing Gigasporaceae into just
three genera —Gigaspora, Racocetra, Scutellospora. Gigaspora has five species
(Bentivenga & Morton 1995) in which the morphological variation is low
(Bago et al. 1998, Souza et al. 2004, Lanfranco et al. 2001), and only diameter,
color and spore wall thickness of glomerospores have been used for species
identification (Bentivenga & Morton 1995). Species-specific primers designed
for G. margarita (Lanfranco et al. 1999) and G. rosea (Lanfranco et al. 2001)
have shown to be effective in solving such morphological conflicts. In this study
we show how a species-specific PCR primer constructed for G. albida helps
solve problems associated with discriminating Gigaspora species and evaluate
Gigaspora phylogenetically through SSU and LSU rDNA analyses.
Materials & methods
AM fungi
Eleven reference isolates (TABLE 1) representing Gigaspora propagated in pot cultures
were selected.
Intracellular bacteria
Presence of intracellular bacteria was assessed with the Live/Dead Bac-Light
bacterial viability kit (Molecular Probes, Inc., Eugene, OR, USA) following Bianciotto
et al. (1996).
DNA extraction
Ten to 50 spores were washed in distilled water, sonicated 3-4 times, crushed in
50-100 ul of lx REDTaq PCR Reaction Buffer (10 mM Tris-HCl pH 8.3, 50 mM KCI, 1.1
mM MgCl, and 0.01% gelatin) (Sigma-Aldrich, Milan, Italy), and centrifuged at 1000
RPM for 2 min. The supernatant containing the DNA was incubated at 95°C for 13 min.
After extraction, the DNA was stored at —20°C.
Design of PCR primers, amplification and sequencing
A new species-specific reverse PCR primer ALB1 (5’-CCCAACTAAAAATACTTCAGTC-
3’) was designed for G. albida based on the GenBank ITS sequence AJ239118 and
combined with GilTS1 (Lanfranco et al. 1999) to create a 385 bp fragment. For
G. margarita and G. rosea, combinations of primers GiITS1+GiITS2 (Lanfranco et al.
1999) and GiITS1-GiR3 (Lanfranco et al. 2001) were used, respectively.
Discrimination of Gigaspora spp. ... 19
TABLE 1. Glomeromycota isolates used in PCR amplification tests with
species-specific primers and phylogenetic analysis.
SPECIES* ISOLATE ORIGIN Source?
Gigaspora albida N.C. Schenck & G.S. Sm. BR 601 Brazil INVAM
G. albida FL 927 USA UFPE
G.decipiens I.R. Hall & L.K. Abbott BEG 45 Australia BEG
G. gigantea (T.H. Nicolson & Gerd.) Gerd. & Trappe MN 414D USA INVAM
G. gigantea NC 150 USA INVAM
G. gigantea WV 932 USA INVAM
G. gigantea NC 199A USA INVAM
G. margarita W.N. Becker & I.R. Hall MAFF 52 Japan MAFE
G. margarita MAFF 54 Japan MAFF
G. margarita BEG 34 New Zealand = BEG/UNITO
G. margarita BR 444 Brazil INVAM
G. rosea T.H. Nicolson & N.C. Schenck UT 102 USA INVAM
G. rosea MAFF 62 Japan MAFF
G. rosea BRI51A Brazil INVAM
G. rosea DAOM 194757 NA NA
Scutellospora calospora (T.H. Nicolson & Gerd.) BEG 32 UK BEG
C. Walker & EE. Sanders
S. calospora HDAM-3 na na
Scutellospora sp. W 3485 UK C. Walker
* Species used in the test with species-specific primers (in bold). "INVAM: International Culture Collection
of Arbuscular and Vesicular-Arbuscular Mycorrhizal Fungi, USA; UFPE: Universidade Federal de
Pernambuco, Departamento de Micologia, Brasil; MAFF: Ministry of Agriculture, Forest and Fisheries,
Japan; BEG European Bank of Glomales, France; UNITO: Universita di Torino, Dipartimento di Biologia
Vegetale, Italy; na: information not available.
The 28G1 and 28G2 primers (Silva et al. 2006) were used to amplify the partial LSU
rDNA region. NS1, NS2, NS3, NS4, NS5 and NS8 were used to obtain the SSU rDNA
amplicons (White et al. 1990).
PCR reactions were carried out in a volume of 50 ul, containing 10 mM Tris-HCl
pH 8.3, 50 mM KCI, 1.1 mM MgCl, 0.01% gelatin, 200 uM each dNTPs, 1 uM of each
primer and 2 units of REDTaq™ DNA polymerase (SIGMA) (Sigma-Aldrich, Milan,
Italy). Cycling parameters were 45 s at 94°C, 1 min at 55°C, 1 min at 72°C for 40 cycles,
with a final elongation of 7 min at 72°C followed the last cycle. The amplicons were
visualized on 1.5% agarose gel with ethidium bromide. The amplified products for
SSU and LSU rDNA were purified with a QIAquick kit (Qiagen S.p.A., Milan, Italy)
following the manufacturer's instruction and sequenced (accession numbers are listed
in TABLE 1). Sequencing was made by GeneLab (Roma, Italy).
Sequence alignment and phylogenetic analysis
Prior to phylogenetic analysis, a BLASTn query of the National Center for
Biotechnology information databases demonstrated that sequences obtained from AMF
species were affiliated with the genus Gigaspora.
20 ... Silva & al.
Sequences of 15 Gigaspora and 11 Scutellospora isolates (some obtained from
GenBank) were selected to align SSU and LSU rDNA (TABLE 1) using Clustal X (Larkin
et al. 2007) and edited with BioEdit (Hall 1999).
For phylogenetic analyses and tree construction, neighbor joining (NJ), maximum
parsimony (MP), and maximum likelihood (ML) analysis with 1,000 bootstrap
replications were performed using PAUP4 (Phylogenetic Analysis Using Parsimony
vers. 4, Swofford 2003). NJ and ML analyses were performed using parameters obtained
from ModelTest 3.7 (Posada & Crandall 1998). Scutellospora calospora and Scutellospora
sp. were used as outgroup.
Results
Morphological observations of isolates FL 927 and BR 444
Isolates FL 927 (G. albida’) and BR 444 (‘G. margarita’) had morphological
characters similar to other Gigaspora species: spore wall thickness [9.6-(12.2)-
14.4 um and 12-(13.9)-16.8 um, respectively] and spore diameter [230-(282)-
360 um and 250-(320)-384 um, respectively]. However, the ‘G. margarita’
BR 444 spores were hyaline/white to yellow and lacked the characteristic green
(G. albida) or pink (G. rosea) coloration observed in reference isolates G. albida
BR 601 and G. rosea UT 102. All isolates of “G. margarita BR 444 and G. albida
BR 601 contained endobacteria, which were absent in all isolates of G. rosea
and ‘G. albida’ FL 927.
Testing species-specific primers for taxa of Gigaspora
Eleven Gigaspora isolates were screened for PCR amplification of a short
partial nuclear ITS rDNA fragment (385bp) with species-specific primers
(TABLE 1). The primers GilTS1+GiITS2 amplified only the G. margarita species,
excluding isolate “G. margarita BR 444, which did not amplify at all (Fic. 1A).
The combination of the species-specific primer constructed for G. rosea (GiR3)
with GiITS1 amplified not only the isolates of G. rosea, but also ‘G. albida’
FL 927 and showed a slight reaction to the DNA from spores of G. albida BR
601 and ‘G. margarita’ BR 444 (Fic. 1B), while the GiITS1+ALB1 primer pair
amplified only G. albida BR 601 and ‘G. margarita’ BR 444 (Fic. 1C). These
results support a misidentification for “G. albida FL 927 and ‘G. margarita’
BR 444.
Phylogenetic analysis of Gigaspora from SSU and LSU rDNA
In the SSU rDNA phylogenetic analyses (NJ, MP and ML), the genus
Gigaspora was supported as a monophyletic group with 100% of the bootstrap
value (Fic. 2). Three subclades were observed in the genus, the first grouping
‘G. margarita BR 444 with all isolates of G. albida and G. rosea. In the
second cluster just G. gigantea was present and in the last group all isolates of
G. margarita (except ‘G. margarita’ BR 444) appeared together with G. decipiens.
In the tree constructed with the LSU rDNA, Gigaspora was monophyletic
with high bootstrap support (Fic. 3). All isolates of G. margarita (except
Discrimination of Gigaspora spp... 21
Fic. 1. Agarose gels (1.5%) with PCR products of the Gigaspora spp. Different combinations of
primers were used: A) GilTS1-GiITS2; B) GilTS1-GiR3; C) GiITS1-ALB1. M = pUC 18 digested
with Hae III. NTC = no template control.
‘G. margarita’ BR 444) clustered together. Two isolates of Gigaspora gigantea
grouped in the same clade, Gigaspora albida BR 601 and ‘Gigaspora margarita’
BR 444 clustered together and Gigaspora rosea UT 102 was close to “Gigaspora
albida’ FL 927. Based on SSU and LSU rDNA analyses ‘Gigaspora margarita BR
444 has been misidentified.
Discussion
Due to the low morphological variation amongst Gigaspora species
(Bentivenga & Morton 1995), some papers have reported species misidenti-
fication (Bago et al. 1998, Souza et al. 2004, Lanfranco et al. 2001). These
studies also report the usefulness of molecular approach as an identification
tool. Based on sequences of SSU rDNA and isozyme analysis, Bago et al. (1998)
divided Gigaspora into three subgeneric groups: the first with G. margarita and
G. decipiens, the second with G. albida and G. rosea, and the third with G. gigantea.
In this paper these same groups were observed in the phylogeny generated by
22 ... Silva & al.
S. calospora AJ306443 BEG32
Scutellospora sp. AJ306437 W3485
G. albida Z14009 FL927
G. margarita AJ852603 BR444
65 G. rosea X58726 DAOM194757
61
5 G. albida AJ852599 BR601
51
G. albida AJ852600 FL927
52 G. rosea AJ852608 MAFF520062
68 50
| | G rosea AJ852607 BR151A
G. rosea AJ852606 UT102
G. gigantea AJ852601 MN414D
100) 78 G. gigantea AJ852602 NC150
100) 514
100| 52 | G gigantea EF014362 NC199A
G. gigantea Z14010 WV932
G. margarita AJ852604 MAFF520052
G. decipiens U96146 BEG45
70
60
hc G. margarita AJ852605 MAFF520054
8
8 G. margarita AM181144 BEG34
a G. margarita AM181143 BEG34
0.001
Fic. 2. Phylogenetic reconstruction of the Gigaspora obtained from SSU rDNA sequences (~1700
bp). The NJ and ML analyses were performed with HKY85 + I substitution model. Bootstrap values
(in %) are from neighbor joining (NJ), maximum parsimony (MP) and maximum likelihood (ML)
analyses (1000 bootstraps), respectively. Only topologies with bootstrap values of at least 50% are
shown. (Consistency Index = 0.88; Retention Index = 0.93).
SSU rDNA, and just “G. margarita BR 444 was out of the correct clade. In the
LSU rDNA tree, the isolate BR 444 also grouped together with G. albida BR
601, whereas the isolate FL 927 (identified as G. albida) was clustered with
G. rosea. Bago et al. (1998) observed that the isolates BR 444, identified initially
as G. margarita, and FL 927 (described as G. albida), should instead be ascribed
to G. albida and G. rosea, respectively. The PCR amplification tests with species-
specific primers in this study also indicated that these two isolates should be
reclassified as G. albida and G. rosea. Nevertheless recently Msiska & Morton
Discrimination of Gigaspora spp. ... 23
S. calospora AJ510231 BEG32
S. calospora EU346867 HDAM-3
G. albida AJ852008 FL927
G. rosea AJ852015 UT102
G. albida AJ852007 BR601
G. margarita AJ852012 BR444
G. gigantea AJ852009 MN414D
G. gigantea AJ852010 NC150
G. margarita AJ852013 MAFF520052
G. margarita AJ852014 MAFF520054
G. margarita AJ852011 BEG34
0.01
Fic. 3. Phylogenetic reconstruction of the Gigaspora obtained from LSU rDNA sequences (~ 450
bp). The NJ and ML analyses were performed with GTR substitution model. Bootstrap values (in
%) are from neighbor joining (NJ), maximum parsimony (MP) and maximum likelihood (ML)
analyses (1000 bootstraps), respectively. Only topologies with bootstrap values of at least 50% are
shown. (Consistency Index = 0.93; Retention Index = 0.93).
(2009), based on $-tubulin gene, reported that “G. margarita’ BR 444 did not
group with G. albida or G. rosea, but with G. decipiens.
Using PCR-DGGE analysis, Souza et al. (2004) already observed, as we
confirmed here, that the FL 927 isolate, originally identified as G. albida, should
be ascribed to G. rosea, indicating identification problems. Endobacteria are
usually observed in glomerospores of Gigaspora species, with the exception of
24 ... Silva & al.
G. rosea isolates. Bacteria were not found in “Gigaspora albida’ FL 927, further
substantiating the need for reclassification.
Van Tuinen et al. (1998) were the first to design specific primers for Gigaspora
species (G. rosea) that amplify a region of the LSU rDNA. Because these
authors tested cross-amplification only with species of other AMF genera, it is
not possible to establish whether the primers amplify other Gigaspora species.
Currently there are primers specific for two Gigaspora species (G. margarita
and G. rosea); nevertheless, we report that the reverse primer GiR3 (Lanfranco
et al. 2001) also amplifies G. albida isolates. As Lanfranco et al. (2001) did not
use G. albida and G. decipiens in their analyses with species-specific primers,
it was not possible to establish how specific the primers are to G. rosea and
G. margarita. Of the five known Gigaspora species (Bentivenga & Morton
1995), only G. decipiens was not used in this work.
In summary, our results show that different specific PCR primer pairs
and phylogenetic studies can help discriminate among Gigaspora species
with similar spore morphologies and support the utility of these primers and
phylogenetic analysis for solving problems in identifying groups of species in
Gigasporaceae with a low morphological variation.
Acknowledgements
We are grateful to Dr. Fritz Oehl and Dr. Renata Gomes de Souza for the valuable
comments on the manuscript. L.C. Maia acknowledges the Conselho Nacional de
Desenvolvimento Cientifico e Tecnolé6gico (CNPq) for a research grant. The authors
wish to thank Dr. J. Morton and Dr. M. Saito for providing fungal isolates. We are
grateful to Dr. David Bousfield for the critical reading of the manuscript and appreciate
the corrections by Shaun Pennycook, Nomenclatural Editor, and suggestions by Lorelei
L. Norvell, Editor-in-Chief. This research was funded by the Italian National Council
of Research (CNR), Cassa di Risparmio di Torino and Centro di Eccellenza per la
Biosensoristica Vegetale e Microbica.
Literature cited
Bago B, Bentivenga S, Brenac V, Dodd JC, Piché Y, Simon L. 1998. Molecular analysis of Gigaspora
(Glomales, Gigasporaceae). New Phytol. 139: 581-588.
http://dx.doi.org/10.1046/j.1469-8137.1998.00212.x
Bentivenga SP, Morton JB. 1994. Systematics of glomalean endomycorrhizal fungi: current views
and future directions. In: Pfleger FL, Linderman RG. (eds). Mycorrhizae and Plant Health:
283-308. APS Press, St. Paul.
Bentivenga SP, Morton JB. 1995. A monograph of the genus Gigaspora, incorporating developmental
patterns of morphological characters. Mycologia 87: 719-731.
http://dx.doi.org/10.2307/3760818
Bianciotto V, BandiC, Minerdi D, Sironi M, Tichy HV, Bonfante P. 1996. An obligately endosymbiotic
mycorrhizal fungus itself harbors obligately intracellular bacteria. Appl. Environ. Microbiol. 62:
3005-3010.
Discrimination of Gigaspora spp. ... 25
Daniell TJ, Husband R, Fitter AH, Young JPW. 2001. Molecular diversity of arbuscular mycorrhizal
fungi colonizing arable crops. FEMS Microbiol. Ecol. 36: 203-209.
http://dx.doi.org/10.1111/j.1574-6941.2001.tb00841.x
Gamper H, Leuchtmann A. 2007. Taxon-specific PCR primers to detect two inconspicuous
arbuscular mycorrhizal fungi from temperate agricultural grassland. Mycorrhiza 17: 145-152.
http://dx.doi.org/10.1007/s00572-006-0092-3
Geue H, Hock B. 2004. Determination of Acaulospora longula and Glomus subgroup Aa in plant
roots from grassland using new primers against the large subunit ribosomal DNA. Mycol. Res.
108: 76-83. http://dx.doi.org/10.1017/S0953756203009080
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NTT. Nucl. Acids Symp. Ser. 41: 95-98.
Husband R, Herre EA, Young JPW. 2002. Temporal variation in the arbuscular mycorrhizal
communities colonizing seedlings in a tropical forest. FEMS Microbiol. Ecol. 42: 131-136.
http://dx.doi.org/10.1111/j.1574-6941.2002.tb01002.x
Lanfranco L, Wyss P, Marzachi C Bonfante P. 1995. Generation of RAPD-PCR primers for the
identification of isolates of Glomus mosseae, an arbuscular mycorrhizal fungus. Mol. Ecol. 4:
61-68. http://dx.doi.org/10.1111/j.1365-294X.1995.tb00192.x
Lanfranco L, Delpero M, Bonfante P. 1999. Intrasporal variability of ribosomal
sequences in the endomycorrhizal fungus Gigaspora margarita. Mol. Ecol. 8: 37-45.
http://dx.doi.org/10.1046/j.1365-294X.1999.00535.x
Lanfranco L, Bianciotto V, Lumini E, Souza M, Morton JB, Bonfante P. 2001. A combined
morphological and molecular approach to characterize isolates of arbuscular mycorrhizal fungi
in Gigaspora (Glomales). New Phytol. 152: 169-179.
http://dx.doi.org/10.1046/j.0028-646x.2001.00233.x
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F,
Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. Clustal W and
Clustal X version 2.0. Bioinformatics 23: 2947-2948.
http://dx.doi.org/10.1093/bioinformatics/btm404
Millner PD, Mulbry WW, Reynolds SL, Patterson CA. 1998. A taxon-specific oligonucleotide probe
for temperate zone soil isolates of Glomus mosseae. Mycorrhiza 8: 19-27.
http://dx.doi.org/10.1007/s005720050206
Millner PD, Mulbry WW, Reynolds SL. 2001a. Taxon-specific oligonucleotide primers for detection
of Glomus etunicatum. Mycorrhiza 10: 259-265. http://dx.doi.org/10.1007/s005720000085
Millner PD, Mulbry WW, Reynolds SL. 2001b. Taxon-specific oligonucleotide primers for detection
of two ancient endomycorrhizal fungi, Glomus occultum and Glomus brasilianum. FEMS
Microbiol. Letts. 196: 165-170. http://dx.doi-org/10.1111/j.1574-6968.2001.tb10559.x
Morton JB. 1993. Problems and solutions for the integration of glomalean taxonomy, systematic
biology, and the study of endomycorrhizal phenomena. Mycorrhiza 2: 97-109.
http://dx.doi.org/10.1007/BF00203855
Morton JB, Msiska Z. 2010. Phylogenies from genetic and morphological characters do not support
a revision of Gigasporaceae (Glomeromycota) into four families and five genera. Mycorrhiza 20:
483-496. http://dx.doi.org/ 10.1007/s00572-010-0303-9
Msiska Z, Morton JB. 2009. Phylogenetic analysis of the Glomeromycota by partial 6-tubulin gene
sequences. Mycorrhiza 19: 247-254. http://dx.doi.org/10.1007/s00572-008-0216-z
Mummey DL, Rillig MC. 2007. Evaluation of LSU rRNA-gene PCR primers for analysis of arbuscular
mycorrhizal fungal communities via terminal restriction fragment length polymorphism
analysis. J. Microbiol. Methods 70: 200-204. http://dx.doi.org/10.1016/j.mimet.2007.04.002
26 ... Silva & al.
Oehl F, de Souza FA, Sieverding E. 2008. Revision of Scutellospora and description of five new genera
and three new families in the arbuscular mycorrhiza-forming Glomeromycetes. Mycotaxon 106:
311-360.
Posada D, Crandall KA. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics
14: 817-818. http://dx.doi.org/10.1093/bioinformatics/14.9.817
Redecker D. 2000. Specific PCR primers to identify arbuscular mycorrhizal fungi within colonized
roots. Mycorrhiza 10: 73-80. http://dx.doi.org/10.1007/s005720000061
Silva GA da, Lumini E, Maia LC, Bonfante P, Bianciotto V. 2006. Phylogenetic analysis of
Glomeromycota by partial LSU rDNA sequences. Mycorrhiza 16: 183-189.
http://dx.doi.org/10.1007/s00572-005-0030-9
Souza FA de, Kowalchuk GA, Leeflang P, van Veen JA, Smit E. 2004. PCR-denaturing Gradient gel
electrophoresis profiling of inter- and intraspecies 18S rRNA gene sequence heterogeneity is an
accurate and sensitive method to assess species diversity of arbuscular mycorrhizal fungi of the
genus Gigaspora. Appl. Environ. Microbiol. 70: 1413-1424.
http://dx.doi.org/10.1128/AEM.70.3.1413-1424.2004
Stockinger H, Kriiger M, SchiiBler A. 2010. DNA barcoding of arbuscular mycorrhizal fungi. New
Phytol. 187: 461-474. http://dx.doi.org/10.1111/j.1469-8137.2010.03262.x
Stukenbrock EH, Rosendahl S. 2005. Distribution of dominant arbuscular mycorrhizal fungi
among five plant species in undisturbed vegetation of a coastal grassland. Mycorrhiza 15:
497-503. http://dx.doi.org/10.1007/s00572-005-0357-2
Swofford DL. 2003. PAUP*. Phylogenetic Analysis Using Parsimony *(and Other Methods), Version
4, Sinauer Associates, Sunderland.
van Tuinen D, Jacquot E, Zhao B, Gollotte A, Gianinazzi-Pearson V. 1998. Characterization of root
colonization profiles by a microcosm community of arbuscular mycorrhizal fungi using 25S
rDNA-targeted nested PCR. Mol. Ecol. 7: 879-887.
http://dx.doi.org/10.1046/j.1365-294x.1998.00410.x
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds.). PCR protocols: a guide to
methods and applications. Academic Press, San Diego.
Wyss P, Bonfante P. 1993. Amplification of genomic DNA of arbuscular-mycorrhizal (AM) fungi by
PCR using short arbitrary primers. Mycol. Res. 97: 1351-1357.
http://dx.doi.org/10.1016/S0953-7562(09)80169-X
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/118.27
Volume 118, pp. 27-46 October-December 2011
Contribution to the taxonomy of Bovista in Mexico
SILVIA BAUTISTA- HERNANDEZ’ , TEOFILO HERRERA’,
ELVIRA AGUIRRE-ACOSTA* & MARTIN ESQUEDA?
‘Laboratorio de Micologia, Departamento de Botanica,
Escuela Nacional de Ciencias Biolégicas, IPN,
Prolongacion de Carpio y Plan de Ayala s/n, Distrito Federal 11340, México
*Departamento de Botanica, Instituto de Biologia, UNAM,
Apartado Postal 70-233, Distrito Federal 04510, México
°Centro de Investigacion en Alimentacion y Desarrollo, A.C.,
Apartado Postal 1735, Hermosillo, Sonora 83304, México
CORRESPONDENCE TO *: [email protected]
ABSTRACT — Specimens of the genus Bovista from eight Mexican herbaria (CESUES, ENCB,
FCME, HEMIM, IBUG, IZTA, MEXU, XAL) were examined and studied, and fifteen taxa
were identified: Bovista aestivalis, B. brunnea, B. dermoxantha, B. dominicensis, B. fusca,
B. grandipora, B. graveolens, B. heterocapilla, B. leacoderma, B. oblongispora var. longispora,
B. oblongispora var. oblongispora, B. plumbea, B. pusilla, B. sempervirentium, and B. tomentosa.
The new information obtained indicates a wider distribution for B. aestivalis, B. dermoxantha,
B. fusca, B. graveolens, B. leucoderma, B. oblongispora var. longispora, B. pusilla, and
B. tomentosa. New records for the Mexican mycobiota are: B. dominicensis, B. grandipora,
B. heterocapilla, B. oblongispora var. oblongispora, and B. sempervirentium.
Key worps — Basidiomycota, taxonomy, gasteroid fungi
Introduction
The genus Bovista Pers. is characterized by globose to pyriform basidiomes
with/without a short pseudostipe and with/without mycelial cords (Pegler et
al. 1995) and a thin, fragile, scaly exoperidium. On maturing the basidiome
may form plates, areolae, verrucae, or scales microscopically composed of
hyphal elements, sphaerocysts, claviform cells (Kreisel 1967), or mycosclereids
(Calonge et al. 2005). The endoperidium is persistent, in consistency
papyraceous, pseudopapyraceous, or rigid, smooth and generally shiny or with
a metallic luster (Coker & Couch 1928), although this does not distinguish
Bovista from other related genera. According to Smith (1951), spores are
28 ... Bautista- Hernandez & al.
smooth or ornamented. Shape varies, from globose, subglobose to oblong, with
a pedicel, which may be short or long, straight or curved, corresponding to
the sterigma of the basidium. The subgleba, present only in some species, has
a filamentous, compact appearance and is generally reduced in size and not
well developed. There are three types of capillitium: Lycoperdon, Bovista, and
intermediate (Calonge 1998; Kriiger et al. 2001).
Bovista, traditionally placed in Lycoperdaceae but currently classified in
Agaricaceae (Kirk et al. 2008), is divided into two subgenera based on capillitial
type. Taxa characterized by a Lycoperdon or intermediate capillitium are placed
in subg. Globaria, while those with either a Bovista or heteromorphic (bovista-
+ intermediate) capillitium belong in subg. Bovista. These subgenera are further
divided into sections and series based on capillitium type, absence or presence
of capillitial pores, and presence or absence of a subgleba (Kreisel 1967).
In Mexico few researchers have addressed the taxonomy of Bovista (Herrera
1959); the genus is generally included in general gasteromycete treatments
(Salcedo & Herrera 1966, Guzman & Herrera 1969, 1973, Rodriguez & Herrera
1970, Urista et al. 1985, Esqueda et al. 1990, 1996, 1998, Pardavé 1991, Pérez-
Silva et al. 1994, Calonge et al. 2004a,b, Ochoa & Moreno 1996, 2006). Bovista
has been confused with Lycoperdon Pers., Disciseda Czern., Calvatia Fr.,
Vascellum F. Smarda, Bovistella Morgan, and Calbovista Morse ex M.T. Seidl,
owing to shared macro- and microscopic characteristics. There are, however,
differences that allow them to be quite easily separated. Confusion surrounding
the correct identification of species has prompted this revision of Bovista with
the aim of contributing to the knowledge of the genus in Mexico.
Materials & methods
Herbarium material was examined from CESUES (Centro de Estudios Superiores del
Estado de Sonora, Unidad Hermosillo), ENCB (Escuela Nacional de Ciencias Bioldgicas,
IPN), FCME (Facultad de Ciencias, UNAM), HEMIM (Herbario Micoldgico de Morelos,
UAEM), IBUG (Instituto de Botanica, Universidad de Guadalajara), IZTA (Facultad de
Estudios Superiores campus Iztacala, UNAM), MEXU (Instituto de Biologia, UNAM),
and XAL (Instituto de Ecologia, A.C., Unidad Xalapa).
Macroscopic characters were transcribed from specimen labels or recorded directly
from the basidiomes. For microscopic examination, temporary preparations were made
using 5% potassium hydroxide (KOH) for observing and measuring basidiospores and
capillitial elements with an optical microscope (OM). Lactophenol cotton blue was used
for observing the paracapillitium. Material was also prepared for observation using a
scanning electron microscope (SEM) in order to properly describe spore ornamentation
and perforations in the hyphal walls of the capillitium.
The keys of Kreisel (1967), Demoulin & Marriot (1981), Calonge (1992, 1998) and
Pegler et al. (1995) were mainly used for species identification.
Bovista in Mexico ... 29
Results
Of the 15 Bovista taxa identified and included in the taxonomic key,
9 represented subgenus Globaria (B. aestivalis, B. dermoxantha, B. dominicensis,
B. grandipora, B. heterocapilla, B. oblongispora var. longispora, B. oblongispora
var. oblongispora, B. pusilla, B. sempervirentium) and 6 subgenus Bovista
(B. brunnea, B. fusca, B. graveolens, B. leucoderma, B. plumbea, B. tomentosa).
Five taxa are new records for the Mexican mycobiota and are described below:
B. dominicensis, B. grandipora, B. heterocapilla, B. oblongispora var. oblongispora,
and B. sempervirentium.
Key to the taxa of Bovista recorded from Mexico
1. Basidiomes with intermediate or Lycoperdon capillitium ...................2-.. 2
li Basidiomes with Bovista type-cap itt Uenn: aces sovarshe ssaracahs seavacche svavarcshe averse oats 11
ZltiterMmediaterty pe capil MAUI ase Tasca se Yun, aaa Tan ahceelgn asa Tge aia Tao nis evans ae eahe eee 3
ZL COP CPAOM TY PO CAPU TT UTNE § oe eb cose ttn wen © epaeye H array W moasigd ¥ sneeteyt Hydttesiey’ Sgpllenen Heat i;
3. Basidiomes with ellipsoid spores, short pedicels .......... 0.0... cece eee eee eee +
BZ BASIGIOMES WIT ClODOSESPOL CS ec apa on at oil Pepe PR ag le net oP Piags Pani oR ceo BP ae 5
4 capil lrtnuir wat PepOres) <6. ac’ Wis wale Wis Mal. Wal els Rk ae B. oblongispora var. longispora
4uCapillitinm: pores abSentt ns nk salen assess B. oblongispora var. oblongispora
5:-Heteromorphic-capillitivi, 5 gu), dios. douhes Sdocbe > Sehe 4 aouchet aul tbe Mate ide 6
5 Intermediate capillitiam. 23 vena. cx veoh see steals shale seo teal ed a's OR Sal OH 7
Ge Spores wath pedicels <alWipttne . 25116525 65 a nn pel nye Selene ele ain B. pusilla
GL Spores gvithsped ice) sree lye (iit, Me ait Med wats Ried wake Weed eats Nin Wale Wd Oates B. heterocapilla
7. Echinulate spores with pedicels:< 34 dim o.<-cta. co lense Yooleiten Holes & B. dominicensis
TE OPOLes WAL STG h VETEUCAS enh Whe, Beals beth y Wades bea Res Wadd se body cite e be wited 8
8. Gaprllituimewithbrancnest . Petey Msctew 1A Ti BeenRe Mey eh Ries ty aetna givens tae 9
§) Capillitinm withoutbranghes, ©... 6... 5 ats <.-scayse test ea eye Sa ee eee ee 10
9. Capillitium with amphiseptal branches, numerous pores,
Sivine-avacHo atesappearanice. ts 4H. dl tal tah Mtoe wlaMals © B. grandipora
9°. Capillitium with subseptal branches, with pores ................ B. dermoxantha
10. Exoperidium verrucae made of sphaerocysts .................0000- B. aestivalis
10’ Exoperidium verrucae made of hyphal elements ............ B. sempervirentium
Lil, Basidiomes medivi:tolargey > So Ati es aie eet mene bE arene oH sn tye eaellgnen weal 12
MeBasidiomesismallteneciyiiny:s SeaMIil 29s fie 08s vel ook hae te noe ee GN od 13
12¢Spores subsloboseto.ovoids pedicels: str dighit-c. bate t Aste eter aloo, B. fusca
12° Spores globose to subglobose, pedicels curved..................04. B. graveolens
LC ail Witney athe pores. sre oie Peg Tors ves Tenants awes late peias Vownaset tae aie mner ate eee 14
13° Capillitium pores absent, endoperidium lead colored ............... B. plumbea
30 ... Bautista-Hernandez & al.
FAP SPOKestovoid. 7. iawn 2; hae tates nae nea hea ae eee eee SS B. tomentosa
14, Spores: Slobose te-SulpSloDose Me. oats aes ha a Ola ode ela ob ele cece Oe seer shes 15
15. Capillitium with thick walls, LH = 0.2-0.5............. 0. esse eee eae B. brunnea
15° Capillitium with moderately thin walls, LH = 0.5-0.7 ............. B. leucoderma
Taxa studied
Subgenus Globaria
Bovista aestivalis (Bonord.) Demoulin, Beih. Sydowia 8: 143, 1979. Figs 1-2
SPECIMENS EXAMINED: MEXICO. HipaLGo: MINERAL DEL CHICO MUNICIPALITY,
near Las Ventanas, El Chico National Park, October 5, 1980 G. Guzman 19099 (ENCB).
JALISCO: SAN DIEGO DE ALEJANDRIA MUNICIPALITY, San Diego de Alejandria-San
Julian Highway, 7.5 km from the town of San Diego de Alejandria, August 30, 2000 O.
Rodriguez 2332 (IBUG). EsTADO DE MExIco: Near Amecameca, August 31, 1969 I. Uribe
11 (ENCB); Near La Marquesa, Miguel Hidalgo National Park, July 5, 1963 E. Gonzdlez
12 (ENCB); ATIZAPAN DE ZARAGOZA MUNICIPALITY, Sayavedra Farm subdivision, June
18, 2000 A. Lopez-Villalobos 24 (XAL). Oaxaca: San Pedro Macuiltianguis, June 15,
1984 A. Gonzdlez (XAL).
ComMENTs — ‘this species is characterized by a compact subgleba, evident or
barely developed. Unlike Bovista dermoxantha, B. aestivalis has an intermediate
type of capillitium and under the OM the spores show an ornamentation that
is not very evident. Pegler et al. (1995) mention that it is a very polymorphic
species and thus taxonomically difficult to identify.
Bovista aestivalis has been cited for Baja California (Ochoa & Moreno 2006),
Chihuahua (Moreno et al. 2010), Estado de México, Oaxaca and Veracruz
(Calonge et al. 2004b). This study extends its distribution range to the states of
Hidalgo and Jalisco.
Bovista dermoxantha (Vittad.) De Toni, Syll. Fung. 7: 100, 1888. Figs 3-4
SPECIMENS EXAMINED: MEXICO. Baya CALIFORNIA: km 2, close to the turnoff from
Ensenada to the San Felipe highway, on the way to Hanson Lagoon, in the foothills of
the Juarez range, March 02, 1984 G. Guzman 24326-A (XAL). CHIHUAHUA: TEMOSACHI
MunicIPatity, Nabogame, July 31, 1987 J. E. Laferriére 624 (XAL); 65 km NW of
Janus, September 20, 1972 P. Huerta (ENCB). Hipaueo: San Gregorio, north side of
Xihuingo Hill, July 26, 1963 G. Guzmdn 3865 (ENCB). EstaDo DE MExiIco: Close to
the Guadalupe Dam, July 02, 1967 G. Guzman 5862 (ENCB). Sonora: km 12 on the
Santa Rosa-Yécora highway, August 6, 1989 A. Aparicio 4 (MEXU 22589). TLAXCALA:
HUAMANTLA MUNICIPALITY, 2 km south of La Malinche mountain, July 19, 1987 Mata
217 (XAL). VERACRUZ: Montepio, June 19, 1969 R. Singer & T: Herrera (MEXU 6897);
IZTACZOQUITLAN MUNICIPALITY, in the region of Metlac Gorge, August 09, 1995 P
Navarro 1042; September 13, 1996 P Navarro 1095 (XAL).
CoMMENTS — Pegler et al. (1995) mention that this species is close to B. aestivalis
but differs by its conspicuously ornamented spores and the Lycoperdon type
capillitium.
Bovista in Mexico ... 31
Fics. 1-6. Bovista aestivalis: 1. Spores. 2. Pitted capillitium. Bovista dermoxantha: 3. Spores.
4, Pitted capillitium. Bovista dominicensis: 5. Spores. 6. Spores ornamentation detail. Scale bars:
1-4,6=1um;5=5 um.
Bovista dermoxantha has been reported for the states of Baja California
(Calonge et al. 2004b; Ochoa & Moreno 2006), Chihuahua, Tlaxcala and
Veracruz (Calonge et al. 2004b). This study extends its distribution range to
Hidalgo, Estado de Mexico and Sonora.
Bovista dominicensis (Massee) Kreisel, Feddes Repert. 69: 202, 1964. Fics 5-6
Basidiome 12-37 mm, globose to flattened-globose, exoperidium forms
small pyramidal scales like spines, blackish-brown to greyish in color, formed
by sphaerocysts that are reddish-brown in KOH; endoperidium whitish, of
intertwined hyaline hyphae. Gleba white to olive green. Subgleba compact.
32 ... Bautista-Hernandez & al.
Lycoperdon type capillitium, hyphae thin walled, 4-5 um, light brown
in color, pores absent, barely branched, septa scarce. Paracapillitium absent.
Spores globose, 4-5 um, equinulate, hyaline. Pedicel 13-30(-34) x 1 um,
straight, hyaline.
ECOLOGY & DISTRIBUTION — Gregarious, humicolous in cloud forests,
Pinus-Quercus in transition with cloud forest and tropical vegetation with
columnar cacti, at an altitude of 1270-1550 m.
SPECIMENS EXAMINED: MEXICO. PugEBra: La Magdalena Farm, S of Teziutlan, October
14, 2004 E. Gandara 1161. SINALOA: El Fuerte road to stones with hieroglyphics, after
the El Fuerte River, August 24, 2004 G. Guzmdn 36091. VERACRUZ: Surroundings
of the CONECALLI-DIF social services building, km 2.5 Xalapa-Coatepec Old
Highway, September 7, 1993 D. Fernandez 38; X1co MUNICIPALITY, road from Xico to
Matlalapa, before arriving at Xico Viejo, September 3, 2000 D. Jarvio 677; BANDERILLA
Municipa.ity, La Martinica Hill, July 01, 2004 V. Ramirez-Cruz 94; La Martinica Hill,
August 21, 2006 G. Guzman 36569; COATEPEC MunIcIPALITY, Zoncuantla, royal road
from Xalapa to Coatepec near km 6 of the Xalapa-Coatepec Old Highway (residence),
September 18, 1998 G. Guzman 32468; September 20, 1998 G. Guzman 32482; September
29, 1998 G. Guzman 32666; December 30, 1998 G. Guzmdn 32771; June 24, 1999
G. Guzman 32995; June 27, 1999 G. Guzman 33022; June 01, 2000 G. Guzman 33495;
July 13, 2003 G. Guzman 35488; October 03, 2003 G. Guzmdn 35568; November 02,
2003 G. Guzman 35704; October 02, 2004 G. Guzman 36119; G. Guzman 36122; October
05, 2004 G. Guzmdn 36125; G. Guzman 36127; October 07, 2004 G. Guzman 36133;
G. Guzman 36277; July 10, 2005 G. Guzman 36228; July 26, 2005 G. Guzman 36311;
G. Guzman 36328; October 23, 2005 G. Guzman 36367; July 02, 2006 G. Guzman 36440;
September 15, 2006 G. Guzman 36678; XALAPA MUNICIPALITY, FJ. Clavijero Botanical
Garden, km 2.5 on the Old Highway to Coatepec, June 03, 1995 Garcia- Velazquez 779;
July 03, 1995 Garcia- Velazquez 780; July 10, 2003 FE. Escalona 196; September 30, 2004
E. Gandara 892; October 07, 2004 E. Gandara 932; V. Ramirez-Cruz 189 (XAL).
ComMENTS — Bovista dominicensis, is characterized microscopically by globose
and echinulate spores with long pedicels from 13 up to 34 um. Macroscopically
it can be confused with Lycoperdon because the basidiome is pyriform owing to
the presence of a pseudostipe.
Part of the material examined had been identified as B. longissima Kreisel
and thus reported as a new record for the Americas (Calonge et al. 2004b).
However, B. longissima has verrucose spores and pedicels < 38 um long and to
date it has been recorded only from Japan (Kreisel 1967). Spore ornamentation
places it in B. dominicensis, as it is the same as that in the SEM images shown in
the study by Calonge et al. (2005). Although those authors describe the spores
as verrucose, Kreisel (1967) described them with fine verrucae to delicate
spines. ‘The pedicels of the examined specimens were longer (< 34 um) than
those reported by Kreisel (10-21 um) and Calonge et al. (20 um).
Worldwide, B. dominicensis has been reported for Brazil (Kreisel 1967,
Homrich 1969 [as Lycoperdon dominicensis], Trierveiler et al. 2010), the United
States of America, the Dominican Republic (Kreisel 1967), Colombia (Guzman
Bovista in Mexico ... 33
et al. 2004), and Costa Rica (Calonge et al. 2005). This is the first report of
B. dominicensis for Mexico, where it has been recorded from the states of
Puebla, Sinaloa and Veracruz.
Bovista grandipora Trierv.-Per., Kreisel & Baseia, Mycotaxon 111: 415, 2010.
Fics 7-8
Basidiome 10-12 mm in diameter, globose. Exoperidium white, breaking
into small scales, furfuraceous in appearance, made up of short fragments of
hyphae, orange-red color in KOH. Endoperidium greyish brown to dark brown.
Gleba white to mustard yellow. Subgleba absent. Mycelial cord radicant.
Lycoperdon type capillitium, with amphiseptal septa, pores abundant, giving
a vacuolate appearance. Globose spores, 4—5 tm, verruculose, greenish-yellow.
Short pedicel, 0.5-1 tm, hyaline.
ECOLOGY & DISTRIBUTION —Terricolous, gregarious in the grass. Found in
open Juniperus deppeana forest and in tropical vegetation at altitudes of 2500
and 1500 m, respectively.
SPECIMENS EXAMINED: MEXICO. JALISCO: SAN PEDRO TESISTAN MUNICIPALITY,
highway to Azuayo, W side of the Chapala Lagoon, July 07, 1974 G. Guzman 11582-B
(ENCB); ZAPOPAN MUNICIPALITY, 2 km NW of La Venta, September 27, 1970 D. Garcia
452 (IBUG). PUEBLA: Santa Cruz, between San Martin Texmelucan and La Blanca,
August 25, 1956 T. Herrera (MEXU 901).
CoMMENTS — ‘The specimens examined coincide with the description of
Bovista grandipora given by Trierveiler-Pereira et al. (2010), Microscopically,
B. grandipora is characterized by a capillitium of the Lycoperdon-type with
numerous pores, 0.5-2.4 um, round to ellipsoid or irregularly shaped, and
globose, verruculose with short pedicel (0.5-1 um) basidiospores.
Worldwide, this species has been recorded for Brazil, Cuba, Dominican
Republic, India, Japan, Nepal, Puerto Rico and Spain (Trierveiler-Pereira et al.
2010). This is its first record for Mexico, specifically for the states of Jalisco and
Puebla.
Bovista heterocapilla Kreisel, Beih. Nova Hedwigia 25: 224, 1967. Figs 9-11
Basidiome globose, subglobose to turbinate. Endoperidium papyraceous,
smooth, brown in color, made of intertwined hyphae. Exoperidium is white,
ephemeral, persistent small spines (spinulose), blackish-brown, made up
of sphaerocysts. Subgleba absent or if present, compact, olive brown to dark
brown.
Bovista type or heteromorphic capillitium in the center of the gleba, hyphae
with pseudosepta frequent, true septa and pores absent. Spores 5-6 um,
verrucose, pedicellate. Pedicel 8-17 um, straight, hyaline.
ECOLOGY & DISTRIBUTION — Gregarious, terricolous in Abies, Abies-Quercus
and cloud forest at an altitude of 2330 to 2800 m.
34 ... Bautista-Hernandez & al.
SPECIMENS EXAMINED: MEXICO. Distrito FEDERAL: Contreras, Cerro Tarumba,
October 21, 1956 T: Herrera (MEXU 1426). Hipateco: El Chico National Park, Las
Ventanas, September, 1970 R. Ramos 105 (ENCB); El Chico National Park, October
25, 1975 R. Herndndez (MEXU 12871); Piedras Voladas, Real del Monte, June 13, 1982
E. Pérez-Silva & R. Hernandez (MEXU 17283); Pueblo Nuevo, October 08, 1975 E. Pérez-
Silva (MEXU 11312). Estapo DE MExico: Amecameca, September 18, 1963 A. Najera
(MEXU 2761); La Marquesa-Tenango Highway km 6, October 05, 1975 R. Lamothe &
E. Pérez-Silva (MEXU 10163); La Marquesa, October 21, 1973 R. Lamothe & E. Pérez-
Silva (MEXU 8442); Purificacién NE of Texcoco, September 05, 1976 G. Guzman 16477
(ENCB).
ComMENTsS — ‘This species is characterized by a Bovista type capillitium;
heteromorphic in some specimens, i.e., of the intermediate+Bovista type.
Although Kreisel (1967) mentions that it has the Lycoperdon type of capillitium,
the characteristics of the hyphae and the spores match those cited for
B. heterocapilla.
One species close to B. heterocapilla is B. albosquamosa Kreisel. These
are distinguished by the characteristics of the exoperidium and the spore
ornamentation. In B. heterocapilla the exoperidium is uniformly granular-
verrucose and the spores are verrucose, while in B. albosquamosa the
exoperidium is furfuraceous areolate and the spores are dotted or verruculose
(Kreisel 1967).
Bovista heterocapilla has been reported only for Jamaica (Kreisel, 1967). This
is the first record for Mexico.
Bovista oblongispora var. longispora (Kreisel) A. Ortega & Buendia, Cryptogamie,
Mycol. 6: 285, 1985. Fics 12-13
Basidiome 13-20 x 10-15 um, subglobose to slightly pyriform; when young,
the exoperidium is reddish in color, later it disintegrates, leaving reddish-brown
scaly remains, exposing an ochraceous endoperidium, shiny and papyraceous in
consistency. Gleba whitish, yellowish to dark chocolate brown, fleshy-alveolate
to powdery in consistency. Subgleba present.
Intermediate type capillitium, hyphae 4-5(-6) um, pores moderately
frequent, wall thin, septate, with dichotomous branching. Paracapillitium
absent. Spores 5-7 x 3-4 um, ellipsoid to cylindrical, verrucose; verrucae
irregularly distributed. Pedicel 1-2.5 um, occasionally up to 8 um.
ECOLOGY & DISTRIBUTION — Gregarious, terricolous in Quercus—Pinus
forest, cloud forest, pastures and coffee plantations at altitudes of 1250-2300 m.
SPECIMENS EXAMINED: MEXICO. PuEBLA: Close to the Ocochiguaya Gorge, E side
of Chignahuapan, July 12, 1975 Herrera, Hernandez, Cruz & Guzman (MEXU 25336).
SONORA: YECORA MUNICIPALITY, km 3.4 along the Yécora- Las Cabafias road, September
12, 1996 M. Esqueda, A. Armenta, A. Nufiez & R. Santos (CESUES 3181); September
13, 1996 (CESUES 3013); Onavas MunIcIPALITY, km 204.5 on the Hermosillo-Yécora
road, October 06, 1995 E. Pérez, T. Herrera, M. Esqueda, A. Armenta, A. Nunez,
R. Rodriguez & R. Santos (CESUES 2107). VERACRUZ: Highway to Fortin, 10 km from
Bovista in Mexico ... 35
Fics. 7-13. Bovista grandipora: 7. Spores. 8. Pitted capillitium. Bovista heterocapilla: 9. Spore under
SEM. 10. Spores under OM x1600. 11. Capillitium and spores under OM x400. Bovista oblongispora
var. longispora: 12. Spores. 13. Pitted capillitium. Scale bars = 1 um.
Huatusco, July 20, 1983 S. Chacon 1189 (XAL); highway to Fortin, Tepampa turnoff, 10
km from Huatusco, July 27, 1983 G. Guzman 23527 (XAL); COATEPEC MUNICIPALITY,
Zoncuantla, close to the road to Coatepec, August 15, 1994 G. Guzman 30930 (XAL).
Comments — For the identification of this species the criteria of Ortega &
Buendia (1985) were applied. They propose that B. longispora and B. oblongispora
36 ... Bautista-Hernandez & al.
are varieties of a single species. They argue that the difference between the two
lies in the respective presence or absence of pores in the capillitium.
In his monograph, Kreisel (1967) treats the two taxa as separate species,
stating that B. longispora has a Lycoperdon type capillitium with pores and
compact subgleba, while B. oblongispora has an intermediate type capillitium,
no pores, and no subgleba.
Bovista oblongispora var. longispora has previously been reported from
Mexico as B. longispora (Calonge et al. 2004b; Esqueda et al. 1996; 1998 and
Pérez-Silva et al. 1994).
Bovista oblongispora (Lloyd) Bottomley, Bothalia 4(3): 580, 1948
var. oblongispora Fics 14-15
Basidiome globose to subglobose 17-18 mm in diameter. Exoperidium
formed by small needles separated by approximately 0.5 mm, comprised of
hyphae and sphaerocysts; endoperidium brown in color to dark chocolate
brown, membranous. Gleba powdery, yellowish-brown to dark brown in color.
Subgleba yellowish-brown, compact.
Intermediate type capillitium, hyphae 6-7(-8) um, pores absent, wall thin,
dichotomous branching. Paracapillitium absent. Basidiospores 5-7 x 2.5-3
um, oblong to ellipsoid, verrucose, with a regular longitudinal arrangement.
Pedicel 0.5 um, hyaline.
ECOLOGY & DISTRIBUTION — Solitary, terricolous in cloud forest at an
altitude of 1300 m.
SPECIMEN EXAMINED: MEXICO. VERACRUZ: XALAPA MUNICIPALITY, km 2.5 on the
Xalapa-Coatepec Old Highway, Francisco Javier Clavijero Botanical Garden, May 14,
2005 Gandara 1268 (XAL).
ComMENTs — ‘his variety can be distinguished from B. oblongispora var.
longispora by the absence of pores and the generally predominant ellipsoid
shape of the spores. This is the first record for Mexico.
Bovista pusilla (Batsch) Pers., Syn. Meth. Fung. 1: 138, 1801. Fics 16-17
SPECIMENS EXAMINED: MEXICO. JALISCO: ZAPOTLAN EL GRANDE MUNICIPALITY, the
foothills of Nevado de Colima, Las Viboras track, Floripondio, June 27, 1999 Montoya-
Fuentes 14 (IBUG). Estapo DE MExico: La Marquesa, October 18, 1976 A. Gonzdlez
(FCME 496); NauUCALPAN MuNICcIPALITY, Los Remedios, October 7, 1956 T. Herrera &
O. Sanchez (MEXU 1416). SonorA: YECORA MunIcIPALiTy, km 258 on the highway
from Hermosillo to Yécora, October 5, 1995 E. Pérez-Silva, T. Herrera, M. Esqueda,
A. Armenta, A. Nufiez, R. Rodriguez & R. Santos (CESUES 2073).
Comments — For B. pusilla, we do not follow the species concept of Kreisel
(1967), who characterizes this species by small basidiomes with a Lycoperdon-
type capillitium and non-pedicellate spores, characters not seen in the recently
examined material. Larsson et al. (2009) amply discuss the taxonomic,
Bovista in Mexico ... 37
Fics. 14-19. Bovista oblongispora var. oblongispora: 14. Spores under SEM. 15. Spores under OM
1000. Bovista pusilla: 16. Spores under SEM. 17. Spores under OM x1000. Bovista sempervirentium:
18. Spores. 19. Pitted capillitium. Scale bars = 1 um.
ecological, and phylogenetic aspects of B. pusilla that were considered in the
determination of the studied materials: finely warted spores of 4.5-5.5 um,
pedicels of 3-9 um, heteromorphic capillitium, a temperate distribution, and
an association with mosses. These characteristics totally match the studied
material.
Following Kreisel’s (1967) concept, B. pusilla has been cited from seven
Mexican federative entities (Guzman & Herrera 1969; 1973; Rodriguez &
Herrera 1970; Urista et al. 1985; Esqueda et al. 1990; 1996; Pérez-Silva et al.
1994); but following the criteria of Larsson et al. (2009), this species is known
only from the states of Mexico, Jalisco, and Sonora.
38 ... Bautista-Hernandez & al.
Worldwide, B. pusilla sensu Kreisel (1967) is widely distributed in Europe
and America and sensu Larsson et al. (2009) is registered from the northern
Europe region.
Bovista sempervirentium Kreisel, Beih. Nova Hedwigia 25: 107, 1967. Fics 18-19
Basidiome 10-20 mm in diameter, globose. Exoperidium formed by
small furfuraceous verrucae, comprised of hyphal elements. Endoperidium
pseudopapyraceous, ochre-brown in color. Gleba is olive brown. Subgleba
compact.
Intermediate type capillitium, hyphae 4-5 um, with small pores, without
septa or pseudosepta. Paracapillitium absent. Spores 3.5-5 um, globose,
verruculose, with a short pedicel.
ECOLOGY & DISTRIBUTION — Solitary, terricolous in Abies and Pinus forest,
although Kreisel (1967) reported it for a Quercus virginiana forest.
SPECIMENS EXAMINED: MEXICO. DistRITO FEDERAL: Los Leones Desert, July 02, 1950
T. Herrera (MEXU 1438). Estapo DE MExico: El Carmen Hill, Chimalpa, October 28,
1956 T. Herrera & O. Sanchez (MEXU 1430).
ComMENTS — The examined specimens match B. sempervirentium as described
by Kreisel (1967): they have an intermediate type capillitium with small pores
but without septa or pseudosepta, verruculose spores with a short pedicel, an
exoperidium composed of hyphal elements, and a subgleba.
The species has been reported only for the United States of America (Kreisel
1967), thus this is the first record for Mexico, specifically for the Distrito Federal
and the Estado de México.
Subgenus Bovista
Bovista brunnea Berk., Fl. Nov.-Zel. 2: 189, 1855. Fics 20-21
SPECIMENS EXAMINED: MEXICO. DistRITO FEDERAL: Los Leones Desert, July 10, 1949
M. Ruiz-Oronoz e& T. Herrera (MEXU 1418). VERACRUZ: Las ViGAsS MUNICIPALITY,
Surroundings of El Volcancillo, SW of Encino Gacho, Xalapa-Perote road, November
30, 1991 F. Tapia 922 (XAL).
ComMENTS — ‘This species is characterized by Bovista type capillitium with
pores and no septa and a hyphal-vesiculate exostratum. An exoperidium was
not observed in the examined material; only some amorphous structures could
be seen, possibly owing to the weathering of the specimen. Bovista brunnea
is placed in the Globisporae series, which also includes B. echinella Pat.,
B. verrucosa (G.H. Cunn.) G.H. Cunn., and B. leucoderma. Bovista echinella is
distinguished by a hyphal exostratum and a thin papyraceous endoperidium,
B. verrucosa has a distinctive mycelial cord, and B. leucoderma has a white
exoperidium that forms small plates on the endoperidium and a capillitium
with infrequent septa.
Bovista in Mexico ... 39
Fics S. 20-23. Bovista brunnea: 20. Spores under OM x500. 21. Capillitium and spores x600.
Bovista fusca: 22. Spores. 23. Capillittum under OM x100. Scale bars = 1 um.
Herrera (1959) mistakenly cited B. brunnea for the Estado de México but
later redetermined the collection as B. dealbata [= B. leucoderma] (Herrera
1964, Guzman & Herrera 1969), and thus the B. brunnea record for the state
must be discarded. The only authentic previous record from Mexico is from
Veracruz (Calonge et al. 2004b).
Bovista fusca Lév., Ann. Sci. Nat., Bot., sér. 3, 5: 303, 1846. Figs 22-23
REPRESENTATIVE SPECIMENS EXAMINED (total collections = 103): MEXICO.
DIsTRITO FEDERAL: Monte Alegre, Ajusco Mountains, September 20, 1980 E. Aguirre
(MEXU 17044). DURANGO: PUEBLO NuEVo MuniciPa.ity, Las Bayas Property, Los
Otates stream, July 16, 2009 S. Bautista & E. Aguirre (MEXU 26301). GUERRERO:
CHICHIHUALCO MuNICIPALITY, km 8.5 between El Carrizal and Atoyac, M. Robledo 61
July 12, 1980, (FCME 986). H1ipAeo: Piedras Voladas, Real del Monte, June 13, 1982 E.
Pérez-Silva & R. Hernandez (MEXU 17282). JALISCO: CIUDAD GUZMAN MUNICIPALITY,
Nevado de Colima Mountain foothills, El Floripondio, September 25, 1992 V. Chaparro
3 (IBUG, MEXU 25378). EsTADO DE MEXxICco: JALATLACO MUNICIPALITY, km 13.5
on the Jalatlaco-El Ajusco Highway, August 4, 1986 A. Calderén & E. Aguirre (MEXU
21594). MICHOACAN: Mariposa Monarca Sanctuary, near Angangueo, February 5, 1981
S. Acosta 584 (ENCB). MoRELOs: Zempoala Lagoons, July 27, 1985 A. Calderén (MEXU
19857). OAXACA: 3 km SE of Plan de Guadalupe, La Cafiada, June 13, 1991 Pérez-Silva et
AO ... Bautista-Hernandez & al.
al. (MEXU 22788). PUEBLA: CHIGNAHUAPAN MUNICIPALITY, Apizaco-Chignahuapan
Highway, Cieneguilla Larga, July 13, 2000, F. Tapia 2050 (XAL). TLAxcaLa: San
Salvador, November 13, 1983 C. Martinez (IZTA 2540). VERACRUZ: RAFAEL LUCIO
MuNICcIPALITY, Santa Barbara Farm, 10 km NE of the Xalapa-La Joya Highway, July 8,
1998 F. Ramirez-Guillén 100 (XAL).
ComMENTS — This species is characterized macroscopically by a papyraceous
shiny peridium, especially in mature specimens; on maturing the basidiomes
separate easily from the substrate. Macroscopically it can be confused with
B. graveolens, however the difference lies mainly in the shape of the pedicels.
Some authors have confused B. fusca with B. nigrescens Pers. (Calonge et al.
2004b), although that species occurs only in Europe; Calonge et al. (2005)
verified that the XAL specimens earlier identified as B. nigrescens represent
instead B. fusca.
Observed in some of the examined specimens were clamp connections on
brown dichotomously branching hyphae with thin walls and thin-walled septate
ochraceous hyphae with projections shaped like small tubercles interspersed in
the capillitium. Additionally, the pedicel surface appears smooth under the OM
but rough and wrinkly with the SEM. It is notable that these details have not
been reported in previous studies, although these are not diagnostic, with the
exception of the pedicel, which is unique to B. fusca.
The taxonomy of B. fusca is complex and not very clear, because the material
examined, particularly in the collections of young specimens, was easily
confused with Lycoperdon basidiomes, given that they have a rigid granulose-
squamulose peridium. As mentioned previously, B. fusca specimens are easily
confused with other taxa precisely because our knowledge of this species is so
scarce. Herrera (1959) described Mexican material as a new species, B. ruizii,
which Kreisel (1967) synonymized with B. fusca.
The widely distributed B. fusca is very common in Méxicos temperate forests
and has been recorded for Aguascalientes (Pardavé 1991 [as B. ruizii]), Distrito
Federal, Estado de México (Kreisel 1967), and Chihuahua (Moreno et al. 2010).
This study extends its range to the states of Durango, Guerrero, Hidalgo, Jalisco,
Michoacan, Morelos, Oaxaca, Puebla, Tlaxcala and Veracruz.
Bovista graveolens Schwalb, Lotos N. F. 13: 53, 1893. Fics 24-25
SPECIMENS EXAMINED: MEXICO. Estapo pe México: La Marquesa-Tenango
Highway, August 18, 1979 E. Pérez-Silva (MEXU 16052); ZINACANTEPEC MUNICIPALITY,
km 17 Zultepec-Nevado de Toluca Highway near the town of Raices, June 18, 1993 A.
Castellanos (IZTA 2536). MICHOACAN: ZINAPECUARO MUNICIPALITY, Los Azufres
long lagoon under forest protection, July 25, 1987 Pompa-Gonzdlez 14 (FCME 13906).
TLAXCALA: 2 km south of the La Malinche hostel, La Malinche Hill, July 19, 1987 G.
Mata 200 (XAL). VERACRUZ: La Joya, El Rodeo, February 18, 1985 S. Chacén 3387 B
(XAL); RAFAEL Lucio MunicIPALity, La Joya in front of the “La cabafia del chivo”
restaurant, July 8, 1987 F. Ramirez-Guillén 102 (XAL); X1co MUNICIPALITY, eastern
Bovista in Mexico ... 41
25
Fics. 24-28. Bovista graveolens: 24. Spores under SEM. 25. Spores under OM x1000. Bovista
leucoderma: 26. Spores. 27. Pitted capillitium. Bovista plumbea: 28. Spore. Scale bars = 1 um.
region of the Cofre de Perote mountain, Los Gallos, 15 km N of the El Rosario sugar
refinery, May 15, 1995 J. Rico 756 (XAL).
COMMENTS — Bovista graveolens is characterized microscopically by the
curved C-shaped pedicels on the majority of its spores that sometimes occur
at the end of a widening corresponding to the basidium wall, although there
are also spores with straight pedicels. The capillitium is very branched and the
secondary hyphae are very long, compared with those of B. fusca. Although this
species is easily confused with B. fusca, because its basidiomes are very similar,
the differences become markedly evident under the microscope.
Bovista graveolens was known only for the state of Tlaxcala (Calonge et al.
2004b), but the present study broadens its distribution to include Estado de
México, Michoacan, and Veracruz.
Bovista leucoderma Kreisel, Feddes Repert. 69: 203, 1964. Fics 26-27
SPECIMENS EXAMINED: MEXICO. Distrito FEDERAL: S. Gonzdlez 97 (ENCB).
H1patGo: Loma Ancha, Marqués Dam, San Bartolo Socalpa, November 06, 1974
42 ... Bautista-Hernandez & al.
R. Cruz (ENCB); OMITLAN DE JUAREZ MUNICIPALITY, Vicente Guerrero Ranch, ahead
of the Real del Monte Mexico-Tampico Highway, short route km 115, July 05, 1986
A. Calderon et al. (MEXU 20142); EPAzoYUCAN PENAS LARGAS MUNICIPALITY, August
03, 1975 M. Medina & I. Garcia 1102 (ENCB); ZEMPOALA MUNICIPALITY, Tepa,
November 20, 1976 J. Baca del Moral (ENCB); San Miguel Regla, August 16, 1980 E.
Pérez-Silva (MEXU 17180). Estapo DE MExico: La Palma Hill, Salazar, October 20,
1957 M. Ruiz-Oronoz (MEXU 141); Between Chalco and Amecameca, September 05,
1965 J. Alvarez (MEXU 19864); km 39 Xochimilco-Oaxtepec Highway, August 24,
1980 E. Fuentes (MEXU 17098); San Pablo Teacalco, NE of Los Reyes, Mexico-Pachuca
Highway, June 30, 1968 J.L. Magaria 38-B (ENCB); Tlamacas, foothills of Popocatépetl,
August 31, 1958 E. Pérez-Silva (MEXU 889); Salazar, October 01, 1961 Herrera,
Zenteno & Riba (MEXU 7805); October 19, 1969 Herrera, Ulloa & Vazquez (MEXU
6772); Purificacién, NE of Texcoco, September 05, 1976 G. Guzman 16482 (ENCB);
TLALNEPANTLA MUNICIPALITY, Guadalupe Lake, September 15, 1968 F. Martinez 61
(ENCB). PuEBLa: Tepeyahualco, May, 1999 L. Mohedano 3 (XAL). VERACRUZ: Foothills
of the Cofre de Perote mountain, October 30, 1982 L. Guzmdn-Davalos 724 (ENCB).
ComMENTS — Bovista leucoderma is mainly characterized by basidiomes with
a white exoperidium that forms small plates in mature specimens. The Bovista
type capillitium contains pores, pseudosepta and true septa.
This species has been cited for the states of Baja California (Ochoa 1993),
Distrito Federal, Hidalgo, Puebla (Guzman & Herrera 1973), and Estado de
México (Kreisel 1967; Guzman & Herrera 1973). Here it is reported for the first
time for the state of Veracruz.
Bovista plumbea Pers., Ann. Bot. (Usteri) 15: 4, 1795. Fic 28
SPECIMENS EXAMINED: MEXICO. Baja CALIFORNIA: Dofia Petra Canyon, N of
Ensenada, January, 1971 S. Guzman del Proo & S. de la Campa (ENCB); El Junco, 15
km NE of Ensenada, February, 1983 N. Ayala 46-B (XAL); Vallecitos, San Telmo to
Observatory of the UNAM road, San Pedro Martir mountains, February 25, 1984 G.
Guzman 24277-A (XAL).
ComMENTs — This species is easily recognized by its white exoperidium which,
when removed, reveals the lead grey endoperidium.
In México, B. plumbea has been recorded only for Baja California (Ochoa
& Moreno 1996, Ochoa et al. 2000); a previous report for Veracruz is
rejected (Calonge et al. 2004b; Ochoa & Moreno 2006) as the cited specimen
(L. Montoya-Bello 698 XAL) has been redetermined to B. fusca. Kreisel (1967)
mentions that B. plumbea is distributed in northern New Zealand and over a
vast region in Europe, Asia, and North America.
Bovista tomentosa (Vittad.) De Toni, Syll. Fung. 7: 97, 1888. Fics 29-32
SPECIMENS EXAMINED: MEXICO. Baja CALIFORNIA: Turnoff at km 55 on the
Ensenada-San Felipe Highway, km 15 road to the Hanson Lagoon, Juarez mountains,
March 2, 1984 Ayala 365; G. Guzmdn 24328-A (XAL). HiDALGo: Surroundings of
San Gregorio, N side of Xihuingo Hill, July 26, 1963 G. Guzman 3875 (ENCB; MEXU
5548); Highway from Pachuca to Venados, turnoff to El Chico, Barranca Oriental, June
Bovista in Mexico ... 43
Fics. 29-32: Bovista tomentosa: 29-31. Spores. 32. Pitted capillitium. Scale bars: 29 = 5 um;
30-32 = 1 um.
24, 1973 G. Guzman 10874 (ENCB). Estapo DE MExico: Satélite City, June 29, 1982
E. Pérez-Silva (MEXU 22489); ZUMPANGO MUNICIPALITY, San Pablo Teacalco, June 30,
1968 E. Quezada-Guzmdn 10 (ENCB).
COMMENTS — Specimens from the XAL herbarium identified as B. minor
Morgan and B. tomentosa by Calonge et al. (2004b) were compared but no
significant microscopic differences were found. Examination of an herbarium
specimen from Belgium identified as B. tomentosa by Demoulin revealed
that the XAL Mexican specimens cited above coincide both macro- and
microscopically with the Belgian material.
Kreisel (1967) placed B. tomentosa (European) and B. minor (North
American) in subg. Globaria sect. Ovisporae because of their ovoid spores and
the Bovista type capillitium with pores. Microscopically, these two species are
very similar, and Kreisel differentiated them based on their depth in the soil: B.
tomentosa has one third of its basidiome immersed in the substrate and grows in
arid dry open regions, while B. minor produces subhypogeous basidiomes with
only the upper part above the soil and grows in humid regions in the shade. We
believe that the relationship between basidiome and substrate is an ecological
character lacking in taxonomic value. Because of the macro- and microscopic
similarities between the two species, we suggest that they are conspecific, with
B. tomentosa as the prior name.
44 ... Bautista-Hernandez & al.
Bovista tomentosa is characterized by the presence of mainly ovoid verrucose
pedicellate spores and a Bovista type capillitium with pores. In some specimens
both the primary and secondary hyphae have pores, while in others only the
secondary hyphae have them.
Bovista tomentosa has been cited for the state of Baja California (Calonge et
al. 2004b). This study extends its distribution range to Estado de México and
Hidalgo.
Acknowledgements
We wish to express our gratitude to Dr. H. Kreisel and Dr. G. Moreno for reviewing
the manuscript and their useful comments. The authors are grateful to the Posgrado
en Ciencias Biolégicas at UNAM, to CONACYT and to PAPIIT IN-218008 and IN-
207311 for the funding awarded to carry out this project; to Berenit Mendoza for taking
the SEM photographs; to the curators of the herbaria: E. Aguirre (MEXU), J. Cifuentes
(FCME), M.L. Coronado (CESUES), I. Frutis (IZTA), G. Guzman (XAL), L. Guzman-
Davalos (IBUG), R. Valenzuela (ENCB) for the loan of material; and to Aldo Gutiérrez
(CIAD) for preparing the plates and formatting the text. Bianca Delfosse translated the
text from the Spanish original.
Literature cited
Calonge FD. 1992. El género Bovista Pers.: Pers. (Gasteromycetes), en la Peninsula Ibérica e Islas
Baleares. Boletin de la Sociedad Micolégica de Madrid 17: 101-113.
Calonge FD. 1998. Flora Micoldégica Ibérica. Vol. 3. Gasteromycetes, 1. Lycoperdales, Nidulariales,
Phallales, Sclerodermatales, Tulostomatales. J. Cramer, Stuttgart. 271 p.
Calonge FD, Kreisel H, Guzman G. 2004a. Bovista sclerocystis, a new species from Mexico.
Mycologia 96: 1152-1154. http://dx.doi.org/10.2307/3762097
Calonge FD, Guzman G, Ramirez-Guillén F. 2004b. Observaciones sobre los Gasteromycetes de
México depositados en los Herbarios XAL y XALU. Boletin de la Sociedad Micoldgica de
Madrid 28: 337-371.
Calonge FD, Mata M, Carranza J. 2005. Contribucidn al catalogo de los Gasteromycetes
(Basidiomycotina, Fungi) de Costa Rica. Anales del Jardin Botanico de Madrid 62: 23-45.
http://dx.doi.org/10.3989/ajbm.2005.v62.i1.26
Coker WC, Couch JN. 1928. The Gasteromycetes of the Eastern United States and Canada.
University of North Carolina Press, Chapel Hill. 201 p.
Demoulin V, Marrito JVR. 1981. Key to the Gasteromycetes of Great Britain. Bulletin of the British
Mycological Society 15: 37-56. http://dx.doi.org/10.1016/S0007-1528(81)80033-8
Esqueda M, Quintero-Ruiz T, Pérez-Silva E, Aparicio-Navarro A. 1990. Nuevos registros de
Gasteromycetes de Sonora. Revista Mexicana de Micologia 6: 91-104.
Esqueda M, Pérez-Silva E, Herrera T, Villegas RE. 1996. Los Gasteromycetes citados de Sonora.
Vinculacién CESUES 1: 3-16.
Esqueda M, Pérez-Silva E, Herrera E, Moreno G. 1998. Adiciones al conocimiento de los
Gasteromicetos de Sonora, México. Revista Mexicana de Micologia 14: 41-52.
Guzman G, Herrera T. 1969. Macromicetos de las zonas aridas de México, II Gasteromicetos. Anales
del Instituto de Biologia de la Universidad Nacional Aut6noma de México 40: 1-92.
Bovista in Mexico ... 45
Guzman G, Herrera T. 1973. Especies de macromicetos citadas de México, IV. Gasteromicetos.
Boletin de la Sociedad Mexicana de Micologia 7: 105-119.
Guzman G, Torres MG, Ramirez-Guillén F, Rios-Hurtado A. 2004. Introduccién al conocimiento
de los macromicetos de Chocé, Colombia. Revista Mexicana de Micologia 19: 33-43.
Herrera T. 1959. Bovista y Scleroderma en el Valle de México. Anales del Instituto de Biologia de la
Universidad Nacional Aut6noma de México 30: 35-57.
Herrera T. 1964. Clasificacion, descripcion y relaciones ecoldgicas de gasteromicetos del Valle de
México. Anales del Instituto de Biologia de la Universidad Nacional Auténoma de México
35(1-2): 9-43.
Homrich MH. 1969. Etude de quelques Gastéromycetes du Rio Grande do Sul. Revue de Mycologie
34: 3-15.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s Dictionary of the Fungi.
10th. International Mycological Institute, CAB International, Wallingford. 771 p.
Kreisel H. 1967. Taxonomisch-Pflanzengeographische Monographie der Gattung Bovista. Beih.
Nova Hedwigia 25. 244 p.
Kriger D, Binder M, Fischer M, Kreisel H. 2001. The Lycoperdales. A molecular approach to the
systematics of some gasteroid mushrooms. Mycologia 93: 947-957.
http://dx.doi.org/10.2307/3761759
Larsson E, Jeppson M, Larsson KH. 2009. Taxonomy, ecology and phylogenetic relationships
of Bovista pusilla and B. limosa in North Europe. Mycol. Progress 8: 289-299.
http://dx.doi.org/10.1007/s11557-009-0599-z
Moreno G, Lizarraga M, Esqueda M, Coronado M. 2010. Contribution to the study of gasteroid
and secotioid fungi of Chihuahua, Mexico. Mycotaxon 112: 291-315.
http://dx.doi.org/10.5248/112.291
Ochoa C. 1993. Contribucién al estudio taxondmico, ecoldgico y corolégico de la clase
Gasteromycetes sensu lato en Baja California, México. PhD Dissertation. Universidad de Alcala
de Henares, Espafia.
Ochoa C, Moreno G. 1996. Gasteromycetes de la reserva de la biosfera, Alto Golfo de California. I.
México. Brenesia 45-46: 143-152.
Ochoa C, Moreno G. 2006. Hongos gasteroides y secotioides de Baja California, México. Boletin de
la Sociedad Micoldgica de Madrid 30: 121-166.
Ochoa C, Moreno G, Altés A, Aguilar-Rodriguez JL. 2000. Gasteromycetes de Sierra Juarez (Baja
California, México). I. Boletin de la Sociedad Micoldgica de Madrid 25: 157-166.
Ortega A, Buendia AG. 1985. Estudio de algunas especies con esporas oblongas del género Bovista
Pers. Cryptogamie Mycologie 6: 281-288.
Pardavé LM. 1991. Gasteromicetos del estado de Aguascalientes. Revista Mexicana de Micologia
7: 71-77.
Pérez-Silva E, Esqueda M, Herrera T. 1994. Contribucién al conocimiento de Gasteromicetos de
Sonora, México. Revista Mexicana de Micologia 10: 77-101.
Pegler DN, Laessoe T, Spooner BM. 1995. British puffballs, earthstars and stinkhorns. Royal
Botanic Gardens, Kew. 265 p.
Rodriguez M, Herrera T. 1970. Algunas especies de Lycoperdaceae de México. Boletin de la Sociedad
Mexicana de Micologia 4: 5-19.
Salcedo J, Herrera T. 1966. Distribucion de los gasteromicetos del Valle de México en otras regiones
del mundo. Anales del Instituto de Biologia de la Universidad Nacional Aut6noma de México
37: 43-70.
46 ... Bautista- Hernandez & al.
Smith AH. 1951. Puffballs and their allies in Michigan. University of Michigan Press, Ann Arbor.
131 p.
Trierveiler-Pereira L, Kreisel H, Baseia IG. 2010. New data on puffballs (Agaricomycetes,
Basidiomycota) from the Northeast Region of Brazil. Mycotaxon 111: 411-421.
http://dx.doi.org/10.5248/111.411
Urista E, Garcia J, Castillo J. 1985. Algunas especies de Gasteromicetos del norte de México. Revista
Mexicana de Micologia 1: 471-523.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.47
Volume 118, pp. 47-52 October-December 2011
Subulicystidium curvisporum sp. nov. (Hymenochaetales,
Basidiomycota) from the Patagonian Andes
SERGIO P. GoRjJON™?, ALINA G. GRESLEBIN’” & MARIO RAJCHENBERG’”
'Centro de Investigacion y Extension Forestal Andino Patagonico,
Area de Proteccién. CC 14, 9200 Esquel, Chubut, Argentina
?Consejo Nacional de Investigaciones Cientificas y Técnicas (CONICET) Argentina
*CORRESPONDENCE TO: [email protected]
ABSTRACT — Subulicystidium curvisporum is described as a new species from the Patagonian
Andes forests. It differs from its closest related species, S. longisporum and S. perlongisporum,
in considerably longer and characteristically curved basidiospores. A key to all known
Subulicystidium species is included, and the new species is compared with other species in
the genus.
Key worps — Argentina, corticioid fungi, Nothofagus dombeyi, Patagonia, taxonomy
Introduction
The genus Subulicystidium Parmasto comprises 9 described species (Duhem
& Michel 2001, Parmasto et al. 2004). Subulicystidium is an easily distinguished
genus characterized above all by the distinctive cystidia encrusted with
rectangular crystals arranged crosswise to the main axis (“two rows of “ribbon-
like” structures,’ Julich 1975), the presence of repetobasidia, and by the
cylindrical to acicular basidiospores sharing a more or less vermiform shape.
Molecular studies by Hibbett & Binder (2002) and Larsson et al. (2004) show
that Subulicystidium is closely related to Tubulicium vermiferum (Bourdot)
Oberw. ex Jiilich, and both are included in the trechisporoid clade next to other
Trechispora P. Karst. species, even if they do not share the same morphological
and ecological characters.
As a result of collecting trips in the Patagonian Andes forests of southern
Argentina, we have found growing on Nothofagus dombeyi (Mirb.) Oerst.
(Nothofagaceae)aSubulicystidiumspecieswithlongacicularandcharacteristically
curved basidiospores, distinct from previously described species, which we
propose as new below. Some species in Tulasnella J. Schrét. have spirally curved
48 ... Gorjén, Greslebin & Rajchenberg
basidiospores that often produce secondary spores by replication, but basidia
are differentiated by the large globose to clavate sterigmata. We considered the
possibility that a Tulasnella species inhabited the same substrata where the
Subulicystidium grew, but we have not found any trace of a tulasnelloid fungus.
Tulasnella helicospora Raunk., although somewhat inconspicuous, clearly differs
in the grayish pruinose basidiome, more variably shaped wider basidiospores
with homogeneous oily contents that germinate secondary spores, and typical
basidia with obclavate distally tapered sterigmata.
Material & methods
For light microscopic studies, samples were mounted in 3% potassium hydroxide
(KOH), Melzer’s reagent (IKI), and 0.1% cotton blue in 60% lactic acid to determine
cyanophily of basidiospores. The term Q expresses the ratio Length/Width of the
basidiospore size. Line drawings were made with a camera lucida attachment. Specimens
are deposited in the herbarium of the “Centro de Investigacién y Extension Forestal
Andino-Patagonico” (CIEFAP, Esquel, Argentina), BAFC, and SALA.
Taxonomy
Subulicystidium curvisporum Gorjon, Gresl. & Rajchenb., sp. nov. PLATES 1,2
MycoBank MB 561691
Ab Subulicistidium longisporum et Subulicistidium perlongisporum differt basidiosporae
longioribus et recurvis.
Ho.otypus: Argentina, Chubut, Los Alerces National Park, Alerzal milenario
(42°36'34"S 71°53'28"W), 530 m a.s.l., on decayed wood of Nothofagus dombeyi, 3 May
2010, leg. S.P.Gorjon coll. 2689. Holotype, BAFC; isotypes, SALA and herbarium of
Centro de Investigacién y Extensién Forestal Andino-Patagonico.
ETyMOLoGy: curvisporum, Latin, referring to the curved shape of the basidiospores.
BASIDIOMATA annual, fragile, resupinate, effused, arachnoid, smooth and finely
velutinous due to the protruding cystidia, white to light grey, margin abrupt.
HYPHAL SYSTEM monomitic, generative hyphae with clamps, thin- to thick-
walled, 3-4 um wide, smooth or encrusted with amorphous hyaline material.
CYSTIDIA numerous, subulate, 70-80(-100+) x 3-4 um, projecting 60-80 um
above the basidia, encrusted over all the length, except in the smooth apical
part, with rectangular crystals circularly to spirally arranged along the cystidial
wall. BAsIDIA urniform, basally clamped, some of them repetitive, thin-walled,
12-15 x 5-7 um, with 4 stout sterigmata. BASIDIOSPORES long acicular, spirally
curved, with a vermiform shape, smooth, thin-walled, (25-)27-35(-38) x
(1.8-)2-2.5(-2.8) um, inamyloid, nondextrinoid, acyanophilous, guttulate
(Plates 1, 2).
DISTRIBUTION AND EcoLocy —Subulicystidium curvisporum is only
known from the Patagonian Andes forest of Argentina (Valdivian rainforest).
Subulicystidium curvisporum sp. nov. (Argentina) ... 49
PiatE 1. Subulicystidium curvisporum.
Hymenial elements— a) basidiospores, b) basidia, c) cystidia, d) generative hyphae.
coll. S.P.Gorjén 2689, holotype.
50 ... Gorjén, Greslebin & Rajchenberg
PLATE 2. Subulicystidium curvisporum. Basidiospores,
coll. S.P.Gorjén 2689, holotype.
Subulicystidium curvisporum sp. nov. (Argentina) ... 51
It grows on decayed wood of Nothofagus dombeyi, an endemic southern
South American perennial hardwood, in cold rainforests mixed with Fitzroya
cupressoides (Molina) I.M. Johnst. (Cupressaceae), Luma apiculata (DC.) Burret
(Myrtaceae), and Chusquea culeou E. Desv. (Poaceae).
ADDITIONAL SPECIMENS EXAMINED — Subulicystidium curvisporum. ARGENTINA.
Cuusvut: Los Alerces National Park, Alerzal milenario, on decayed wood of N. dombeyi,
3 Mar 2011, leg. S.P.Gorjon, SPG 3023.
Subulicystidium longisporum. ARGENTINA. TIERRA DEL FUEGO: Depto. Ushuaia,
Estancia El Valdez, on dead wood of Nothofagus betuloides and N. pumilio, 4 Mar 1996,
leg. A. Greslebin, AG 340, 382; Monte El Martial, on N. pumilio, 28 Mar 1998, leg.
M. Rajchenberg, MR 11564. CHILE. X REGIon: Puyehue, Entre Lagos, close to Gol-Gol
river bridge, on decayed wood of N. dombeyi, 21 Feb 2010, leg. N. Hallenberg & S.P.
Gorjon, SPG 2600.
Tulasnella helicospora. ARGENTINA. Rio NEGRO: Mallin Ahogado, El Guadal, on
bark of fallen trunk of Austrocedrus chilensis (D. Don) Pic.Serm. & Bizarri (Cupressaceae),
5 Sep 1995, leg. M. Rajchenberg, MR 11015.
ComMENTS — Subulicystidium curvisporum belongs to the group of
Subulicystidium species with long filiform to acicular basidiospores with a
Q > 4. Among them, Subulicystidium longisporum (Pat.) Parmasto, a common
globally distributed species, has the shortest basidiospores with a Q = 4-7. The
closest related species seems to be Subulicystidium perlongisporum Boidin &
Gilles (known from Réunion Island, Tropical Africa, Japan, France, and the
Caucasus) with smaller and straight basidiospores (Boidin & Gilles 1988).
Subulicystidium cochleum Punugu, known from St. Lucia in the Lesser Antilles,
has smaller basidiospores with the distal end slightly folded back or twisted
and curved; S. cochleum differs also in the cystidial ornamentation composed
of long acicular crystals arranged in a cylinder and restricted to the middle part
(Punugu et al. 1980). The remaining species —S. allantosporum Boidin & Gilles,
S. brachysporum (P.H.B. Talbot & V.C. Green) Jiilich, S. meridense Oberw.,
S. naviculatum Oberw., S. nikau (G. Cunn.) Jilich, S. obtusisporum Duhem & H.
Michel— have differently shaped basidiospores, usually reniform or cylindrical
to fusiform and with a Q<4. Limits between some Subulicystidium species are
unclear, and spore size frequently overlaps. As Liberta (1980) already stated, it
is likely that some species belong to a single species complex.
Key to Subulicystidium
bg, Basidiospores were mals Crt. ra.87. a8, OE LAN Oe lee OR Ao OR Oe OR al gt ee alas 2.
1b. Basidiospores fusiform, cylindrical to reniform, Q <4 ................0. 0. eee 5
2a. Basidiospores (9-)12-16(-18) x (1.8-)2-3 um, Q = 4-7 .......... S. longisporum
2beBasidiospores longer es >O8 x31 OR vgs eta Aye et RG NO Ree, AS Rn REA 3
3a. Basidiospores spirally curved, (25-)27-35(-38) um long ......... S. curvisporum
3b. Basidiospores straight or only slightly curved, shorter ....................000. 4
52 ... Gorjon, Greslebin & Rajchenberg
4a. Basidiospores 20-27 x 2-3 um, cystidial encrustation restricted to the middle part
OP ENE CY StI IN Bassa octet tie Nee ete sible sary alle dter tls bap y either tags alla S. cochleum
4b. Basidiospores 16-25 x 1.5-2.3 um, cystidia encrusted over the entire length
SER ae aa UN eta, ge Aha mie A E airet eN Giowl oe el S. perlongisporum
Hake BasicOspores 4a 5 ih WA S:ion A eh MO aM Oo! Ml LAAN Ula! Met MOL CBE So} 6
bb; Basidiospores ups tO Ag Wale... 2 liste. -a tists, ea tidteer att ber 3 ti ber gLite A Bea nes 7
6a. Basidiospores navicular, 10-12 x 4.5-5 um ........ eee eee eee S. naviculatum
6b. Basidiospores phaseoliform, 7-9.2 x 4-5 UM .... 2... eee eee eee eee S. nikau
7a. Basidiospores :(2;5=)3—4-ymk Wide... 5 ios ete kb ec Ed eee hd eee tie gene to 8
7beBasidigsporesO=2. 5a )auim Wide 37 eia.ct fist det we) eee Bh ee 9
8a. Basidiospores shorth cylindrical, 6-8 x 3-3.6 um.............. S. allantosporum
8b. Basidiospores cylindrical to fusoid, slightly curved,
(9-)11-13(-15) x (2.5-)3-4 um oo. eee eee ee S. obtusisporum
9a. Basidiospores cylindrical, 6.5-8.5 x 2.2-2.5 um .............. 000 S. meridense
9b. Basidiospores cylindrical to fusiform or banana-shape,
O.5e725-10 X22 (HS. See eh a uh 3 og ok gh aig S. brachysporum
Acknowledgments
Drs. Harold H. Burdsall, Jr. and Nils Hallenberg acted as pre-submission reviewers.
The Consejo Nacional de Investigaciones Cientificas y Técnicas (CONICET, Argentina)
supported this research through PIP 80101000. Sergio Pérez Gorjén is a postdoctoral
research fellow of the Agencia Espafiola de Cooperacién Internacional (MAEC-
AECID).
Literature cited
Boidin J, Gilles G. 1988. Basidiomycétes Aphyllophorales de Vile de la Réunion XII - le genre
Subulicystidium Parmasto. Bulletin de la Société Mycologique de France 104(3): 191-198.
Duhem B, Michel H. 2001. Contribution a la connaissance du genre Subulicystidium Parmasto
1968 (Basidiomycota, Xenasmatales). Cryptogamie, Mycologie 22(3): 163-173.
Hibbett DS, Binder M. 2002. Evolution of complex fruiting-body morphologies in homo-
basidiomycetes. Proceedings of the Royal Society of London 269: 1963-1969.
http://dx.doi.org/ 10.1098/rspb.2002.2123
Julich W. 1975. Studien an Cystidien. I. Subulicystidium Parm. Persoonia 8: 187-190.
Larsson KH, Larsson E, Koljalg U. 2004. High phylogenetic diversity among corticioid
Homobasidiomycetes. Mycological Research 108(9): 983-1002.
http://dx.doi.org/10.1017/S0953756204000851
Liberta AE. 1980. Notes on the genus Subulicystidium. Mycotaxon 10: 409-412.
Parmasto E, Nilsson RH, Larsson KH. 2004. Cortbase version 2. Extensive updates of a
nomenclatural database for corticioid fungi (Hymenomycetes). Phyloinformatics 1: 5.
Punugu A, Dunn MT, Welden AL. 1980. The peniophoroid fungi of the West Indies. Mycotaxon
10(2): 428-454.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/118.53
Volume 118, pp. 53-56 October-December 2011
New records of smut fungi. 4. Microbotryum coronariae comb. nov.
CVvETOMIR M. DENCHEV & TEODOR T. DENCHEV
Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Sciences,
2 Gagarin St., 1113 Sofia, Bulgaria
* CORRESPONDENCE TO: [email protected]
AxsstRAcT — For Ustilago coronariae on Lychnis flos-cuculi, a new combination in
Microbotryum, M. coronariae, is proposed. It is reported as new to Bulgaria.
Key worps — Microbotryaceae, taxonomy
Introduction
A new combination in Microbotryum, M. coronariae, is proposed for Ustilago
coronariae on Lychnis flos-cuculi.
Material & methods
Dried specimens from SOMF and (on loan) BP, BPI, COLO, DAOM, FH, H, ILL,
ILLS, ISC, KRAM, M, KSC, MICH, NY, and W were examined under light (LM) and
scanning electron (SEM) microscopes. For LM observations, spores were mounted
in lactophenol solution on glass slides, gently heated to boiling point to rehydrate the
spores, and then cooled. Spore measurements are given in the form: min-max (extreme
values, if necessary) [mean + 1 standard deviation]. The total number of spores (n) from
all collections (x) measured are given in the form ‘(n/x). For SEM, spores were attached
to specimen holders by double-sided adhesive tape and coated with gold with an ion
sputter. The surface structure of spores was observed at 10 kV and photographed with a
JEOL SM-6390 scanning electron microscope.
Taxonomy
Liro (1924) described Ustilago coronariae as a species morphologically
identical with U. dianthorum Liro, U. lychnidis-dioicae Liro, and U. stellariae
(Sowerby) Liro but with a narrow specialization on Coronaria flos-cuculi (L.)
A. Braun (currently Lychnis flos-cuculi). Using artificial infections with Ustilago
coronariae, Liro (1924: 319) demonstrated that the following caryophyllaceous
plants were not hosts: Agrostemma githago L., Dianthus deltoides L., Lychnis
54 ... Denchev & Denchev
chalcedonica L., Silene dioica (L.) Clairv. (as Melandrium rubrum), Silene latifolia
subsp. alba (Mill.) Greuter & Burdet (as Melandrium album), Silene nutans L.,
Silene vulgaris (Moench) Garcke (as S. inflata), Stellaria graminea L., Stellaria
holostea L., and Viscaria vulgaris Bernh. Later, Ustilago coronariae was reduced
to a synonym of Ustilago violacea and, after its transfer to Microbotryum, to
M. violaceum s. lat. (cfr Vanky 1994: 156). Based on physiological (Liro 1924)
and molecular phylogenetic (Le Gac et al. 2007, Refrégier et al. 2008, Devier
et al. 2010) inferences, we propose that Ustilago coronariae be transferred to
Microbotryum as an independent species.
Microbotryum coronariae (Liro) Denchev & T. Denchev, comb. nov. FIGs 1-2
MycoBank MB 561573
= Ustilago coronariae Liro, Annales Academiae Scientiarum Fennicae, Ser. A
17(1): 38, 1924. — Lectotype on Coronaria flos-cuculi (design. by Lindeberg
1959: 142), Finland, Regio aboénsis, Turku [Abo], 11 July 1916, J.I. Liro &
E. Kitunen; isolectotypes in Liro, Mycoth. fennica, no. 347.
SorI in anthers. SPORE MASS powdery, dark livid, dark purple or dark
vinaceous (based on the Rayner (1970) colour chart). Spores mainly globose
or subglobose, sometimes broadly ellipsoidal or ovoid, 6.5-10(-11) x 5.5-9.5
[7.7 + 0.7 x 7.2 + 0.6] um (n/,,=1750); spore wall reticulate, 6-8 meshes per
spore diameter, meshes irregularly polygonal, (0.5-)0.7-1.4(-1.6) um long; in
SEM interspaces smooth.
SPECIMENS EXAMINED — On Lychnis flos-cuculi L.: BULGARIA, Mt. Vitosha, near
Chouypetlyovo, 1250 m, 24 July 1992, C.M. Denchev (SOMF 29192); EstrontA, island
Saaremaa, 1899, T. Vestergren (as U. violacea, DAOM 215227); FAEROE ISLANDS, Kals6,
5 August 1897, J. Hartz & C. Ostenfeld (as U. coronariae, H); FINLAND, Ab, isolectotype,
Mycoth. fennica, no. 347 (H); Ab, Turku, Katariinan laakso, 11 July 1916, E. Kitunen
& J.I. Liro (as U. coronariae, H); N, Vantaa, Tikkurila, 21 June 1919, A. Rainio (as U.
violacea, H); Satakunta, Kankaanpaa, Kunintaanlahde, 8 August 1935, M. Laurila (as U.
coronariae, H); Satakunta, Ylane, Elijarvi, Vastalahti, 60°54’ N, 17 July 1950, L.E. Kari (as
U. violacea, Fungi exs. fennici, no. 710, MICH, NY, W 8496); Tb, Jyvaskyla, Vuoritsalo, 7
July 1916, K. Linkola (as U. coronariae, H); FRANCE, 30 May 1880, N. Patouillard (as U.
antherarum, FH); GERMANY, Bayern, Bez. Kelheim, Ulrain, 12 June 1940, E. Eichhorn
(as U. coronariae, M); Nordrhein-Westfalen, Kr. Siegen, Freudenberg, 17 June 1934, A.
Ludwig (as U. coronariae, BPI 159712, FH); Brandenburg, Berlin, Rahnsdorf, 16 June
1935, Fahrendorff (as U. coronariae, M, W 8999); Genshagen s. Berlin, 23 June 1899, P.
Sydow (as U. violacea, Sydow, Ustilag., no. 214, FH, KSC, M, NY); Mellen bei Zossen, 9
June 1905, P. Sydow (as U. violacea, Sydow, Mycoth. german., no. 367, COLO F-6367, FH
1094144, ILL 17344, M, MICH; the host plant wrongly given as Viscaria vulgaris); Kr.
Teltow, Trebbin, April 1946, W. Lempke (as U. coronariae, BPI 159710); LATVIA, prov.
Vidzeme, Triedaine, 16 July 1932, A. Kirulis (as U. coronariae, BPI 159709, ILLS 23414);
NETHERLANDS, Wageningen, 26 June 1923, J.I. Liro (as U. violacea, H); POLAND,
Leknica (on the label as “Muskau, Lugknitz”; cfr Scholz & Scholz 1988: 231), June 1891,
P. Sydow (Sydow, Mycoth. march., no. 3222) (as U. violacea, BP 3033, NY); Dabroszyn
(formerly German Tamsel), 28 June 1925, P. Vogel (as U. coronariae, Sydow, Mycoth.
german., no. 2290, BPI 159708, COLO F-8290, FH 1095112, ISC 371037, MICH, W
922); “Warthewiesen bei Tamsel’, 28 June 1925, P. Vogel (as U. violacea f. sp. lychnidis-
Microbotryum coronariae comb. nov. ... 95
Fics 1-2. Spores of Microbotryum coronariae on Lychnis flos-cuculi in SEM (Isolectotype, H).
Scale bars: 1 = 10 um; 2 = 1 um.
flos-cuculi, Zillig, Ustilag. Europ., no. 59, M, W 10982); ditto, June 1926, P. Vogel (as
U. coronariae, Petrak, Mycoth. gener., no. 1077, BPI 159713); Kérnik prope Poznan,
June 1927, A. Wrdblewski (Wroblewski et Siemaszko, Fungi polon. selec. exs., no. 7,
KRAM-F 2964); Russta, Karelia, Kpocc, Iso-Keilak, 1 August 1896, Bergroth & J.I. Liro
(as U. coronariae, H); Karelia, Kpor, Jernema - Somba, 17 August 1899, J.I. Liro (as U.
coronariae, H); Karelia, Kpor, Prilug - Siftuga, 12 August 1899, J.I. Liro (as U. coronariae,
H); Karelia, Kpor, Tamitsa, 26 July 1899, J.I. Liro (as U. coronariae, H); Karelia, K],
Kankala, ad rivulum lacuum Valkialampi et Parijarui, 1 August 1935, M. Laurila
(as U. coronariae, H); Sieverskaja, prov. Petropolitanae, 6/18 June 1898, Tranzschel
(Jaczewski, Komarov & Tranzschel, Fungi rossiae exs., no. 207) (as U. violacea, FH, NY);
Mikhaylovskoe, Moskow Gubernia, 28 June 1917, FE Bucholtz (as U. violacea, FH, NY);
SWEDEN, prope Stockholm, 20 June 1883, E. Eriksson (as U. violacea, Eriksson, Fungi
paras. scand. exs., no. 153a, NY); Ostergétland, Gryt parish, Korsudden, 16 July 1957,
J.A. Nannfeldt, no. 14874 (as U. violacea, Fungi exs. suecici, no. 3017, W 13061); Ol,
Stara Rév., June 1900, G. Lagerheim (as U. violacea, FH, H); Ramsasa, 28 June 1929,
H. Christoffersson (as U. coronariae, H); SWITZERLAND, Canton de Vand, Emrions de
Leysiu, 11 July 1917, E. Mayor (as Ustilago coronariae, BPI 159 711).
DISTRIBUTION — On Caryophyllaceae: Lychnis flos-cuculi, Europe (Austria, Bulgaria,
Czech Republic, Estonia, the Faeroes, Finland, France, Germany, Latvia, Lithuania, the
Netherlands, Poland, Romania, Russia, Slovakia, Spain, Sweden, Switzerland, UK) (Liro
1924; Savulescu 1957; Lindeberg 1959; Ignatavicitité 1975, 2001; Mordue & Ainsworth
1984; Vanky 1985; Zogg 1986; Scholz & Scholz 1988; Karatygin & Azbukina 1989;
Almaraz 2002; Zwetko & Blanz 2004; Legon et al. 2005; etc.). The smut is reported here
as new to Bulgaria.
56 ... Denchev & Denchev
Acknowledgements
We gratefully acknowledge Dr Kalman Vanky (Herbarium Ustilaginales Vanky,
Tubingen, Germany) and Dr Roger G. Shivas (Agri-Science Queensland, Australia) for
critically reading the manuscript and serving as pre-submission reviewers, and curators
of the herbaria (listed in Material & methods) for loans of the cited specimens. The
financial support from the Bulgarian National Science Fund (grant no. DO 02-181/2008)
is gratefully acknowledged.
Literature cited
Almaraz T. 2002. Bases coroldgicas de flora micolégica Ibérica. Numeros 1766-1932, in F Pando &
J.C. Hernandez (eds), Cuadernos de trabajo de flora micoldgica Ibérica 17: 1-124.
Devier B, Aguileta G, Hood ME, Giraud T. 2010. Using phylogenies of pheromone receptor
genes in the Microbotryum violaceum species complex to investigate possible speciation by
hybridization. Mycologia 102: 689-696. http://dx.doi.org/10.3852/09-192
Ignataviciuté M. 1975. The smut fungi of the Baltic Region. Mintis, Vilnius. 278 pp. (In Russian)
Ignataviciuteé M. 2001. Ustilaginales of Lithuania. 1-199, in Mycota Lithuaniae, vol. 4. UAB
‘Valstieciy Laikrastis, Vilnius. (In Lithuanian)
Karatygin IV, Azbukina ZM. 1989. Ordo Ustilaginales 1. Familia Ustilaginaceae. Definitorium
Fungorum URSS. Nauka, Leningrad. 220 pp. (In Russian)
Le Gac M, Hood ME, Fournier E, Giraud T. 2007. Phylogenetic evidence of host-specific cryptic
species in the anther smut fungus. Evolution 61: 15-26.
http://dx.doi.org/10.1111/j.1558-5646.2007.00002.x
Legon NW, Henrici A, Roberts PJ, Spooner BM, Watling R. 2005. Checklist of the British & Irish
Basidiomycota. Royal Botanic Gardens, Kew. 517 pp.
Lindeberg B. 1959. Ustilaginales of Sweden (exclusive of the Cintractias on Caricoideae). Symbolae
Botanicae Upsalienses 16(2):1-175.
Liro JI. 1924. Die Ustilagineen Finnlands 1. Annales Academiae Scientiarum Fennicae, Ser. A 17(1):
1-636.
Mordue JEM, Ainsworth GC. 1984. Ustilaginales of the British Isles. Mycological Papers 154:
1-96.
Rayner RW. 1970. A mycological colour chart. CMI, Surrey and the British Mycological Society,
Kew.
Refrégier G, Le Gac M, Jabbour F, Widmer A, Hood ME, Yockteng R, Shykoff JA, Giraud T. 2008.
Cophylogeny of the anther smut fungi and their caryophyllaceous hosts: Prevalence of host
shifts and importance of delimiting parasite species. BMC Evolutionary Biology 8: 100.
Savulescu T. 1957. Ustilaginalele din Republica Populara Romina. Vols 1-2. Editura Academiei R.P.
Romine, Bucuresti. 1168 pp.
Scholz H, Scholz I. 1988. Die Brandpilze Deutschlands (Ustilaginales). Englera 8: 1-691.
http://dx.doi.org/10.2307/3776736
Vanky K. 1985. Carpathian Ustilaginales. Symbolae Botanicae Upsalienses 24(2): 1-309.
Vanky K. 1994. European smut fungi. Gustav Fischer Verlag, Stuttgart, Jena, New York. 570 pp.
Zogg H. 1986 [“1985”]. Die Brandpilze Mitteleuropas unter besonderer Beriicksichtigung der
Schweiz. Cryptogamica Helvetica 16: 1-277.
Zwetko P, Blanz P. 2004. Die Brandpilze Osterreichs. Doassansiales, Entorrhizales, Entylomatales,
Georgefischeriales, Microbotryales, Tilletiales, Urocystales, Ustilaginales. I-IV, 1-241 + CD, in F
Ehrendorfer (ed.), Catalogus Florae Austriae, vol. 3(3), Biosystematics and Ecology Series, vol.
21. Verlag der Osterreichischen Akademie der Wissenschaften, Wien.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.57
Volume 118, pp. 57-71 October-December 2011
Lentinus giganteus revisited:
new collections from Sri Lanka and Thailand
SAMANTHA C. KARUNARATHNA®”°, ZHU L. YANG?’, OLIVIER RASPE’,
THIDA W. Ko Ko’, ELSE C. VELLINGA®, RUI-LIN ZHAO‘, A.H. BAHKALY’,
EKACHAI CHUKEATIROTE’, JEROME DEGREEF*, PHILIPPE CALLAC®
& KEVIN D. HYDE?” ”?
'School of Science, Mae Fah Luang University,
333 Mool, Tasud, Muang, Chiang Rai 57100, Thailand
?International Fungal Research & Development Centre, Research Institute of Resource Insects,
Chinese Academy of Forestry, Kunming 650034, China
°Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany,
Chinese Academy of Sciences, Kunming 650204, China
‘Department of Cryptogamy, National Botanic Garden of Belgium,
Domein van Bouchout, Nieuwelaan 38, 1860 Meise, Belgium
‘Department of Plant and Microbial Biology, University of California,
Berkeley CA 94720-3102, U.S.A.
°Key Laboratory of Forest Disaster Warning and Control in Yunnan Province,
Faculty of Conservation Biology, Southwest Forestry University, Kunming 650224, China
“Botany and Microbiology Department, College of Science, King Saud University,
Riyadh, Saudi Arabia
8INRA, MYCSA (Mycologie et sécurité des aliments),
BP 81, 33883 Villenave d’Ornon cedex, France
*Mushroom Research Foundation,
128 M.3 Ban Pa Deng T. Pa Pae, A. Mae Taeng, Chiang Mai 50150, Thailand
“CORRESPONDENCE TO: [email protected]
ABSTRACT— A new collection of Lentinus giganteus from Sri Lanka, where it was originally
described, is used to epitypify the species after comparison with the type protologue and
drawings held in Peradeniya, Sri Lanka; a full description and illustrations are provided.
Additional collections were made at three sites in northern Thailand. Phylogenetic ITS-
1-5.8S-ITS2 rDNA sequence analyses using maximum likelihood, maximum parsimony
and Bayesian inference all support the transfer of L. giganteus to Pleurotus. Although the
collections from Thailand differ slightly morphologically and phylogenetically from
P. giganteus sensu stricto, these differences do not yet merit specific status. Instead, P giganteus
is maintained as one widely variable species represented by relatively large fruiting bodies.
Saprobic on buried well-rotted wood in forests, P. giganteus is widely consumed in Sri Lanka
and might be profitably cultivated in Thailand.
Key worps— edible fungi, morphology, new records, new combination, taxonomy
58 ... Karunarathna & al.
Introduction
Research on macrofungi of the Mushroom Research Centre and surrounding
areas in northern Thailand has documented a remarkable biodiversity and
produced many new species and new records (Le et al. 2007a,b; Sanmee
et al. 2008; Kerekes & Desjardin 2009; Wannathes et al. 2009a,b; Zhao et al.
2010). Recently we have focused on potentially cultivatable and edible genera
(Karunarathna et al. 2011). This paper presents the first report of Lentinus
giganteus from Thailand.
Lentinus Fr. is a cosmopolitan genus with an estimated 40 species (Kirk et al.
2008) distributed across a wide temperature range, being abundant in the tropics
and often found in temperate regions (Pegler 1983). Lentinus species, normally
wood decaying basidiomycetes, are characterized by decurrent lamellae,
dimitic tissues, and hyaline ellipsoid to cylindrical basidiospores. Species in
subgenus Lentinus have hyphal pegs (Corner 1981, Pegler 1983). Generally
the xeromorphic long-lived basidiomes are tough and firm when dry, but in
Thailand they fruit only at the beginning of the rainy season (Sysouphanthong
et al. 2010, Karunarathna et al. 2011). Traditionally, Lentinus was placed in the
agaric family Tricholomataceae based on the lamellate hymenophore and white
spore print (e.g., Miller 1973).
Previous researchers (e.g., Redhead & Ginns 1985; Hibbett & Vilgalys
1991, 1993; Hibbett & Thorn 1994; Hibbett et al. 1993) noted the existence
of a Lentinus—Pleurotus-Panus complex and showed that Lentinus sensu
Pegler is polyphyletic, with the monophyletic Lentinus subg. Lentinus sensu
Pegler belonging to the Polyporales (Hibbett 1991, Kruger & Gargas 2004).
Panus Fr., Pleurotus (Fr.) P. Kumm., and Neolentinus Redhead & Ginns are
also monophyletic, with Pleurotus belonging to the Agaricales (Fleming 1994,
Hibbett et al. 1994). Corner (1981), Kithner (1980), Pegler (1975, 1983) and
Singer (1986) all classified these genera differently.
Lentinus giganteus, originally described from Sri Lanka (Berkeley 1847),
bears many structures that are atypical of Lentinus, and its taxonomic position
has long been unresolved (Pegler 1983). Corner (1981: 54) suggested it as type
(and only species) of his new subgenus, Panus subg. Gigantopanus Corner.
Pegler (1983: 168) transferred this subgenus (as a section) to Lentinus: L. sect.
Gigantopanus (Corner) Pegler. Even though the largest spores become oblong-
ellipsoid, mature spores are not cylindrical but somewhat broadly ellipsoid. The
oil guttule present inside the spore is characteristic of Lentinus. The generative
hyphae are narrower than the skeletal hyphae. The lamellar edge is distinct with
a broad, sterile layer of lecythiform cheilocystidia similar to those observed
in some Pleurotus species. The lamellae are wide and well separated, and the
development process is metavelangiocarpic. In many ways this species might
be more properly positioned in Pleurotus, rather than in Lentinus. However,
Pleurotus giganteus comb. nov. (Sri Lanka, Thailand) ... 59
the skeletal hyphae of the dimitic hyphal system dominate to produce a
tough basidiome and the radiate construction of the hymenophoral trama
differentiates with the descending trama observed in Pleurotus.
Lentinus giganteus, referred to as “uru paha” in Sri Lanka, is one of the largest
edible mushrooms and —as noted in Buddhist literature— has been treated as
a special food since ancient times (Udugama & Wickramaratna 1991; Berkeley
1847).
Objectives of the present study were to redescribe L. giganteus from fresh
collections from the type locality, epitypify L. giganteus with a fresh Sri Lankan
collection, decide on the taxonomic position of L. giganteus to determine whether
it is related to Lentinus or Pleurotus using ITS-1-5.8 S-ITS2 rDNA sequence
data, and introduce the species to Thailand as a new edible mushroom.
Materials & methods
Lentinus giganteus samples were collected in northern Thailand and Sri Lanka
between June 2008 and October 2010 and processed as in Karunarathna et al. (2011).
Ethnomycological survey
Thirty locals including mushroom sellers in markets were surveyed through a general
questionnaire in Chiang Mai and Chiang Rai provinces, Thailand.
Morphological examination
Macro-morphological characters were described from fresh material and documented
by photographs. Colour designations (e.g., 4B5) follow Kornerup & Wanscher (1978),
while the colour names (e.g., grayish yellow) follow Ridgway (1912). Specimens were
dried, placed in separate plastic bags, and deposited in the Herbarium of Mae Fah
Luang University (MFLU). For microscopical examination, sections were cut with
a razor blade from dried specimens, mounted on slides in 5% KOH and Congo red,
observed, measured, and illustrated using a Zeiss Axioskop 40 compound microscope.
Basidiospore measurement abbreviations: n = number of spores measured; L_ = mean
spore length; W_, = mean spore width; Q = length/width ratio (L/W) of a spore in side
view; Q. = average Q of all spores measured.
Molecular & phylogenetic methods
DNA EXTRACTION— Genomic DNA was extracted from dried mushroom samples
with cetyl trimethylammonium bromide (CTAB) according to Doyle & Doyle (1990)
with some modifications. DNA concentrations were estimated visually in agarose gel by
comparing band intensity with a 1000 bp DNA ladder (Transgen Biotech).
PCR AMPLIFICATION & SEQUENCING—PCR reactions were performed in a 50 ul
volume (0.625 mM primers (White et al. 1990: ITS4: 5’TCCTCCGCTTATTGATATGC3’;
ITS5: 5°GGAAGTAAAAGTCGTAACAAGG3 ’); 10-20 ng DNA template, 10x buffer, 0.2 mM
dNTPs, 1.5 units Taq and sterile water. Thermal cycles: 3 m at 94 °C, 30-35 cycles at 93
°C for 30 s, 1 m at 55 °C, 1 m at 72 °C, final extension 10 m at 72 °C. PCR products were
verified by 1% agarose electrophoresis gels stained with ethidium bromide in 1xTris-
boric acid EDTA buffer. ITS 4/ITS 5 were used to sequence both DNA strands (White et
al. 1990) at the National Botanic Gardens of Belgium.
60 ... Karunarathna & al.
TABLE 1. Pleurotus giganteus and other taxa sequenced for phylogenetic analyses.
Taxa COUNTRY OF ORIGIN GENBANK accession numbers (ITS)
Lentinus squarrosulus Japan AB478883 (Sotome et al. 2009)
Panus sp. China HM245784 (unpublished)
P. australis New Zealand AY315764 (Zervakis et al. 2004)
P. cornucopiae Austria AY450341 (unpublished)
P. cystidiosus India AY315810 (Zervakis et al. 2004)
P. euosmus China EU424298 (unpublished)
P. giganteus ; :
(MELU 08 1370) Thailand (new sequence, from dried sample)
P. giganteus : ,
(MELU 08 1371) Thailand (new sequence, from dried sample)
P. giganteus . :
(MELU10 0141) Thailand (new sequence, from dried sample)
P. giganteus : ;
(MELU 11 0018, epitype) Sri Lanka (new sequence, from dried sample)
Pleurotus giganteus ; :
fastLebdinusieanteid Thailand DQ334857 (unpublished)
P. giganteus China HM245788 (unpublished)
[as Panus giganteus]
P. giganteus China HM245786 (unpublished)
[as Panus giganteus]
P. giganteus China ;
Lea gbantnsl HM245780 (unpublished)
P. fuscosquamulosus India AY315789 (Zervakis et al. 2004)
P. smithii Mexico AY315779 (Zervakis et al. 2004)
SEQUENCE ALIGNMENT & PHYLOGENETIC ANALYSIS— Taxa sequenced and GenBank
accession numbers are listed in TaBLE 1. Sequences for each strain were aligned
using Clustal X (Thompson et al. 1997). Alignments were manually adjusted to allow
maximum sequence similarity. Gaps were treated as missing data. Phylogenetic analysis
were performed using PAUP* 4.0b10 (Swofford 1998). Ambiguously aligned regions
were excluded from all analyses. Trees were inferred using the heuristic search option
with TBR branch swapping and 1000 random sequence additions. Maxtrees were
unlimited, branches of zero length were collapsed and all multiple parsimonious trees
were saved. Clade stability of the trees resulting from the parsimony analyses were
assessed by bootstrap analysis with 1000 replicates, each with 10 replicates of random
stepwise addition of taxa (Felsenstein 1985). Trees were figured in TreeView.
Results
The ITS sequence dataset comprised 16 sequences (TABLE 1) representing
three Panus giganteus collections and one Lentinus giganteus collection from
GenBank, three L. giganteus collections from northern Thailand, and one
collection from Sri Lanka. Outgroup taxa were Lentinus squarrosulus and Panus
sp. Of 732 total characters, 363 are constant, 112 are parsimony-uninformative,
and 257 are parsimony-informative. The MP tree was produced after 238,115
Pleurotus giganteus comb. nov. (Sri Lanka, Thailand) ... 61
AB478883 L. squarrosulus
AB509648 Panus sp.
AY315764 Pl. australis
100
0 AY315779 Pl. smithii Pleurotus subgenus
$9 Coremiopleurotus clade
99 AY315810 Pl. cystidiosus
AY315789 Pl. fuscosquamulosus
MFLUII 0018 PI. giganteus } Sri Lankan Giganteus forms a new clade
100
HM245788 Pl. giganteus*
86 68
79 HM245780 PI. giganteus* Giganteus clade I
(Chinese taxa belong to this clade)
96 HM245786 PI. giganteus*
MFLU10 0141 Pl. giganteus
98
89 MFLU08 1371 PI. giganteus Giganteus clade Il
96 Be MFLUO8 1370 Pl. giganteus (Thai specimens belong to this clade)
DQ334857 Pl. giganteus**
100 EU424298 Pl. euosmus
AY450341 Pl. cornucopiae
PLaTE 1. Maximum parsimony phylogram showing phylogenetic relationships among Pleurotus
giganteus from Thailand (MFLUO8 1370, MFLUO8 1371, MFLU10 0141) and epitype from Sri Lanka
(MFLU11 0018) with some selected Lentinus, Panus and Pleurotus species based on ITS-1-5.8 S-ITS2
rDNA sequences. Data were analysed with random addition sequence, unweighted parsimony and
gaps were treated as missing data. Values above the branches are parsimony bootstrap (2 50%). The
tree is rooted with Lentinus squarrosulus (AB478883) and Panus sp. (AB509648). Pl = Pleurotus;
** = as Lentinus giganteus in GenBank, * = as Panus giganteus in GenBank.
rearrangements; the best MP tree found (scored at 645) was chosen to represent
the phylogenetic position of L. giganteus (PLATE 1).
The three L. giganteus samples from Thailand (MFLU08 1370, MFLUO8 1371,
MFLU1O 0141) and Chinese collections from GenBank form one clade (PLATE 1)
that is sister (86% bootstrap support) to the only L. giganteus collection from
Sri Lanka. Both Sri Lankan and Thai collections are closely related to Pleurotus
cornucopiae and P. euosmus (89% bootstrap support). The L. giganteus clade,
P. cornucopiae, and P. euosmus cluster with Pleurotus subg. Coremiopleurotus
(100% bootstrap support). Coremiopleurotus comprises P. australis, P. smithii,
P. cystidiosus, and P. fuscosquamulosus.
These results support the view that L. giganteus is related to Pleurotus and not
Panus or Lentinus. Since the morphological data also supports the molecular
62 ... Karunarathna & al.
conclusions, we transfer L. giganteus to Pleurotus and epitypify the species
based on the collection from the holotype locality to enable future molecular
studies.
Taxonomy
Pleurotus giganteus (Berk.) Karunarathna & K.D. Hyde, comb. nov. PLATES 2-4
MycoBank MB 561087
= Lentinus giganteus Berk., Lond. Journ. Bot. 6: 493[bis], pl.17/18 f.2 (1847)
= Pocillaria gigantea (Berk.) Kuntze, Revis. Gen. Pl. 2: 866 (1891)
= Velolentinus giganteus (Berk.) Overeem, Bull. Jard. Bot. Buitenz, 3 sér., 9: 12 (1927)
= Panus giganteus (Berk.) Corner, Beih. Nova Hedwigia 69: 69 (1981)
Type: Sri Lanka, Central Prov., Hautane Range, on ground, July 1844, by Gardner, No 58
(holotype K; PLaTe 2A-C); Central Prov., Kandy Distr., Deliwala village, 7°14'43.55"N
80°33'51.40"E, elevation 1050 m, rainforest dominated by Swietenia spp. and Artocarpus
heterophyllus, 5 June 2009 (MFLU11 0018, epitype designated here [PLATE 4A]).
PitEus 60-310 mm in diameter, strongly convex to applanate becoming
slightly depressed in the centre, dark brown (7F5), towards the margin light
brown camel (6D4), grayish orange (5B4) at the marginal area, at centre
fibrillose-scaly, surface initially uniformly dark, fuscous brown, fuliginous or
black, then fading with age to pale ochraceous or yellowish brown (E8), with a
darker centre although sometimes remaining dark, dry, distrupted into small,
indefinite, radial, innate squamules, overlain by scanty, pale grey or blackish,
verrucose-floccose, concentrically arrange remnants of the veil; margin strongly
involute then straight, thin, slightly sulcate-striate. LAMELLAE moderately
crowded with lamellulae of five lengths, decurrent, slightly interveined and
anastomosing over the stipe apex, 2-3 mm broad, white to cream (3A2); edge
entire, pale ochraceous or yellowish brown (E8). STIPE up to 50-200 mm long,
7-10 mm broad at the apex, 10-15 mm at the base, fusiform, with radicating
base, solid, with surface concolorous with the pileus, paler at the apex, finely
tomentose with indefinite zones of paler velar remnants in the early stages; veil
thin, floccose, pale to dark brown (6F6), soon reduced to floccose remnants but
never forming an annulus on the stipe. CONTEXT 5-10 mm thick at the disk,
submembranous at the pileal margin, white in pileus and stipe, fleshy-spongy,
consisting of a dimitic hyphal system with skeletal hyphae.
GENERATIVE HYPHAE (PLATE 3e) 4-6 um in diameter, inflating with a
thick or slightly thickened wall, more or less radially parallel but frequently
branching and with large clamp connections. SKELETAL HYPHAE (PLATE 3d)
6-8 um in diameter, hyaline of intercalary or terminal origin, becoming very
thick-walled with a narrow lumen, tending to taper apically, occasionally with
a limited lateral branch. BAsIDIOSPORES (PLATE 3a) 7-9 x 6-7 um [n = 40, L_=
8.30 um, W_ = 6.36 um, Q= 1.18-1.46, Q_ = 1.33] broadly ellipsoid to ellipsoid,
white in mass, smooth, with one large oil drop or multiguttulate, inamyloid,
Pleurotus giganteus comb. nov. (Sri Lanka, Thailand) ... 63
PLATE 2. Lentinus giganteus: watercolour illustrations by Mr. William De Silva conserved at
Fungal Herbarium, Horticultural Crop Research and Development Institute (HORDI), Sri Lanka
[scanned by and reproduced with permission of Mrs. Srimathie Udugama, Director, Fungal
Herbarium, Horticultural Crop Research and Development Institute (HORDI), Sri Lanka]. A-C:
Sri Lanka, Hautane Range, on ground, July 1844, Gardner n.58 (holotype; Berkeley 1847); A:
habit of young basidiocarps; B. cap surface, upper view; C: side view of mature basidiocarp. D: Sri
Lanka, Peradeniya, July 1868, Thwaites n.688 (Berkeley & Broome 1873, as L. stenophyllus); habit
of basidiocarp.
thin-walled. The large spores are not cylindrical but rather broadly ellipsoid,
although the largest spores become oblong ellipsoid. Basip1A (PLATE 3c) 25-40
x 8-10 um, elongate, clavate, bearing 4 sterigmata. LAMELLA EDGE sterile with
a broad layer of CHEILOCYSTIDIA (PLATE 3b) 15-30 x 6-10 um, more or less
64 ... Karunarathna & al.
PLaTE 3. Pleurotus giganteus (MFLUO8 1370). a: Spores; b: Cheilocystidia; c: Basidia; d: Skeletal
hyphae; e: Generative hyphae; Scale bars: a~c = 20 um; d, e = 10 um.
PiaTE 4 (to right). A. Basidiocarp of Pleurotus giganteus from Sri Lanka (MFLU11 0018, epitype);
B-E: Basidiocarps of P. giganteus from northern Thailand (B: MFLU10 0141; C: MFLUO8 1371;
D, E: MFLUO8 1370). Scale bars: A = 20 cm; B, C = 10 cm.
Pleurotus giganteus comb. nov. (Sri Lanka, Thailand) ... 65
66 ... Karunarathna & al.
lecythiform with a ventricose base and a small capitellum (3-4 um) subtended
by a narrow neck, hyaline, thin-walled.
ECOLOGY AND DISTRIBUTION— solitary on buried rotten wood in rain
forest. Widely distributed in Australia, China, Malay Peninsula, Sabah, Sri
Lanka, Vietnam (Pegler 1983), Thailand (this study).
ADDITIONAL MATERIAL EXAMINED: THAILAND, CHIANG Mal PRov., MAE TAENG
Distr., Ban Pha Deng, Mushroom Research Centre, 19°17.123'N 98°44.009’E, elevation
900 m, rainforest dominated by Castanopsis armata, Erythrina sp, and Dipterocarpus
sp., 8 July 2008, Ruilin Zhao (MFLU08 1370); 21 June 2008, Samantha C. Karunarathna
(MFLU10 0138); 27 June 2008, Samantha C. Karunarathna (MFLU08 1371); 6 July 2008,
Samantha C. Karunarathna (MFLU08 1382); 22 July 2008, Samantha C. Karunarathna
(MFLU10 0137); 10 July 2010, Olivier Raspe (MFLU10 0153); Doi Suthep-Pui National
Park, Sangasabhasri Lane to Huai Kok Ma village, 18°48.62'N 98°54.60’E, elevation 1145
m, rainforest dominated by Castanopsis spp., Lithocarpus polistachyus and other trees,
9 June 2008, Samantha C. Karunarathna (MFLU10 0136); CHIANG Ral PRov., Highway
No.110 to Mae Sai, Doi Tung, 20°17'37"N 99°48'56"E, elevation 950 m. 15 July 2009,
Samantha C. Karunarathna (MFLU10 0140); 15 July 2009, Samantha C. Karunarathna
(MFLU10 0141); 8 August 2009, Samantha C. Karunarathna (MFLU10 0142);
8 August 2009, Samantha C. Karunarathna (MFLU10 0143); 16 July 2010, Samantha C.
Karunarathna (MFLU10 0154).
Discusston— Molecular evidence indicates that Lentinus giganteus is better
placed in Pleurotus. This is supported by morphology as (1) the lamella-edge is
well defined with a broad, sterile layer of differentiated cheilocystidia, similar
to those found in some Pleurotus species; (2) basidiomes are soft in texture with
short life span, similar to Pleurotus species; (3) the lamellae are broad and well
spaced; and (4) development is metavelangiocarpic. Although Corner (1981)
established L. subg. Gigantopanus for L. giganteus, our limited data do not
support this division.
We collected 11 Pleurotus giganteus specimens from three sites in northern
Thailand and one specimen from the original site in Sri Lanka cited in the
protologue. The new Sri Lankan collection, identical to that of Corner’s (1981)
description and our observation of the holotype, is designated as epitype of
P. giganteus. Molecular data groups our collections from Thailand with high
bootstrap support in a single clade that clusters with sequences of P giganteus
from China, suggesting strain similarity. The Sri Lankan P. giganteus collection
forms a sister group with Thai and Chinese collections with 86% bootstrap
support. This suggests that the Chinese and ‘Thai collections might have
diverged from the Sri Lankan species due to geographical isolation. There are
also micro-morphological differences (TABLE 2), although more collections
are needed to confirm whether these are different taxa. Thus we maintain P
giganteus as a single widely variable species. Both Thai and Sri Lankan collections
are more closely related to Pleurotus than to Panus and Lentinus. Pleurotus
australis, P. smithii, P. cystidiosus, and P. fuscosquamulosus (all Pleurotus subg.
Pleurotus giganteus comb. nov. (Sri Lanka, Thailand) ... 67
TABLE 2. Pleurotus giganteus morphological comparisons
Cap (diam.) SPORES BASIDIA CHEILOCYSTIDIA
ISOLATE/COLLECTION STIPE (length) (mm) (mm) (um)
(both in mm)
MFLU08 1370 Cap: 100-110 7-9 x 25-40 x 15-30 x
Stipe: 65-70 6-7 8-10 6-10
MFLU10 0138 Cap: 90-110 6.5-8.5 x 26-38 x 14-30 x
Stipe: 80-110 6-7 7.5-9.5 6.5-11
MFLU08 1371 Cap: 165-170 6.5-8.5 x 25-39 x 13.5-31 x
Stipe: 65-70 6-7 7.5-9.5 6-11
MFLU08 1382 Cap: 45-50 6.5-8.5 x 25.5-41 x 15-31 x
Stipe: 65-70 6.5-7 8-10.5 6-10.5
MFLU10 0137 Cap: 105-110 6.5-8.5 x 24-41 x 15-31 x
Stipe: 50-60 6-7 8-10 6.5-10.5
MFLU10 0153 Cap: 140-150 6.5-8.5 x 25-41 x 14-30.5 x
Stipe: 190-200 6.5-7 8.5-10.5 6-10
MFLU10 0140 Cap: 50-70 6.5-8 x 25-41 x 15-31 x
Stipe: 130-150 6.5-7 8.5-10.5 6.5-11
MFLU10 0143 Cap: 200-220 6-8 x 25-41.5 x 15-30.5 x
Stipe: 70-80 6-7 8-10 6-10
MFLU10 0141 Cap: 70-100 6.5-8 x 25-39.5 x 14-30.5 x
Stipe: 150-180 6.5-7.5 8.5-10 6.5-10.5
MFLU10 0142 Cap: 100-180 6.5-8.5 x 24-40 x 14-31 x
Stipe: 120-130 6.5-7 8.5-10 6.5-10.5
MFLU10 0154 Cap: 150 6.5-8.5 x 23.5-41 x 15.5-31 x
Stipe: 75 6.5-7 8-10 6.5-10
MFLU10 0136 Cap: 130 6.5-8.5 x 24-41 x 15-31 x
Stipe: 110 6.5-7 8-9.5 6.5-10.5
MFLU11 0018 Cap: 60-310 6-8 (-9) x 29-52 x 23-35(-38) x
(epitype) Stipe: 50-190 4.3-5.2 8-9.5 6-10
K Cap: 50-300 6-8 X 30-50 x 25-35 x
(holotype) Stipe: 50-180 4.5-5.2 8-9 6-10
Coremiopleurotus) group with all sequenced P giganteus collections with 100%
bootstrap support.
Pleurotus giganteus is closely related to P subg. Coremiopleurotus, a group
of edible species with high commercial value (Zervakis et al. 2004). The
relationship suggests that P giganteus is likely to be a good edible species,
confirmed by its present consumption in Sri Lanka (Pegler 1983; Udugama &
Wickramaratna 1991). Pleurotus giganteus is also considered edible in China
(Dai et al. 2010).
The most commonly and easily cultivated mushrooms in Thailand and other
southeast Asian countries are oyster mushrooms (Pleurotus ostreatus (Jacq.)
P. Kumm.), ear mushrooms (Auricularia polytricha (Mont.) Sacc.), and straw
mushrooms (Volvariella volvacea (Bull.) Singer). Other mushroom species in
68 ... Karunarathna & al.
Lentinula, Lentinus, Ganoderma, and Macrocybe (Hanko 2001, Karunarathna
et al. 2011, Boa 2007) and Agrocybe can also be cultivated successfully but
require more attention and knowledge (Boa 2007).
Wild mushrooms are one of the higher valued non-timber forest products
in northern Thailand (Sysouphanthong et al. 2010, Karunarathna et al. 2011).
They provide locals with seasonal food, medicine, and an alternative income
while maintaining forest health (Sysouphanthong et al. 2010). The richness
of wild mushrooms is also one bioindicator of ecosystem health (Dai & Yang
2009; Du et al. 2011a,b; Sysouphanthong et al. 2010; Egli 2010). Cultivated,
non-mycorrhizal mushrooms (e.g., Lentinula edodes (Berk.) Pegler, Pleurotus
sajor-caju (Fr.) Singer, Flammulina velutipes (Curtis) Singer, and species of
Agaricus, Auricularia, Pleurotus, Agrocybe, and Volvariella) are available year
around in northern Thai markets. However, edible wild mushrooms can be
found only in the wet season from June to September (Sysouphanthong et al.
2010, Karunarathna et al. 2011). As Pleurotus species form a heterogeneous
commercially valuable group of edibles, it is therefore desirable to try to introduce
members of this genus as commercial species. Although there are many studies
on cultivated and wild edible mushrooms and their nutritional value in the
northern hemisphere (Aletor 1995; Latiff et al. 1996; Manzi et al. 1999, 2001;
Dermirbas 2000), there is little information available concerning the taxonomy,
biodiversity, and economic potential of Pleurotus species in the tropics. Scientific
information on wild mushrooms is essential for the introduction of new species
for the table (Karunarathna et al. 2011, Sysouphanthong et al. 2010).
Based on the survey of 30 locals through a questionnaire in Chiang Mai and
Chiang Rai provinces, we were unable to obtain a clear idea as to whether or
not they regard P. giganteus as an edible mushroom. Pleurotus giganteus is not
sold in Thai markets during wet season, and most inhabitants of Chiang Mai
and Chiang Rai provinces do not consume this wild edible mushroom. Even
though P giganteus has a very good taste (Udugama & Wickramaratna 1991), it
is not yet cultivated in Thailand as a commercial mushroom.
Acknowledgements
Weare grateful to Jian Kui Liu, Naritsada Thongklang and Phongeun Sysouphanthong
for their help in collecting and suggestions, Pheng Phengsintham and Nilam Wulandari
are gratefully acknowledged for their valuable discussions. We wish to acknowledge
the help with field work provided by Kobeke Van de Putte, Nalin Wijewardane, Putrak
Chomnuti, Rungtiva Pookamsak, Saowanee Wikee, Stefan D. Baros, Joshua Mark
Birkebak, Anjel Creig, Don Nelson, Jie Chen, Michael Pilkington. Kanjana Niraphai
(MFLU) is thanked for her assistance in the herbarium. A special thank goes to Prof.
Nimal Adikaram for providing his laboratory facilities and his valuable suggestions. The
comments by the two reviewers, Dr. Eric McKenzie and Dr. Yu Chen Dai, are gratefully
acknowledged. This study was financially supported by the project “Value added products
Pleurotus giganteus comb. nov. (Sri Lanka, Thailand) ... 69
from basidiomycetes: Putting Thailand's biodiversity to use” (BRN049/2553). The Global
Research Network for Fungal Biology and King Saud University are also thanked for
supporting this research. Study in China was supported by a grant from the Ministry of
Science and Technology of the People’s Republic of China (2008FY 110300).
References
Aletor VA. 1995. Compositional studies on edible tropical species of mushrooms. Food Chem.
54 (3): 265-268. http://dx.doi.org/10.1016/0308-8146(95)00044-J
Berkeley MJ. 1847. Decades of fungi. Dec. XV-XIX. Ceylon fungi. Lond. J. Bot. 6: 479-514.
Boa E. 2007. Wild edible fungi - a global overview of their use and importance to people. Delhi:
Daya Publishing House.
Corner EJH. 1981. The agaric genera Lentinus, Panus, and Pleurotus with particular reference to
Malaysian species. Nova Hedwig. Beih. 69: 1-169.
Dai YC, Yang ZL, Cui BK, Yu CJ, Zhou LW. 2009. Species diversity and utilization of medicinal
mushrooms and fungi in China (Review). Int. J. Med. Mushrooms 11: 287-302.
Dai YC, Zhou LW, Yang ZL, Wen HA, Bao T, Li TH. 2010. A revised checklist of edible fungi in
China. Mycosystema 29: 1-21.
Demirbas A. 2000. Accumulation of heavy metals in some edible mushrooms from Turkey. Food
Chem. 68 (4): 415-419. http://dx.doi.org/10.1016/S0308-8146(99)00210-1
Doyle JJ, Doyle JL. 1990. Isolation of plant DNA from fresh tissue. Focus 12: 13-15.
Du P, Cui BK, Dai YC. 201la. High genetic diversity in wild culinary-medicinal wood ear
mushroom, Auricularia polytricha (Mont.) Sacc., in tropical China revealed by ISSR analysis.
Int. J. Med. Mushrooms 13: 289-298.
Du P, Cui BK, Dai YC. 2011b. Genetic diversity of wild Auricularia polytricha in Yunnan Province of
South-western China revealed by sequence-related amplified polymorphism (SRAP) analysis.
J. Med. Plants Res. 5: 1374-1381.
Egli S. 2011. Mycorrhizal mushroom diversity and productivity —- an indicator of forest health?
Annals Forest Sci. 68 (1): 81-88. http://dx.doi.org/10.1007/s13595-010-0009-3
Felsenstein J. 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evol. 39:
783-791.
Fleming R. 1994. Neolentinus - a well-founded genus in Pleurotaceae that includes Heliocybe.
Mycol. Res. 98: 542-544. http://dx.doi.org/10.1016/S0953-7562(09)80476-0
Hanko J. 2001. Mushroom cultivation for people with disabilities - a training manual. Food and
Agriculture Organization of the United Nations, Regional Office for Asia and the Pacific.
Bangkok, Thailand.
Hibbett DS, Thorn RG. 1994. Nematode-trapping in Pleurotus tuberregium. Mycologia 86: 696-699.
Hibbett DS, Vilgalys R. 1991. Evolutionary relationships of Lentinus to the Polyporaceae - Evidence
from restriction analysis of enzymatically amplified ribosomal DNA. Mycologia 83: 425-439.
Hibbett DS, Vilgalys R. 1993. Phylogenetic relationships of Lentinus (Basidiomycotina) inferred
from molecular and morphological characters. Systematic Botany 18: 409-433.
Hibbett DS, Murakami S, Tsuneda A. 1993. Hymenophore development and evolution in Lentinus.
Mycologia 85 (3): 428-443.
Karunarathna SC, Yang ZL, Zhao R, Vellinga EC, Bahkali AH, Chukeatirote E, Hyde KD. 2011.
Three new species of Lentinus from northern Thailand. Mycological Progress 10: 389-398.
http://dx.doi.org/10.1007/s11557-010-0701-6
Kerekes J, Desjardin DE. 2009. A monograph of the genera Crinipellis and Moniliophthora from
Southeast Asia including a molecular phylogeny of the nrITS region. Fungal Divers. 37: 101-152.
70 ... Karunarathna & al.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. (eds) 2008. Ainsworth and Bisby’s dictionary of the
fungi. 10th ed. Wallingford, Oxon, UK: CABI International.
Kornerup A, Wanscher JH. 1978. Methuen handbook of colour, 3rd Edn. Methuen: London.
Kriger D, Gargas A. 2004. The basidiomycete genus Polyporus — an emendation based on phylogeny
and putative secondary structure of ribosomal RNA molecules. Feddes Repert. 115: 530-546.
http://dx.doi.org/10.1002/fedr.200311052
Kihner R. 1980. Les Hyménomycétes agaricoides. Bull. Soc. Linn. Lyon. 49: 1027-1030.
Latiff LA, Daran ABM, Mohamed AB. 1996. Relative distribution of minerals in the pileus and stalk
of some selected edible mushrooms. Food Chem. 56 (2): 115-121.
Le TH, Nuytinck J, Verbeken A, Lumyong S, Desjardin ED. 2007a. Lactarius in northern Thailand:
1. Lactarius subgenus Piperites. Fungal Divers. 24: 173-224.
Le TH, Nuytinck J, Stubbe D, Verbeken A, Lumyong S, Desjardin ED. 2007b. Lactarius in northern
Thailand: 2. Lactarius subgenus Plinthogali. Fungal Divers. 27: 61-94.
Manzi P, Gambelli L, Marconi S, Vivanti V, Pizzoferrato L. 1999. Nutrients in edible mushrooms:
an inter-species comparative study. Food Chem. 65 (4): 477-482.
Manzi P, Aguzzi A, Pizzoferrato L. 2001. Nutritional value of mushrooms widely consumed in Italy.
Food Chem. 73: 321-325.
Miller O. 1973. Mushrooms of North America. E.P. Dutton: New York. 368 p.
Pegler DN. 1975. The classification of the genus Lentinus Fr. (Basidiomycota). Kavaka 3: 11-20.
Pegler DN. 1983. The genus Lentinus: a world monograph. HMSO: London.
Redhead SA, Ginns JH. 1985. A reappraisal of agaric genera associated with brown rots of wood.
Trans Mycol. Soc. Jpn. 26: 349-381.
Ridgeway R. 1912. Color standards and color nomenclature. Ridgeway: Washington DC.
Sanmee R, Tulloss RE, Lumyong P, Dell B, Lumyong S. 2008. Studies on Amanita (Basidiomycetes:
Amanitaceae) in northern Thailand. Fungal Divers. 32: 97-123.
Singer R. 1986. The Agaricales in modern taxonomy. 4th ed. Koeltz Scientific Books: Koenigstein,
Germany. 981 p.
Sotome K, Hattori T, Ota U, Kakishima M. 2009. Second report of Polyporus longiporus and its
phylogenetic position. Mycoscience 50: 415-420. http://dx.doi.org/10.1007/s10267-009-0506-0
Swofford DL. 1998. PAUP and other methods. Phylogenetic Analysis Using Parsimony, version 4.
Sinauer Associates: Sunderland, Massachusetts, USA.
Sysouphanthong P, Thongkantha S, Zhao R, Soytong K, Hyde KD. 2010. Mushroom diversity
in sustainable shade tea forest and the effect of fire damage. Biodivers. Conservation 19 (5):
1401-1415. http://dx.doi.org/10.1007/s10531-009-9769-1
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The Clustal X windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res. 25 (24): 4876-4882.
Udugama S, Wickramaratna K. 1991. Artificial production of naturally occurring Lentinus giganteus
(Uru Paha), a Sri Lankan edible mushroom. Horticultural Crop Research & Development
Institute (HORDI), Gannoruwa, Peradeniya.
Wannathes N, Desjardin DE, Lumyong S. 2009a. Four new species of Marasmius section Globulares
from northern Thailand. Fungal Divers. 36: 155-163.
Wannathes N, Desjardin DE, Hyde KD, Perry BA, Lumyong S. 2009b. A monograph of Marasmius
(Basidiomycota) from northern Thailand based on morphological and molecular (ITS
sequences). Fungal Divers. 37: 209-306.
White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. Pp. 315-322, in: MA Innis et al. (eds). PCR Protocols: A Guide
to Methods and Applications. Academic Press, New York.
Pleurotus giganteus comb. nov. (Sri Lanka, Thailand) ... 71
Zervakis GI, Moncalvo JM, Vilgalys R. 2004. Molecular phylogeny, biogeography and speciation of
the mushroom species Pleurotus cystidiosus and allied taxa. Microbiology 150: 715-726.
http://dx.doi.org/10.1099/mic.0.26673-Oshr
Zhao RL, Desjardin DE, Soytong K, Perry BA, Hyde KD. 2010. A monograph of Micropsalliota
in northern Thailand based on morphological and molecular data. Fungal Divers. 43: 33-79.
http://dx.doi.org/10.1007/s13225-010-0050-4
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.73
Volume 118, pp. 73-81 October-December 2011
Diversispora clara (Glomeromycetes)— a new species
from saline dunes in the Natural Park Cabo de Gata (Spain)
BEATRIZ ESTRADA’, JAVIER PALENZUELA’, JOSE-MIGUEL BAREA’,
JUAN MANUEL Ru1z-LOZANO', GLADSTONE ALVES DA SILVA? & FRITZ OEHL?
‘Departamento de Microbiologia del Suelo y Sistemas Simbioticos, Estacién Experimental del
Zaidin, CSIC, Profesor Albareda 1, 18008 Granada, Spain
*Departamento de Micologia, CCB, Universidade Federal de Pernambuco,
Av. Prof. Nelson Chaves s/n, Cidade Universitaria, 50670-420, Recife, PE, Brazil
*Federal Research Institute Agroscope Reckenholz-Tdanikon ART,
Organic Farming Systems, Reckenholzstrasse 191, CH-8046 Ziirich, Switzerland
*CORRESPONDENCE TO: [email protected]
ABSTRACT — A new species of Diversispora (Glomeromycetes) was found in saline sand dunes
of the Natural Park Cabo de Gata (Almeria, Andalucia, Southern Spain) in the rhizosphere
of Asteriscus maritimus, a plant species especially adapted to saline environments. The new
fungal species forms brilliant white spores that are 79-130 x 75-125 um and have one wall
consisting of three layers. The subtending hyphae are, as typical for many Diversispora spp.,
thin-walled, hyaline, and cylindrical (or rarely constricted) and flexible and fragile below the
septa separating the spore and hyphal contents. The septa form regularly at the spore bases
or, less frequently, in subtending hyphae at short distances from the spore base. Phylogenetic
analyses of the ITS and partial 28S ribosomal gene confirm that D. clara forms a monophyletic,
independent clade within Diversispora.
Key worps — Glomus, Glomeromycota, Europe, extreme environments, rDNA
Introduction
During recent studies on arbuscular mycorrhiza (AM) fungal diversity
in sand dune systems of the Cabo de Gata Natural Park in Almeria (Spain),
a brilliant-white new glomeromycotean fungus was recovered from the
rhizosphere of Asteriscus maritimus, a plant species characteristic of saline
Mediterranean environments with elevated soil electrical conductivity. The
new fungus formed spores in AM fungal bait cultures predominantly in the
Asteriscus maritimus rhizosphere. The aims of the present study were to analyze
this particular fungus applying combined morphological and molecular tools
and to describe its characteristics.
7A ... Estrada & al.
Material & methods
Soil and plant sampling
Soil samples were taken in February 2010 from the rhizosphere of ten Asteriscus
maritimus plants growing in a natural sand dune system of the Natural Park Cabo de Gata
in Almeria (Andalucia, Spain). The site is located at 36°44’41"N 02°07'26"E. The samples,
air-dried in the laboratory, were used to analyze selected chemical soil parameters (pH,
soil organic carbon, total nitrogen, soil electrical conductivity) and spore populations.
The ten plants and the surrounding rhizosphere soil were also extracted and used as
bait cultures for propagation of AM fungal communities indigenous to the natural sand
dune system. At the site, the soil was sandy and with pH (H,O) 8.2, organic carbon 15.3
g kg", total nitrogen 1.9 g kg’, available P 27.0 mg kg", and soil electrical conductivity
1.5 uS cm”.
AM fungal bait cultures
Bait cultures were established and maintained as described in Palenzuela et al. (2008,
2011) by transplanting 10 Asteriscus maritimus plants with their rhizosphere soils into
1 L pots and transferring them to the greenhouse at EEZ in Granada immediately after
sampling. The pots were irrigated three times per week and fertilized every four weeks
with Long-Aston nutrient solution (Hewitt 1966). Pure cultures of the new fungus were
initiated in a mixed-culture of three Allium porrum L. and three Hieracium pilosella
L. plantlets in 750 mL pots grown together at three locations in the pots. The plant
rhizosphere was inoculated with 20 spores per pot and pot location. A sterile mixture
of Terragreen (American aluminum oxide, Oil Dry US special, type III R; Lobbe
Umwelttechnik Iserlohn, Germany) and Loess (mixture 3:1; with pH-KCl 6.2; organic
carbon 0.3%; available P (Na-acetate) 2.6 mg kg”; available K (Na-acetate) 350 mg kg"!
was chosen as culture substrate (Oehl et al. 2002). So far, pure cultures of the new fungus
have not been obtained.
Morphological analyses
AM fungal spores were separated from the soil samples by a wet sieving process
(Sieverding 1991). The morphological spore characteristics and their subcellular
structures were described from a specimen mounted in: polyvinyl alcohol-lactic acid-
glycerol (PVLG; Koske and Tessier 1983); a mixture of PVLG and Melzer’s reagent
(Brundrett et al. 1994); a mixture of lactic acid to water at 1:1; Melzer’s reagent; and
water (Spain 1990). The spore structure terminology follows Oehl et al. (2003, 2005,
2011a) for species with glomoid or diversisporoid spore formation. Photographs (Fics
1-10) were taken with a Leica DFC 290 digital camera on a Leitz Laborlux S compound
microscope using Leica Application Suite Version V 2.5.0 R1 software. Specimens
mounted in PVLG and the PVLG+Melzer’s mixtures were deposited at the herbaria
Z+ZT (ETH Zurich, Switzerland), GDA-GDAC (University of Granada, Spain), and
URM (Federal University of Pernambuco, Recife).
Molecular analyses
Five spores isolated from the trap cultures were surface-sterilized with chloramine
T (2%) and streptomycin (0.02%) (Mosse 1962) and crushed with a sterile disposable
micropestle in 40 uL milli-Q water (Ferrol et al. 2004). PCRs of the crude extracts
Diversispora clara sp. nov. (Spain) ... 75
were obtained in an automated thermal cycler (Gene Amp PCR System 2400, Perkin-
Elmer, Foster City, California) with a pureTaq Ready-To-Go PCR Bead (Amersham
Biosciences Europe GmbH, Germany) following manufacturer's instructions with 0.4
uM concentration of each primer. A two-step PCR amplified the partial SSU, ITS1,
5.88, ITS2 and partial LSU rDNA ribosomal fragment using the SsUmAf/LSUmAr
and SSUmCf/LSUmBr primers consecutively (Kriger et al. 2009). The second PCR
products were separated electrophoretically on 1.2% agarose gels stained with Gel Red™
(Biotium Inc., Hayward, CA, U.S.A.) and viewed by UV illumination. The band of the
expected size was excised with a scalpel and the amplified DNA was isolated from the
gel with the QIAEX II Gel Extraction kit (QIAGEN, Valencia, CA, USA), cloned into the
PCR2.1 vector (Invitrogen, Carlsbard, CA, USA), and transformed into one shot TOP10
chemically competent Escherichia coli cells. After plasmid isolation from transformed
cells, cloned DNA fragments were sequenced with vector primers (White et al. 1990) in
both directions by Taq polymerase cycle sequencing on an automated DNA sequencer
(Perkin-Elmer ABI Prism 373). Sequence data were compared to gene libraries (EMBL
and GenBank) using BLAST (Altschul et al. 1990). The new sequences were deposited in
the EMBL database under the accession numbers FR873629-FR873633.
PHYLOGENETIC ANALYSES: The AM rDNA ITS1+5.8S +ITS2 fungal sequences were
aligned in ClustalX (Larkin et al. 2007) and edited with BioEdit (Hall 1999) to obtain
a final alignment with Acaulospora laevis Gerd. & Trappe and A. lacunosa J.B. Morton
as outgroups. Prior to phylogenetic analysis, the model of nucleotide substitution
was estimated using Topali 2.5 (Milne et al. 2004). Bayesian (two runs over 1 x 10°
generations with a burn in value of 2500) and maximum likelihood (1000 bootstrap)
analyses were performed in MrBayes 3.1.2 (Ronquist & Huelsenbeck 2003) and PhyML
(Guindon & Gascuel 2003) respectively, launched from Topali 2.5, using the GTR +
G model. Neighbor-joining (established with the model cited above) and maximum
parsimony analyses were performed using PAUP*4b10 (Swofford 2003) with 1000
bootstrap replications.
Results
Diversispora clara Oehl, B. Estrada, G.A. Silva & Palenz., sp. nov. Fries 1-10
MycoBank MB 561583
Sporae albae, 79-130 x 75-125 um, tunica tribus stratis, 4.3-8.4 um. Stratum exterior
hyalinum; stratum medium, album ad rarum ochreo-album, 2.8-5.4 um crassum; stratum
interius album. Hypha adhaerenta, 8-13 um in diametrum. Tunica hyphae 1.0-1.8 um
crassa. Strata medium interiusque septo porum occludentes. Strata exterior mediumque
flava colorantes Melzeri.
Type: Spain. Andalucia, Almeria, Cabo de Gata Natural Park, sand dune, from the
rhizosphere of Asteriscus maritimus (L.) Less. (Asteraceae), isolation date February 2011,
by B. Estrada (holotype, ZT Myc 3796 [permanent slide 20-2001]; isotypes, ZT Myc
3797 [permanent slides 20-2003 to 20-2012], GDA-GDAC [permanent slides 20-2013
to 20-2018], URM [permanent slides 20-2019, 20-2020]).
ErymMo_oey: clara (Latin = clear, bright, brilliant, light), referring to the brilliant white
spores.
76 ... Estrada & al.
=o . ee
Pee
Cand
Fics 1-10. Diversispora clara: 1-4. Uncrushed spores with a triple-layered spore wall (sw11-3), a
single, cylindrical subtending hypha (sh), and a septum (sp) arising directly or at some distance
from the base. Fics 5-6. Spores crushed to show triple layered spore wall (SwL1-3). Fics 7-8. Spore
wall structure in PVLG + Melzer’s reagent. The swL1 or sw12 (or both) stain light to dark yellow
in Melzer’s, while no such staining reaction is seen on SwL3. However, the yellow stain is usually
most noticeable in the spore cell contents. Fic. 9. Septum at spore base formed by sw12 (sw13 is
not visible in uncrushed spore). Fic. 10. Septum at spore base formed by sw13.
SPoRES (Fics 1-4) singly formed in rhizosphere soils, terminally on subtending
hyphae, globose (80-110 um diam.) to subglobose (79-130 x 75-125 um), one-
walled, brilliant to creamy white.
SPORE WALL 4.3-8.4 um thick, three-layered (Swil, swL2, SwL3; FIGs 5-7);
outer layer (Swi1) hyaline, 0.8-1.5 um thick, evanescent and thus often
absent in mature spores; second layer (sw12) bright to (rarely) creamy white,
laminated, 2.8-5.4 um thick (Fic. 7) in uncrushed spores (sometimes < 6.6 um
in crushed spores when pressure is applied on the cover slip); inner layer (SwL3)
Diversispora clara sp. nov. (Spain) ... 77
brilliant white, 0.7-1.5 um thick (usually tightly adherent to sw12 and difficult
to observe when < 1.0 um; see Fics 5-6); both swi1 and sw12 generally light to
dark yellow in Melzer’s reagent (Fics 7-8, with spore cell contents often a more
intense yellow than the surrounding cell wall layers (Fic. 8).
SUBTENDING HYPHAE (sh) generally singly on spores; brilliant white
(Fics 1-3), cylindrical or (rarely) slightly constricted at the spore base, 4.0-8.0
um broad tapering to 3.2-6.1 um within 100 um of spore base, although the
distance may appear shorter (4.0-10(-25) um) because the sh walls taper from
1.0-1.8 um thick to 0.6-1.2 um within the first 10 um from the base causing the
flexible fragile portion to break from the mature spore (Fics 3, 4, 9) at a point
where the septum separates the spore contents from the hyphal contents. Spore
pores at the spore bases or in the sh normally closed by a septum (Fics 1-2, 4)
arising from sw12 (Fic. 9), swi3 (Fic. 10), or both layers (not shown); pores
rarely open (Fic. 3).
DISTRIBUTION: Known only in the natural sand dune system of the Cabo de
Gata Natural Park in Andalucia in the rhizosphere of Asteriscus maritimus.
MOLECULAR ANALYSES: Phylogenies derived from ITS (Fic. 11) and 28S (data
not shown) rDNA analyses cluster the new fungus within the Diversisporaceae
in a well-separated clade adjacent to several other Diversispora species, Otospora
bareae, and Tricispora nevadensis (Oehl et al. 2011b).
Discussion
Our morphological analyses, in particular those of the subtending hyphae
and spore bases, clearly support the new fungus in Diversispora, with many
characters identical to those of other Diversispora species (e.g., D. spurca,
D. eburnea; see Oehl et al. 2011a,b) such as the thin-walled, hyaline, cylindrical
(or rarely constricted) subtending hyphae that appear flexible and fragile behind
the septum that closes the pore at the spore base or in short distance from the
base. In Diversispora species with pigmented spores, the subtending hyphae
regularly change color conspicuously, becoming hyaline to white behind the
septum (Oehl et al. 2011a). This color change, however, was not confirmed for
D. clara, since the new fungus generally does not form pigmented spores.
Molecular analyses confirm the species as new: in the phylogenetic tree,
D. clara clusters in a independent, monophyletic clade within a polyphyletic
Diversispora. ‘These sequence analyses also confirm unequivocally using
morphology to identify diversisporoid species within the Glomeromycota (Oehl
et al. 201 1a,c).
Including D. clara, there are now 14 Diversispora spp. known in the
Glomeromycetes (Oehl et al. 2011a,b). The 9 species that form significantly
pigmented, yellow brown to brown or orange to orange brown spores are
D. arenaria (Blaszk. et al.) Oehl et al., D. aurantia (Blaszk. et al.) C. Walker
& A. Schiissler, D. epigaea (B.A. Daniels & Trappe) C. Walker & A. Schiissler,
78 ... Estrada & al.
D. insculpta (Btaszk.) Oehl et al., D. przelewicensis (Blaszk.) Oehl et al.,
D. pustulata (Koske et al.) Oehl et al., D. tenera (P.A. Tandy) Oehl et al.,
D. trimurales (Koske & Halvorson) C. Walker & A. Schiissler, and D. versiformis
(P. Karst.) Oehl et al. (Oehl et al. 2011a,b). Diversispora celata C. Walker et
al. forms triple-layered, ochre to ivory to pinkish cream spores (Gamper et al.
2009). Only D. spurca (C.M. Pfeiff. et al.) C. Walker & A. Schiissler, D. eburnea
(L.J. Kenn. et al.) C. Walker & A. Schiissler, and D. gibbosa (Blaszk.) Blaszk. &
Kovacs form hyaline to subhyaline spores that are, however, never brilliant-
white as observed for D. clara. Moreover, D. spurca and D. eburnea have bi-
layered spore walls (Kennedy et al. 1999), D. gibbosa has a five-layered wall
(Blaszkowski 1997), and D. clara has a three-layered wall.
In the past, large-spored or sporocarpic AM fungi were described from sand
dune systems, such as Gigaspora, Scutellospora, Pacispora or Glomus species
that were generally easy to isolate and recognize from field samples (Koske &
Gemma 1995, Gemma et al. 1989, Blaszkowski 1994). Likewise in the current
Cabo de Gata Natural Park sand dune system, where Funneliformis coronatus
(Giovann.) C. Walker & A. Schtissler, E mosseae (T.H. Nicolson & Gerd.)
C. Walker & A. Schiissler, Scutellospora calospora (T.H. Nicolson & Gerd.)
C. Walker & EE. Sanders, Racocetra persica (Koske & C. Walker) Oehl et al.,
and Glomus macrocarpum Tul & C. Tul. were identified (Estrada, unpublished).
When sand dune AM fungal communities were maintained and reproduced
in bait cultures, small-spored Glomus spp. were also sometimes detected (e.g.
Blaszkowski et al. 2009a,b, 2010). It was supposed that species with small, quickly
degrading spores were difficult to recover or identify only from field samples.
This might also be true for D. clara, even though its laminated wall structure
is clearly persistent. It will be interesting to see whether future taxonomists
will be able to identify the new species directly from field samples, now that
the existence and morphology of this unique, brilliant-white, conspicuous but
small-spored species is known. Morphological spore and molecular root and
spore analyses will hopefully tell us more about the ecology and biogeography
of this fungus that is thus far known only from a single Asteriscus maritimus
rhizosphere in the Natural Park Cabo de Gata of Almeria in southern Spain.
Acknowledgments
This study has been supported by the Junta de Andalucia (Spain), project P06-CVI-
01876 and by the Swiss National Science Foundation (SNSF; Project 315230_130764/1).
We acknowledge the valuable comments on the manuscript and revisions of Dr. Bruno
Tomio Goto (Universidade Federal do Rio Grande do Norte, UFRN, Natal, Brazil), Dr.
Ivan Sanchez-Castro (INRA, Dijon, France) and PD Dr. Ewald Sieverding (University
of Hohenheim, Germany) and appreciate the corrections by Shaun Pennycook,
Nomenclatural Editor, and suggestions by Lorelei L. Norvell, Editor-in-Chief.
Diversispora clara sp. nov. (Spain) ... 79
Acaulospora laevis AJ242499
A. lacunosa AJ891113
100
100
100
Redeckera pulvinata AM418550
R. pulvinata AM418549
41.00
93} 99 _ R megalocarpa AM418552
400| 95 g P
as ee R. megalocarpa AM418551
99) R. fulva AM418547
tool rR. fulva AM418548
1.00 R. fulva AM418545
R. fulva AM418546
72 Diversispora spurca FN547641
100 71
100 76 D. spurca FN547644
100 0.93
1.00 D. spurca FN547637
99 D. aurantia AJ849468
ar D. aurantia FN547661
ari D. aurantia FN547655
a4 D. aurantia FN547657
1.00 es D. celata AM713403
t
88 D. celata AM713402
81 0.86
83 D. celata AM713404
0.09 72| | |r D. eburnea AM713409
a D. eburnea AM713408
O97 D. eburnea AM713416
D. eburnea AM713407
D. clara FR873632
D. clara FR873629
93
ue D. clara FR873633
9,96 D. clara FR873631
D. clara FR873630
D. versiformis FN547635
98 D. versiformis AY842567
a5 D. versiformis FN547674
1.00 D. versiformis AY842569
D. versiformis FN547666
ton Otospora bareae FR865444
ape O. bareae FR865445
1007 Entrophospora nevadensis FR865447
408 E. nevadensis FR865448
1.00. EF nevadensis FR865446
0.1
Fic. 11. Diversisporaceae. ITS rDNA-based phylogenetic tree rooted by Acaulospora laevis and
A. lacunosa. Sequences are labeled with database accession numbers. Support values are from
neighbor-joining (NJ), maximum parsimony (MP), maximum likelihood (ML) and bayesian
analyses. Diversispora clara sequences are in bold. Only topologies with = 50% bootstrap values are
shown. (Consistency Index = 0.72; Retention Index = 0.84).
80 ... Estrada & al.
Literature cited
Altschul SF, Gish W, Miller W, Myers EW, Lipton DJ. 1990. Basic local alignment search tool. J. Mol.
Biol. 215: 403-410. http://dx.doi.org/10.1006/jmbi.1990.9999
Blaszkowski J. 1994. Arbuscular fungi and mycorrhizae (Glomales) of the Hel Peninsula, Poland.
Mycorrhiza 5, 71-88. http://dx.doi.org/10.1007/BF00204022
Blaszkowski J. 1997. Glomus gibbosum, a new species from Poland. Mycologia 89(2): 339-345.
http://dx.doi.org/10.2307/3761092
Btaszkowski J, Ryszka P, Oehl F, Koegel S$, Wiemken A, Kovacs GM, Redecker D. 2009a. Glomus
achrum and G. bistratum, two new species of arbuscular mycorrhizal fungi (Glomeromycota).
Botany 87: 260-271. http://dx.doi.org/10.1139/B08-138
Blaszkowski J, Kovacs GM, Balazs TK. 2009b. Glomus perpusillum, a new arbuscular mycorrhizal
fungus. Mycologia 101(2): 247-255. http://dx.doi.org/10.3852/08-087
Blaszkowski J, Wubet T, Harikumar VS, Ryszka P, Buscot F. 2010. Glomus indicum, a new arbuscular
mycorrhizal fungus. Botany 88: 132-143. http://dx.doi.org/10.1139/B09-104
Brundrett M, Melville L, Peterson L. 1994. Practical methods in mycorrhizal research. Mycologue
Publications, University of Guelph, Guelph, Ontario, Canada.
Ferrol N, Calvente R, Cano C, Barea JM, Azcon-Aguilar C. 2004. Analyzing arbuscular mycorrhizal
fungal diversity in shrub-associated resource islands from a desertification-threatened semiarid
Mediterranean ecosystem. Appl. Soil Ecol. 25: 123-133.
http://dx.doi.org/10.1016/j.apsoil.2003.08.006
Gamper HA, Walker C, Schiifler A. 2009. Diversispora celata sp. nov.: molecular ecology and
phylotaxonomy of an inconspicuous arbuscular mycorrhizal fungus. New Phytol. 182(2):
495-506. http://dx.doi.org/10.1111/j.1469-8137.2008.02750.x
Gemma JN, Koske RE, Carreiro MM. 1989. Seasonal dynamics of five species of VA fungi in a sand
dune. Mycol. Res. 92: 27-32 http://dx.doi.org/10.1016/S0953-7562(89)80072-3
Guindon S, Gascuel O. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies
by maximum likelihood. Systematic Biol. 52: 696-704.
http://dx.doi.org/10.1080/10635150390235520
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NTT. Nucl. Acids Symp. Ser. 41: 95-98.
Hewitt EJ. 1966. Sand and water culture methods used in the study of plant nutrition. Farnham
Royal, Farnham, England: Commonwealth Agricultural Bureau. 547 p.
Kennedy LJ, Stutz JC, Morton JB. 1999. Glomus eburneum and G. luteum, two new species of
arbuscular mycorrhizal fungi, with emendation of G. spurcum. Mycologia 91(6): 1083-1093.
http://dx.doi.org/10.2307/3761638
Koske R., Gemma JN. 1995. Scutellospora hawaiiensis (Gigasporaceae): a new species of arbuscular
mycorrhizal fungi from Hawaii. Mycologia 87: 679-684. http://dx.doi.org/10.2307/3760811
Koske RE, Tessier B. 1983. A convenient, permanent slide mounting medium. Mycol. Soc. Am.
Newsl. 34: 59.
Kriger M, Stockinger H, Kriiger C, Schii%ler A. 2009. DNA-based species-level detection of
arbuscular mycorrhizal fungi: one PCR primer set for all AMF. New Phytol. 183(1): 212-223.
http://dx.doi.org/10.1111/j.1469-8137.2009.02835.x
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F,
Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. Clustal W and
Clustal X version 2.0. Bioinformatics 23: 2947-2948.
http://dx.doi.org/10.1093/bioinformatics/btm404
Milne I, Wright F, Rowe G, Marshal DF, Husmeier D, McGuire G. 2004. TOPALi: Software for
Automatic Identification of Recombinant Sequences within DNA Multiple Alignments.
Bioinformatics 20: 1806-1807. http://dx.doi.org/10.1093/bioinformatics/bth155
Diversispora clara sp. nov. (Spain) ... 81
Mosse B. 1962. Establishment of vesicular-arbuscular mycorrhiza under aseptic conditions. J. Gen.
Microbiol. 27: 509-520.
Oehl F, Wiemken A, Sieverding E. 2002. Glomus caesaris, a new arbuscular mycorrhizal fungus
from the Kaiserstuhl in Germany. Mycotaxon 84: 379-385.
Oehl F, Wiemken A, Sieverding E. 2003. Glomus aureum, a new sporocarpic species in the Glomales
from European grasslands. J. Appl. Bot. 77: 111-115.
Oehl F, Redecker D, Sieverding E. 2005. Glomus badium, a new sporocarpic arbuscular mycorrhizal
fungal species from European grasslands of higher soil pH. J. Appl. Bot. Food Qual. 79: 38-43.
Oehl F, Silva GA, Goto BT, Sieverding E. 2011a. Glomeromycota: three new genera, and glomoid
species reorganized. Mycotaxon 116: 75-120. http://dx.doi.org/10.5248/116.75
Oehl FE Silva GA, Sanchez-Castro I, Goto BT, Maia LC, Vieira HEE, Barea JM, Sieverding E, Palenzuela
J. 2011b. Revision of Glomeromycetes with entrophosporoid and glomoid spore formation, with
three genera nova. Mycotaxon 117: 297-316, http://dx.doi.org/10.5248/117.297
Oehl F, Sieverding E, Palenzuela J, Ineichen K, Silva GA. 2011c. Advances in Glomeromycota
taxonomy and classification. IMA Fungus 2: 191-199.
http://dx.doi.org/10.5598/imafungus.2011.02.02.10
Palenzuela J, Ferrol N, Boller T, Azcén-Aguilar C, Oehl E 2008. Otospora bareai, a new fungal
species in the Glomeromycetes from a dolomitic shrub-land in the National Park of Sierra de Baza
(Granada, Spain). Mycologia 100: 296-305. http://dx.doi.org/10.3852/mycologia.100.2.296
Palenzuela J, Barea JM, Ferrol N, Oehl FE 2010. Entrophospora nevadensis, a new arbuscular
mycorrhizal fungus, from Sierra Nevada National Park (southeastern Spain). Mycologia 102:
624-632, http://dx.doi.org/10.3852/09-145
Palenzuela J, Barea JM, Ferrol N, Oehl F. 2011. Ambispora granatensis, a new arbuscular mycorrhizal
fungus, associated with Asparagus officinalis in Andalucia (Spain). Mycologia 103: 333-340.
http://dx.doi.org/10.3852/09-146
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Sieverding E. 1991. Vesicular-arbuscular mycorrhizal management in tropical agrosystems.
Technical Cooperation (GTZ). Eschborn. Friedland, Bremer, Rossdorf, TZ-Verlagsgesellschaft.
Germany.
Sieverding E, Oehl F. 2006. Revision of Entrophospora and description of Kuklospora and Intraspora,
two new genera in the arbuscular mycorrhizal Glomeromycetes. J. Appl. Bot. Food Qual. 80:
69-81.
Spain JL. 1990. Arguments for diagnoses based on unaltered wall structures. Mycotaxon 38: 71-76.
Swofford DL. 2003. PAUP*. Phylogenetic Analysis Using Parsimony (*and other methods). Sinauer
Associates, Sunderland, Massachusetts.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols: a guide to
methods and applications. Academic Press, San Diego, California.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.83
Volume 118, pp. 83-88 October-December 2011
Asterophora salvaterrensis (Basidiomycota, Agaricales),
a new species from Galicia (Spain)
JAIME B. BLANCO-DIOsS
Centro de Formacion e Experimentacion Agroforestal de Lourizan,
Conselleria de Medio Rural, Xunta de Galicia, RO. Box 127.36080, Pontevedra,Spain
* CORRESPONDENCE TO: [email protected]
ABSTRACT—Asterophora salvaterrensis, collected in Pinus pinaster forests in Galicia
(northwest Iberian Peninsula), is described as new and compared with other known
Asterophora species. The new species is distinguished by its zonate greenish brown to
brownish ochre pileus with whitish margin that blackens, decurrent obtuse furfuraceous grey
lamellae, furfuraceous brown to blackish stipe, black context, nondistinctive odor and taste,
and small basidiospores. A key to all known Asterophora species is provided.
Key worps—Lyophyllaceae, parasitic fungi, taxonomy
Introduction
Mycological studies conducted during the last decades in the forests
of maritime pine (Pinus pinaster Aiton) in the Mifo river basin of Galicia
(northwestern Spain) have produced interesting discoveries, such as the new
species, Sparassis miniensis Blanco-Dios & Zheng Wang (Blanco-Dios et al.
2006). In this territory, several samples of a remarkable species of Asterophora
Ditmar were recently collected on a russulaceous host (Russula sp.).
Species of Asterophora (Lyophyllaceae) are among the few agarics that grow
on basidiomata of other fungi (the most common hosts are russulaceous species,
mainly in Lactarius Pers. and Russula Pers.). The genus is further distinguished
by the production of chlamydospores. Asterophora is phylogenetically placed in
Lyophyllaceae (Matheny et al. 2006).
Today, only three well documented species of Asterophora are accepted:
A. lycoperdoides (Bull.) Ditmar, A. parasitica (Pers.) Singer, and A. mirabilis
(T.W. May) Redhead & Seifert (May & Fuhrer 1995; Redhead & Seifert 2001a,b;
Vizzini 2009). Our collections, which do not fit the morphological concept of
any of these taxa, are described here as a new species.
A key to the known species of Asterophora is provided.
84 ... Blanco-Dios
Materials & methods
Macro- and micromorphological descriptions are based on observations of both
fresh and dried specimens. L = number of lamellae; Q = quotient of length /width of
an individual spore and avQ is the average Q. All the micromorphological structures
were measured in Melzer’s or 3% KOH, except for the pileipellis and stipitipellis
hyphae, which were measured in 10% ammonia. Spore measurements do not include
the hilar appendage. The length of intercalary chlamydospores was measured from the
septum of one subtending hypha to the septum of the other; the length of terminal
chlamydospores was measured from basal septum to apex. All specimens, including
the holotype, are kept in LOU-Fungi herbarium (Centro de Investigacién Forestal de
Lourizan, Pontevedra, Spain).
Taxonomy
Asterophora salvaterrensis Blanco-Dios, sp. nov. PLATE 1, Fic. 1
MycoBank MB 519728
Pileus 0.5-4 mm latus, planus leviter depressus, non hygrophanus, haud traslucenter
striatus, zonatus, ab brunneo-viridulus ad brunneo-ochraceus, ad medium brunneus,
aliunde albidus, nigrescens. Lamellae decurrentes, dispersae, obtusatae, furfuraceae,
griseae. Stipes 1.5-10 mm longus, 0.5-1.5 mm latus, plenus, furfuraceus, brunneus vel
brunneo-nigrescens. Caro nigrescens, parce conspicua. Odor et sapor haud notabiles. Sporae
2.5-3.2(-4.5) x (1.2-)1.8-2.5 um, Q = 1.29-2, ellipsoidaeae vel oblongae, laeves. Basidia
tetrasporigera, fibulata. Acies lamellarum fertilis. Chlamydosporae (12-)13-17.5(-20.5) x
(7.3-)8.5-10.5(-11.5) um Q=1.26-2, ellipsoidaeae vel oblongae, laeves. Fibulae praesentes.
Ad basidiomata corruptas Russulae nigricantis.
Type: Spain: Pontevedra, Salvaterra de Mifio, Leirado. Collected by J.B.Blanco-Dios,
1-XII-2009 (Holotype: LOU-Fungi 19491).
EryMo.oey: salvaterrensis, from the municipality of Salvaterra de Mino (Galicia,
Spain).
PiLEus 0.5-4 mm diam., plano-convex to flattened with depressed centre,
margin first involute, then broadly wavy, not hygrophanous or translucently
striate, zonate, brown at the disc, greenish brown to brownish ochre elsewhere
with the margin whitish, blackening with age or handling. LAMELLAE < 1 mm
broad, decurrent, scattered (L = 8-10), thick, not forked, entirely furfuraceous
over a grey pale or grey colour, edge concolourous, even, obtuse, lamellulae
absent. Stipe 1.5-10 x 0.5-1.5 mm, central, even or a bit expanded above or
attenuate, filled, entirely furfuraceous over a brown or blackish brown surface.
CONTEXT very thin, black when exposed, finally brown to ochre. ODOR AND
TASTE nondistinctive. SPORE PRINT whitish.
BASIDIOSPORES 2.5-3.2(-4.5) x (1.2-)1.8-2.5 um, Q = 1.29-2, avQ = 1.47,
(n = 30), sparse, ellipsoid to oblong, smooth, thin-walled, not amyloid. Bastp1a
(10-)13-19 X 4-7 um, sparse, broadly clavate, 4-spored, sterigmata up to 2.5
um long, siderophilous. CHLAMYDOSPORES (12-)13-17.5(-20.5)x (7.3-)
8.5-10.5(-11.5) um, Q = 1.26-2, avQ = 1.56, numerous in the lamellar trama,
Asterophora salvaterrensis sp. nov. (Spain) ... 85
PLaTE. 1. Asterophora salvaterrensis (holotype). Habit.
Photos by Amancio Castro.
86 ... Blanco-Dios
0006
9000
Fic. 1. Asterophora salvaterrensis (holotype).
a. basidiospores; b.basidia; c. chlamydospores. Scale bars = 10 um.
in the pileal trama above the lamellae, and on the pileus surface, numerous also
in the host tissue, intercalary or terminal, smooth, ellipsoid to oblong, hyaline
then pale yellow, at length with an inner wall up to 0.5 um thick which excludes
a segment adjacent to each subtending hypha (the basal portion of terminal
chlamydospores is similarly excluded), enclosing contents which are granular
and with small and large, refractive droplets. CysTip1a not seen. PILEIPELLIS a
cutis, consisting of parallel, cylindrical hyphae, 1.5-10 um diam., thin walled,
radially arranged, with ochre intracellular pigment. STIPITIPELLIS a cutis,
composed of parallel, cylindrical hyphae, 1.5-9 um diam., thin walled. CLamp
CONNECTIONS present in all tissues.
ECOLOGY & DISTRIBUTION— On blackened and rotten Russula nigricans
basidiomata, growing together with Asterophora lycoperdoides and A. parasitica
in a Pinus pinaster forest. Known only froma single locality in Spain. November-
December.
COLLECTIONS EXAMINED: SPAIN: PONTEVEDRA: SALVATERRA DE MINO, Leirado,
29TNG4565, 110 m, forest of Pinus pinaster, on basidiomata of Russula nigricans,
1.X1I.2009, leg. J.B.Blanco-Dios, LOU-Fungi 19491 (holotypus); 24.X1.2009, leg.
J.B.Blanco-Dios, LOU-Fungi 19490.
OTHER COLLECTIONS EXAMINED: Asterophora lycoperdoides - SPAIN: A CORUNA:
Brion, Adoufe, 29TNH2645, 70 m., on basidiomata of Russula nigricans, 19.XII.1977,
leg. L. Cabo Rey, LOU-Fungi 0114; Santraco, bosque de la Condesa, 29TNH3747,
Asterophora salvaterrensis sp. nov. (Spain) ... 87
250 m., on basidiomata of Russula nigricans, 23.X.1975, leg. L. Freire, LOU-Fungi
0112. PONTEVEDRA: A EstTRADA, Arnois, 29TNH4834, 60 m., on basidiomata of
Russula nigricans, 23.X.1975, leg. L. Freire, LOU-Fungi 0116; ViILAGARCIA DE AROUSA,
29TNH1916, 20 m., on basidiomata of Russula sp, 18.X1.1987, leg.: E.Valdés-Bermejo,
LOU-Fungi 0113.
Asterophora parasitica - SPAIN: A CoruNa: Bridn, Adoufe, 29TNH2645, 70 m.,
on basidiomata of Russula nigricans, 12.X1.1981, leg. L. Cabo Rey, LOU-Fungi 0117;
CAMBRE, Cecebre, Fraga de Cecebre, 29TNH5794, 100 m., on basidiomata of Russula sp.,
17.X1.1990, leg. L. Freire, LOU-Fungi 4557; PUEBLA DO CARAMINAL, Cabio, 29TNH0514,
10 m., on basidiomata of Russula densifolia Secr. ex Gillet, 25.X1.1989, leg. M. Martinez
Campos, LOU-Fungi 6930; on basidiomata of Russula nigricans, 08.X11.1984, leg. L.
Freire & M. L. Castro, LOU-Fungi 0121. Lugo: MONDONEDO, Couboeira, 29TPJ3215,
100 m., on basidiomata of Russula sp., 3.X.1992, leg. S. Cabanela, LOU-Fungi 5844.
ComMENTS. Asterophora salvaterrensis is unique with respect to the other
known Asterophora species —A. lycoperdoides, A. parasitica, A. mirabilis— by
the following combination of features: (i) the zonate pileus which is brown
at the disc, greenish brown to brownish ochre towards margin and whitish
at the margin, (ii) the pileus-surface turning blackish with age or handling,
(iii) the decurrent lamellae, which are furfuraceous and grey-tinged, (iv) the
furfuraceous stipe-surface over a brown or blackish-brown cortical layer, (v)
the context blackening when exposed and lacking a distinct smell and taste.
From the micromorphological point of view the small, ellipsoid to oblong
basidiospores associated with large, smooth, ellipsoid to oblong chlamydospores
are typical and diagnostic. Some stellate chlamydospores (from basidiomata of
Asterophora lycoperdoides),13-16.5 x 12-15 um, were seen in the pileipellis,
lamellae, and stipitipellis surface.
Asterophora lycoperdoides differs by having stellate chlamydospores, formed
in the upper pileal trama. Additionally, this species frequently does not produce
basidiospores, has a globose to pulvinate pileus with a powdery surface, and
shows often only rudimentary lamellae. Asterophora parasitica also frequently
does not produce basidiospores, has a convex to umbonate pileus with a
typically silky surface and obtuse but comparatively well-formed lamellae.
Both of these species cover a similar geographic range spanning through North
America, Europe, North Africa, East Asia, and Papua New Guinea (Corner
1966, Horak 1980, Singer 1986). Asterophora mirabilis, known from Australia
(Victoria and Tasmania), is similar to A. parasitica, but differs in producing
stellate chlamydospores that are numerous in the lamellar trama and pileal
trama above the lamellae and sparse to absent in the upper pileal trama and on
the pileus surface (May & Fuhrer 1995).
From the taxonomic point of view, owing to the fact that it produces only
smooth chlamydospores, Asterophora salvaterrensis seems to be close to
Asterophora parasitica from which it is easily distinguished by greenish-brown
to greenish-ochre zonate pileus and much smaller basidiospores.
88 ... Blanco-Dios
Key to the known species of Asterophora
bar GC blamiydosparesistellatees £4chcchs dds Ad BR a Rg Ey 2
LBAE WamMiyAOS POLES: SIO ORD 5h fon he fe aie Beale eee 2 be ae RN LAR Nas ot 3
2a. Pileus surface powdery; chlamydospores formed in the upper pileal trama
ws tis oS Siig Be Seta he Mey: Ma Sees WE Ricci, WE pe Se Mipy 8 Ri se IS A. lycoperdoides
2b. Pileus smooth; chlamydospores formed in the lamellar trama
and pileal trama above the lamellae............... 0... eee eee eee A. mirabilis
3a. Pileus white or grey with a silky surface, not zonate;
basidiospores, 5-6, 52554: Wiis e505 Fs FE AR Whaat UT A. parasitica
3b. Pileus brown-greenish-ochre, zonate;
basidiospores 2:5=3r -* 1.8-2.5 aime sn, See gee cle! A. salvaterrensis
Acknowledgements
The author is grateful to Drs. Scott A. Redhead and Tom W. May for kindly sending
relevant literature. Drs. Alfredo Justo, Alfredo Vizzini, and Marco Contu are thanked
for critically reviewing an earlier draft of this paper. Amancio Castro is gratefully
acknowledged for providing the photographs. Finally I express my most sincere thanks
to the direction and members of the Centro de Investigacién Forestal de Lourizan
(Conselleria de Medio Rural, Xunta de Galicia) for curating the herbarium LOU-
Fungi.
Literature cited
Blanco-Dios JB, Wang Z, Binder M, Hibbett DS. 2006. A new Sparassis from Spain described using
morphological and molecular data. Myc. Res. 110: 1127-1134. http://dx.doi.org/10.1016/
j-mycres.2006.07.012.
Corner EJH. 1966. A monograph of cantharelloid fungi. Ann. Bot. Mem. 2: 1-255.
Horak E. 1980. New and remarkable hymenomycetes from tropical forests in Indonesia (Java) and
Australasia. Sydowia 33: 39-63.
Matheny PB, Curtis JM, Hofstetter V, Aime MC, Moncalvo J-M, Ge Z-W, Yang Z-L, Slot JC,
Ammirati JF, Baroni TJ, Bougher NL, Hughes KW, Lodge DJ, Kerrigan RW, Seidl MT, Aanen
DK, DeNitis M, Daniele GM, Desjardin DE, Kropp BR, Norvell LL, Parker A, Vellinga EC,
Vilgalys R, Hibbett DS. 2006. Major clades of Agaricales: a multilocus phylogenetic overview.
Mycologia 98(6): 982-995.
May TW, Fuhrer BA. 1995. Nyctalis mirabilis (Fungi, Agaricales), a new species from Australia.
Muelleria 8: 385-390.
Redhead SA, Seifert KA. 2001a. Asterophora Ditmar ex Link 1809 versus Nyctalis Fries 1825, and
the status of Ugola Adanson 1763. Taxon 50: 243-268. http://dx.doi.org/10.2307/1224526
Redhead SA, Seifert KA. 2001b. Proposal to conserve the name Agaricus lycoperdoides Bull.
(=Asterophora lycoperdoides (Bull.) Ditmar against Asterophora agaricoides Fr.: Fr. and
Asterophora lycoperdoides Fr.: Fr. Taxon 50: 279-280. http://dx.doi.org/10.2307/1224530
Singer R. 1986. The Agaricales in modern taxonomy. 4th ed. Koeltz Scientific Books. Koenigstein.
Vizzini A. 2009. Revisione del genere Asterophora ed introduzione allo studio delle Lyophylleae. 371-
376, in: J-C Maire et al. (eds). Compléments a la Flore des champignons supérieurs du Maroc de
G. Malencon et R. Bertault. Confédération Européenne de Mycologie Méditerranéenne, Nice.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.89
Volume 118, pp. 89-94 October-December 2011
Amicodisca castaneae sp. nov.
(Hyaloscyphaceae, Helotiales) on Japanese chestnut bur
JAE-Gu Han’, TsuyosHi Hosoya? & HYEON-DONG SHIN”
"Division of Environmental Science and Ecological Engineering,
College of Life Sciences and Biotechnology, Korea University,
Seoul 136-701, Korea
*Department of Botany, National Museum of Nature and Science,
4-1-1 Amakubo, Tsukuba, Ibaraki 305-0005, Japan
*CORRESPONDENCE TO: [email protected]
ABSTRACT— Amicodisca castaneae sp. nov. was collected on Japanese chestnut bur. It differs
from all known members of Amicodisca by having brownish apothecia and smaller asci and
ascospores. A key to the accepted Amicodisca species is given.
KEY worpDs— Castanea crenata, discomycetes, species nova, taxonomy
Introduction
Svréek (1987) established a monotypic genus Amicodisca Svréek, typified
by Amicodisca brdensis (Velen.) Svréek (= Dasyscyphus brdensis Velen.), which
is characterized by yellowish to olivaceous colored excipulum and hairs,
ascospores bearing lemon-yellow pigment dissolving in NH,OH or KOH
solutions, and fimbriate dehiscence of the ascus pore. Amicodisca viridicoma
(Peck) J.H. Haines, A. svrcekii Raitv. & Huhtinen, and A. groenlandica Raitv.
were later additionally described (Haines 1989; Raitviir 2001, 2003). Since
Huhtinen (1994) proposed A. virella (P. Karst.) Huhtinen (with its earlier
basionym) as the correct name for the type species, and Raitviir (2004) listed A.
viridicoma as a synonym of A. virella, there are three species now recognized.
In the course of extensive survey on the fungal biodiversity in Korea, an
interesting discomycete with small apothecia surrounded with yellowish hairs
was collected on fallen burs of Japanese chestnut (Castanea crenata Siebold
& Zucc.). Its gross morphology and microscopic features fit well with those
of Amicodisca, but it is clearly different from the known species in having
remarkably smaller asci and ascospores and by host preference. Here, we
describe and illustrate this fungus as new to science.
90 ... Han, Hosoya & Shin
Materials & methods
Fresh materials were primarily mounted in distilled water to confirm the natural
colors of their microstructures. Dried materials were revived in 3-10% aqueous KOH.
Amyloid reactions were tested by Melzer’s reagent (MLZ) or Lugol's solution (IKI)
without KOH pretreatment. Olympus BX50 microscope equipped with a drawing
tube (Olympus U-DA) was used for measurements and line drawings. Structures were
measured at 1000x; measurements are reported as follows: minimum-—maximum
(length) x minimum-maximum (width) [mean length + standard deviation x mean
width + standard deviation, Q (I/w ratio) = average + standard deviation]. All specimens
examined are deposited in the Herbarium of Korea University, Seoul, Korea (KUS) or
National Museum of Nature and Science, Tsukuba, Japan (TNS).
Taxonomy
Amicodisca castaneae J.G. Han, Hosoya & H.D. Shin, sp. nov. Fics. 1-2
MycoBAank 561134
Apothecia sessilia, bruneta, receptaculo dense sulphureo longipiloso. Pili cylindro-conique,
2-5-septati, tenuiter tunicatis, 63-107 x 2-3 um. Excipulum ectale ex textura angularis ad
prismatica compositur. Asci non uncinati, cinereae, 38-57 x 4-5.2 um. Sporae ellipsoidea
ad clavato-ellipsoideae, hyalinae ad cinereae, 4.8-7 x 1.4-2 um. Ab Amicodiscae svrcekii
ascosporis brevius et pili septatae differens.
Type: The inner surface of chestnut bur (Castanea crenata), Korea, Goesan, Songnisan
National Park, 36°44'42.54"N, 128°53'53.33”E, 320 ma.s.L, 5 Oct. 2007, J.G. Han & H.D.
Shin (KUS-F51917 Holotype; TNS-F32105 Isotype).
ErymMo.ocy: The specific epithet refers to the generic name of the host.
APOTHECIA superficial, scattered to gregarious, developed on well-developed
anchoring hyphae, broadly sessile; RECEPTACLE at first globose to cupulate,
then becoming discoid, externally covered by yellowish white hairs, turning
reddish-brown when dry; Disc up to 3 mm in diameter, greyish-brown to
chestnut when fresh, turning dark brown to dark grey when dry; Harrs
cylindric-conical, straight, gradually tapering toward the apex, hyaline to
yellowish, 2-5-septate, thin-walled, smooth, apex not sharply pointed, up to
3 um wide near the base, 63-107 um long; ECTAL EXCIPULUM yellow to light
brown, composed of thin-walled angular to rectangular cells, 7-12 x 4-7 um;
AscI arising from simple septa, cylindric-clavate, yellowish, 8-spored, apical
pore blued in MLZ and IKI without KOH pretreatment, 38-57 x 4-5.2 um
(45.2 + 4.19 x 4.5 + 0.41 um, n = 50); Ascosporss biseriate, ellipsoid to clavate
or ovoid, hyaline to light yellow, aseptate, eguttulate, occasionally containing a
central guttule, smooth, 4.8-7 x 1.4—2 um (5.7 + 0.69 x 1.6 + 0.18 um, Q = 3.6 +
0.62, n = 120); PARAPHysSES filiform, hyaline to yellowish, septate, slightly bent,
sometimes branched, slightly exceeding the asci, up to 1.5 um wide.
ADDITIONAL SPECIMENS EXAMINED - the inner surface and spines of chestnut
bur: KOREA, Wownju, Chiaksan National Park, Geumdae valley, 37°17'44.44"N,
128°01'10.34"E, 370 m as.l, 9 Sep. 2006, J.G. Han & H.D. Shin (KUS-F51377);
Amicodisca castaneae sp. nov. (Korea) ... 91
Fic. 1. Amicodisca castaneae (holotype KUS-F51917). A: Fruiting bodies on a fallen bur of Castanea
crenata, B: Sessile apothecia densely gregarious, C: An immature apothecium, globose to cupulate,
D: A mature apothecium, expanded. Scale bar: C-D = 1 mm.
92 ... Han, Hosoya & Shin
BORYEONG, Oseosan recreation forest, 36°26'31.52”N 126°40'3.2"E, 240 m a.s.l., 27 Oct.
2007, J.G. Han & H.D. Shin (KUS-F51993).
Discussion
Amicodisca is a small group of hyaloscyphaceous discomycetes characterized
by a lemon-yellow colored excipulum, hairs, and ascospores (Svréek 1987).
Although its dark globose ectal cells and translucent greyish hymenium
suggest a relationship to Dermateaceae, many authors (Svréek 1987; Haines
1989; Huhtinen 1994; Huhtinen & Less@e 2001; Raitviir 2003, 2004) have
preferred to assign the genus to the Hyaloscyphaceae based on the presence of
distinct hairs. Dematioscypha Svréek is similar to Amicodisca in having a dark
excipulum and cylindric hairs with tapering apices, but differentiate the genus
by its hyaline hairs with glassy apices, inamyloid ascal pore, and association
with a Haplographium anamorph. Superficially, it is also reminiscent of
Dennisiodiscus Svréek in sessile apothecia with greyish hymenium and bright
colored surrounding hairs, but differs in hairs encrusted by reddish brown
granules and growing on culms or leaves of monocotyledonous hosts.
Macroscopically, the present fungus is easily discriminated from other
species by relatively large apothecia (< 3 mm diam.) with brownish hymenium.
In contrast, all known species of Amicodisca produce greyish or olivaceous
apothecia and are usually smaller than 1 mm in diameter. Amicodisca castaneae
is microscopically closest to A. svrcekii and A. virella, but their larger ascospores
(8-11 and 17-25 um long, respectively) and slightly narrower paraphyses
(0.8 and 1 um broad, respectively) are different. Amicodisca groenlandica
strikingly differs in much larger asci (92-116 x 12-15 um) and ascospores
(20-27 x 3-5 um).
The specificity of A. castaneae to chestnut burs seems to be another notable
feature. Hitherto all known Amicodisca species have been collected on woody
substrates (Raitviir 2004), such as Alnus, Betula, Salix, Sambucus, and other
deciduous trees.
A key to the accepted species of the genus is provided below.
Key to the accepted species of Amicodisca
la. Fruiting bodies formed on chestnut bur; disc brownish ............ A. castaneae
1b. Fruiting bodies formed on woods; disc greyish or olivaceous ...............4. 2
2a (1b). Disc pale greenish-olivaceous when fresh, becoming dark green when dry;
ascilonGer, than-SO iii tes eie we, Me tem hein, Mita s eet aes tann pests A. groenlandica
2b. Disc greyish when fresh and dry; asci shorter than 80 um ................006. 3
3a (2b). Ascospores 8-11 x 1.8-2.5 UM ......... eee eee eee ee eee A. svrcekii
Sb: ASCosporesyl 7225 9CA— Git” Le Paice pela a elaine dle lant a aed gn dlanatend as A. virella
Amicodisca castaneae sp. nov. (Korea) ... 93
B
gq lee
Tee CAE
VO
E
Fic. 2. Amicodisca castaneae (holotype KUS-F51917). A: 8-spored asci, note on the apical pore blued
in MLZ, B: Ellipsoid to ovoid ascospores with pale yellowish pigments, C: Filiform paraphyses, D:
Cylindric hairs with tapering apices, E: Brownish ectal excipulum composed of texture angularis to
prismatica. Scale bars: A and C-E = 20 um, B = 10 um.
94 ... Han, Hosoya & Shin
Acknowledgements
The authors are grateful to Dr. Seppo Huhtinen (Herbarium, University of Turku,
Finland) and Dr. Peter Johnston (Landcare Research, New Zealand) for kindly reading
the manuscript and suggesting appropriate revisions. This work was supported bya grant
from Regional Subgenebank Support Program of Rural Development Administration,
Republic of Korea.
Literature cited
Haines JH. 1989. Studies in the Hyaloscyphaceae V: Species described by C.H. Peck. Mycotaxon
$5:3:17=352,
Huhtinen S. 1994. Finnish records of discomycetes: type studies on some Karsten species. Karstenia
34: 5-12.
Huhtinen S, Leessae T. 2001. Amicodisca - en skivesvampeslegt med to smukke, mennesten ens
arter. Svampe 43: 43-47.
Raitviir A. 2001. Taxonomic notes on Dematioscypha and Amicodisca. Czech Mycol. 52: 289-294.
Raitviir A. 2003. New or forgotten Helotiales from Greenland 1. Dermateaceae and Hyaloscyphaceae.
Mycotaxon 87: 359-378.
Raitviir A. 2004. Revised synopsis of the Hyaloscyphaceae. Scripta Mycol. 20: 1-133.
Svréek M. 1987. New or less known discomycetes. XV. Czech Mycol. 41: 16-25.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/118.95
Volume 118, pp. 95-101 October-December 2011
Pseudocercospora epidendri sp. nov. on the neotropical orchid,
Epidendrum secundum from Brazil
MEIRIELE DA SILVA & OLINTO LIPARINI PEREIRA*
Departamento de Fitopatologia, Universidade Federal de Vicosa
Vicosa, Minas Gerais, 36570-000, Brazil
* CORRESPONDENCE TO: [email protected]
ABSTRACT — A new leaf spot disease was observed on the orchid species Epidendrum
secundum in “high altitude grasslands” of Araponga, Minas Gerais State, Brazil. Inoculation
tests on healthy plants confirmed the pathogenicity of this fungus. Pseudocercospora epidendri
sp. nov., the causal agent of the leaf spot disease of E. secundum, is described, illustrated, and
compared with allied Pseudocercospora species on hosts of the family Orchidaceae.
KEY worps — cercosporoid hyphomycetes, phytopathology, plant disease, tropical fungi
Introduction
Epidendrum secundum is an orchid species with epiphytical or terrestrial
habitat, characteristic of the Brazilian “high altitude grasslands” (PLATE 1)
and the Brazilian Cerrado (Caiafa & Silva 2005, Neto et al. 2007). In 2002,
exploratory research was begun with the goal of describing the phytopathogenic
mycodiversity associated with Orchidaceae in the state of Minas Gerais (Pereira
et al. 2002, Pereira & Barreto 2004, Silva & Pereira 2007, 2008, Silva et al. 2008,
Lopes et al. 2009, Pereira & Silva 2009). During an initial botanical survey in
the “high altitude grasslands” of Parque Estadual da Serra do Brigadeiro in
Araponga in Minas Gerais State, Brazil, samples of the orchid E. secundum
with leaf spots caused by a cercosporoid hyphomycete were collected (PLATE
2-3). Our morphological characterization showed that the leaf-spotting fungus
represented a new species of Pseudocercospora, which we describe, illustrate,
and discuss below.
Material & methods
Samples of infected E. secundum leaves were collected, photographed (SONY
DSC-H9 digital camera), dried in a plant press, and deposited at the herbarium of
Universidade Federal de Vicosa (VIC). Fungal samples were removed from fresh
96 ... Silva & Pereira
> ww
le \ -
Pes . \
-
PiaTeE 1. Terrestrial Epidendrum secundum in the “high altitude grasslands” of the Parque
Estadual da Serra do Brigadeiro, Araponga, State of Minas Gerais, Brazil.
leaf spots under an Olympus SZX7 stereomicroscope and mounted on glass slides
with lactophenol. Material was also hand sectioned for stromata observation and
measurements. Structures were observed, measured (30 of each structural type), and
illustrated under 400x magnification using an Olympus BX 50 light microscope fitted
with a drawing tube. To determine pathogenicity, the fungus was isolated directly onto
PDA, brought into pure culture, and grown at 27°C for 20 days. Culture disks taken
Pseudocercospora epidendri sp. nov. (Brazil) ... 97
-
. )
-
\\ aN
-- in nd
¥
3
PLATE 2-3. Pseudocercospora epidendri. Detail of infected leaf, showing delimited and
irregular necrotic spots. 2. Adaxial leaf surface. 3. Abaxial leaf surface.
from colony borders were used to inoculate four healthy young and mature leaves of
three E. secundum plants. The inoculated plants were maintained in moist chambers for
three days and then transferred to a greenhouse at 25°C and 70-80% humidity. Healthy
leaves, on which only PDA plugs were placed, served as control. This assay was carried
in three replications.
98 ... Silva & Pereira
PiaTE 4-5. Pseudocercospora epidendri (VIC 30553, holotype). 4. Pigmented conidiophores
with inconspicuous conidiogenous cells. 5. Solitary, pluriseptate conidia, with inconspicuous
unthickened and not darkened scars. Bar: 10 um.
Taxonomy
Pseudocercospora epidendri Meir. Silva & O.L. Pereira, sp. nov. PLATE 4-5
MycoBAnk 519630
Differt a Pseudocercospora odontoglossi conidiphoris non ramosae et brevioribus, 10-57
x 2-6 um; conidiis brevioribus 11-86 x 1-3 um.
Ho.otyPe: BRAZIL, Minas Gerais, Araponga, Parque Estadual da Serra do Brigadeiro,
on leaves of Epidendrum secundum Jacq. (Orchidaceae), 08 Jan. 2008, O. L. Pereira (VIC
30553, holotype). Ex-type culture OLP 30553 (Universidade Federal de Vicosa).
EryMo_oey: referring to the host genus Epidendrum.
Pseudocercospora epidendri sp. nov. (Brazil) ... 99
PLATE 6. Necrotic symptoms on leaves of Epidendrum secundum 8 days after inoculation with
Pseudocercospora epidendri.
Leaf spots distinct, scattered over leaves, amphigenous, irregular, pale brown,
delimited by a black margin on abaxial and adaxial leaf surfaces, 3-12 mm
diam. Stromata well-developed, immersed, becoming erumpent, brown,
47.5-166 um wide and 57-213 um high. Caespituli commonly hypophyllous,
brown. Conidiophores fasciculate, brown, becoming paler towards apex,
unbranched, smooth, 0-2 septate, subcylindrical, straight to curved, arising
from cells of a well-developed stroma, 10-57 x 2-6 um. Conidiogenous cells
terminal, integrated, pale brown, smooth 3-4.5 x 2-3.5 um. Conidiogenous
loci inconspicuous, not darkened, unthickened. Conidia solitary, acicular
to obclavate, 11-86 x 1-3 um, 1-9 septate, straight to curved, pale brown,
smooth, guttulate, base rounded to long obconically truncate hila unthickened,
not darkened.
Cultures on PDA slow growing, 1.5-2.0cm after 30 days at 27°C, stromaticand
immersed in center, grayish aerial mycelium, black reverse, no sporulation.
ComMENTS — Dark sunken necrotic symptoms were detected 8 days after
artificial inoculation on all inoculated leaves, with structures formed 20-30
days after inoculation. Uninoculated control leaves, on which only PDA plugs
were placed, remained healthy. The same fungus was then re-isolated, from
the symptom in the inoculation assay (PLATE 6). Thirteen cercosporoid species
are known to occur on orchidaceous hosts: Cercospora angraeci Feuilleaub.
100 ... Silva & Pereira
TABLE 1. Pseudocercospora spp. known to occur on Orchidaceae.
CONIDIOPHORES CONIDIA CAESPITULI HOST GENERA
SPECIES (um) (um)
P. cypripedii 10-40 x 3-5 30-150 x mainly Cypripedium
3-5 epiphyllous
P. dendrobii 10-100 x 2-5 15-80 x Dendrobium
hypophyllous
2-4.5
P. peristeriae 10-60 x 2.5-6 40-100 x mainly Peristeria
2-5 hypophyllous
P. odontoglossi 50-200 x 3-5.5 35-100 x hypophyllous Cattleya, Cymbidium,
3-5 Dendrobium, Epidendrum,
Laelia, xLaeliocattleya,
Odontoglossum
P. epidendri 10-57 x 2-6 11-86 x mainly Epidendrum
1-3 hypophyllous
& Roum., C. cephalantherae Ondiej & Zaviel, C. epidendronis Bolick,
C. epipactidis C. Massal., C. eulophiae M.S. Patil, C. habenariicola Meeboon et al.,
Ramularia epipactidis U. Braun & Rogerson, Pseudocercospora cypripedii (Ellis
& Dearn.) U. Braun & Crous, P. dendrobii Goh & W.H. Hsieh [= P. dendrobii
(H.C. Burnett) U. Braun & Crous, nom. illegit.], P. odontoglossi (Prill. & Delacr.)
U. Braun, P. peristeriae (H.C. Burnett) U. Braun & Crous, Stenella orchidacearum
U. Braun & Sivap., and S. cyrtopodii Dorn.-Silva et al. (Chupp 1954, Hsieh &
Goh 1990, Crous & Braun 2003, Braun & Crous 2007, Dornelo-Silva et al. 2007,
Meeboon et al. 2007). Pseudocercospora epidendri is the fifth Pseudocercospora
species known to occur on the Orchidaceae (TABLE 1) and the second known
to occur on Epidendrum (P. odontoglossi was the first reported to occur on that
genus.) Pseudocercospora cypripedii and P. odontoglossi can be distinguished
from P. epidendri by their longer and wider conidia (Chupp 1954), while
P. dendrobii produces narrower conidia (Crous & Braun 2003) and P. peristeriae
is diagnosed by superficial hyphae with solitary conidiophores (Meeboon et
al. 2007). Almost all P. epidendri caespituli were hypophyllous but not formed
through stomata, which may indicate an adaptation for the high solar incidence
typical of Brazilian “high altitude grasslands”.
Acknowledgments
The authors wish to thank Uwe Braun (Institute of Biology, Martin-Luther-
University, Germany) and Jamjan Meeboon (Faculty of Agricultural Technology,
Chiang Mai Rajabhat University, Thailand) for reviewing the manuscript. This work is
part of an ongoing program of surveying and describing the phytopathogenic and the
endophytic mycodiversity associated to the family Orchidaceae in the state of Minas
Gerais supported by grants from Fundacao de Amparo a Pesquisa do Estado de Minas
Gerais - FAPEMIG (project 279/07) and the CNPq fellowship for O.L. Pereira.
Pseudocercospora epidendri sp. nov. (Brazil) ... 101
Literature cited
Braun U, Crous PW. 2007. The diversity of cercosporoid hyphomycetes — new species, combinations,
names and nomenclatural clarifications. Fungal Diversity 26: 55-72.
Caiafa NA, Silva AF. 2005. Composicao floristica e espectro biolégicode um campo de altitude no
Parque Estadual da Serra do Brigadeiro, Minas Gerais-Brazil. Rodrigésia 56: 163-173.
Chupp C.1954. A monograph of the fungus genus Cercospora. Ithaca, Published by the author.
Crous PW, Braun U. 2003. Mycosphaerella and its anamorphs: 1. Names published in Cercospora
and Passalora. CBS Biodiversity Series 1.571 p.
Dornelo-Silva D, Pereira-Carvalho RC, Dianese JC. 2007. New Stenella and Parastenella species from
the Brazilian cerrado. Mycologia 99: 753-764. http://dx.doi.org/10.3852/mycologia.99.5.753
Hsieh WH, Goh TK. 1990. Cercospora and similar fungi from Taiwan. Maw Chang Book Company,
Taipei. 376 p.
Lopes UP, Zambolim L, Pereira OL. 2009. First report of Lasiodiplodia theobromae causing leaf
blight on the orchid Catasetum fimbriatum in Brazil. Australasian Plant Disease Notes 4:
64-65.
Meeboon J, Hidayat I, Nakashima C, To-Anun C. 2007. Cercospora habenariicola sp. nov. and some
new records of cercosporoid fungi from Thailand. Mycotaxon 99: 117-121.
Neto LM, Alves RJV, Barros F, Fonzza RC. 2007. Orchidaceae do Parque Estadual de Ibitipoca, MG,
Brasil. Acta Botanica Brasilica 21: 93-101.
Pereira OL, Barreto RW. 2004. First report of Sphenospora kevorkianii (Raveneliaceae) on the orchid
Catasetum fimbriatum in Brazil. Plant Pathology 53: 256.
http://dx.doi.org/10.1111/j.0032-0862.2004.00969.x
Pereira OL, Silva M. 2009. Two new hosts, Epidendrum secundum and Epidendrum xanthinum, for
the orchid rust Sphenospora kevorkianii (Raveneliaceae) in Brazil. Australasian Plant Disease
Notes 4: 62-63.
Pereira OL, Cavallazzi JRP, Rollemberg CL, Kasuya MCM. 2002. Sphenospora kevorkianii, a rust
fungus (Uredinales: Raveneliaceae) on the orchid Pleurothallis mentigera. Brazilian Journal of
Microbiology 33: 155-156. http://dx.doi.org/10.1590/S1517-83822002000200011
Silva M, Pereira OL. 2007. First report of Guignardia endophylicola leaf blight on Cymbidium
(Orchidaceae) in Brazil. Australasian Plant Disease Notes 2: 31-32.
http://dx.doi.org/10.1071/DN07015
Silva M, Pereira OL. 2008. Black mildew disease of the neotropical orchid Epidendrum secundum
caused by Lembosia epidendri sp. nov. from Minas Gerais, Brazil. Mycotaxon 104: 385-390.
Silva M, Pereira OL, Braga IF, Lelis SM. 2008. Leafand pseudobulb diseases on Bifrenaria harrisoniae
(Orchidaceae) caused by Phyllosticta capitalensis in Brasil. Australasian Plant Disease Notes 3:
53-56. http://dx.doi.org/10.1071/DN08022
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/118.103
Volume 118, pp. 103-111 October-December 2011
Eremiomyces magnisporus (Pezizales), a new species
from central Spain
PABLO ALVARADO”, GABRIEL MORENO’, JOSE L. MANJON’ & MIGUEL A. SANZ
‘Departamento de Biologia Vegetal - Universidad de Alcala, 28871, Alcala de Henares, Spain
*CORRESPONDENCE TO: [email protected]
ABSTRACT — A new Species of Eremiomyces is described from central Spain. Eremiomyces
magnisporus is proposed to accommodate a single collection found in July 2010 in a marl-
gypsicolous soil at Mount Gurugu, Alcala de Henares (Spain). The habitat and macro-/
micromorphology of the fresh material are described. Molecular analyses of ITS and nLSU
DNA support the new species as closely related to but distinct from Eremiomyces echinulatus
from the Kalahari desert.
Key worps — Kalahari truffles, Mediterranean, hypogeous fungi
Introduction
The genus Eremiomyces Trappe & Kagan-Zur must be considered as a
member of the Pezizaceae Dumortt. (Pezizales J. Schr6t.) since it was proposed
by Ferdman et al. (2005) to accommodate the molecularly deviant species
Choiromyces echinulatus Trappe & Marasas [= E. echinulatus (Trappe & Marasas)
Trappe & Kagan-Zur]. Eremiomyces echinulatus is a truffle of the African
Kalahari, collected in South Africa, Botswana, and Namibia (Trappe et al. 2008,
2010) and, until now, the only known species in this genus.
In the present work, a second Eremiomyces species is described from the
steppe-like semi-arid hills around Alcala de Henares, central Spain. These
low hills present a marl-gypsum soil covered by introduced Pinus halepensis
as well as indigenous xerophilous shrubs such as Macrochloa tenacissima,
a Mediterranean poaceous plant with an Iberian and northern African
distribution (Fics. 1-2). Other fungi previously collected in this region
include Battarrea phalloides (Dicks.) Pers., Dictyocephalos attenuatus (Peck)
Long & Plunkett, Galeropsis desertorum var. bispora (Vassilkov) G. Moreno
et al., Gastrosporium simplex Mattir., Tulostoma spp., and Phaeomyces ibericus
(G. Moreno & Esteve-Rav.) E. Horak.
104 ... Alvarado & al.
ert) Fu
Figs. 1. Habitat under Pinus halepensis with Macrochloa tenacissima. 2. Sample collection site.
Materials & methods
Morphology
The type material is preserved in the herbarium of the Dept. of Plant Biology,
University of Alcala de Madrid (AH). Microscopical observations were recorded
from tissues mounted in KOH 5%, lactophenol cotton blue, and congo red. Spore
measurements do not include superficial structures. Scanning electron microscopy
(SEM) images were taken at the University of Alcala de Henares, using a Zeiss DSM-950
instrument.
DNA extraction, PCR amplification, and DNA sequencing
DNA extraction, PCR amplification, and amplicon purification from type collection
AH 38981 was performed as described previously (Alvarado et al. 2010). PCR primers
ITS1F and ITS4 (Gardes & Bruns 1993), and ITS4 (White et al. 1990) for the ITS region,
and LR1 and LR7 (van Tuinen et al. 1998, Vilgalys & Hester 1990) for the nLSU rDNA
region were employed for PCR amplification and sequencing purposes. Sequences were
visually inspected for reading errors in MEGA4 (Tamura et al. 2007).
Sequence alignment and phylogenetic analysis
The obtained sequences were aligned with the closest matches from BLAST searches
in the public databases. ITS and nLSU sequences came mainly from Lzessoe & Hansen
(2007) and Perry et al. (2007). Sequences were aligned in MEGA4.0 software using
its ClustalW application. The final alignment was assembled manually. Neighbour-
joining phylogenetic inference was performed in MEGA4 (pairwise deletion of gaps,
2000 bootstrap replicates). The aligned loci were loaded in PAUP* 4.0b10 (Swofford
2001) and a maximum parsimony phylogenetic tree reconstruction was performed
(2000 bootstrap replicates, TBR swapping algorithm, 50 sequence additions per
replicate, MULTrees not in effect). Aligned loci were also subjected to MrModeltest 2.3
(Nylander 2004) in PAUP* 4.0b10 to search for the evolutionary models that best fit
the data. These models were simulated during the analysis of each locus in MrBayes 3.1
(Ronquist & Huelsenbeck 2003). A Bayesian maximum likelihood (BML) analysis using
4 metropolis-coupled Monte Carlo Markov Chains (MCMC) was performed setting the
temperature of the chains to 0.2 and sampling once each 100 generations. The analysis
was run until convergence parameters were met in two simultaneous runs, after about
2M generations. A full search for the highest scoring ML trees was also performed in
RAXML (Stamatakis 2006) using the standard search algorithm, a thousand bootstrap
replications, and allowing an independent evolutionary model for each locus.
Eremiomyces magnisporus sp. nov. (Spain) ... 105
Molecular results
The final alignment of the ITS region included 327 of 658 variable sites,
288 of which were also parsimony-informative. In turn, nLSU alignment
included 114 parsimony-informative among 151 variable sites from a total 592
bases. Both ITS and nLSU data were best described by the evolutionary model
GTR+G+I.
Taxonomy
Eremiomyces magnisporus G. Moreno, P. Alvarado, Manjon & Sanz sp. nov.
MycoBank MB561665 FIGS. 3-11
Ascomata subglobosa, 5 cm longa, peridio pallide brunneo passim atrorufo. Colores iuvenum
speciminum permanent post siccationem. Peridium 0.1-0.3 mm crassum, angularis
structura, magnis cellulis 25-45 x 5-20 um composita, praeditum. Gleba griseobrunnea
vel griseostraminea numerosis albidis venis incomposite distributis, formantibus varium
reticulum. Sporae 14-17 um sine ornamentis, globosae, hyalinis vel pallide luteolis vacuolis
praeditae. Sporarum ornamenta ex obtusis bacillis vel conis dense distributis, in mente
revocantibus ornamenta Terfeziae arenariae, sed perspicue breviora (1.5-2 um longa,
I um lata) et magis dense disposita, efformata. Asci cylindrici difficiles inventu aetate
provecta speciminis, videntur una serie dispositi. Paraphyses haud observatae. Odor fortis
revocans caseum domesticum.
Type — Spain, Madrid, Alcala de Henares, Mount San Juan del Viso, 750 m a.s.l.,
10.VII.2010, leg. M.A. Sanz (Holotype AH 38981). [GenBank JN032128 (ITS), JN032129
(28S nLSU)].
ErymMo.ocy — Latin, magni- (big) + -sporus (spores), referring to the larger size relative
to those in E. echinulatus.
Ascoma subglobose 5 cm diam., without an obvious attachment point to the
substrate, peridium smooth, pale brown with reddish to reddish-black areas
where damaged, fresh colours retained after drying. PERrpIuM 0.1-0.3 mm
thick, with an angular structure formed by entangled cylindrical hyphae; cells
25-45 x 5-20 um, becoming more globose toward the interior; cell walls < 1.5
um, hyaline to slightly yellowish; outermost cell layer 10-40 um thick, red-
brownish vacuolar pigments present; external layer of amorphous debris < 25
uum thick. GLEBA beige to dun straw with abundant 0.05-0.4 mm broad whitish
veins irregularly distributed forming a variable reticulated mesh with multiple
attachment points to the peridium, colour appearing darker where bitten by
animals; once dried, small [0.5-1.5 mm diam.] (sub)globose or subglobose
spore-containing pockets protrude. Ascospores globose, 14-17 um (average
15.875, SD 0.545) without ornamentation, hyaline to slightly yellowish,
vacuolate; ornamented by densely arranged 1.5-2 x 1 um blunt-edged rods
and cones reminiscent of Terfezia arenaria (Moris) Trappe, but clearly shorter
and more densely arranged. Asci and pARAPHYSES could not be found due to
the advanced maturity of the sample, but spores remained linearly arranged,
commonly in groups of 4(-5) spores. ODouR strong, similar to cottage cheese.
106 ... Alvarado & al.
Fics 3-11. Eremiomyces magnisporus (Holotype: AH 38981). 3. Ascoma peridium and gleba.
4, Peridium. 5. Detail of angular peridial cells. 6-7. Spores under LM. 8. Linearly arranged spores.
9-10. Spores under SEM. 11. Detail of spore ornamentation under SEM.
Scale bars: 3 = 1 cm, 4= 100 m, 5 = 25 um, 6-7 = 10 um, 8 = 20 um, 9-10 = 5 um, 11 = 2 um.
ECOLOGY & DISTRIBUTION. Eremiomyces magnisporus is a rare species
fruiting in steppe-like areas of the marl-gypsum hills surrounding Alcala de
Henares (central Spain).
ComMENTSs. A single ascoma was located by the truffle-hunting dog of Miguel
Angel Sanz under Macrochloa tenacissima and Pinus halepensis in July 2010.
Eremiomyces magnisporus sp. nov. (Spain) ... 107
FIGURE 2 shows the exact point of collection under M. tenacissima, without any
sign of the typical ‘burr’ associated with other hypogeous fungi. It cannot be
concluded which plant species was host of this presumably mycorrhizal fungus.
Kalahari truffles have been said to fruit under poaceous species: Enneapogon
cenchroides (Licht.) C.E. Hubb., Eragrostis rigidior Pilg., and Stipagrostis
uniplumis (Licht.) De Winter (Trappe et al. 2008). Interestingly, E. echinulatus
was collected in June during the austral winter (Trappe et al. 2010), while
E. magnisporus appeared in northern hemisphere during the summer.
Eremiomyces magnisporus is characterized by its pale brown peridium with
reddish areas that do not blacken after drying, large-sized spores (14-17 um
without ornamentation), and a spore ornamentation formed by very densely
arranged blunt-edged hyaline to pale yellow cones. Eremiomyces echinulatus
is distinguished by a peridium that turns black after drying, dark brown glebal
veins, and smaller spores (10-14 um without ornamentation).
Discussion
Phylogenetic similarities between South African and Mediterranean
fungi have been reported before. The recently proposed inocybeoid genus
Tubariomyces Esteve-Rav. & Matheny is represented in both Spain and Italy
and Zambia (Alvarado et al. 2010). Tubariomyces species apparently associate
with Cistaceae Juss. in the Mediterranean and with Phyllanthaceae Martinov
and Fabaceae Lindl. in Zambia.
Macrochloa tenacissima, the putative host plant of E. magnisporus, is
commonly found in semiarid basic soils of the Mediterranean basin in Turkey,
Italy, Spain, Morocco, Algeria, Tunisia, and Libya. In the western Mediterranean,
it reaches central Spain and several more scattered spots of northeastern Spain,
yet it is not found beyond the high plateaus preceding the Sahara desert to the
south and southwest of Morocco. Up to now, M. tenacissima has been regarded
as an exclusively endomycorrhizal plant, hosting glomalean species such
as Glomus aggregatum N.C. Schenck & G.S. Sm. and Funneliformis mosseae
(T.H. Nicolson & Gerd.) C. Walker & A. Schiissler (Roldan-Fajardo 1994).
Interestingly, the hypogeous fungus Gastrosporium simplex has also been found
in association with poaceous species of the Arrhenathero-Stipetum tenacissimae
association in the hills around Alcala de Henares (Moreno et al. 1991) as well as
with Festuca ovina L. (Montecchi & Sarasini 2000).
Of the poaceous genera indicated by Trappe et al. (2010) as the most
probable hosts of the Kalahari truffles, those most closely related to Macrochloa
are Stipagrostis Nees, Eragrostis Wolf and Enneapogon Desv. ex P. Beauv.
Although widely distributed, Eragrostis is considered typical of subtropical
and xerophilous habitats and is common in Spain. Likewise, Enneapogon has
a split Australian—African distribution, with only E. desvauxii P. Beauv. being
108 ... Alvarado & al.
AF 276681 Mattirolomyces terfezioides
AJ305045 Mattirolomyces terfezioides
AJ272444 Mattirolomyces terfezioides
AY789329 Peziza phyllogena
400 100| AF 435829 Eremiomyces echinulatus
100 109 *°l AF 435825 Eremiomyces echinulatus
ae AH38981 Eremiomyces magnisporus
10 100 | AY818334 Peziza ostracoderma
1 1FJ537076 Peziza ostracoderma
GQ231749 Ulurua nonparaphysata
100 100 f AY830852 Cazia flexiascus
°° | EU834194 Cazia flexiascus
100 1007 HE U819535 Peziza depressa
a DQ200837 Peziza depressa
EF644112 Peziza badia
100 100 | 22888695 Tirmania pinoyi
*9%°°| GQ888697 Tirmania pinoyi
2° | ao a00 AF 276667 Tirmania nivea
°F J197820 Tirmania nivea
too100 | AF 276678 Terfezia leptoderma
wi | AF276679 Terfezia leptoderma
sony AF396862 Terfezia leptoderma
sooltoo | ~ AF 276676 Terfezia trappei
mo" |» AF387657 Terfezia olbiensis
AF276677 Terfezia‘trappe?
95 79 AF092097 Terfezia boudieri
AF301419 Terfezia boudieri
toqft00-] | AF276672 Terfezia boudieri
AF092096 Terfezia boudieri
AF092098 Terfezia boudieri
| naan) AF276674 Terfezia arenaria
wml AF276675 Terfezia arenaria
AF387646 Terfezia claveryi
1001001 AF 387647 Terfezia claveryi
101! AF301421 Terfezia claveryi
HM352543 Terfezia claveryi
Fic. 12. Eremiomyces magnisporus and its closest relatives in the Pezizaceae. Highest scoring ITS tree
(maximum parsimony, PAUP*). Only nodes supported by three or more of the inference methods
are annotated. Values represent (from upper left to lower right): MEGA4 neighbour-joining, PAUP
maximum parsimony, RAxML bootstrap proportions, and MrBayes posterior probabilities.
Eremiomyces magnisporus sp. nov. (Spain) ... 109
GQ231755 Mattirolomyces terfezioides
GQ231753 Mattirolomyces austroafricanus
AF335159 Peziza retrocurvata
AY789328 Peziza phyllogena
AF335117 lodowynnea auriformis
AH38981 Eremiomyces magnisporus
100 100
100100 | 4p | AF 439823 Eremiomyces echinulatus
100999 | AY 232725 Eremiomyces echinulatus
AY500533 Hapsidomyces venezuelensis
3600 AY500554 Plicania trachycarpa
AY500553 Plicaria anthracina
AF335156 Peziza phyllogena
AF335155 Peziza phyllogena
AF335139 Peziza ellipsospora
AY500558 Terfezia claveryi
AF435824 Terfezia claveryi
AF435828 Terfezia boudieri
AY500557 Terfezia boudieri
AF435820 Terfezia boudieri
AF435822 Terfezia boudieri
AF 499448 Terfezia boudieri
DQ191679 Pezizaceae sp.
nag 4 fe — AF335147 Peziza limnaea
“08 AF335132 Peziza badiofusca
AF335175 Ruhlandiella berolinensis
GQ231747 Mycoclelandia bulundari
9997
98/100
7575
AF335178 Tirmania pinoyi
AF335177 Tirmania nivea
ae AF335149 Peziza michelii
eee AF335166 Peziza succosa
AF335137 Peziza domiciliana
AF335154 Peziza nivalis
AF335128 Peziza ampliata
AF335174 Pfistera pyrophila
seae| AF335131 Peziza arvernensis
AF335130 Peziza arvernensis
AF335145 Peziza fimeti
AF335170 Peziza sp.
AF335173 Peziza sp. 5
AF335161 Peziza subcitrina
AF335162 Peziza subcitrina
sete AY500548 Peziza lobulata
se ‘al AF335165 Peziza subviolacea
100 100
100 100
Fic. 13. Eremiomyces magnisporus and its closest relatives in the Pezizaceae. Highest scoring
nLSU rDNA tree (maximum parsimony, PAUP*). Only nodes supported by three or more of
the inference methods are annotated. Values represent (from upper left to lower right): MEGA4
neighbour-joining, PAUP maximum parsimony, RAxML bootstrap proportions, and MrBayes
posterior probabilities.
110... Alvarado & al.
widespread. Most African Enneapogon species range from south to northeastern
Africa, often reaching Arabia and India (Peterson et al. 2010). Only E. persicus
Boiss. reaches western Mediterranean to southeastern Spain. In turn, Stipagrostis
is found from southern Africa to Middle East and northwestern India, reaching
the western Mediterranean up to Morocco (Le Houérou 2001). It would be
interesting to search for this and other hypogeous genera in the distribution
areas of the poaceous species mentioned above. More research on Eremiomyces
and its unexpected plant hosts is clearly needed to shed light on its disjunct
geographical distribution
Acknowledgements
This work was financed by the Spanish Ministry of Education and Culture for FPU
grant AP2006-00890 and the “Subprograma AGR del Ministerio de Ciencia y Innovacién
(Plan Nacional I+D+I)” for the Research Project AGL2009-12884-C03-03. We express
our gratitude to Dr. G. Pacioni and Dr. M. Castellano for reviewing the manuscript
and adding a number of useful comments and to Mr. D.W. Mitchell for reviewing the
manuscript. We express gratitude to Mr. A. Priego and Mr. J.A. Pérez of the Electron
Microscopy Service of the University of Alcala de Henares for their invaluable help
with the SEM. We also thank L. Monje and A. Puebla of the Department of Drawing
and Scientific Photography at the Alcala University for their help in the preparation
of the digital images, Dr. J. Rejos, curator of the AH herbarium for his assistance with
the specimens examined in the present study, Dr. J. Alvarez and Dr. C. Bartolomé for
their comments on the phanerogamic aspects of the discussion section, and finally
Dr. G. Consiglio for his help with the Latin diagnosis.
Literature cited
Alvarado P, Manjon JL, Matheny PB, Esteve-Raventés F. 2010. Tubariomyces, a new genus of
Inocybaceae from the Mediterranean region. Mycologia 102(6): 1389-1397.
http://dx.doi.org/ 10.3852/10-041
Ferdman Y, Aviram S, Roth-Bejerano N, Trappe JM, Kagan-Zur V. 2005. Phylogenetic studies of
Terfezia pfeilii and Choiromyces echinulatus (Pezizales) support new genera for southern African
truffles: Kalaharituber and Eremiomyces. Mycol Res 109: 237-245.
http://dx.doi.org/10.1017/S0953756204001789
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes—application
to the identification of mycorrhizae and rusts. Mol Ecol 2: 113-118.
Leessoe T, Hansen K. 2007. Truffle trouble: what happened to the Tuberales? Mycol Res 111:
1075-1099. http://dx.doi.org/10.1016/j.mycres.2007.08.004
Le Houérou HN. 2001. Biogeography of the arid steppeland north of the Sahara. J Arid Environm
48: 103-128. http://dx.doi.org/10.1006/jare.2000.0679
Montecchi A, Sarasini M. 2000. Funghi ipogei d’Europa. AMB Fondazione Centro Studi Micologici,
Trento. 714 p.
Moreno G, Galan R, Montecchi A. 1991. Hypogeous fungi from peninsular Spain. Hl. Mycotaxon
42: 201-238.
Nylander JAA. 2004. MrModeltest v2. Evolutionary Biology Centre, Uppsala University.
Eremiomyces magnisporus sp. nov. (Spain) ... L11
Perry B, Hansen K, Pfister DH. 2007. A phylogenetic overview of the family Pyronemataceae
(Ascomycota, Pezizales). Mycol Res 111: 549-571. http://dx.doi.org/10.1016/j.mycres.2007.03.014
Peterson PM, Romaschenko K, Johnson G. 2010. A classification of the Chloridoideae (Poaceae)
based on multi-gene phylogenetic trees. Mol Phylogenet Evol 55: 580-598.
http://dx.doi.org/10.1016/j.ympev.2010.01.018
Roldan-Fajardo BE. 1994. Effect of indigenous arbuscular mycorrhizal endophytes on the
development of six wild plants colonizing a semi-arid area in south-east Spain. New Phytol
127: 115-121. http://dx.doi.org/10.1111/j.1469-8137.1994.tb04265.x
Ronquist F, Huelsenbeck JP. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with
thousands of taxa and mixed models. Bioinformatics 22(21): 2688-2690.
http://dx.doi.org/ 10.1093/bioinformatics/btl446
Swofford DL. 2001. PAUP”: phylogenetic analysis using parsimony (and other methods). Version
4.0b10. Sinauer, Sunderland, Mass.
Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis
(MEGA) software version 4.0. Mol Biol Evol 24: 1596-1599.
http://dx.doi.org/ 10.1093/molbev/msm092
Trappe JM, Claridge AW, Arora D, Smit WA. 2008. Desert truffles of the African Kalahari: ecology,
ethnomycology, and taxonomy. Econ Bot 62(3): 521-529.
http://dx.doi.org/ 10.1007/s12231-008-9027-6
Trappe JM, Kovacs GM, Claridge AW. 2010. Comparative taxonomy of desert truffles of the
Australian outback and the African Kalahari. Mycol Progress 9: 131-143.
http://dx.doi.org/ 10.1007/s11557-009-0612-6
van Tuinen D, Zhao B, Gianinazzi-Pearson V. 1998. PCR studies of AM fungi, from studies to
application. Springer, Berlin.
Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified
ribosomal DNA from several Cryptococcus species. J Bacteriol. 172: 4238-4246.
White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. pp. 315-322, in: MA Innis et al. (eds). PCR Protocols: A Guide to
Methods and Applications. Academic Press Inc., New York.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/118.113
Volume 118, pp. 113-121 October-December 2011
Peziza paludicola, the correct binomial for
P. udicola nom. inval.
GABRIELE CACIALLI’, ANGELA LANTIERI” & GIANFRANCO MEDARDI?
'Via Goito 25, I-57127 Livorno, Italy
*Dipartimento di Biologia “Marcello La Greca”, Universita di Catania,
Via Antonino Longo 19, I-95125 Catania, Italy
°Via Giuseppe Mazzini 21, I-25086 Rezzato (Brescia), Italy
*CORRESPONDENCE TO: [email protected]
ABSTRACT — “Peziza udicola’, P. crassipes Quél., and P. paludicola are shown to be conspecific,
with P. paludicola as the correct name for the species. Peziza crassipes var. kilimanjarensis is
recombined as a variety of P. paludicola.
Key worps — Ascomycota, Pezizales, nomenclatural analysis, taxonomy
Introduction
During preparation of a monograph on Peziza Fr. —to be published by
the Bresadola Mycological Association (AMB, Trento, Italy)— the name
Peziza udicola Svréek aroused our attention. This name appears only in some
identification keys (Hohmeyer et al. 1989, Spooner 2001), generally as a short
observation without reference to year and place of publication and sometimes
also without author. No information about its date and place of publication was
available from the INDEX OF FUNGI, INDEXFUNGORUM (www.indexfungorum.
org), or MycoBANK (www.mycobank.org).
A loan request for the holotype from the mycological collections of the
National Museum of Prague (PRM), where Svréek’s specimens are located, was
met with the response that there were no specimens or data relating to this
name.
It was moreover necessary to verify the possible conspecificity of “P. udicola”
with Aleuria paludicola Boud. (assumed by Schmid-Heckel 1990) and also with
Peziza crassipes Quél. (reported by Svréek 1970).
Svréek (1970) provided a detailed description of P crassipes Quél. (free
translation from German):
114 ... Cacialli, Lantieri & Medardi
... Hymenial surface 250-300 um tall, tending to brown. Hypothecium narrow, not
distinctly delimited from the medulla. Asci 250-300 x 14-22 um, 8-spored, with
apical ring strongly amyloid... Spores (19—)22-—24(-25) x (10-)10.5-12.5(-13.5)
um, mostly 21-23 x 11-12 um, long elliptical to cylindrical-elliptical, round to
sharpened at both extremities, homogeneous content, often pale yellow-brown,
totally smooth...on decaying twigs, herbaceous stems, completely rotten wood,
debris, sometimes on necrotic herbs or directly on bare ground, in humid to
swampy places, river banks and near springs, particularly under large herbaceous
plants (e.g. Petasites, Chamaenerion angustifolium)....
Svrcéek (1970) also reported:
...I cannot exclude the possibility that Aleuria paludicola Boudier (1907) and
Peziza crassipes are conspecific. Boudier’s original diagnosis states that this Aleuria
has saucer-shaped apothecia, spores 23-26 x 12-15 um and exceptionally wide
paraphyses (18-22 um). Up to now it has been collected by the author only once,
on marsh stems in a swamp. Maybe it is an abnormal form of Peziza crassipes...
Moser (1963) mistakes the two species and unintentionally uses the epithet
>
“palustris” for Boudier’s “paludicola?
In 1970, therefore, Svréek did not make any mention of the earlier homonym,
Peziza crassipes Wallr. (Wallroth 1833), an inoperculate ascomycete. This
earlier homonym makes P. crassipes Quél. a nom. illegit. Eleven years later
in a checklist of Czech discomycetes, Svréek (1981) listed his 1970 records of
P. crassipes Quél. under a newly coined name “P. udicola,” noting that there was
an earlier homonym of Quélet’s binomial and referring to the description and
illustration in his previous publication: “Svr. 1970: 63 (c. fig.) (Peziza crassipes
Quél., non Wallroth)”. The name “P. udicola” was apparently intended as a
potential nom. nov. for the illegitimate Quélet binomial, but Svréek failed to
meet the requirements for valid publication when he made no full and direct
reference to the place of publication of the replaced synonym. As a potential
sp. nov., it was also not validly published because of the absence of any Latin
description or reference to a previously published Latin description (McNeill
et al. 2006: Art. 36.1); it may even be argued that it is a nom. nud. (McNeill
et al. 2006: Art. 32.1(d)) despite the direct reference to the previous German
description (Svréek 1970) and the indirect reference to the original French
description (Quélet 1883).
Specimen loans of the holotype, isotype, or other relevant collections of
P. crassipes and Aleuria paludicola were requested from the fungal collections of
the National Museum of Natural History, Paris (PC) but none were found. We
have therefore only been able to compare published information.
TABLE 1 summarizes what each cited author wrote about the three names.
Brummelen (1969) noted that microscopic dimensions given by Boudier
(1907, 1904-10) contain an error and need to be decreased by 10%. This was
taken into account when analysing the spore sizes of A. paludicola reported by
LS
2”
<9
Peziza udicola” is P. paludicola. ...
wm ¢1-ZI
x (S'P7-)77-61
wan (€1-)ZI-IT
x (S7-)€7-17(-61)
(6961
UspPPUIUINIg 0} ‘d9e),
wm ¢€1-8'01
X PET-L'0Tx
wm ¢€[-OT
x (97-)€Z-12(-6T)
aAZIS TAOdSOOSYV
uonepnuess wosy ayeJUap sieodde
ynq ‘o1JUd o8po SUIsIeUT PIeMO}
Josuap UoT}ejNuUeIs “WUNTUSUTAY
uey} Joyed AYysts 10 sno10joDu07)
YsHryM yejsOpnosd
‘UOTJeNUeIS WOIJ 9}e]UNp UTSsIeU
‘snosoeINjJINj-uMoIq
‘untusuTAY UeY} Jayeg
po]Uspurl jou UTsIey
‘snosoeinjiny Apouy
untTusuTAY Ue} Jaye
snoaseinjing UMOIg AjTaUT,
‘untusudéy uey) Joyed Ap YSIS
AOVAUNS ATOVLdHORY
snoaodeIYO-YsTUMOIg
uMOIq-MOTOA
‘Kakeqo-UMOIG
‘UMOIG-SNOIIeIYIO
qnuyezeyy
umoiq-AUMe}
‘UMOI 0} SNOIde.IYDO
‘moyJad-snoaseIyoo YsIppoy
UMOI Yep ‘snoaderyIo
Ayitp ‘Aakepo-umoq
UMOIG-SnosdeIYIO
aed 0} snoasei~pO
(4OTO9)
WOAINTWALH
a8ed }xou UO panuryUoS | ATAV I,
WI0}}0q 9Y} UO pouayey.
‘090 “payyejs qns 0} apIssas
‘oqyeorIquin + ‘passoidap
‘podeys-dno Anysiyis
‘QTIssasqns ‘juaroype
Ajasie] ‘passoidap ‘Ts
‘WIIOJTYeAI-dJeUTGIN} 0}
podeys-saones ‘pousyey
/ pedeys-dno Apysys
prey Aysoy ‘payyeys
Ajsoys ‘ayeuraqnd ysourye
‘podeys-dnd jou ‘ouryg
wInyeIsqns sy} 0}
Jusroype ATapIM ‘aseq
a3] YIM ‘poyyeys F
‘ayeoriquin ‘padeys-dno
Apysys + podeys-xAqeD
WNIDXHLOdVY
(soded sty})
Ayeyy
vjoapnyod q
(OZ61 49244S)
RTYLAOTSOYIIZ)
sadissv19 q
(LO6I JaIpnog)
doureLy
vjoapnyod q
(€88T PPND)
sued]
sadissv1 q
(99U919F9Y)
uIsII0 Jo AUNOT)
NOXV],
‘vjonpniyd gq pue “Jang sadissv19 vz1Zag JO SUOTIDITJOO JO UOsTIedUWO’) "| ATAV,
116... Cacialli, Lantieri & Medardi
sjenpIsor
snoaseqiay Apoom
UI YI WIeOT Spoom
snonproep papeiseq
sjueyd snoaseqisy
a81e] YIM sooeyd prumy
Aaa Jo punoss Adurems
‘sUIa}s sNoadeqIoY
‘s31M} YsnpMes ‘(poring
OsTe) poom yYsieyy
seare Adurems
UI sTeNpIsal [eJaB9A 19410
JO SaAva] XAVD YsieU UO
jsnpmes
‘snumny Apoom
‘(paling Ose) pooMm
LVLIGVH
‘umn ST-OT sTJe°
“TW 0} JLPIUITS 7X9}:
‘seyddAy o7eO1UI YIM poxTul
win OOTS S][2> 3X9} Jes “IAT
‘un Q€-OT ST]Je0 ‘suepNsue-"[3
JO BSOTNQOTS *}x9} :uINTUSUTAYqnS
‘unl (09-)OF-ST “aT[eUIS sT[Io
“TW 0} TeTIWIs -q
‘un (6-09 STJe°
‘s11e[NSue-esO[Nqoys 1X2} :qIL
‘ayqeysinsunsip jou :umnruswAyqns
poyiodas JON
s]]29 JaTTeUUS YIM 3nq
“AW 0} Jepruuts “aq
‘s1IepNSue-esO[Ngoys 3X9} :qW
winjndioxe [e9q = qq
umnndioxs Arey]Npsw = FW
AMALONULS WATAdIOXY
yred Jamo]
dy} UI poys10oj Jo ofdurts ‘wu
OL S pure sepnsars xode ‘un
G-P 0} SUTTJAMS sT]J29 Teseq
7-1 ‘Aqrerpour yestpurpAd
popunm Ayrepn sari
‘oyearyo
‘um [1-2
pornojoo Apyeam
Spryn ‘padeys-qnyp
suo xode ‘(uajaumunig
0} ‘90k opIMm win Q7Z-9T)
soynuess yuoursid YIM
SOUITJIUIOS ‘PIA.INd 29
posieyus uayo Iepnsars1
Ayyensn ‘oprm wm T[-Z
SHSAHAVUVd
um gI-ST
X 08Z-0SZ
wm 77-41
X 00€-0SZ
(6961 UsTeuTUINAg 0} *99k),,
wn S7Z-81
xX 09€-OLTx
wm g1-P1
X 00€-0S7
AZIS SAOSW
(soded sty)
Ajeyy
vjoapnyod q
(0261 49244S)
RTYLAOTSOYIIZD
sadissv1o q
(LO6I JaIpnog)
o0uely
vjoapnyod q
(€88T I9]9NO)
a0uely
sadissv1 q
(99U919FOY)
uIsII0 Jo AUNOT)
NOXV,
pepnpuos ‘Tt aTavy,
“Peziza udicola” is P. paludicola. ... 117
Boudier. The corrected dimensions of the spores in question here are 20.7—23.4
x 10.8-13.5 um. Comparing these data with those obtained from our analyses
on “P. udicola” makes clear that the various characteristics are very similar and
that small differences may be considered physiological variations of different
individuals. We believe they are not enough to justify treating the names as
separate species.
Materials & methods
Macro- and microscopic examinations were carried out on both fresh and dried
specimens (rehydrated in water or KOH 5%), with water as a mounting medium and
Melzer’s reagent to observe the iodine reaction of the asci, using an Optika optical
microscope (BK 1301 model), with 40x or 100x (immersion oil) objectives. Spore
dimensions were obtained by measuring of 50 mature spores. Collections were placed
in the fungal reference collection of LAquila (HMA), the Royal Botanic Gardens, Kew
K(M), and the private herbaria collections of F Padovan (FP) and G. Medardi (GM).
Taxonomy
Peziza paludicola (Boud.) Sacc. & Traverso, Syll. Fung. 20: 315, 1911. FIG. 1
= Aleuria paludicola Boud., Hist. Classific. Discomyc. Europe: 46, 1907
= Peziza crassipes Quél., C.R. Ass. Frang. Av. Sci. (La Rochelle
1882) 11: 405, 1883, nom. illegit., non Wallr. 1833.
“Peziza udicola” Svréek, Ceska Mykologie 35(2): 72, 1981
nom. inval., ICBN [Vienna] Art. 36.1.
TYPIFICATION: Lectotype designated here, FRANCE, “sur les feuilles pourries des Carex,
Juillet, dans les marais. Montmorency’, Aleuria paludicola coloured plate, Boudier, Icon.
Mycol., Série 5(24): no. 469 [Tom. 2: pl. 269], 1909. Epitype designated here, ITALY,
Trentino-Alto Adige, Belluno, shore of the river Piave, 10/05/86, leg. e det. F. Padovan
[K(M) 169757].
APOTHECIA up to 20 mm diam., slightly cup-shaped, sessile to sub-stalked.
Hymenial surface smooth, slightly depressed to more or less umbilicate,
sometimes flattened, brownish-ochraceous. RECEPTACLE SURFACE concolorous
or slightly paler than the hymenium and with brown granules, more dense
toward the margin; margin regular, appearing dentate because of the
granulation, but actually entire. FLEsH fragile and waxy, greyish-ochraceous.
ASCOSPORES 19-22(-24.5) x 12-13 um, elliptical, smooth, hyaline, without
oil drops, uniseriate in the ascus. Asc1 250-280(-300) x 15-18 um, sub-
cylindrical. PARAPHYSES sub-cylindrical and 4—5 um wide at the base (often
with 1-2 basal enlarged cells), dilated and irregularly shaped in the upper part,
up to 10 um, simple or forked at the base, septate. HyYMENIUM up to 300 um
thick. SUBHYMENIUM 40-50 um thick; textura globulosa-angularis, composed
of rounded or slightly angular cells, 10-30 um diam. MEDULLARY EXCIPULUM
118 ... Cacialli, Lantieri & Medardi
— = 10 um
s
SK
10 ym >fS )
x
Fic. 1. Peziza paludicola (Epitype, K(M) 169757). A. Uppermost zone of the hymenium
(tips of paraphyses and asci with ascospores). B. Released ascospores.
about 500 um thick; textura globulosa, composed of rounded cells up to 100 um
diam., mixed with obvious intricate hyphae, 15-20 um wide. ECTAL EXCIPULUM
20-30 um thick; textura angularis, composed of angular or sub-angular cells,
about 10-15 um diam.
Hasirat: in small groups on degraded wood of deciduous trees.
ADDITIONAL MATERIAL EXAMINED: ITALY, ABRUzzo, LAQuita, Castellafiume,
09/11/84, leg. e det. not declared, sub P ampliata, (HMA 4129); LOMBARDY, BRESCIA,
Breno, tableland of Gaver, 21/08/04, leg. e det. G. Medardi, (in herb. priv. GM); Ponte
di Legno, P. so Gavia, on loam and humid woody herbaceous remnants, at 2800 m of
altitude, 06/08/06, leg. e det. G. Medardi, (in herb. priv. GM).
LS
2”
Peziza udicola” is P. paludicola. ...
<9
syueUUaI
snujy Uo ATaIeI IOUT
‘s[eNpIsas / 19}I] PooMm vaaig
poom snonppeq
WIeo] WOT}BATNS
pue punoiny
punoin
syueuuter APOooM
pure snosseqiaH]
IVLIGVH
RSOTNQoO]s 3X9} :qq
"S]JOO dsOQoys ApIepN BoM 2» eCOTIIUT "}X9} (7
‘eyeOTIJUL *}X9} ,[) aA] Z “AW
‘g]qeysInsurjsip jou :wmrusuAyqns
‘ureIp unl GT-OT ST[29
‘s1repnsue "}xo} :qq
‘ureIp win QOT 0} dn sqja9
eSO[NQO]s "}X9} Jo IaAR] | “AW
‘ureIp un Y¢-OT STIP9
‘s1epnsue-eso[nqoys *}X9} :umMTUsuTAYqns
RCOTIJULT *}X9} -q
*‘(sLIe[NSue-esO[NGOyS *}X9} ,€ “EJLITIJUT *}X9} ,7
“eSO[NGO]S "}X9} ,[) SIOART € “AI
‘sLiepnsue-esopNqoys *}x9} :umMTUsUTAYQnS
esOpNgoys 3X9} :qq
“BJLOTIJUT *}X9} JO JOART T AIA
‘sLIvpnsue-esopNqoys *}x9} :umMTUsUTAYQnS
“wIeIp wn (Gh-)GE-ST ST]
‘s1epnsue-esopnqoys *}X9} :qq
(win 08-09 x (OFZ-)OZZ-OFT) ST[2> 28Ie] AIOA
YIM esopNgoys *}x9} Jo OAR] T “AW
‘sLiepn3ue-esopNqoys *}xo} :umMTUsUTAYQnS
urnpndioxa ye q = 7A
umnyndioxa Arey[npow = A
AMALONALS WATAIOXY
wm 71-01
x 17-81
wm ¢1-ZI
x (S'P7-)77-61
wm [1-01
x (7Z-)O7-8I
um 6-Z
x [7-02(-81)
wm F1-ZI
X ZZ-0Z
aZIS TAOdSOOSV
sosut} ajdind-snoasejora
JO SNOSIRAT[O YIM YIM
snoasdeIyso
-£913-jnujazeY
snoaodeJYoO-YsTUMOIg
SOXIJOI YSIMOTIA YIM
umoiq-AUMET,
SoXa]JoI aueIO YIM
snoaoeAl[O-MOT[aA-UMOIG
umolgq aed
JO UMOIQ-YsTIYM,
WOTOO WNINAWAH
(L007 !P1epa)
Ajeyy
vpiydotas vzizag
(soded sty})
Ayeyy
vjonpnyod vzizag
(soded sty})
Ayeyy
sISUaJ4OY VZ1ZIg
(soded sty})
Ayeyy
Ldalpnog vzizag
(soded sty})
Ayeyy
vyoydup vzizag
(a0Uatajoy)
UIBLIO Jo ATJUNOD
NOXV],
‘satoads re] IWIs YIM vjos1pnjyd vz1zag Jo uosTIeduloy "7 ATAV I,
120 ... Cacialli, Lantieri & Medardi
Peziza paludicola var. kilimanjarensis (J. Moravec) Cacialli, Lantieri & Medardi,
comb. nov.
MycoBank MB 561192
= Peziza crassipes var. kilimanjarensis J. Moravec, Ceska Mykologie 32(2): 77. 1978.
The Moravec (1978) variety required transfer from the illegitimate species,
P. crassipes Quél., to its legitimate synonym P. paludicola.
Discussion
Peziza paludicola can be distinguished from similar species by the following
characteristics: apothecia with monotonous colours; the outside showing a
dark granulation more evident at the margin; smooth and relatively large
spores; habitat generally related to decaying deciduous wood. Similar species
are Peziza boudieri (Cooke) Donadini, Peziza hortensis P. Crouan & H. Crouan,
and Peziza sciophila Medardi. These can be differentiated by the anatomy of the
excipular tissues and by the habitat. Peziza ampliata Pers. is distinctive in both
the excipular architecture and the position of the layers and the dimensions
of the cells; the substratum is also at times important to separate these fungi.
TABLE 2 summarizes the main characteristics of these species.
Acknowledgments
The authors thank Prof. D.H. Pfister (Massachusetts, USA) and Prof. W-Y Zhuang
(China) for critically reviewing the manuscript, Dr. B. Buyck (Natural History Museum
of Paris), Dr. A. Kubatova, and Dr. M. Chlebicka (National Museum of Prague) for help
in searching for specimens, Dr. M. Svréek (Czech Scientific Society for Mycology) for
information about P. udicola, Dr. J. Moravec (Czech Republic) for information about
P. crassipes, Ing. C. Lavorato (Calabria, Italy) for help in translating some articles from
German, Dr. G. Lalli (Univ. of LAquila, Italy) and Dr. F. Padovan (Veneto, Italy) for
putting their collections at our disposal, and Prof. D. Minter for reviewing the English.
Literature cited
Boudier E. 1904-10. Icones mycologicae ou iconographie des champignons de France, 4 vol. Paul
Klincksieck, Paris.
Boudier E. 1907. Histoire et classification des discomycétes d’Europe. Paul Klincksieck, Paris.
Brummelen J van. 1969. Clues for the determination of the spore-sizes in Boudier’s illustrated
publications. Persoonia 5(3): 233-236.
Hohmeyer H, Ludwig E, Schmid H. 1989. Seltene Ascomyceten in Bayern (2). Uber einige
operculaten Discomyceten (Pezizales). Hoppea 47: 5-36.
McNeill J, Barrie FE Burdet HM, Demoulin V, Hawksworth DL, Marhold K, Nicolson DH, Prado J,
Silva PC, Skog JE, Turland NJ, Wiersema J. 2006. International Code of Botanical Nomenclature
(Vienna Code). Adopted by the Seventeenth International Botanical Congress, Vienna, Austria,
July 2005. Regnum Vegetabile 146. 568 p.
Medardi G. 2007. Una nuova Peziza dall’Italia: Peziza sciophila. Rivista di Micologia (50) 4:
333-343.
Moravec J. 1978. Fungi of Kilimanjaro - I. Discomycetes, Pezizales. Ceska Mykologie 32(2): 70-78.
“Peziza udicola” is P. paludicola. ... 121
Quélet L. 1883. Quelques espéces critiques ou nouvelles de la Flore Mycologique de France.
Comptes-rendus de l’'Association Francaise pour l’Avancement des Sciences 11: 387-412.
Schmid-Heckel H. 1990. Pilze in den Berchtesgaden Alpen. Nationalpark Berchtesgaden
Forschungebericht 15, 2. Auflage: 3-136.
Spooner B. 2001. The larger cup fungi in Britain - part 3. The genera Peziza and Plicaria. Field
Mycology 2 (2): 51-59. http://dx.doi.org/10.1016/S1468-1641(10)60516-6
Svréek M. 1970. Uber einige Arten der Diskomyzetengattung Peziza [Dill.] L. ex St-Amans. Ceska
Mykologie 24(2): 57-77.
Svréek M. 1981. Katalog operkulatnich diskomycetti (Pezizales) Ceskoslovenska II. (O-W). Ceska
Mykologie 35(2): 64-89.
Wallroth KFW. 1833. Flora cryptogamica Germaniae. Pars posterior, continens algas et fungos.
Norimbergae, sumtibus J.L. Schragii.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.123
Volume 118, pp. 123-129 October-December 2011
Two new species of Corynespora
from northeastern Uttar Pradesh, India
RAGHVENDRA SINGH & KAMAL
Department of Botany, D.D.U. Gorakhpur University, Gorakhpur, U.P, India- 273 009
*CORRESPONDENCE TO: [email protected]
ABSTRACT — Two Corynespora species collected from northeastern Uttar Pradesh, India,
are described and illustrated: C. carrisae sp. nov. from living leaves of Carissa spinarum
(Apocynaceae) and C. peristrophicola sp. nov. from living leaves of Peristrophe bicalyculata
(Acanthaceae).
Key worps — biodiversity, hyphomycetes, foliar diseases, phytopathogenic fungi,
taxonomy
Introduction
Indian researchers have added several novel species to the anamorphic
genus Corynespora during the past few years (Meenu et al. 1997, Meenu &
Kamal 1998, Sharma et al. 2002, Jain et al. 2002, Pal et al. 2007, Singh et al.
2007, Kumar et al. 2008). During our recent survey, we encountered several
plant species exhibiting leaf blights. Upon critical examination and a thorough
survey of the literature, we found that two blights were caused by two new
Corynespora species: C. carrisae on Carissa spinarum L. (Apocynaceae) and
C. peristrophicola on Peristrophe bicalyculata (Retz.) Nees. (Acanthaceae). These
taxa are described and illustrated below.
Materials & methods
Infected leaf samples from different parts of northeastern Uttar Pradesh (U.P.)
were placed in separate polythene bags and taken to the laboratory. Suitable mounts
of surface scrapings and free-hand cut sections were prepared from infected portions
of the leaf samples. The material was mounted in a cotton-blue lactophenol mixture on
microscope slides. The slides were examined, the specimens were measured and camera
lucida drawings were made. Morphotaxonomic determinations were made with the help
of current literature and available resident expertise. Holotypes have been deposited
in HCIO (Herbarium Cryptogamiae Indiae Orientalis), Indian Agricultural Research
124 ... Singh & Kamal
Institute, New Delhi; isotypes were retained in the herbarium of the Department of
Botany, D.D.U. Gorakhpur University, Gorakhpur, for further reference.
Taxonomy
Corynespora carrisae R. Singh & Kamal, sp. nov. FIG. 1
MycoBank MB 519052
Maculae amphigenae, circulares vel subcirculares, 3-5 mm in diam., brunneae vel atrae.
Coloniae amphiphyllae, effusae, brunneae. Mycelium internum, tenuitnicatum, glabrum,
ex hyphis ramosis, olivaceo brunneis vel brunneis. Stromata nulla. Conidiophora singularia,
macronematosa, mononematosa, erecta vel procumbenta, recta vel flexuosa, nonramosa,
cylindrica, glabra, crassitunicata, 4-8-septata et 1-15 successivas proliferationes, 250-675
x 4-10 um, cellula basalis inflatis, brunneis vel atro brunneis. Cellulae conidiogenae in
conidiophoris integratae, terminales, monotreticae, cicatrices non incrassates. Conidia
acrogenaes, solitaria, simplicia, non ramosa, tenui tunicata, glabra, recta vel curvata,
obclavato-cylindrica, 4-17-distoseptata, 75-242 x 6-14 wm, ad apicem obtusa vel
rotundata, olivacea vel luteo brunnea, hilo in crassato, germinato conidium notatum.
Type: On living leaves of Carissa spinarum (Apocynaceae), Kusumhi forest, Gorakhpur
(U.P.), India, 19 September 2007, coll. Raghvendra Singh, HCIO No. 48276 (holotype),
GPU Herb No. KR-10 (isotype).
EryMo_oey: the epithet is derived from the genus name of the host.
Infection spots amphigenous, circular to subcircular, 3-5 mm in diameter,
brown to black. Colonies amphiphyllous, effuse, brown. Mycelium internal,
thin-walled, smooth, branched, olivaceous brown to brown. Stromata absent.
Conidiophores arising singly, macronematous, mononematous, erect to
procumbent, straight to flexuous, unbranched, cylindrical, smooth, thick-
walled, 4-18-septate and 1-15 successive cylindrical proliferations, 250-675
x 4-10 um, basal cell swollen, brown to dark brown. Conidiogenous cells
integrated, terminal, monotretic, scars unthickened. Conidia acrogenous,
solitary, simple, unbranched, thin-walled, smooth, straight to slightly curved
to obclavate-cylindrical, 4-17-distoseptate, 75-242 x 6-14 um, apex obtuse to
rounded, olivaceous to very light brown, hilum thickened, germinating conidia
present.
REMARKS— Only one Corynespora species, C. alstoniae Meenu et al. (Meenu
et al. 1997), has been described on Apocynaceae. Compared with the present
collection, C. alstoniae has shorter and broader conidiophores (121-473.5 x
6.0-13.5 um) and conidia (48.5-154 x 8.5-21.5 um). The hilum in C. carrisae is
thickened while in C. alstoniae it is unthickened.
Unbranched to branched and longer conidiophores (110-850 x 4-11 um)
easily distinguish C. carrisae from C. cassiicola (Berk. & M.A. Curtis) C.T. Wei
(Wei 1950), which has unbranched, shorter conidiophores. Its 4-17-distoseptate
longer thinner conidia also contrast with the 4-20-distoseptate shorter thicker
(40-220 x 9-22 um) conidia in C. cassiicola.
Corynespora carrisae & C. peristrophicola spp. nov. (India) ... 125
Fic. 1. Corynespora carrisae.
a: symptoms; b: conidia, germinating conidia, and conidiophores.
(Scale bars: a = 20 mm, b = 20 um).
126 ... Singh & Kamal
The new species appears to be most similar to C. euphorbiacearum Meenu
et al. (Meenu et al. 1997). Corynespora carrisae has more septa (4-18), more
successive cylindrical proliferations and longer conidiophores compared with
C. euphorbiacearum with 3-7-septate, shorter conidiophores (100-358 x 6-8
um), and thickened noncatenate and narrower conidia separate C. carrisae
from C. euphorbiacearum conidia that are unthickened, solitary to catenate,
and broader (59-235 x 11.5-22.5 um).
One other possible close relative is C. gigaspora (Berk. & Broome) M.B. Ellis
(Ellis 1957), which produces conidia that are longer and broader (100-270 x
19-28 um) with more distosepta (9-52).
Corynespora peristrophicola R. Singh & Kamal, sp. nov. FIG. 2
MycoBank MB 519051
Maculae epigenae, circulares vel subcirculares/irregulares, 1-18 mm in diam., brunneae
vel atrae. Coloniae epiphyllae, effusae, grisae. Mycelium internum, tenui tunicatum,
glabrum, ex hyphis ramosis, olivaceo-brunneis vel brunneis. Stromata nulla. Conidiophora
superficialia, ex hyphis oriunda singulata vel 2-3-fasciculata, macronematosa,
mononematosa, cylindrica, recta vel procumbenta, erecta vel flexuosa, non ramosa, glabra,
crassitunicata, 5-18-septata et 1-3 successivas proliferationes, medio brunnea, 120-325
x 5-10 um, cellula basalis inflatis. Cellulae conidiogenae in conidiophoris incorporatae,
terminales, monotreticae, cicatrices incrassatae. Conidia acrogena, sicca, solitaria,
simplicia, non ramosa, tenui tunicata, glabra, recta vel leniter curvata, obclavata vel
obclavato-cylindricata, 5-12-distoseptata cum 0-1 angulis distoseptis simulatibus, 60-135
um longa et 5-16 um lata, apicem obtusa vel rotundata, olivacea vel luteo-brunnea, hilo
crassato praedita.
Type: On living leaves of Peristrophe bicalyculata (Acanthaceae), Gorakhpur University
campus, Gorakhpur (U.P.), India, 2 December 2007, coll. Raghvendra Singh, HCIO No.
48278 (holotype), GPU Herb No. KR-12 (isotype).
Erymo_oey: the epithet is derived from the genus name of the host.
Infection spots epigenous, circular to subcircular/irregular, 1-18 mm in
diameter, brown to blackish. Colonies epiphyllous, effuse, grayish. Mycelium
internal, thin-walled, smooth, branched, olivaceous to brown. Stromata absent.
Conidiophores arising singly as lateral branches from superficial hyphae,
solitary or in fascicle of 2-3, macronematous, mononematous, cylindrical, erect
to procumbent, straight to flexuous, unbranched, smooth, thick-walled, 5-18-
septate with 1-3 successive cylindrical proliferations, mid brown, 120-325 um
long and 5-10 um wide, basal cell swollen. Conidiogenous cells integrated,
terminal, monotretic, scars unthickened. Conidia acrogenous, dry, solitary,
simple, unbranched, thin-walled, smooth, straight to slightly curved, usually
obclavate to obclavate-cylindrical, 5-12- distoseptate with 0-1 transverse band-
like distosepta, 60-135 um long and 5-16 um wide, apex obtuse to rounded,
olivaceous to very light brown, hilum thickened.
Corynespora carrisae & C. peristrophicola spp. nov. (India) ... 127
Fic. 2. Corynespora peristrophicola.
a: symptoms; b: conidia and conidiophores.
(Scale bars: a = 20 mm, b = 20 um).
128 ... Singh & Kamal
REMARKS— Only C. barleriicola N. Sharma et al. (Sharma et al. 2002) has is
known to occur on members of Acanthaceae. Corynespora peristrophicola has
shorter unbranched 5-18-septate conidiophores while those in C. barleriicola
are branched, 3-7-septate, and longer (253-479 x 7-9 um). Furthermore,
C. barleriicola has longer conidia (41-246 x 10-18.5 um), which are 3-17-
distoseptate with 0-5 distinct transverse band-like distosepta, and its hila are
unthickened.
The conidia of C. peristrophicola appear most similar to those of C. siwalika
(Subram.) M.B. Ellis (Ellis 1961: 88-140 x 15-20 um), C. leptoderridicola M.B.
Ellis (Ellis 1957: 70-120 x 14-17 um), and C. combreti M.B. Ellis (Ellis 1963b:
40-122 x 8-11 um) but lack the rostrate morphology typical of the other
species. The 5-12 conidial distosepta in C. peristrophicola are slightly more
numerous than in C. combreti (4-10-distosepta) and less numerous than in
C. leptoderridicola (6-16-distosepta) and C. siwalika (9-19-distosepta).
The new species also resembles C. alstoniae (Meenu et al. 1997), which,
however, has longer broader conidiophores (121-473.5 x 6-13.5 um) and
broader, catenate unthickened conidia (48.5-154 x 8.5-21.5 um).
Other possible closely related species are separated by number of distosepta:
C. bdellomorpha M.B. Ellis (Ellis 1963a) with 12-19 and C. eranthemi J.M. Yen
& Lim (Yen & Lim 1980) with 5-25.
Acknowledgments
The authors thank Dr Rafael F. Castafieda-Ruiz and Dr Eric H.C. McKenzie for
reviewing the manuscript. We also express our deep thanks to Dr Shaun Pennycook
for nomenclatural review. Thanks are also due to the Curator, HCIO, New Delhi for
accepting holotype specimens and providing accession numbers thereof.
Literature cited
Ellis MB. 1957. Some species of Corynespora. Mycological Papers 65: 1-15.
Ellis MB. 1961. Dematiaceous hyphomycetes: HI. Mycological Papers 82: 1-55.
Ellis MB. 1963a. Dematiaceous hyphomycetes: IV. Mycological Papers 87: 1-42.
Ellis MB. 1963b. Dematiaceous hyphomycetes: V. Mycological Papers 93: 1-33.
Jain SL, Rai AN, Mehta P. 2002. Additions to the genus Corynespora from India. Indian
Phytopathology 55(1): 51-56.
Kumar S, Singh R, Pal VK, Singh DP, Agarwal DK. 2008. Novel additions to Corynespora Giissow
from India. Indian Phytopathology 61(1): 111-117.
Meenu, Kamal. 1998. New species of Corynespora. Mycological Research 102: 344-345.
http://dx.doi.org/10:1017/S0953756297005455
Meenu, Singh A, Singh SK. 1997. Some new forms of genus Corynespora. Indian Phytopathology
50(1): 17-24.
Pal VK, Akhtar M, Agarwal DK, Chaudhary RK, Ahmad N. 2007. Diversity of foliar fungi
in the forest flora of North-Eastern U.P: Five new species of Corynespora Gussow. Indian
Phytopathology 60(3): 330-340.
Corynespora carrisae & C. peristrophicola spp. nov. (India) ... 129
Sharma N, Chaudhary RK, Kamal. 2002. Five undescribed species of Corynespora. Indian
Phytopathology 55(4): 458-463.
Singh R, Kumar S, Pal VK, Upadhyaya PP, Agrawal DK. 2007. New Taxa of foliicolous
hyphomycetes-Cercospora, Corynespora and Phaeotricoconis from North Eastern U.P. India.
Indian Phytopathology 60(4) 506-512.
Wei CT. 1950. Notes on Corynespora. Mycological Papers 34: 1-10.
Yen JM, Lim G. 1980. Etude sur les champignons parasites du Sud-Est asiatique. 37. Les Corynespora
de Malaisie. Cryptogamie Mycologie 1: 83-90.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.131
Volume 118, pp. 131-136 October-December 2011
New lichenicolous fungi records for
Kyrgyzstan, Uzbekistan, and Ukraine
OLGA NADYEINA'& MEHMET GOKHAN HALIcI?*
'M.G. Kholodnyi Institute of Botany, National Academy of Science of Ukraine,
Tereschenkivska str., 2, 01601 Kyiv, Ukraine
?Erciyes Universitesi, Fen Edebiyat Fakiiltesi, Biyoloji Boliimti, 38039 Kayseri, Turkey
CORRESPONDENCE TO *: '[email protected] & ’*[email protected]. tr
ABSTRACT — Gemmaspora lecanorae and Rosellinula haplospora are newly reported for
Uzbekistan (Asia), Rosellinula frustulosae for Kyrgyzstan (Asia), and Muellerella ventosicola
and Weddellomyces heterochrous for Ukraine (Europe). The different ascospore sizes reported
for W. heterochrous are also briefly discussed.
Key worps — Ascomycota, cephalothecioid plates, lichens
Introduction
More than 1500 species of lichenicolous fungi had been described by
2003 (Lawrey & Diederich 2003), and 3000-4000 are estimated worldwide
(Hawksworth 2001). Lichenicolous fungi have been one of the least explored
fungi because of the inadequate literature and a confused taxonomy based
largely on nineteenth century concepts (Hawksworth 1983). But with the recent
publication of new keys (Foucard 2001, Nash et al. 2004, Halici 2008, Ihlen
& Wedin 2008) and checklists (e.g. Kocourkova 2000, Diederich & Sérusiaux
2000, Scholz 2000, Faltynowicz 2003, Hawksworth 2003), these organisms have
started to receive more attention. Here, we report new records of lichenicolous
fungi for Ukraine (Europe) and Kyrgyzstan and Uzbekistan (Asia).
Material & methods
Specimens reported are deposited in KW (Kyiv, Ukraine) or KHER (Kherson,
Ukraine). Specimens were examined with a Leica DM 1000 research microscope.
Microphotographs were taken with a Leica DFC 420 digital microscope camera with
c-mount interface and with a 5 megapixel CCD. Sections were prepared by hand and
examined in Merck Lugol’s iodine (I) and water. Ascospores were measured in water.
132 ... Nadyeina & Halici
Ascospores and asci measurements are given by the arithmetic mean flanked by the
mean + standard deviation and parenthetical minimum and maximum values. All
measurements and ratios include the halo in ascospores. The length/breadth ascospore
ratio is indicated as l/b.
Taxonomy
Gemmaspora lecanorae (Werner) D. Hawksw. & Halici
A detailed description is provided by Hawksworth & Halici (2007).
The species is lichenicolous on the thallus of Aspicilia species and evidently
commensalistic, as no damage or discoloration was observed in the host thallus.
Perithecia are black, >300 um wide, semi-immersed to almost superficial. Asci
are 8-spored and ascospores (0—)1-septate, with very thick cell walls, which are
2-layered, and very broadly ellipsoid to globose, (12—)12.5-13-14 x 8.5-9 um
with 1/b ratio (1.35-)1.4-1.5-1.6(-1.65).
Gemmaspora lecanorae was previously known from just two localities: Syria,
on the thallus of Aspicilia cf. farinosa, and Turkey, on the thallus of Circinaria
calcarea (L.) A. Nordin & al. (Hawksworth & Halici 2007). New to Uzbekistan
on A. thjanschanica Oxner.
UZBEKISTAN. ‘TASHKENT REGION, Western Tian-Shan, Velykyi Chymgan
Mountain, 1800 m alt., granite outcrop, on the thallus of Aspicilia thjanschanica with
Rosellinula haplospora. A. Lazarenko, 28.09.1929 (KW 23638, isolectotype of Aspicilia
thjanschanica).
Muellerella ventosicola (Mudd) D. Hawksw.
A detailed description (as M. pygmaea var. ventosicola) is provided by Triebel (1989) and
Triebel & Kainz (2004).
The species is lichenicolous on the thallus of on a wide range of crustose
saxicolous lichens including Rhizocarpon, Ophioparma, and Protoparmelia
(Triebel 1989, Ihlen & Wedin 2008, Halici 2008) and apparently commensalistic,
as no damage or discolouration was observed in the host thallus. Ascomata
perithecioid, black, semi-immersed, 250-300 um. Asci (20-)50-spored, 50-55
x 15 um. Ascospores brown, thick-walled, 1-septate, 6-7.5-9(-10) x 4-4.5-5
(-6) um, |/b ratio (1.3-)1.4-1.6-1.8(-2).
Muellerella ventosicola grows on Rhizocarpon geographicum (L.) DC. and
R. grande (Florke ex Flot.) Arnold. New to Ukraine
UKRAINE. ZAKARPATTIA (TRANSCARPATHIAN) REGION, RAKHIV DISTRICT,
Svydovets, Blyzhnytsia Mountain, 1500 m alt., on the thallus of Rhizocarpon grande,
M. Makarevych, 11.07.1947 (KW 27534). ZAPORIZHZHA REGION, CHERNIGYVSKYI
DISTRICT, Novopoltavka Village, Synia outcrop, on the granite, on the thallus of
R. geographicum, O. Khodosovtsev, 02.10.2007 (KHER 1469).
Lichenicolous fungi new to Kyrgyzstan, Uzbekistan & Ukraine ... 133
Ma
Fic. 1. Weddellomyces heterochrous. A, Perithecium; B, Cephalothecioid plates; C, Ascospores and
pseudoparaphyses; D, Ascospores; E, 6-spored and 8-spored asci; F, Ascospores.
134 ... Nadyeina & Halici
Rosellinula haplospora (Th. Fr. & Almq.) R. Sant.
A detailed description is provided by Hafellner (1985).
The species has previously been reported as lichenicolous on the thalli of
Circinaria caesiocinerea (Nyl. ex Malbr.) A. Nordin et al., Aspicilia cinerea
(L.) Koérb., A. intermutans (Nyl.) Arnold, and Bellemerea alpina (Sommerf.)
Clauzade & Cl. Roux (Hafellner 1985; Ihlen & Wedin 2008; Halici 2008). It
is evidently commensalistic, as no damage or discolouration was observed in
the host thallus of our collections, where it grew together with Gemmaspora
lecanorae and Lichenostigma elongatum Nav.-Ros. & Hafellner (on Aspicilia
spp.). Ascomata perithecia 200-230 um, 20-50 spores per ascus, (5-)6-6.5-
7.5(-8) x (4-)4.5-5-5.5(-6) um, with 1/b ratio (1-)1.1-1.3-1.5(-2).
New to Uzbekistan on Aspicilia thjanschanica and Aspicilia species in our
report.
UZBEKISTAN. TASHKENT REGION, Western Tian’-Shan, Velykyi Chymgan Mountain,
1800 m alt., granite outcrop, on the thalli of Aspicilia thjanschanica and Aspicilia sp.
A. Lazarenko, 28.09.1929 (KW 23638, isolectotype of Aspicilia thjanschanica).
Rosellinula frustulosae (Vouaux) R. Sant.
A detailed description is provided by Hafellner (1985).
The species is lichenicolous on the thallus of Lecanora frustulosa and L.
argopholis and evidently commensalistic, as no damage or discolouration was
observed in the host thallus. Perithecia, 220-280 um, c. 100 spores per asci.
Spores (4.5-)5.5-6-7(-7.5) x (3.5-)4-4.5-5(-6) um, with I/b ratio (1-)1.1-
1.3-1.5(-1.8).
Rosellinula frustulosae is specific to Lecanora frustulosa (Dicks.) Ach. and L.
argopholis (Ach.) Ach. (Hafellner 1985). New to Kyrgyzstan on L. argopholis.
Although we have no fresh collections from Ukraine, the holotype was collected
from a L. frustulosa thallus by K. Mereschkowsky near Simpheropol in Crimea
(Hafellner 1985). This is still the only known Ukrainian locality of this species,
but it has not yet been reported in Ukrainian check-lists (Kondratyuk at al.
1998, Kondratyuk at al. 2010).
KYRGYZSTAN. Issyk-Kut’, Pokrovka, Kyrgyz Station, Institute of Geography AS
USSR, in the river valley, on the thallus of Lecanora argopholis, on granite. Sobol;
15.07.1947 (KW 3898 - specimen is kept under name “Rhizocarpon geographicum”).
Weddellomyces heterochrous Nav.-Ros. & Cl. Roux FIGURE 1
A detailed description is provided by Navarro-Rosinés & Roux (1995).
The species is lichenicolous on the areoles of Aspicilia and Circinaria species
and causes a slight bleaching in the infected parts. It is weakly parasitic. The
following description is based on our collection on Aspicilia contorta subsp.
hoffmanniana S. Ekman & Froéberg ex R. Sant.
Lichenicolous fungi new to Kyrgyzstan, Uzbekistan & Ukraine ... 135
Asci cylindrical or largely cylindrical clavate, (110-)111-113-115(-118) x
(18-)19.5-20.5-21.5(-25) um (n = 20), 4-6-8-spored, wall gradually thickened
towards the apex, I-, ocular chamber present. Ascospores 3-septate, brown,
terminal cells concolorous with central cells, surface smooth, halonate, halo ~1
uum, slightly constricted at the septa, but sometimes strongly constricted in the
middle septa, heteropolar, uniseriate or irregularly biseriate in the asci, (21-)23-
25-27(-28) x (8-)9-9.5-10(-11) um (n = 40), I/b = (2.2-)2.4-2.6-2.8(-3.1)
The ascospore sizes in our data and cited in the literature seem very variable.
In the original description, based on a single type on Circinaria calcarea, the
ascospores (primarily 3-septate) measure (25—)26.5-30.4-35.5(-38) x (10-)11-
12-13.5(-14.5) um (Navarro-Rosinés & Roux 1995). In a Turkish collection on
an Aspicilia species, the ascospores measured (32-)36-40 x 11-13 um (Halici
et al. 2007). More collections are needed to reassess the ascospore size and host
variations and to determine whether more than a single taxon exists.
New to Ukraine.
UKRAINE. LuHANsS’K REGION, PEREVAL’S’K DISTRICT, steppe slope between
Mikhailivka and Troits’ke Villages above Isakiivs’ ke water storage, on thallus of
Aspicilia contorta subsp. hoffmanniana on limestone outcrop, O. Nadyeina 09.04.2007
(KW 68135).
Acknowledgements
Sergio Pérez-Ortega (Spain) and Kerry Knudsen (UCR) are thanked for reviewing
this paper. Fungal Research Trust Foundation is acknowledged for supporting the visit
of the first author (ON) to Erciyes University, Turkey.
Literature cited
Diederich P, Sérusiaux E. 2000. The lichens and lichenicolous fungi of Belgium and Luxembourg.
An annotated checklist. Musée national d’histoire naturelle, Luxembourg. 1-207.
Faltynowicz W. 2003. The lichens, lichenicolous and allied fungi of Poland - an annotated checklist.
Biodiversity of Poland 6: 1-435.
Foucard T. 2001. Svenska Skorplavar och swampar som vaxer pa dem. Interpublishing,
Stockholm.
Hafellner J. 1985. Studien tiber lichenicole Pilze und Flechten II. Die Gattung Roselliniella Vainio
emend. Haf. (Ascomycotina, Dothideales). Herzogia 7: 166-169.
Halici MG. 2008. A key to the lichenicolous Ascomycota (including mitosporic fungi) of Turkey.
Mycotaxon 104: 253-286.
Halici MG, Candan M, Ozdemir Tiirk A. 2007. New records of lichenized and lichenicolous fungi
from Turkey. Mycotaxon 100: 255-260.
Hawksworth DL 1983. A key to the lichen-forming, parasitic, parasymbiotic and saprophytic fungi
occurring on lichens in the British Isles. Lichenologist 15: 1-44.
http://dx.doi.org/10.1017/S0024282983000031
Hawksworth DL. 2001. The magnitude of fungal diversity: the 1.5 million species estimate revisited.
Mycological Research 05: 1422-1432. http://dx.doi.org/10.1017/S0953756201004725
Hawksworth DL. 2003. The lichenicolous fungi of Great Britain and Ireland: an overview and
annotated checklist. Lichenologist 35: 191-232.
http://dx.doi.org/10.1016/S0024-2829(03)00027-6
136 ... Nadyeina & Halici
Hawksworth DL, Halic1 MG. 2007. Gemmaspora, a new verrucarialean genus with remarkable
ascospores for Adelococcus lecanorae growing on Aspicilia species in Syria and Turkey.
Lichenologist 39: 121-128. http://dx.doi.org/10.1017/S0024282907006548
Thlen PG, Wedin M. 2008. An annotated key to the lichenicolous Ascomycota (including mitosporic
morphs) of Sweden. Nova Hedwigia 86: 275-365.
http://dx.doi.org/10.1127/0029-5035/2008/0086-0275
Kocourkova J. 2000. Lichenicolous fungi of the Czech Republic (the first commented checklist).
Acta Musei Nationalis Pragae, B55: 59-169.
Kondratyuk SY, Khodosovtsev AY, Zelenko SD. 1998. The second checklist of lichen forming,
lichenicolous and allied fungi of Ukraine. Phytosociocentre, Kyiv.
Kondratyuk SY, Dymytrova LV, Nadyeina O. 2010. The third checklist of lichen-forming and allied
fungi of Ukraine (state at 2010). In “Flora lichainikiv Ukraini’, Vol. 2, part 3. Naukova dumka,
Kyiv: 446-487.
Lawrey JD, Diederich P. 2003. Lichenicolous fungi: interactions, evolution and biodiversity. Bryologist
106: 80-120. http://dx.doi.org/10.1639/0007-2745(2003)106[0080:LFIEAB]2.0.CO;2
Nash TH III, Ryan BD, Diederich P, Gries C, Bungartz F. 2004. Lichen Flora of the Greater Sonoran
Desert Region. Vol. 2. Tempe: Arizona State University.
Navarro-Rosinés P, Roux C. 1995. Le genre Weddellomyces (Dothideales, Dacampiaceae) en
Catalogne et en Provence. Mycotaxon 53: 161-187.
Scholz P. 2000. Katalog der Flechten und flechtenbewohnende Pilze Deutschlands. Schriftenreihe
der Vegetationskunde 31: 1-298.
Triebel D. 1989. Lecideicole Ascomyceten. Eine Revision der obligat lichenicolen Ascomyceten auf
lecideoiden Flechten. Bibliotheca Lichenologica 35: 1-278.
Triebel D, Kainz C. 2004. Muellerella. 673-675, in TH Nash III et al. (eds). Lichen Flora of the
Greater Sonoran Desert Region. Vol. 2. Tempe: Arizona State University.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.137
Volume 118, pp. 137-146 October-December 2011
New records of Agaricales from Atlantic Forest fragments
of Pernambuco, Northeast Brazil
FELIPE WARTCHOW™, LEONOR C. MAIA?
& M. AUXILIADORA Q. CAVALCANTY’
"Universidade Federal da Paraiba, Departamento de Departamento de Sistematica e Ecologia,
CEP: 58051-970, Jodo Pessoa, PB, Brazil
? Universidade Federal de Pernambuco, Departamento de Micologia/CCB,
Av. Prof. Nelson Chaves, s/n, CEP: 50670-901, Recife, PE, Brazil
* CORRESPONDENCE TO: [email protected]. br
ABSTRACT — Some interesting fungi were collected during recent expeditions to Atlantic
Forest fragments. Entoloma aripoanum is recorded for the first time from Brazil. Crepidotus
flavus, E. tucuchense, and Lepiota erinana are new records from Brazil's northeast region,
and Trogia cantharelloides is new from Pernambuco State. Drawings and descriptions of the
species are provided.
KEY worpDs — Agaricaceae, Crepidotaceae, Entolomataceae, neotropics, taxonomy
Introduction
The Atlantic Forest, which is a priority area for conservation (Myers et al.
2000), has been drastically diminished by human activity since the beginning
of Portuguese colonization (Kimmel et al. 2008, Trindade et al. 2008). Only
11-16% remains of the original forest (Ribeiro et al 2009). Research on fungal
diversity is urgently needed in this threatened biome.
In this continuation of previous reports on agarics from Atlantic Forest
fragments of Pernambuco (Wartchow 2006, Wartchow & Maia 2007, Wartchow
et al. 2007a,b, 2008a,b), we present new records of Crepidotus (Fr.) Staude,
Entoloma (Fr.) P. Kumm., Lepiota (Pers.) Gray, and Trogia Fr.
Material & methods
Collections were undertaken at the Usina Sao José (7°50'20"S 35°00'10” W), an area
covered by variously sized (12-380 ha) Atlantic Forest fragments among sugar cane
fields (Alves-Araujo et al. 2008, Trindade et al. 2008). These preserved fragments shelter
650 species (379 genera, 105 families) of trees, with Fabaceae, Poaceae, Cyperaceae,
138 ... Wartchow, Maia & Cavalcanti
Asteraceae, Euphorbiaceae, Myrtaceae, Rubiaceae, Melastomataceae, Araceae, Malvaceae,
Apocynaceae, Sapindaceae, and Sapotaceae as the most diverse (Alves-Aratjo et al.
2008).
The usual methodology for studying agarics was followed (Singer 1986). Color codes
and names follow Maerz & Paul (1950; ‘M&P’); x = average dimension. Exsiccates are
deposited at URM Herbarium (Thiers 2011).
Taxonomy
Crepidotus flavus Capelari, Mycotaxon 115: 146. 2011. FIG. 1
PiLEus 5-14 mm, uniformly sulfur yellow (M&P 10J1 “Sulphur Y, Citrus”),
convex with incurved margin in young specimens, then more or less straight,
moderately tomentose/pubescent when young, smooth and glabrous in age;
context thin, fleshy, cream to pale yellow, unchanging. LAMELLAE radiating
from an attachment point, narrow (<0.5 mm broad) concolorous with pileus,
then ferruginous in older basidiomata, crowded, with lamellulae. Stipe absent
or very rudimentary.
BASIDIOSPORES 6.5-8.5 x 6-8 um, x = 7.6 x 7.2 um, Q = 1.00-1.09(-1.11),
Qx = 1.05, globose to occasionally subglobose, distinctly punctuate/ echinulate,
slightly thick-walled, yellowish brown to pale brown in KOH. Basip1a 17-25
x 7-8.5 um, clavate, mainly 2-spored. PLEURocystTip1A absent. Lamella edge
sterile, with crowded cheilocystidia. CHEILOCYsTIDIA 20-35 x 8-10 um, mostly
fusoid to utriform/lageniform, very infrequently ellipsoid to somewhat more
or less sinuous, thin walled, hyaline. PILEIPELLIS a cutis with hyphae approx. 5
um wide, radially oriented, walls moderately thick, hyaline, colorless. LAMELLA
TRAMA regular, < 5 um wide. CLAMP CONNECTIONS numerous.
HABITAT: gregarious on rotten wood in a fragment of tropical rain forest.
MATERIAL EXAMINED: BRAZIL. PERNAMBUCO, Igarassu, Usina Sao José (“Mata de
Piedade”), 25.viii.2005, F. Wartchow s.n. (URM 80088); Moreno, v.2008, RPPN Garnijé,
G.M. Mueller et al. 27 (URM 80089).
Note: The macroscopic features were noted from both collections; microscopic
characters were taken almost entirely from URM 80088, except for observations of
cheilocystidia in URM 80089.
REMARKS: This C. flavus collection is characterized by small, sulfur yellow
basidiomes with slightly tomentose to smooth pilei, globose to occasionally
subglobose basidiospores, clamped hyphae, exclusively 2-spored_basidia,
and absence of “antler-like” cheilocystidia (Capelari 2011). The last feature
is consistent in the current collections as well as in material from Sao Paulo
(Capelari 2011). All features fit with the species concepts given by Senn-Irlet &
Immerzeel (2003) for this group.
In the protologue of C. flavus, Capelari (2011) tried to segregate this species
from C. sulphurinus Imazeki & Toki, described from Japan, based on the two-
spored basidia described for C. sulphurinus, although apparently no basidia
Agaricales new to Atlantic Forest fragments (Brazil) ... 139
C
FiGuRE 1. Crepidotus flavus.
A. Habit. B. Basidiospores. C. Cheilocystidia. D. Basidia.
Scale bars: A = 10 mm; B-D = 10 um.
had been found in the original collection of C. flavus. According to Imazeki &
Toki (1954), C. sulphurinus is a disjunct taxon that differs in the less globose
basidiospores and somewhat clavate cheilocystidia. On the other hand, our
materials agree with the protologue of the Sao Paulo material in the yellowish
pileus and utriform/lageniform cheilocystidia (which Capelari interpreted as
ventricose), although larger basidiospores (8.7 x 8.7 um) were reported in the
Sao Paulo material. Hongo (1961), who described C. sulphurinus specimens
from Japan, referred to the cystidia as broadly clavate and ventricose, but
the basidiospores as subglobose to globose (7.5-9 x 6.5-7.5 um). Senn-Irlet
& Immerzel (2003), however, reported utriform cystidia for other Japanese
materials.
Another allied species is C. citrinus Petch from Sri Lanka. A type study
by Pegler (1986) referred to clavate cylindric and often constricted cystidia,
and apparently exclusively 4-spored basidia. Earlier, Singer (1973) reported
C. citrinus as growing in montane subtropical forest in Argentina; he did
mention the type from Sri Lanka but did not describe it. The Argentinean
material and our C. flavus collection have a similar spore size (6.8-8.3 um)
but differ in the clavate to versiform cheilocystidia with frequent projections
(“antler-like” in Senn-Irlet & Immerzeel 2003) and the 2-4-spored. Although
Pegler (1986) did not report “antler-like” cystidia in the type and Pilat (1950)
140 ... Wartchow, Maia & Cavalcanti
had not referred to that feature, Senn-Irlet & Immerzeel (2003), who studied
C. citrinus collections distant from the type locality (La Réunion and Puerto
Rico), observed this feature. Special attention must be given to de Meijer (2008:
321), who reported rare antler-like cystidia in a Parana collection of C. citrinus
(he described them as having a “contorted apical appendage”). We follow the
Senn-Irlet & Immerzeel (2003) species concept of this group and agree with
Capelari (2011): we regard C. flavus as distinct from —but very similar to—
C. citrinus and C. sulphurinus mainly by the cystidial shape. Morphological,
phylogeographical, and molecular studies on a worldwide scale are necessary
to elucidate whether or not all of these yellow species are different.
Crepidotus brunswickianus Speg. is another South American yellow species
closely related to C. flavus. It was first described from Southern Argentinean
forests by Spegazzini (1887) with a “pallide melleus” to “fulvo lutescens” pileus,
concolorous lamellae, and basidiospores measuring 5-6 x 3-4 um. It was
later described from a montane zone in Venezuela as having cadmium yellow
basidiomata, larger (7-8.5 x 6-7 um) subglobose basidiospores, and vesicular
to clavate cheilocystidia (Dennis 1961, 1970). Despite the close similarities
in the descriptions, we believe that C. brunswickianus and C. flavus represent
distinct species, although a revision is needed for the material identified in
Dennis (1961).
Pereira (1990), Pegler (1997), Senn-Irlet & de Meijer (1998), de Meijer (2006,
2008) and Capelari (2007, 2011) reported several species of Crepidotus, and
now we have the opportunity to record C. flavus for the first time in Northeast
Brazil.
Entoloma aripoanum Dennis, Bull. Soc. Mycol. Fr. 69: 196. 1953. FIG. 2
PiLEus < 17 mm, plane-convex, with a central depression, surface white,
glabrous, smooth; margin smooth, entire, slightly involute; context thin, fleshy,
white, unchanging. LAMELLAE adnate to short decurrent, white, membranous,
moderately crowded, with lamellulae. Stipe 36 x 3 mm, central, cylindrical,
white, glabrous, smooth, with rhizomorphs, mycelium present at base. ODOR
strong, pleasant.
BASIDIOSPORES 10-11.5(-12.5) x 7-7.5 um, x= 10.7 x 7.3 um, Q= 1.30-1.50(-
1.66), Qx= 1.45, heterodiametric-elliptical, with 6-8 depressed facets, pink and
moderately thick-walled. Basip1a 32-42 x 10-11 um, clavate, 2- or 4-spored.
PLEUROCYSTIDIA absent. CHEILOCYSTIDIA 47-72 x 9-17 um, cylindrical and
some clavate, hyaline, thin walled. PrILerrrama of exclusively hyphae similar
to ones of lamella trama; vascular hyphae occasional, 5 um wide. PILEIPELLIS a
cutis with erect hyphae 3.5-10 um wide, hyaline. LAMELLA TRAMA regular with
hyphae ranging to 3.5-8.5 um wide, apparently with yellowish brown granular
cytoplasmatic contents. CLAMP CONNECTIONS present.
Agaricales new to Atlantic Forest fragments (Brazil) ... 141
D
FIGURE 2. Entoloma aripoanum.
A. Basidiome. B. Basidium. C. Basidiospores. D. Cheilocystidia.
Scale bars: A = 10 mm; B-D = 10 um.
Hasirat: Solitary on rotten decayed wood in a tropical forest fragment.
MATERIAL EXAMINED: BRAZIL. PERNAMBUCO, IGARASSU, “USsINA SAO JOSE”
(“MATA DE PIEDADE’), 25.VIII.2005, F WARTCHOW S.N. (URM 80085).
REMARKS: This is an interesting species recognized by the pure white basidiome
with slightly depressed pileus centre, adnate to short decurrent lamellae,
lignicolous habit, basidiospore size and shape, and clavate cheilocystidia (Baroni
& Lodge 1998, as Alboleptonia aripoana (Dennis) Pegler). Cheilocystidia in
our collection are slightly shorter than those in the Trinidad type as revised by
Baroni & Lodge (1998), who reported cystidia 46-110 um long, but the other
features agree with the original description. Baroni & Lodge (1998) suggest
that A. aripoana sensu Pegler (1983) represents a distinct species, based on
the number of spore facets (8-10 in Pegler’s Antillean specimen versus 6-8 in
E. aripoanum). Entoloma aripoanum is known from Trinidad (Dennis 1953,
Horak 1977), possibly also from Martinique and Dominica (Pegler 1983; but
see Baroni & Lodge 1998), and now is reported for the first time from Brazil.
Entoloma tucuchense Dennis, Bull. Soc. Mycol. Fr. 69: 196. 1953. FIG.3
PitEus 35 mm, plane slightly convex, surface dark brown (M&P 8A12
“Autumn”) radially striate-rimose showing the white context, disrupting in
small granular squamules; context thin, fleshy, unchanging. LAMELLAE adnate,
142 ... Wartchow, Maia & Cavalcanti
FiGuRE 3. Entoloma tucuchense.
A. Habit. B. Pileipellis showing the inflated cells and tip on one of the erect cylindrical hyphae.
C. Basidiospores. D. Basidium. E. Hyphoid terminal projections from lamella edge.
Scale bars: A = 10 mm; B-E = 10 um.
pale cinnamon pink, membranous, sub distant, with lamellulae. STIPE 66 x 4
mm, central cylindrical, surface pale grey, smooth, white at base because of the
basal mycelium.
Agaricales new to Atlantic Forest fragments (Brazil) ... 143
BASIDIOSPORES 8-9.5(-10) x 6.2-7.5 um, x = 8.7 x 7 um, Q = (1.13-)
1.18-1.30(-1.35), Qx = 1.24, subisodiametric-angular, with 5-6 facets, with thin
pink walls. Basip1a 35-40 x 11-12 um, clavate, 4-spored. PLEUROCYSTIDIA
absent. CHEILOCYSTIDIA absent, although pronounced catenate hyphae 27-52
x 7-13 um, frequently cylindrical, hyaline to light yellowish brown pigmented
sometimes arising from the lamellar trama. PILEITRAMA hyphae filamentous
or inflated, < 11 um diam.; 5-um vascular elements occasionally present.
PILEIPELLIS an epithelium composed of subglobose to ovoid elements 18-37
x 15-26 um intermixed with dark brown erect cylindrical hyphae 52-82 x
7-15 um. LAMELLA TRAMA regular, hyphae filamentous, < 4 um diam. CLamp
CONNECTIONS absent.
Hasirat: solitary on soil near an unidentified angiosperm in a fragment of
tropical rain forest.
MATERIAL EXAMINED: BRAZIL. PERNAMBUCO, Igarassu, Usina Sao José (“Mata de
Piedade’), 22.vii.2005, EF Wartchow 18/2005 (URM 80086).
REMARKS: This species and Calliderma fibulatum Karstedt & Capelari,
C. rimosum Karstedt & Capelari, C. caeruleosplendens Largent et al., Entoloma
foldatsii (Dennis) E. Horak, and E. pruinatocutis E. Horak are all characterized
by a granulose (rimose in this case) pileus and distinctly hymeniform pileipellis,
a very infrequent feature in Entoloma sensu lato (Horak 1977, Aime et al. 2010,
Karstedt & Capelari 2010). Except for the lack of cystidioid projections in the
type specimen, other features (i.e. radially sulcate pileus, basidiospore size)
our material matches the type as analyzed by Horak (1977), Pegler [1983, as
Inopilus tucuchensis (Dennis) Pegler], and Karstedt & Capelari (2010).
The recently described Calliderma rimosum, the most macroscopically
similar taxon, differs from E. tucuchense in a pileus that cracks more strongly
with age, a revolute pileal margin, sinuate (not adnate) lamellae, and cylindric,
clavate to ventricose cheilocystidia (Karstedt & Capelari 2010).
Entoloma tucuchense, previously known from Trinidad (Dennis 1953) and
Amazonas State, Brazil (Horak 1982), is newly reported from Pernambuco
State, northeast Brazil.
Recent studies place E. tucuchense and other taxa with hymeniform pileipelli
in Calliderma (Romagn.) Largent (Aime et al. 2010, Karstedt & Capelari 2010).
However, other recent molecular studies support Calliderma as an integral part
of a monophyletic Entoloma (Co-David et al. 2009).
Lepiota erinana Dennis, Kew Bull. 7: 484. 1952. Fic. 4
PILEUS 6mm, convex, surface covered with appressed vinaceous brown (M&P
4K11 “Lacquer R”) squamules, cracking to reveal a pale cream background, but
remaining entire at centre, margin entire, not sulcate, nor striate; context very
thin, submembranous. LAMELLAE free, membranous, white, crowded, with
lamellulae. Stipe 9 x 1 mm, central, cylindrical, surface concolorous with the
144 ... Wartchow, Maia & Cavalcanti
O00 a
aorpeannnscarmeey
C = Ss “i
Ficur™ 4. Lepiota erinana.
A. Basidiome. B. Basidiospores. C. Basidia. D. Cheilocystidia.
Scale bars: A = 5 mm; B-D = 10 um.
pileus, with loose, floccose vinaceous brown squamules, rhizomorphs present.
ANNULUS superior, ephemeral, and indistinct.
BASIDIOSPORES 4.5-5 X 2.5-3 um, x = 4.6 x 2.7 um, Q = (1.53-)1.62-1.78
(-1.88), Qx = 1.24, ellipsoid to elongate, thin walled, smooth, dextrinoid,
hyaline. Bastp1a 15-17 x 5-6 um, clavate, 2- or 4-spored. PLEUROCYSTIDIA
absent. CHEILOCYSTIDIA 18-20 x 6-9 um, inflate-clavate to clavate, thin walled,
hyaline. PILEUS COVERING a trichodermium comprising chains of cylindrical
to subclavate hyphae with slightly thick walled light grayish terminal elements
37-47 x 5-6 um. LAMELLA TRAMA regular. CLAMP CONNECTIONS present.
Habitat: solitary on humus in a fragment of tropical rain forest.
MATERIAL EXAMINED: BRAZIL. PERNAMBUCO: Igarassu, Usina Sao José (“Mata de
Piedade’), 22.vii.2005, EF Wartchow 22/2005 (URM 78709).
REMARKS: As far as we know, this small fragile species with a pileus < 10 mm
is known only from the Neotropics (Dennis 1952, Pegler 1983, de Meijer 2006,
Rosa & Capelari 2009) and the very small size of our basidiome adds to what
is known for Lepiota erinana. Known previously from Trinidad (Dennis 1952),
Martinique and Venezuela (Pegler 1983), and Parana (de Meijer 2006) and
Minas Gerais (Rosa & Capelari 2009) states in Brazil, L. erinana is reported
here for the first time from northeast Brazil.
Trogia cantharelloides (Mont.) Pat., Essai Taxon. Hymén.: 129. 1900.
SOLITARY on leaves and soil arising from a dense mycelium in litter in a
tropical rain forest fragment.
Agaricales new to Atlantic Forest fragments (Brazil) ... 145
MATERIAL EXAMINED: BRAZIL. PERNAMBUCO: Igarassu, Usina Sao José (“Mata de
Piedade’), 18.viii.2005, F Wartchow (URM 78707).
REMARKS: Singer (1965) previously reported T: cantharelloides was from Paraiba
State, northeast Brazil. This is the first record from Pernambuco.
Acknowledgments
The authors thank Dr. Clark L. Ovrebo and Dr. Marcelo A. Sulzbacher for critically
reviewing the manuscript, and Dr. Vagner G. Cortez for preparing the plates. This
contribution to the “Sustainability of remnants of the Atlantic rainforest in Pernambuco
and its implications for conservation local development’, a Brazilian-German scientific
cooperation within “Science and Technology for the Atlantic Rainforest,’ was funded
by CNPq (590039/2006-7) and BMBF (01 LB 0203 A1), permitted and logistically
supported by Usina Sao José $.A/Grupo Cavalcanti Petribu. CNPq is also acknowledged
for providing grants to L.C. Maia (PP-Proc. 301126/2005-4) and sholarship to
FE, Wartchow (PROTAX/CNPq/MCT Proc. 141073/2006-3). This project was supported
by CNPq (Proc. 170067/02-5). FACEPE (Proc. BFP 0100-2.03/09).
Literature cited
Aime MC, Largent DL, Henkel TW, Baroni TJ. 2010. The Entolomataceae of the Pakaraima
Mountains of Guyana IV: new species of Calliderma, Paraeccilia and Trichopilus. Mycologia
102: 633-649. http://dx.doi.org/10.3852/09-162
Alves-Araujo A, Araujo D, Marques J, Melo A, Maciel JR, Uirapua J, Pontes T, Lucena MFA,
DuBocage AL, Alves M. 2008. Diversity of angiosperms in fragments of Atlantic Forest in the
State of Pernambuco, Northeastern Brazil. Bioremed., Biodivers., Bioavailab. 2: 14-26.
Baroni TJ, Lodge DL. 1998. Alboleptonia from the Greater Antilles. Mycologia 90: 680-696.
Capelari M. 2007. O género Crepidotus no Parque Estadual das Fontes do Ipiranga, Sao Paulo, SP,
Brasil e descricao de duas novas espécies. Hoehnea 34: 75-85.
Capelari M. 2011. New species and new records of Crepidotus from the northwest region of Sao
Paulo State, Brazil. Mycotaxon. 115: 145-153. http://dx.doi.org/10.5248/115.145
Co-David D, Langeveld D, Noordeloos ME. 2009. Molecular phylogeny and spore evolution of
Entolomataceae. Persoonia 23: 147-176. doi:10.3767/003158509X480944.
Dennis RWG. 1952. Lepiota and allied genera in Trinidad, British West Indies. Kew Bull. 7:
459-499.
Dennis RWG. 1953. Les Agaricales de Vile de la Trinité: Rhodosporae-Ochrosporae. Bull. Soc.
Mycol. Fr. 69: 145-198.
Dennis RWG. 1961. Fungi Venezuelani. IV. Agaricales. Kew Bull. 15: 67-156.
Dennis RWG. 1970. Fungus flora of Venezuela and adjacent countries. Kew Bull. Add. Ser. 3:
1-540.
Hongo T. 1961. On some agarics of Japan. IV. Mem. Shiga Univ. 11: 39-42.
Horak E. 1977. Entoloma in South America. I. Sydowia 30: 40-111.
Horak E. 1982. Entoloma in South America. II. Sydowia 35: 75-99.
Imazeki R, Toki S. 1954. Higher fungi of Asakawa Experiment Forestry. Bull. For. Exp. Sta. Meguro
67: 19-71.
Karstedt F, Capelari M. 2010. New species and new combinations of Calliderma (Entolomataceae,
Agaricales). Mycologia 102: 163-173. http://dx.doi.org/10.3852/09-019
146 ... Wartchow, Maia & Cavalcanti
Kimmel T, Piechowski D, Gottsberger G. 2008. The history of fragmentation of the lowland Atlantic
Forest of Pernambuco, Brazil. Bioremed., Biodiv. Bioavailab. 2: 1-4.
Maerz AJ, Paul MR. 1950. A dictionary of color. 2nd ed. McGraw-Hill Book Company, New York.
de Meijer AAR. 2006. A preliminary list of the macromycetes from the Brazilian State of Parana.
Bol. Mus. Bot. Municipal (Curitiba) 68: 1-55.
de Meijer AAR. 2008. Macrofungos notaveis do estado do Parana. Editora Embrapa Florestas,
Colombo.
Myers M, Mittermeier RA, Mittermeier CG, Fonseca GAB, Kent J. 2000. Biodiversity hotspots for
conservation priorities. Nature 403: 853-858. http://dx.doi.org/10.1038/35002501
Pegler DN. 1983. Agaric flora of Lesser Antilles. Kew Bull. Add. Ser. 9: 1-668.
Pegler DN. 1986. Agaric flora of Sri Lanka. Kew Bull. Add. Ser. 1-519.
Pegler DN. 1997. The agarics from Sao Paulo. Kew, Royal Botanic Garden.
Pereira AB. 1990. O género Crepidotus no Rio Grande do Sul, Brasil. Cad. Pesq. Ser. Bot. 2: 65-85.
Pilat A. 1951. Revision of the types of some extra-european species of the genus Crepidotus. Trans.
Brit. Mycol. Soc. 33: 215-249. doi:10.1016/S0007-1536(50)80077-3
Ribeiro MC, Metzger JP, Martensen AC, Ponzoni FJ, Hirota MM. 2009. The Brazilian Atlantic Forest:
how much is left, and how is the remaining forest distributed? Implications for conservation.
Biol. Conserv. 142: 1141-1153. http://dx.doi.org/10.1016/j.biocon.2009.02.021
Rosa LH, Capelari M. 2009. Agaricales fungi from Atlantic Forest Fragments in Minas Gerais,
Brazil. Braz. J. Microbiol. 40: 846-851.
Senn-Irlet B, de Meijer AAR. 1998. The genus Crepidotus in the state of Parana, Brazil. Mycotaxon
66: 165-199.
Senn-Irlet B, Immerzeel G. 2003. Crepidotus cristatus, a new yellow species from the Netherlands.
Persoonia 18: 231-237.
Singer R. 1965. Interesting and new Agaricales from Brazil. Atas do Inst. Micol. Univ. Recife 2:
iyeo9:
Singer R. 1973. The genera Marasmiellus, Crepidotus and Simocybe in the neotropics. Beih. Nova
Hedw. 44: 1-517.
Singer R. 1986. The Agaricales in modern taxonomy. 4th ed. Koeltz Scientific Books, Stuttgart.
Spegazzini C. 1887. Fungi Patagonici. Bol. Acad. Ciencias Cordoba 11: 5-64.
Thiers B. 2011. Index Herbariorum: A global directory of public herbaria and associated staff. New
York Botanical Garden's Virtual Herbarium. <http://sweetgum.nybg.org/ih/> accessed 22 april
2011.
Trindade MB, Lins-e-Silva AC, Silva HP, Figueira SB, Schessl M. 2008. Fragmentation of the
Atlantic rainforest in the northeast coastal region of Pernambuco, Brazil: recent changes and
implications for conservation. Bioremed., Biodiv., Bioavailab. 2: 5-13.
Wartchow EF. 2006. The Neotropical Entoloma dragonosporum (Agaricales, Basidiomycota): new
record from Northeast Brazil. Biociéncias 14: 93-94.
Wartchow FE, Maia LC. 2007. The Neotropical Amanita crebresulcata Bas: new citation from
Northeast Brazil. Hoehnea 34: 131-134.
Wartchow F, Putzke J, Cavalcanti MAQ. 2007a. Ripartitella (Agaricales) from an Atlantic Forest in
Pernambuco, Brazil. Mycotaxon 100: 261-267.
Wartchow F, Putzke J, Cavalcanti MAQ. 2007b. Catatrama costaricensis (Agaricales): a strange
lepiotoid fungus is found in South America. Mycotaxon 101: 35-39.
Wartchow EF, Maia LC, Cavalcanti MAQ. 2008a. Inocybe martinica: new record from South America
and studies of allied species from the Lesser Antilles. Mycotaxon 104: 43-49.
Wartchow F, Putzke J, Cavalcanti MAQ. 2008b. Agaricaceae Fr. (Agaricales, Basidiomycota) from
areas of Atlantic Forest in Pernambuco, Brazil. Acta Botanica Brasilica 22: 287-299.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.147
Volume 118, pp. 147-157 October-December 2011
Tremelloscypha gelatinosa (Sebacinales) from tropical deciduous
Gymnopodium forests in southern Mexico
VicTorR M. BANDALA (*, LETICIA MONTOYA? & RAFAEL VILLEGAS?
'? Red Biodiversidad y Sistemdatica & Red de Ambiente y Sustentabilidad,
Instituto de Ecologia, A.C., RO. Box 63, Xalapa, Veracruz 91000, Mexico
CORRESPONDENCE TO *: *[email protected], * [email protected]
& * [email protected]
ABSTRACT — Populations of Tremelloscypha gelatinosa were found growing on the soil in
Gymnopodium floribundum associations of the tropical deciduous forest in southern Mexico
(State of Chiapas). Documentation of the different developmental coriaceous and spongy
stages revealed a widely variable gross morphology that ranges from stipeless pulvinate forms
to rudimentarily stipitate pseudoinfundibuliform forms that appear polyporoid, steroid, or
gomphoid. The studied collections are described and their taxonomically distinctive macro-
and micromorphological characters are illustrated. The possible mycorrhizal association of
T. gelatinosa with Gymnopodium floribundum and traditional use of the basidiomes as a wild
edible fungus by the local population are also discussed.
Key worps — edible mushrooms, Sebacinaceae, taxonomy, tropical fungi
Introduction
During the last few years we have sampled ectomycorrhizal macromycetes
within the Gymnopodium floribundum Rolfe (Polygonaceae) association, a type
of tropical deciduous vegetation established in the Central Chiapas basin (State
of Chiapas) in southern Mexico [Miranda 1952, as G. antigonoides; Reyes-
Garcia & Souza 1997]. Several species of Amanita, Cantharellus, Russula and
other ectomycorrhizal genera have been found, all possibly associating with
G. floribundum. Lactarius chiapanensis Montoya et al. was previously recorded
from this ecosystem (Montoya et al. 1996) and recently several new fresh
collections were gathered.
An interesting find in the Gymnopodium forest was numerous specimens
of a fungus with coriaceous soft spongy rudimentarily stipitate sporophores.
Mature specimens, which were somewhat trumpet-shaped, resembled a
stout Gomphus species. After examination, we identified these specimens as
148 ... Bandala, Montoya & Villegas
Tremelloscypha gelatinosa, a heterobasidiomycete related to members of order
Sebacinales M. Weif et al. (WeifS et al. 2004a). Molecular-based studies indicate
that T. gelatinosa belongs to Sebacinales group A and is phylogenetically
related to proven ectomycorrhizal species (Weif’ & Oberwinkler 2001, Weif
et al. 2004a, Selosse et al. 2002). There is still no documentation about the
mycorrhizas of T. gelatinosa, but its phylogenetic placement among recognized
ectomycorrhizal sebacinoid species suggests that it could be a potential fungal
symbiont of plant roots (Glen et al. 2002, Selosse et al. 2002, Urban et al. 2003,
Weifé et al. 2004a,b). Considering the abundance of T. gelatinosa and its possible
ectomycorrhizal status in the Gymnopodium forest that we visited, we collected
mycorrhizas from soil samples, including some occurring directly under
T. gelatinosa sporophores. Morphological examination revealed the constant
presence of at least two different morphotypes, but as PCR amplification from
extracted genomic DNA failed, it was not possible to determine whether the
collected mycorrhizas involved T. gelatinosa or other fungi. New collections
of root tips of Gymnopodium floribundum-Tremelloscypha gelatinosa will be
studied in the future.
Tremelloscypha gelatinosa is rare not only in Mexico but also worldwide,
and its morphological variation still deserves to be documented and illustrated.
Therefore we present important information on the extent of morphological
variation exhibited by fresh basidiomes collected at different developmental
stages. Today the species concept of T: gelatinosa is based on the type specimen
(a portion of a basidiome) and some single collections from Jamaica (type
locality), Florida (USA), Yucatan and Quintana Roo (Mexico) (Burt 1915,
Guzman 2004, Roberts 2006, Wells 1961, Wells & Oberwinkler 1982). Here we
describe our new collections in detail, providing photographs and illustrations
of basidiomes and distinctive micromorphological characters and taxonomic
observations.
Tremelloscypha gelatinosa is an economically valuable wild edible fungus
in the Central Chiapas basin, particularly near Tuxtla Gutierrez, Chiapas.
In this region T. gelatinosa is locally known as “nangafiafa” and —with the
so-called “moni” Lactarius chiapanensis (first reported by Miranda 1952 and
formally described by Montoya et al.. 1996)— is commonly collected by the
local population for personal consumption and/or for sale. Gymnopodium
floribundum is a dominant or co-dominant species in the deciduous tropical
forest established at SE of Tuxtla Gutierrez (Miranda 1952, Reyes-Garcia &
Souza 1997); the G. floribundum forest, which (although now fragmented) covers
several hectares, is collectively called “nanganal” (“aguanal” or “aguanacatonal”
in Miranda 1952). More will be published on traditional use of T: gelatinosa in
the future.
Tremelloscypha gelatinosa in Gymnopodium forests (Mexico) ... 149
Materials & methods
Observations were made from fresh basidiomes collected in a forest dominated by
Gymnopodium floribundum, a tropical deciduous component of vegetation in Suchiapa,
municipality of Suchiapa, SE of Tuxtla Gutierrez, Chiapas. Color codes in descriptions
refer to Kornerup & Wanscher (1967; e.g. 10C2) and Munsell (1994; e.g. SYR 4/1). For
microscopic observations, hand sections of dried samples were mounted in 3% KOH
and stained with both 1% Congo red aqueous solution and phloxine. Line drawings were
made with the aid of a drawing tube. Measurements were made in KOH; 35-45 spores
were measured per collection; Xr = range of means of length x width of n collections;
Qr = range of means of basidiospore length/width ratios in n collections. Herbarium
acronyms follow Holmgren et al. (1990).
Identification of collection VB4212 was confirmed by extraction and amplification
of the ITS rDNA region according to Montoya et al. (2010). The obtained sequence was
edited with Sequencher Ver. 4.1 (Gene Codes, Ann Arbor, Michigan) and deposited
in GenBank database (http://www.ncbi.nlm.nih.gov/) under accession number
T. gelatinosa (VB 4212) JQ012947. The ITS rDNA sequence from VB4212 was compared
with T. gelatinosa AF490394 (GenBank) using the BLAST sequence similarity search
tool (Altschul et al. 1997), revealing a 99% maximum similarity.
Taxonomy
Tremelloscypha gelatinosa (Murrill) Oberw. & K. Wells,
Mycologia 74: 325, 1982. PLATES 1-4
= Eichleriella gelatinosa Murrill, Ann. Missouri Bot. Gard. 2: 748, 1915.
BASIDIOMES (25-)40-165 x 30-110 mm, pulvinate or irregularly subglobose
in young stages, becoming more or less trumpet-shaped in profile and then
pseudoinfundibuliform, rudimentarily stipitate, soft and spongy when wet
but coriaceous and even fibrous in dried condition. PILEUS (25—)40-165 mm
wide, subglobose, gradually plano-convex, plane and finally plane-depressed
(not deeply depressed or perforated), then pseudoinfundibuliform, irregularly
circular, frequently becoming flabellate or spathulate, often confluent forming
an irregular mass of spathulate or flabelliform pilei, with somewhat crenate or
more or less lobed margin, this latter thin or broad, slightly elevated, obtuse;
surface dry, zonate, at first velvety, with age appearing fibrillose, villose or
strigose, at times somewhat floccose-scaly (mainly in old specimens); whitish
or grayish when young, at times whitish with pale gray-blue or pinkish areas,
becoming brown-yellow, brownish (5D5-7), brown-reddish or brown-orange
(6D4-6), rarely with greenish shades, with darker concentric zones (6E6-7,
6F5-6), in dried material pale brown to brown, with spongy aspect, dry; margin
whitish becoming brownish or paler, in some stages showing pale vinaceous
tinges. HYMENOPHORE decurrent, smooth, plane to irregularly rugulose or with
short bulges, then at times appearing faintly verruculose, continuous, rarely
cracked, cartilaginous in aspect, tough when dried, whitish or with yellow to
150 ... Bandala, Montoya & Villegas
PLaTE 1. Tremelloscypha gelatinosa. (a: Bandala 4210; b: Bandala 4212). Scale bar = 20 mm.
Tremelloscypha gelatinosa in Gymnopodium forests (Mexico) ... 151
PLaTE 2. Tremelloscypha gelatinosa. (a: Bandala 4361; b. Bandala 4363). Scale bar = 20 mm
152 ... Bandala, Montoya & Villegas
gray tints (SYR 4/1), dark or light grayish-vinaceous (9D3, 9E4, 10C2, 11D2),
gray with pink tinges (SYR 2/5-6) or grayish-brown (5D2-3, 5E3, 6C2, 6D2-3),
occasionally pale orange-brown (5YR 3-4/3-4) or pale orange (7B5), whitish,
pale vinaceous or pale vinaceous-brown towards or on the margin, often with
obscure concentric zones. STIPE as an attenuated end of the hymenophore
attached to the substratum, at times with age becoming poorly defined, around
15-25 x 15-30 mm, more or less cylindrical to attenuate, stout, velutinous,
somewhat hirsute to glabrous at base, same color with pileus or hymenophore,
whitish at base, compact. CONTEXT pale to more or less grayish-white, often
with pale vinaceous or pink tinges, showing concentric growth lines, dry,
fibrous, unchanging on exposure, 6-21 mm thick in pileus. Odor strong, almost
farinaceous (recalling some stipitate hydnoids), taste mild.
BASIDIOSPORES 8-13 x (5.5-)6-9 um, (Xr = 9.1-11.5 x 6.8-7.4 um;
Qr = 1.28-1.58), ellipsoid to broadly ellipsoid, some subglobose, at times
adaxially weakly depressed, apiculus conspicuous, more or less truncate, thin-
walled, smooth, hyaline, guttulate, germination not observed. BAsrp1a 14-18 x
9-12 um, ovate to obovate, at times clavate or subglobose, forming 2-4 basidial
segments, clampless, guttulate; epibasidia cylindric or faintly tapered apically,
up to 45 x 2-4 um; fertile hyphae faintly tortuous, usually branching, forming
basidia by proliferating near subbasidial hyphal segment. DIKARYOPHYSES
simple to shortly branched, 2-4 um diam., guttulate, abundant, not forming
a distinct layer above the basidia; the basal portion of the hymenial elements
consisting of cylindrical, septate and compactly arranged hyphae; the general
aspect of the hymenial stratum is of a gelatinous tissue, with its elements very
compactly arranged and with refractive contents, more or less differentiated
into several growth layers, each consisting of prostrate and ascending elements.
CONTEXT consisting of cylindric, yellowish-brown or pale brown hyphae,
3-5(-9) um wide, simple or bifurcate, shortly or more or less spacing segmented,
thick-walled, loosely interwoven or in some areas with many hyphae arranged
in tight fascicles forming a compact tissue; a narrow, prostrate layer composed
of indistinct, agglutinated hyphae giving rise to the hymenial elements. CLamp
CONNECTIONS absent.
EcoLocy— Scattered or gregarious (occasionally solitary) in soil, commonly
among fallen dead leaves and twigs, the basidiomes often enclosing small,
dead twigs or thin stalks of live plants, in tropical deciduous Gymnopodium
floribundum forest.
MATERIAL STUDIED — MEXICO. Cuiapas: Suchiapa, Mpio. de Suchiapa, 4.X1.2003,
Bandala 3838; 5.VI1I.2005, Montoya 4353; 5.I1X.2006, Bandala 4210, 4212 (GenBank
JQ012947); 14.VI.2008, Bandala 4361, 4363; 15.V1.2008, Bandala 4366, 4370, 4374 (all
at XAL). JAMAICA. Troy and Tyre, Cockpit Country, W.A. Murrill & W. Harris (Fungi
of Jamaica 1087) (Holotype, NY).
Tremelloscypha gelatinosa in Gymnopodium forests (Mexico) ... 153
PiatE 3. Tremelloscypha gelatinosa.
a. Basidiospores. b. Basidia and dikaryophyses. c. Section of basal portion of hymenium.
(Bandala 4210). Scale bar = 10 um
154 ... Bandala, Montoya & Villegas
aa
Prate 4. Tremelloscypha gelatinosa.
a. Context hyphae. b. Basidia and dikaryophyses. c. Basidiospores.
(a: Bandala 4210; b-c: Bandala 4274). Scale bar = 10 um.
Tremelloscypha gelatinosa in Gymnopodium forests (Mexico) ... 155
Discussion
Recognition of Tremelloscypha gelatinosa as a non-resupinate fungus (i.e.
different from members of Eichleriella Bres.; cf. Wells & Raitviir 1980) was
inferred not from the type but from a specimen from Florida gathered by K.
Lampe & A.L. Welden in 1957 (Wells 1961). The holotype (from Jamaica) in fact
consists of only a pressed 35 x 18 mm portion apparently separated from the rest
of the basidiome and superficially bearing a resemblance to an effuse-reflexed
fructification as indicated both by the diagnosis (Burt 1915) and the field label
accompanying the type noting “a specimen of Stereum or Cladoderris? Using
data from the previously cited Florida collection and microscopic examination
of the holotype, Wells & Oberwinkler (1982) recorded T. gelatinosa as growing
on decayed wood and described the basidiomes as 35-75 x 20-55 mm, 1-6
mm thick, flabellate, infundibuliform or pseudoinfundibuliform in shape, and
with a poorly defined stipe.
Our fresh collections covered many different developmental stages, thus
providing more information on the variability of the gross morphology.
The fructifications were irregularly subglobose, pulvinate, lacking a stipe or
rudimentarily stipitate and pseudoinfundibuliform, more or less trumpet-
shaped and sometimes flabellate or spathulate, not with umbilicate, depressed
or deeply depressed pileus, in some stages the sporophores then superficially
resembled polyporoid, stipitate-steroid or gomphoid forms.
Sporophores of both T’ australiensis D.A. Reid, the type species of the
genus (Reid 1979), and our T: gelatinosa collections grew on soil, not wood.
Tremelloscypha australiensis differs morphologically from T. gelatinosa in its
smaller (7-20 x 8-12 mm) distinctly infundibuliform stipitate basidiomes that
are yellow when fresh and yellowish- or ochraceous-brown when dry and a
pileus surface with an almost waxy-cartilaginous appearance (Reid 1979).
Spore characters are particularly important: T: australiensis basidiospores
are subcylindrical, narrowly elliptical to suballantoid (Reid 1982: 10-13.2 x
4.5-5 um; Wells & Oberwinkler 1982: 10.5-13 x 5-5.5 um), while T: gelatinosa
basidiospores are ellipsoid to broadly ellipsoid (Burt 1915: 8-10 x 6 um;
Wells 1961: 7.5-11 x 5.5-8 um; Wells & Oberwinkler 1982: 9-13.5(-14.5) x
5.5-8(-9.5) um; Guzman 2004: (7-)9-13 x 6-8 um; this study: 8-13 x (5.5-)
6-9 um).
Acknowledgments
We are grateful to Dr. D.J. Lodge (USDA Forest Service, Forest Products Laboratory
in Puerto Rico) and Dr. M. Weif} (Institute of Evolution and Ecology, University of
Tubingen, Germany) for critical comments to improve the manuscript. We thank the
Curator from NY for the loan of type material. Thanks to Biols. T.G. Cabrera, T. Acero,
and M.J. Gutierrez (Botanical Garden of Tuxtla Gutierrez Chiapas) for their support
and assistance during visits by V.M. Bandala and L. Montoya to Tuxtla Gutierrez and
156 ... Bandala, Montoya & Villegas
for providing information on local use of T. gelatinosa as a wild edible fungus. We
appreciate the collaboration of Biols. P. del Moral and D. Ramos in the laboratory and in
the field, and MSc E. Garay by assistance during the molecular analysis (all at Instituto
de Ecologia, Xalapa). This work was partially supported by project Monitoreo de aves
en lineas de transmision fase III. Chicouasen, Chiapas, Juile, Veracruz (directed by
R. Villegas).
Literature cited
Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped
BLAST and PSI-Blast: a new generation of protein database search programs. Nucleic Acids Res
25:3389-3402. http://dx.doi.org/10.1093/nar/25.17.3389
Burt EA. 1915. The Thelephoraceae of North America V. Tremellodendron, Eichleriella and Sebacina.
Ann. Missouri Bot. Gard. 2: 731-771.
Glen M, Tommerup IC, Bougher NL, O’Brien PA. 2002. Are Sebacinaceae common and widespread
ectomycorrhizal associates of Eucalyptus species in Australian forests? Mycorrhiza 12: 243-247.
http://dx.doi.org/10.1007/s00572-002-0180-y
Guzman G. 2004. Los hongos de la Peninsula de Yucatan (México) V. Nuevas observaciones y
nuevos registros. Rev. Mex. Mic. 18: 7-13.
Holmgren PK, Holmgren NH, Barnett LC. 1990. Index herbariorum. Part I. The herbaria of the
world. 8th edn. New York. 693 p.
Kornerup A, Wanscher JH. 1967. Methuen handbook of colour. 2th ed., Methuen, London.
Miranda FE. 1952. La vegetacién de Chiapas. Ediciones del Gobierno de Chiapas, Tuxtla Gutierrez,
Chiapas.
Montoya L, Bandala VM, Guzman G. 1996. New and interesting species of Lactarius from Mexico
including scanning electron microscope observations. Mycotaxon 57: 411-424.
Montoya L, Haug I, Bandala VM. 2010. Two Lactarius species associated with a relict Fagus
grandifolia var. mexicana population in a Mexican montane cloud forest. Mycologia 102:
153-162. http://dx.doi.org/10.3852/09-010
Munsell. 1994. Munsell soil-color charts. Macbeth, New Windsor.
Reid DA. 1979. Tremelloscypha and Papyrodiscus two new genera of Basidiomycetes from Australia.
Beih. Sydowia 8: 332-334
Roberts P. 2006. Caribbean heterobasidiomycetes: 2. Jamaica. Mycotaxon 96: 83-107.
Reyes-Garcia A, Souza M. 1997. Listados floristicos de México XVII. Depresién Central de Chiapas.
La selva baja caducifolia. Instituto de Bioloia, UNAM, México, D.F.
Selosse MA, WeifS M, Jany JL, Tillier A. 2002. Communities and populations of sebacinoid
basidiomycetes associated with the achlorophyllous orchid Neottia nidus-avis (L.) L.C.M. Rich.
and neighbouring tree ectomycorrhizae. Molecular Ecology 11: 1831-1844.
http://dx.doi.org/10.1046/j.1365-294X.2002.01553.x
Urban A, Weif$ M, Bauer R. 2003. Ectomycorrhizas involving sebacinoid mycobionts. Mycol. Res.
107: 3-14. http://dx.doi.org/10.1017/S0953756202007116
WeifS M, Oberwinkler FE. 2001. Phylogenetic relationships in Auriculariales and related groups —
hypotheses derived from nuclear ribosomal DNA sequences. Mycol. Res. 105: 403-415.
Weifi M, Selosse MA, Rexer KH, Urban A, Oberwinkler F. 2004a. Sebacinales: a hitherto overlooked
cosm of heterobasidiomycetes with a broad mycorrhizal potential. Mycol. Res. 108: 1003-1010.
http://dx.doi.org/10.1017/S0953756204000772
Weifi M, Bauer R, Begerow D. 2004b. Spotlights on heterobasidiomycetes. In Agerer R, Piepenbring
M, Blanz P. (eds). Frontiers in Basidiomycote Mycology 7-48, IHW-Verlag.
Tremelloscypha gelatinosa in Gymnopodium forests (Mexico) ... 157
Wells K. 1961. Studies of some Tremellaceae IV. Exidiopsis. Mycologia 53: 317-370.
http://dx.doi.org/10.2307/3756581
Wells K, Oberwinkler F. 1982. Tremelloscypha gelatinosa, a species of a new family Sebacinaceae.
Mycologia 74: 325-331. http://dx.doi.org/10.2307/3792902
Wells K, Raitviir A. 1980. The species of Eichleriella (Tremellaceae) of the U.S.S.R. Mycologia 72:
564-577. http://dx.doi.org/10.2307/3759531
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.159
Volume 118, pp. 159-176 October-December 2011
New records of polypores from southern Florida
J. VLASAK?”, J. KouT?, J. VLASAK JR. & L. RYVARDEN‘
"Biol. Centre of the Academy of Sciences of the Czech Republic &
*University of South Bohemia, Faculty of Science,
Branisovskd 31, CZ-370 05 Ceské Budéjovice, Czech Republic
°University of West Bohemia, Faculty of Education, Department of Biology,
Klatovska 51, CZ-306 19 Pilsen, Czech Republic
‘Biological Insitute, RO. Box 1045, Blindern, N-0316 OSLO, Norway
*CORRESPONDENCE TO: [email protected]
ABSTRACT — Fifteen new records of polypore species are reported from the southern Florida,
USA, with short comments to their key features, ecology, and distribution. The combination
Fomitiporia apiahyna is proposed.
Key worps — Basidiomycota, Hymenochaetaceae, Polyporaceae, taxonomy, invasive species
Introduction
The southernmost part of Florida south of Tamiami Trail (U.S. 41, which
bisects Miami) lies in the tropical hardwood forest region of the state (Young
& Giese 2003). This relatively small area contributes substantially to poroid
xylophilous fungi diversity in the USA, and about 15% of USA polypore species
published in a compendium by Gilbertson & Ryvarden (1986, 1987) probably are
found only here. Although Ryvarden (2004) and Decock et al. (2007) published
new data on southern Florida Ganodermataceae and Hymenochaetaceae, to our
knowledge no new records have been added for the Polyporaceae since 1987.
Most of the territory belongs to Everglades National Park and is covered
with regularly flooded wetland or with extensive mangrove stands along the
coast. The rather uniform mangrove polypore flora from Brazil treated by
Sotao et al. (2002) and Trierveiler-Pereira et al. (2009) is not the primary focus
of our study.
Much higher polypore diversity is found in tropical hardwood forest areas
with red-barked gumbo-limbo (Bursera simaruba (L.) Sarg. (Burseraceae)) the
typical tree species. This forest-type, however, is confined to small tear-shaped
160 ... Vlasak& al.
islands of “hardwood hammocks” that occur on raised peaty platforms above
surrounding wetlands. As most are inaccessible by foot, the casual visitor is
restricted to only a handful of such localities in the Everglades and several Miami
city parks. Another distinctive Everglades locality comprises the remnant pine
rockland fragments dominated by Pinus elliottii Engelm. (Pinaceae).
Several small state parks were also established in the Florida Keys archipelago.
Their polypore flora is not as rich because many temperate tree species, such as
southern live oak (Quercus virginiana Mill. (Fagaceae)) and sugarberry (Celtis
laevigata Willd. (Ulmaceae)), together with their associated polypores reach
their southern limits on the mainland. Also, Florida Keys hardwood hammocks
are drier because of ocean breezes and low rainfall (Whitney et al. 2004). On
the other hand, there are several tropical trees that occur only in the Keys and
some polypore species seem to be growing only on them.
After exploring all these small localities several times, we have discovered
some tropical polypores not yet recorded from the USA. We describe these
below and also propose one new combination. Critical Florida collections were
compared with our finds of the same or similar species from northern Florida,
US Virgin Islands, Mexico, Belize, and Guatemala. Some species could be
determined only after ITS rRNA region sequencing. Surprisingly, sequencing
confirmed some of the most common polypores as new records.
Materials & methods
During December 2003, April 2009, August 2010, and December 2010, polypore
specimens were photographed in situ, collected, dried, and examined microscopically
mounted in Melzer’s reagent or 10% KOH. All specimens were deposited in private
herbarium of the first author, with duplicates of some specimens maintained in the
Prague Museum Herbarium (PRM).
DNA was isolated from selected polypore samples and the ITS rRNA region was
sequenced to confirm the determination. 0.25 g of the context tissue from dried
specimens was disintegrated 60 s with a steel ball in mixer mill MM301 RETSCH at
room temperature. DNA was isolated using CTAB/NaCl extraction buffer (Murray &
Thompson 1980), followed by repeated extraction with chloroform and isopropanol
precipitation. Crude DNA was dissolved in 100 ml of sterile water and further purified
using Wizard Clean Up kit PROMEGA. Resulting DNA solution (50 ul) was diluted
ten times and 1 ul was used as template for amplification with ITS5 and ITS4 primers
(White et al. 1990) in 25 ml reaction mixture using 55 °C annealing temperature.
Amplified DNA was sequenced in the Genomics laboratory of Biology Centre, Academy
of Sciences of the Czech Republic, Ceské Budéjovice, on ABI 3730xl DNA analyzer,
using BigDye Terminator 3.1 kit.
Results & discussion
Noteworthy collections are listed alphabetically by family, genus, and
species. Descriptions are included for some species, with additional comments
Polypores new to Florida (U.S.A.) ... 161
on distribution, ecology, and diagnostic or critical characters. All species are
new records to Florida.
Hymenochaetaceae Donk
Fomitiporia apiahyna (Speg.) Vlask & Kout, comb. nov. PHOTO 1
MycoBank MB 519982
= Fomes apiahynus Speg., Bol. Acad. Nac. Ci. 11: 438, 1889.
Basidiomes perennial, sessile, triquetrous, ungulate, 3 x 2 x 1 cm; upper surface
glabrous, sulcate, zonate, dark brown to black, margin acute, pore surface
grayish-brown, the pores circular, 7-9 per mm, with thick, entire dissepiments;
tubes 2 mm long each year, context yellowish brown, woody hard, up to 0.2 cm
thick. Hyphal system dimitic, contextual skeletal hyphae brown in KOH, thick-
walled, rarely branched, 2.5-5 um in diam.; generative hyphae hyaline, thin-
walled, 1.5-3 um in diam., with simple septa. Basidia broadly ellipsoid, 7-10 x
4.5-6 um, simple septate at the base, with 4 sterigmata. Basidiospores globose,
hyaline, thick-walled, dextrinoid in Melzer’s reagent, 5-6 x 4.5-5 um.
SPECIMENS EXAMINED — USA. FLORIDA: COLLIER COUNTY, Fakahatchee Strand
Preserve, East Main Tram, 23. IV. 2009, sabal palm, leg. J. Vlasak Jr., det. J. Vlasak
(JV 1008/113), (JV1008/114); MonROE County, Florida Keys, Long Key State Park, 27.
VIII. 2010, shrub, leg. & det. J. Vlasak (JV 1008/46); Sarasota County, Myakka River
State Park, 24. IV. 2009, sabal palm, leg. & det. J. Vlasak (JV 1008/1474).
DISTRIBUTION & ECOLOGY - from northern Argentina to Costa Rica (Ryvarden 2004).
In southern Florida not rare, most often on living sabal palm (Sabal palmetto (Walter)
Lodd. ex Schult. (Arecaceae)) but also on other substrates.
; 5)
A ee ken
pee a i, pyr |
eR ¢
: ieee ae
PHOTO 1: Fomitiporia apiahyna JV 1008/113 on living sabal palm.
~ i
“>< i
162 ... Vlasak& al.
ComMENTS - This species is remarkable for its very small thumbnail-sized
applanate (more often ungulate) pilei. Its microscopic features are reminiscent
of Fomitiporia robusta (P. Karst.) Fiasson & Niemela: globose thick-walled
strongly dextrinoid spores that are, however, distinctly smaller in Fo. apiahyna
and an absence of setae. As molecular analysis clusters the species with
Fo. robusta/punctata (Goes-Neto et al. 2002), we transfer this species to
Fomitiporia Murrill as defined by Fiasson & Niemela (1984).
Fomitiporia maxonii Murrill
DESCRIPTION — Ryvarden (2004:188).
SPECIMENS EXAMINED — USA. FLORIDA: DADE County, Miami, Fairchild Botanical
Garden, 24. XII. 2003, leg. J. Vlasak Jr., det. J. Vlasak (JV0312/24.16-J, PRM915956);
US VirGIN IsLANDs: St. John, 3. IX. 2004, leg. J. Vlasak Jr., det. J. Vlasak (JV0409/19-J,
PRM915955).
DISTRIBUTION & ECOLOGY - Costa Rica, Belize, Galapagos (Ryvarden 2004). Probably
quite rare in the USA: we collected it only once in Florida (in Fairchild Botanical Garden)
and also on US Virgin Islands. On dead hardwoods.
ComMENTSs - The species resembles Fo. punctata (P. Karst.) Murrill but has
somewhat larger pores and smaller spores. It can be positively determined only
after DNA sequencing. Sequences of our collections deposited in the GenBank
(GU136210, GU136211) correspond perfectly to other published Fo. maxonii
sequences (Decock et al. 2007).
Inonotus micantissimus (Rick) Rajchenb. PHOTO 2
DESCRIPTION — Ryvarden (2004: 136).
Mae Sy Saye
° . y % ‘ \
Sein, AS Ngee
Epon ee Bh.
eg
“4
A
PHOTO 2: Inonotus micantissimus JV 1008/80 on living Ocotea coriacea.
Polypores new to Florida (U.S.A.) ... 163
SPECIMENS EXAMINED — USA. FLORIDA: DADE County, Miami, Matheson Hammock
Nature Area, 30. VIII. 2010, Ocotea coriacea, leg. J. Vlasak, det. L. Ryvarden (JV 1008/80,
ITS rRNA JF692194); US VirGIN IsLANDs: St. John, 3. IX. 2004, leg. K. Vlasakova., det.
J. Vlasak (JV0409/3-K, PRM902083). JAMAICA. Ocho Rios, 12. VI. 2008, leg. J. Vlasak
Jr., det. J. Vlasak (JV0806/18-J).
DISTRIBUTION & ECOLOGY - Argentine, Brazil, and Dominican Republic (Ryvarden
2004). We have collected this species before on US Virgin Islands and Jamaica; the ITS
rRNA region sequences of these collections are nearly identical. All collections are from
living hardwoods.
ComMENTs - Inonotus micantissimus may be recognized by its resupinate or
somewhat bulbous, very dark brown basidiomata, abundant setal hyphae as
well as hymenial setae and large, globose, hyaline basidiospores, 10-13 um in
diam.
Fuscoporia callimorpha (Lév.) Groposo, C.L. Leite & Gées-Neto PHOTOS 3-5
DEscRIPTIONS — Ryvarden & Johansen (1980:145); Loguercio-Leite & Wright (1995).
PHOTO 3: Fuscoporia callimorpha JV0904/87, in situ.
SPECIMENS EXAMINED — USA. FLorIDA: BROWARD County, Davie, Tree Tops Park,
26.1V.2009 (JV0904/174, 178); 28.XII.2003 (JV0312/28.5-J); Everglades Nat. Park,
Long Pine Key Campground, 27.VHI.2010 (JV1008/43); 29.VIII.2010 (JV 1008/63);
Everglades Nat. Park, Royal Palm, 19.IV.2009 (JV0904/33); 22.IV.2009 (JV0904/87,
ITS rRNA JF692190&191, JV0904/88); 20.XII.2003 (JV0312/20.1-J, 20.5-J, ITS rRNA
JF692192); 28.XII.2003 (JV0312/28.5-J); DapE County, Miami, Matheson Hammock
Nature Area, 26.VIII.2010, leg. & det. J. Vlasak (JV 1008/10); 19.IV.2009 (JV0904/13-
16); 24.X1I.2003 (JV0312/24.2-J,24.8-J); H1iGHLANDs County, Highlands Hammock
164 ... Vlasak& al.
PHoTO 4: Fuscoporia callimorpha JV0904/155, in collection.
St. Park, 25.IV.2009 (JV0904/155); Saint JOHN Counry, St. Augustine, Washington
Oaks St. Park, 20.XII.2002 (JV0212/7-J); Sarasota County, Myakka River St. Park,
24.1V.2009 (JV0904/143, 144); US VirGIN IsLANDs, St. John, 4.1X.2004, leg. J. Vlasak
Jr., det. J. Vlasdk, (JV0409/14-J, ITS rRNA JF692193, 15-J). BELIZE. Cockscomb Basin,
30.X.2006, leg. J. Kout, det. J. Viasak (JV0610/13P-K). GUATEMALA. Tikal, 4.X1.2006,
leg. J. Kout, det. J. Vlasak (JV0611/1P-K, K3C-K). MEXICO. VERAcRUuz: Los Tuxtlas,
12.X.2006, leg. J. Kout, det. J. Viasak (JV0610/S-K); Cutapas: Palenque, Campground,
19.X.2006, leg. J. Kout, det. J. Viasak (JV0610/6P-K). VENEZUELA. Cueva el Guacharo,
22.11.2004, leg. J. Kout, det. J. Viasak (JV0402/41, 42).
DISTRIBUTION & ECOLOGY - Africa (Ryvarden & Johansen 1980), Central America
(Lowe 1957), Brazil (Loguercio-Leite & Wright 1995). On dead hardwoods.
Comments - This annual, sometimes reviving, corky hard species is by far
the most common pileate Phellinus in southern Florida. Accordingly, it is
also a very variable species forming usually flat applanate pilei but sometimes
also triquetrous or effused-reflexed basidiomes or fully effused (on the log
underside) with detached sharp margin. No cuticle or black line develops
under the pileus tomentum, which is quite persistent, usually structured in
sharp zones (agglutinated in some), exuding a thin waxy layer that is somewhat
shiny-glossy and silvery. This important field trait is, however, not obvious in old
pilei with hardened surfaces. The pore surface is much more constant: fulvous
Polypores new to Florida (U.S.A.) ... 165
PuHoTo 5: Fuscoporia callimorpha JV0312/20.1 and JV0312/20.5, in collection.
with a purplish tint and pores that are very small (7-9 per mm), very regular,
round, and with thick dissepiments. Hymenial setae are short (< 25 um), not
much contrasting, abundant in some specimens but very rare and difficult to
find in others. In the hymenium are thin-walled, ventricose cystidioles (necks
< 10 x 1.5-2 um) that are not mentioned in descriptions but well pictured in
Loguercio-Leite & Wright (1995). Basidiospores (oblong ellipsoid, hyaline,
thin-walled, 3.5-4.2 x 2.2-2.9 um) are always collapsed and difficult to find in
winter and early spring collections.
This species is evidently a taxonomical problem. The ITS rRNA region
sequence is identical with the GenBank sequence AY558649 from culture
CBS 182.34. In 1934 Overholts isolated the culture in the USA as Phellinus
torulosus (Pers.) Bourdot & Galzin. TomSovsky & Jankovsky (2007) showed,
however, that this sequence differs from the European Fuscoporia (Phellinus)
torulosa (Pers.) T. Wagner & M. Fisch. Moreover, Fu. torulosa develops much
thicker basidiomes that are very persistent, even on dead wood for more than
25 years. Fu. torulosa probably does not occur in the USA, for there are no
reliable records (see also Rizzo et al. 2003) and we were not able to find it
despite numerous excursions in Pennsylvania and Virginia where it should
have optimal conditions for growth.
Phellinus roseocinereus (Murrill) D.A. Reid, described from North America
and widespread in Central America (Lowe 1957), corresponds very well to
this common Florida polypore. However, we agree with Ryvarden & Johansen
(1980) and Loguercio-Leite & Wright (1995), who consider P_ roseocinereus
166 ... Vlasak& all.
identical to Fu. callimorpha, described originally from Madagascar. Corner
(1991) was unable to detect any difference between Phellinus senex (Nees &
Mont.) Imazeki from Asia and P callimorphus, except for slightly narrower
spores of the latter. The sequence of Fuscoporia senex (Nees & Mont.) Ghob.-
Nejh. in GenBank AY558647 (isolate CBS 442.76 of B.K. Bakshi from India),
which is really much more similar to our sequences than Fu. torulosa, still
clusters separately (with 99% bootstrap support, not shown). Judging from the
literature and our examinations of two Fu. senex specimens from China, we
think that Fu. senex has only an indistinctly zonate pileus surface, lacks glossy
zones, and produces broader spores (>3.5 um; compared to always <3 um in
Fu. callimorpha). Also, older Fu. senex spores are sometimes slightly thick-
walled and yellowish, never true in Fu. callimorpha.
Phellinus neocallimorphus Gibertoni & Ryvarden, known only from the
type locality in Brazil, differs from Fu. callimorpha only by the absence of
setae. Nevertheless, we also could not find any setae in some of our specimens
(e.g. 0312/20.5) although in other respects, including rDNA ITS region
sequence, the specimens were typical. More detailed study of P. neocallimorphus
is needed, evidently.
Phellinus gilvus (Schwein.) Pat. is another quite similar species found in
southern Florida, although not as often as elsewhere in the USA. The similar
basidiomes are, however, glabrous, without tomentum, azonate, and softer.
Although also hyaline and thin-walled, Ph. gilvus spores are ovoid and 3-3.5
um broad.
We have sequenced nine collections of Fu. callimorpha from southern
Florida, US Virgin Islands, and Mexico with markedly different pileus forms,
and, except for a few mutations, all sequences are the same. We infer that there
is no other similar species in the region.
Phellinus calcitratus (Berk. & M.A. Curtis) Ryvarden PHOTO 6
DESCRIPTION — Ryvarden (2004: 162).
SPECIMENS EXAMINED — USA. FLorIDA: BROWARD County, Davie, Tree Tops Park,
26.1V.2009 (JV0904/167); DapE County, Miami, Matheson Hammock Nature
Area, 30.VIHI.2010, leg. & det. J. Vlasak (JV1008/83, ITS rRNA JF894114, JF894115);
26.VUI.2010 (JV1008/11); 19.IV.2009 (JV0904/12).
DISTRIBUTION & ECOLOGY - South America, West Indies (Ryvarden 2004). Locally
abundant in the Matheson Hammock Nature Area but rare elsewhere. Always on rather
thick, old, decorticated logs, probably oaks.
ComMENtTs ~ This is a characteristic species with a broadly attached, applanate
pileus with a sharp margin and thick crustulose black zone under hard
tomentum. The very thin-walled tubes are unique for Phellinus species in the
region. Spores are thick-walled, globose, yellow to brown. The sequence shows
no homology with GenBank sequences.
Polypores new to Florida (U.S.A.) ... 167
PHOTO 6: Phellinus calcitratus JV1008/83.
Phellinus caribaeo-quercicola Decock & S. Herrera PHOTO 7
DESCRIPTION — Decock et al. (2006).
SPECIMENS EXAMINED — USA. FLorIDA: BROWARD County, Davie, Tree Tops Park,
26.1V.2009, leg. & det. J. Vlasak (JV0904/177, ITS rRNA GU594159); Everglades Nat.
* ~ s ra
PuHoTo 7: Phellinus caribaeo-quercicola JV0904/28-J.
(The photo was taken one year after breaking off the original basidiome.)
168 ... Vlasak& al.
Park, Royal Palm, 19.IV.2009, leg. J. Vlasak Jr., det. J. Viasak (JV0904/28-J, PRM915960,
ITS rRNA GU594158); 20.X1I.2003 (JV0312/20.7-J).
DISTRIBUTION & ECOLOGY - Described relatively recently from western Cuba as growing
exclusively on Quercus cubana A. Rich. (Decock et al. 2006). Nevertheless, it seems not
to be rare around Miami on dead stems and branches of Q. virginiana.
Comments - Phellinus caribaeo-quercicola produces large perennial bulbous
or semipileate basidiomes, usually with several layers of rather long tubes. The
rare to abundant thick-walled setae with hooked tips and subglobose thick-
walled light yellowish spores are characteristic. The ITS rRNA of our collections
corresponds perfectly to the published sequence (Decock et al. 2006).
Phellinus nilgheriensis (Mont.) G. Cunn. PHOTO 8
DESCRIPTION — Ryvarden & Johansen (1980:187).
SPECIMENS EXAMINED - USA. FLoripa: DapE County, Hwy 41, Kirby Storter
Boardwalk, 28.VIII.2010, leg. & det. J. Vlasak (JV1008/49); (JV1008/50); 23.IV.2009
(JV0904/112, PRM915957).
DISTRIBUTION & ECOLOGY - Southeast Asia, Africa, Cuba (Ryvarden & Johansen
1980), French Antilles, and Guiana (David & Rajchenberg 1985), Brazil (Groposo et
al. 2007); always on hardwoods. Not previously published from the USA. However,
around the Kirby Storter boardwalk at a Hwy 41 wayside, the fungus grows on several
living Taxodium distichum (L.) Rich. trees in the slough, approximately at the height of
summer-time water level.
Comments - The applanate pilei, not as hard as in similar Phellinus species, are
typically more or less glabrous with a narrow rounded margin and rather bright
PuotTo 8: Phellinus nilgheriensis JV 1008/50 on living Taxodium distichum.
Polypores new to Florida (U.S.A.) ... 169
brown context. Lack of setae and subglobose thick-walled, yellow to rusty
brown spores (in Melzer’s) may remind of Fomitiporia when viewed in Melzer’s
reagent. It seems to be annual but reviving species— new tubes overgrow dead
the previous year’s tubes with the tube layers separated by a context tissue layer.
The ITS rRNA of our collections corresponds perfectly to published sequence
AY558633.
Polyporaceae Fr. ex Corda
Coriolopsis hostmannii (Berk.) Ryvarden PHOTO 9
DESCRIPTION — Ryvarden (2007).
SPECIMENS EXAMINED - (all on living buttonwood mangrove) USA. FLorIDA:
COLLIER County, Hwy 41, Collier-Seminole State Park, 24.XII.2003, leg. J. Vlasak,
det. L. Ryvarden (JV 1008/56, 57); 23.1V.2009, leg. & det. J. Viasak (JV0904/125);
25.XII. 2003, leg. J. Vlasak Jr., det. J. Vlasak (JV0312/25.7-J); MONROE COUNTY,
Florida Keys, Long Key State Park, 27.VIII.2010, leg. J. Vlasak, det. L. Ryvarden
(JV 1008/42).
DISTRIBUTION & ECOLOGY - Pantropical. This species is probably confined to
living buttonwood (Conocarpus erectus L. (Combretaceae)). Its ecology was
extensively treated in several papers about buttonwood polypore populations
(Bergeman et al. 2009, Parrent et al. 2004) using the name “Datronia caperata
(Berk.) Ryvarden from buttonwood’, even though the authors were aware that
their fungus is not conspecific with typical D. caperata. Our ITS rRNA sequence
4
Ri:
i
PHOTO 9: Coriolopsis hostmannii JV 1008/42 on living buttonwood.
170 ... Vlasak& al.
corresponds very well with their published sequences and differ from an authentic
D. caperata sequence.
ComMENTs - This is a very typical and relatively common species. Nonetheless,
it appears in the mycological literature quite rarely under its proper name. It
seems to be often misinterpreted, for example as Datronia caperata, a South
American species with similar spores and pores but with a dark brown context,
tough trametoid consistency, and coarsely hirsute pileus. Coriolopsis hostmannii
looks more like a pileate Inonotus species because of its relatively soft context
and bright brownish colors in all parts of basidiome. The pileus surface is
glabrous to shiny-glossy, the pores are very small and regular, and the pore
surface is characteristically uneven.
Coriolopsis polyzona (Pers.) Ryvarden
DESCRIPTION — Ryvarden & Johansen (1980: 291).
SPECIMENS EXAMINED - USA. FLorIDA: DADE Country, Florida City, irrigation canal
dam, 29.VIII.2010, Ficus sp., leg. J. Vlasak Jr., det. J. Vlasak (JV1008/64-J). BELIZE.
Cockscomb Basin, 30. X. 2006, hardwood, leg. J. Kout, det. J. Vlasak (JV0610/A8-
K). JAMAICA. Ocho Rios, 12.V1.2008, hardwood, leg. J. Vlasak Jr., det. J. Vlasak
(JV0806/12-J). MEXICO. VERAcRUz: Montepio, 14.X.2006, hardwood, leg. J. Kout, det.
J. Vlasak (JV0610/A16-K); Los Tuxtlas, 12.X.2006, hardwood, leg. J. Kout, det. J. Vilasak
(JV0610/A14A-K).
DISTRIBUTION & ECOLOGY - Pantropical, on dead hardwoods (Ryvarden & Johansen
1980:291). We collected this species many times in Mexico, Belize, and Jamaica but only
once in Florida, in a typical man-influenced locality.
COMMENTS — Common in South America and resembling the boreal Trametes
hirsuta (Wulfen) Lloyd but with even more pronounced and more hirsute zones
on pileus surface and larger, less regular pores that are often a bit elongated in
various directions. The broader spores of C. polyzona are narrowly elliptic but
not cylindric.
Navisporus floccosus (Bres.) Ryvarden PHOTO 10
DESCRIPTION — Torres-Torres et al. (2007).
SPECIMEN EXAMINED — USA. FLoripA: DapDE County, Miami, Old Cutler road alley,
hardwood stump, 26.VIII.2010, leg. & det. J. Viasak (JV 1008/30, ITS rRNA JF692195).
DISTRIBUTION & ECOLOGY - Africa, Southeast Asia (Ryvarden & Johansen 1980), Cuba,
Mexico (Torres-Torres et al. 2007), Costa Rica (Mata et al. 2007).
COMMENTS - Remarkable, very large (< 50 cm wide x 10 cm thick) pilei
reminding large Ganoderma P. Karst. distinguish this species. The glabrous
pileus surface has a patchy black cuticle or thin azonate crust. The thick light
brown context has a relatively soft consistency and is strikingly lightweight
when dry. Because of large naviculate spores, this species is traditionally
classified close to Navisporus sulcatus (Lloyd) Ryvarden, also a South Florida
Polypores new to Florida (U.S.A.) ... 171
s f %, ’ \ . 7
{ ‘ied wy : . ; <P
HOTO 10: Navisporus floccosus JV 1008/30.
\.
species, but very different, with small, effused-reflexed pilei and relatively large
pores. Decock (2007) has commented critically on the taxonomical position of
N. floccosus.
Skeletocutis diluta (Rajchenb.) A. David & Rajchenb. PHOTO 11
DEscRIPTION — David & Rajchenberg (1992).
SPECIMENS EXAMINED — USA. FLoripA: DAabDE County, Everglades Nat. Park, Long
Pine Key, Campground, 29.VII.2010, Pinus elliottii log, leg. & det. J. Viasak (JV 1008/61,
ITS rRNA JF692198); Long Pine Key, Pinelands Trail, 20.IV.2009, Pinus elliottii log,
leg. & det. J. Vlasak (JV0904/44); (JV0904/45). BELIZE. Cockscomb basin, 30.X.2006,
hardwood, leg J. Kout, det. J. Vlasak (JV0610/16-K, ITS rRNA JF692197); 29.X.2006,
hardwood, leg J. Kout, det. J. Vlasak (JV0610/G4-K).
DISTRIBUTION & ECOLOGY - Argentina, Africa (David & Rajchenberg 1992), Panama
(Nufiez & Ryvarden 1999). Mostly on hardwoods but the type was collected in Argentina
on Pinus taeda L. (Rajchenberg 1983). In Florida it occurs on logs of slough pine (Pinus
elliottii) in seasonally flooded parts of the Everglades Long Pine Key region. Probably
not rare as we noted several quite disintegrated basidiomes in dry wintertime. During
the next summer the whole area was a half meter under water and we could collect only
one well developed specimen just on the edge of a water basin.
ComMENTS - Dextrinoid to weakly amyloid skeletals that dissolve in KOH
and the tiny spores make this species unmistakable. The species was originally
described as “resupinate or effused-reflexed.” Although our collections from
Belize on hardwoods are always pileate, our Florida specimens (collected on
pine) are strictly resupinate. Also, from the microphotography, the spores
172 ... Vlasak& al.
“4 AT
r
at a pv) ,
} MY ee al
Rye hee ke ut LR ‘
ya eat id ee tf ne
Pee 4 SF Lid
ET Tan
PHoTo 11: Skeletocutis diluta JV1008/61 on Pinus elliottii log.
seem to be only 2.5 x 0.4 um, smaller than published (3.1-3.5 x 0.5-0.8 um).
Nevertheless, the ITS rRNA sequences of Belize and Florida samples are nearly
identical. Though originally described as a variety of S. nivea (Rajchenberg
1983), the ITS rRNA sequence shows no significant homology with S. nivea
(Jungh.) Jean Keller but low homology with S. chrysella Niemela (91%) and
S. kuehneri A. David (90%).
Trametes lactinea (Berk.) Sacc.
This species is treated separately in Vlasak & Kout (2011).
Trametes ochroflava Cooke PHOTO 12
= Daedalea microsticta Cooke
DESCRIPTION — Fidalgo & Fidalgo (1967: 848).
SPECIMEN EXAMINED — USA. FLoRIDA: DADE County, Miami, Fairchild Botanical
Garden, Albizia stump, 24. XII. 2003, leg. J. Vlasak Jr., det. J. Vlasak (JV0312/24.17-J,
PRM915968).
DISTRIBUTION & ECOLOGY — South and Central America, Mexico, West Indies. Dead
deciduous trees (Ryvarden & Aime, unpublished).
ComMMENTS - Trametes ochroflava is characterized by large, flat, tough,
whitish pilei with labyrinthine pores and brownish context and trama. Pores
often appear also on pileus surface. The species was long known as Daedalea
microsticta and only recently has the older and more appropriate name been
Polypores new to Florida (U.S.A.) ... 173
PHOTO 12: Trametes ochroflava JV0312/24.17 in collection.
applied (Ryvarden & Aime, unpublished). The type of rot is unknown but the
sequence shows similarity to Trametes Fr., not Daedalea Pers. The sequence of
our specimen is identical with the published sequence FJ403209.
Ceriporiopsis cystidiata C.L. Leite, G.V.C. Gong. & Ryvarden
DESCRIPTION — Loguercio-Leite et al. 2001.
Inconspicuous, white resupinate polypore with 2-3 mm long tubes and very
thin subiculum, margin and touched places somewhat yellowish when dry.
SPECIMEN EXAMINED — USA. FLoRIDA: DADE County, Miami, Matheson Hammock
Nature Area, 26. VIII.2010, hardwood, leg. & det. J. Viasak (JV 1008/26).
DISTRIBUTION & ECOLOGY - up to now known only from the type locality: Brazil, dead
hardwood.
Comments ~The abundant hymenial cystidia and cylindrical but rather thick
straight spores are diagnostic.
Wrightoporia bracei (Murrill) I. Lindblad & Ryvarden PHOTO 13
= Amylosporus bracei (Murrill) A. David & Rajchenb.
DESCRIPTION — Murrill 1921, Rajchenberg 1983.
Strikingly pinkish-violet resupinate polypore, widely effused on the substrate,
with tiny pores (5-7 per mm). Spores amyloid, ovoid, 3.5-4 x 2.5-3 finely
174 ... Vlasak& al.
PHOTO 13: Wrightoporia bracei JV1008/77 in situ.
echinulate, hyphal system dimitic, skeletal hyphae weakly dextrinoid, generative
hyphae with simple septa.
SPECIMEN EXAMINED — USA. FLORIDA: MONROE Country, Florida Keys, Key Largo,
John Pennekamp Coral Reef State Park, 29. VIII.2010, hardwood, leg. & det. J. Vlasak,
(JV 1008/77, ITS rRNA JF692199).
DISTRIBUTION & ECOLOGY - Argentina (Rajchenberg 1983), French Antilles (David &
Rajchenberg 1985), Bahamas, Puerto Rico (Murrill 1921). Tropical hardwood forest.
CoMMENTS— Contrary to original description, this specimen is strongly
rhizomorphic, perhaps due to the growth on an underside of a log and its violet
colors are unchanged after drying. The species was transferred to Amylosporus
Ryv. by David & Rajchenb. (1985), but the rRNA ITS sequence shows only low
homology with Wrightoporia lenta (Overh. & J. Lowe) Pouzar and W. luteola
B.K. Cui & Y.C. Dai (GenBank) and none at all with Amylosporus campbellii
(Berk.) Ryvarden (our sequences JF692200, JF692201).
Acknowledgments
Dr. W. Spirin and Dr. Sergio Pérez Gorjon have kindly acted as presubmission
reviewers and their help is acknowledged. We are grateful also to Dr. Shaun Pennycook
for his help in the correction and improvement of the present paper. This research was
supported by CEZ: AV0Z50510513 fund.
Literature cited
Bergemann SE, Smith MA, Parrent JL, Gilbert GS, Garbelotto M. 2009. Genetic population
structure and distribution of a fungal polypore, Datronia caperata (Polyporaceae) in mangrove
forests of Central America. J. Biogeogr. 36: 266-279.
Corner EJH. 1991. Ad polyporaceas VII. The xanthochroic polypores. Nova Hedwigia, Beih. 101.
175 p.
Polypores new to Florida (U.S.A.) ... 175
David A, Rajchenberg M. 1985. Pore fungi from French Antilles and Guiana. Mycotaxon 22(2):
285-325.
David A, Rajchenberg M. 1992. West African polypores: new species and combinations. Mycotaxon
45: 131-148.
Decock C. 2007. On the genus Microporellus, with two new species and one recombination
(M. papuensis spec. nov., M. adextrinoideus spec. nov., and M. terrestris comb. nov.). Czech
Mycol. 59(2): 153-170.
Decock C, Herrera Figueroa S, Robledo G, Castillo G. 2006. Phellinus caribaeo-quercicolus sp. nov.,
parasitic on Quercus cubana: taxonomy and preliminary phylogenetic relationships. Mycologia
98: 265-274.
Decock C, Herrera Figueroa S, Robledo G, Castillo G. 2007. Fomitiporia punctata (Basidiomycota,
Hymenochaetales) and its presumed taxonomical synonyms in America: taxonomy
and/or phylogeny of some species of tropical/subtropical areas. Mycologia 99: 733-752.
http://dx.doi.org/10.3852/mycologia.99.5.733
Fiasson JL, Niemela T. 1984. The Hymenochaetales: a revision of the European poroid taxa.
Karstenia 24: 14-28.
Fidalgo O, Fidalgo MEPK. 1967. Polyporaceae from Trinidad and Tobago. II. Mycologia 59(5):
833-869.
Gilbertson RL, Ryvarden L. 1986. North American polypores, Vol. 1. Fungiflora. Oslo. 1-433.
Gilbertson RL, Ryvarden L. 1987. North American polypores, Vol. 2. Fungiflora. Oslo. pp.
434-885.
Gé6es-Neto A, Loguercio-Leite C, Guerrero RT. 2002. Molecular phylogeny of tropical
Hymenochaetales (Basidiomycota). Mycotaxon 84: 337-354.
Groposo C, Loguercio-Leite C, Gées-Neto A. 2007. Fuscoporia (Basidiomycota, Hymenochaetales)
in Southern Brazil. Mycotaxon 101: 55-63.
Loguercio-Leite C, Wright JE. 1995. The genus Phellinus (Hymenochaetaceae) on the Island of
Santa Catarina, Brazil. Mycotaxon 54: 361-388.
Loguercio-Leite C, Goncalves GVC, Ryvarden L. 2001. Studies in neotropical polypores 13.
Ceriporiopsis cystidiata sp. nov. Mycotaxon 79: 285-288.
Lowe JL. 1957. Polyporaceae of North America. The genus Fomes. State Univ. Coll. Forestry,
Syracuse Univ. Techn. Publ. 80: 97 p.
Mata M, Ruiz-Boyer A, Carranza J, Ryvarden L. 2007. Nuevos registros de hongos poliporoides
(Basidiomycetes) para Costa Rica. Bol. Soc. Micol. Madrid 31: 123-129.
Murray MG, Thompson WF. 1980. Rapid isolation of high molecular weight plant DNA. Nucleic
Acids Research 8: 4321-4325. http://dx.doi.org/10.1093/nar/8.19.4321
Murrill WA. 1921. Light-colored resupinate polypores — II. Mycologia 13(2): 91.
Nufiez M, Ryvarden L. 1999. Studies in neotropical polypores IV. New and noteworthy species
from Coiba National Park, Panama. Mycotaxon 71: 361-367.
Parrent JL, Garbelotto M, Gilbert GS. 2004. Population genetic structure of the polypore Datronia
caperata in fragmented mangrove forests. Mycol. Res. 108(4): 403-410.
Rajchenberg M. 1983. New South American resupinate polypores. Mycotaxon 16(2): 500-506.
Rizzo DM, Gieser PT, Burdsall HH. 2003. Phellinus coronadensis: A new species from southern
Arizona, USA. Mycologia 95: 74-79. http://dx.doi.org/10.2307/3761963
Ryvarden L. 2004. Neotropical polypores, Part 1. Synopsis Fungorum 19. Fungiflora, Oslo. 227 p.
Ryvarden L. 2007. Studies in neotropical polypores 23. New and interesting wood-inhabiting fungi
from Belize. Synopsis Fungorum 23. Fungiflora, Oslo. 111 p.
Ryvarden L, Johansen I. 1980. A preliminary polypore flora of East Africa. Fungiflora, Oslo.
636 p.
176 ... Vlasak& al.
Sotao HMP, Campos EL, Costa SPSE, Melo OA, Azevedo JC. 2002. Basidiomycetes macroscépicos
de manguezais de Braganca, Para, Brasil. Hoehnea 29(3): 215-224.
Tomsovsky M, Jankovsky L. 2007. DNA sequence analysis of extraordinary fruiting specimens of
Fuscoporia torulosa (Phellinus torulosus) on Pyrus spp. Czech Mycol. 59(1): 91-99.
Torres-Torres MG, Guzman-Davalos L, Ryvarden L. 2007. New data and localities for Navisporus
in America. Mycotaxon 100: 319-326.
Trierveiler-Pereira L, Baltazar JM, Loguercio-Leite C. 2009. Santa Catarina island mangroves 4—
xylophilous basidiomycetes. Mycotaxon 109: 107-110.
Young RA, Giese RL. (eds.). 2003. Introduction to forest ecosystem science and management. 3"
edition. John Wiley and Sons.
Vlasak J, Kout J. 2011. Tropical Trametes lactinea is widely distributed in the eastern USA.
Mycotaxon 115: 271-279. http://dx.doi.org/10.5248/115.271
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds.). PCR Protocols: a guide to
methods and applications. San Diego, Academic Press.
Whitney E, Means DB, Rudloe A. 2004. Priceless Florida: Natural ecosystems and native species.
Pineapple Press, Sarasota.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.177
Volume 118, pp. 177-180 October-December 2011
Paraphysoderma sedebokerense, gen. et sp. nov.,
an aplanosporic relative of Physoderma (Blastocladiomycota)
TIMOTHY Y. JAMES’ , YORAM HOFFMAN’, ALIZA ZARKA” & SAMMY BOUSSIBA’S
"Department of Ecology and Evolutionary Biology, University of Michigan
Ann Arbor, MI 48109, USA
?Microalgal Biotechnology Laboratory, the Jacob Blaustein Institutes for Desert Research,
Ben Gurian University of the Negev, Sede-Boker Campus 84990, Israel
CORRESPONDENCE TO: ‘[email protected] & [email protected]
ABSTRACT — A monocentric blastocladialean fungus was identified as a parasite of
the green alga Haematococcus pluvialis in aquaculture and isolated into pure culture.
Phylogenetic analysis suggests the fungus is a sister taxon to the obligately biotrophic
plant parasitic genus Physoderma. The parasite, which has not been observed to reproduce
by zoospores, instead forms amoeboid aplanospores. We formally describe the new genus
and species Paraphysoderma sedebokerense to accommodate this unusual member of the
Blastocladiomycota.
Key worps — algae, Blastocladiales, cultures, nomenclature
Introduction
A fungal parasite of the green alga Haematococcus pluvialis has recently
been characterized (as “Haematococcus parasite” in Hoffman et al. 2008)
and provisionally referred to as “Paraphysoderma sedebokerensis” (Gutman
et al. 2009; Porter et al. 2011). The parasite has the appearance of a typical
chytridiomycete zoosporic fungus with an epibiotic globular sporangium
subtended by an intracellular rhizoidal system. It was first observed during
aquaculture of H. pluvialis, an important producer of the carotenoid astaxanthin
used in cosmetics and pharmaceuticals (Del Campo et al. 2007). Neither pure
nor dual cultures of the alga and fungus produced a zoosporic stage; instead
sporangia released amoeboid aplanospores that were infective to H. pluvialis
(Hoffman et al. 2008) but not other green algae (Gutman et al. 2009). In a
molecular phylogeny based on the 18S ribosomal RNA gene the novel parasite
was closely related but clearly basal to the plant parasitic zoosporic fungus
Physoderma (Blastocladiomycota) (Hoffman et al. 2008). Its phylogenetic
178 ... James & al.
position, the absence of a zoospore stage, and its occurrence in an algal host
suggest that the parasite should be placed in a separate genus.
A detailed description of the infection cycle and growth characteristics of
the parasite has been published (Hoffman et al. 2008). The goal of this paper is
to provide a formal description of the parasite.
Taxonomy
Paraphysoderma Boussiba, Zarka & T.Y. James, gen. nov.
MycoBank MB 561750
Sporangium monocentricum, eucarpicum, epibioticum. Aplanosporae paucae usque ad
plurimae per sporangium, sine flagellis, congregentes antequam liberati, per incisuram in
sporangio exeuntes, 3-6 um diametro pseudopodiis filosis, in superficie cellulae nutricis
repentes antequam incystati et endogene evolventes. Systema rhizoidale e puncto unico
in sporangio evolvens, intra hospitem bulbosum. Sporangium dormiens epibioiticum,
fuscatius, pariete crassiore quam zoosporangium, germinans ut aplanosporas liberarent.
In alga viridi parasitica.
TYPE SPECIES — Paraphysoderma sedebokerense Boussiba, Zarka & T. James
EryMoLocy — The new genus is closely related to, but distinct morphologically and in
host preference, from the genus Physoderma.
SPORANGIUM monocentric, eucarpic, epibiotic. APLANOSPORES few to dozens
per sporangium, lacking flagella, swarming before being released, exiting
through tear in sporangium, 3-6 um diameter with filose pseudopodia,
crawling on surface of host cell before encysting and developing endogenously.
RHIZOIDAL SYSTEM developing from single point on the sporangium, forming
an apophysis inside host. RESTING SPORANGIUM epibiotic, darker and with
thicker wall than zoosporangium, germinating to release aplanospores. Parasitic
on green algae.
Paraphysoderma sedebokerense Boussiba, Zarka & T.Y. James, sp. nov.
MycoBank MB 561751
Descriptio ad genus. In Haematococcus pluvialis parasitica.
Ho.otype — Hoffman et al. 2008, Mycological Research 112: Fic. 5D.
ErymoLocy — Referring to Sede Boker, Israel, the locality where the species was
originally isolated.
Description as for genus. Sporangium size 20-35 um in dual culture on host
(Hoffman et al. 2008); aplanospores with numerous refractive globules that
coalesce upon encystment; parasitic on non-motile Haematococcus pluvialis
Flot. (Haematococcaceae, Chlorophyceae).
Discussion
Paraphysoderma is differentiated from Physoderma by the absence of a
motile spore, the presence of an epibiotic resting sporangium, culturability,
Paraphysoderma sedebokerense, gen. et sp. nov. ... 179
and host range. However, it has a general appearance of a typical monocentric,
eucarpic chytrid or blastocladialean fungus, and is similar to Physoderma in
having an epibiotic sporangium and a limited rhizoid emanating from a single
axis on the sporangium. Its phylogenetic position (Hoffman et al. 2008) implies
that the genus or species has recently lost a flagellated spore stage. Despite the
absence of a motile spore, the aplanospores of the parasite are nonetheless able
to cause severe epidemics in aquaculture.
Our current observations do not exclude the possibility that additional study
of Paraphysoderma will ultimately reveal a zoospore stage. When sexuality is
observed in members of phylum Blastocladiomycota, an alternation of diploid
and haploid generations is observed (James et al. 2006). Thus it is possible that
a thallus or stage of different ploidy on an alternative host may exist, although
infection studies suggest it is not likely to be another green alga (Gutman et al.
2009). However, the observation that the aplanospores from both resting and
thin-walled sporangia are morphologically similar suggests the absence of a
separate gametophyte stage. If the fungus conforms to the life cycles expected
of other blastoclads, then it would be considered to have a ‘Brachyallomyces’
(short) life cycle, which may or may not include meiosis during resting sporangial
germination (Emerson 1941). The basal placement of Paraphysoderma to
Physoderma is consistent with the derivation of the land plant parasitism from
an aquatic one between a chytrid-like fungus and an alga. The culturability of
Paraphysoderma and not Physoderma is consistent with the evolution of an
increasingly obligate parasitic relationship of Physoderma to its host. Indeed,
Physoderma and Paraphysoderma are unique among Blastocladiomycota in its
parasitism of the plant kingdom, although whether the use of plant hosts is a
derived or ancestral trait is unclear, as Physodermataceae occupy the most basal
branch in the Blastocladiomycota (Porter et al. 2011). The distinct differences in
culturability between the two genera suggests that Paraphysoderma might serve
as a model species for the clade in research requiring large numbers of cultured
cells, such as genomics and biochemistry.
The unique nature of the amoeboid swarming aplanospores suggests that
neither genus nor species has been observed before. Chytridiomycota species
that have been found to reproduce solely by amoeboid aplanospores include
Amoebochytrium rhizidioides Zopf (host: Chaetophora elegans (Chlorophyceae)),
Sporophlyctis rostrata Serbinow (host Draparnaldia spp. (Chlorophyceae)), and
Sporophlyctidium africanum Sparrow (host Protoderma sp. (Ulvophyceae)),
all of which differ in several ways (including rhizoidal development) from
Paraphysoderma. An aplanosporic mode of reproduction is unusual among
aquatic fungi, and the factors that favor the loss of a flagellated spore in an
aquatic environment are unclear. The pattern that many aplanosporic chytrids
parasitize green algae suggests that the need for a motile spore may be minimal
180 ... James & al.
in certain well-mixed environments, while the ability to creep over the host to
find an ideal location for rhizoidal penetration may the trait most influenced
by natural selection.
The number of accepted species of Physoderma is ~50 (Kirk et al. 2008). The
number of species and distribution of Paraphysoderma are currently unknown
but will probably be much greater than currently appreciated given the rapid
expansion of chytrid diversity seen in both culture studies and environmental
DNA surveys (Letcher et al. 2008; Freeman et al. 2009).
Acknowledgments
The authors thank Dr. Joyce E. Longcore (University of Maine), Dr. Wallace Martin
(Randolph-Macon College), and Dr. Merlin White (Boise State University) for their
constructive comments on the manuscript. Thanks also to Angela Piper for her help
with the Latin translation.
Literature cited
Del Campo JA, Garcia-Gonzalez M, Guerrero MG. 2007. Outdoor cultivation of microalgae for
carotenoid production: current state and perspectives. Applied Microbiology and Biotechnology
74: 1163-1174. http://dx.doi.org/10.1007/s00253-007-0844-9
Emerson R, 1941. An experimental study of the life cycles and taxonomy of Allomyces. Lloydia 4:
77-144.
Freeman KR, Martin AP, Karki D, Lynch RC, Mitter MS, Meyer AF, Longcore JE, Simmons DR,
Schmidt SK. 2009. Evidence that chytrids dominate fungal communities in high-elevation
soils. Proceedings of the National Academy of Sciences of the United States of America 106:
18315-18320. http://dx.doi.org/10.1073/pnas.0907303106
Gutman J, Zarka A, Boussiba S. 2009. The host-range of Paraphysoderma sedebokerensis, a
chytrid that infects Haematococcus pluvialis. European Journal of Phycology 44: 509-514.
http://dx.doi.org/10.1080/09670260903161024
Hoffman Y, Aflalo C, Zarka A, Gutman J, James TY, Boussiba S. 2008. Isolation and characterization of
a novel chytrid species (phylum Blastocladiomycota), parasitic on the green alga Haematococcus.
Mycological Research 112: 70-81. http://dx.doi.org/10.1016/i.mycres.2007.09.002
James TY, Letcher PM, Longcore JE, Mozley-Standridge SE, Porter D, Powell MJ, Griffith GW,
Vilgalys R. 2006. A molecular phylogeny of the flagellated fungi (Chytridiomycota) and
description of a new phylum (Blastocladiomycota). Mycologia 98: 860-871.
http://dx.doi.org/10.3852/mycologia.98.6.860
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the fungi, 10 ed. CABI
Publishing, The Netherlands.
Letcher PM, Velez CG, Barrantes ME, Powell MJ, Churchill PF, Wakefield WS. 2008. Ultrastructural
and molecular analyses of Rhizophydiales (Chytridiomycota) isolates from North America and
Argentina. Mycological Research 112: 759-782.
http://dx.doi.org/10.1016/j.mycres.2008.01.025
Porter TM, Martin W, James TY, Longcore JE, Gleason FH, Adler PH, Letcher PM, Vilgalys R.
2011. Molecular phylogeny of the Blastocladiomycota (Fungi) based on nuclear ribosomal data.
Fungal Biology 115: 381-392. http://dx.doi.org/10.1016/j.funbio.2011.02.004
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.181
Volume 118, pp. 181-186 October-December 2011
Microcyclospora rumicis, a new species on Rumex crispus from Iran
MAHDI ARZANLOU*& MOUNES BAKHSHI
Plant Protection Department, Faculty of Agriculture, University of Tabriz,
29" Bahman Boulevard, Tabriz, PRO. Box 5166614766, Iran.
* CORRESPONDENCE TO: [email protected].
ABSTRACT — A new species of Microcyclospora, associated with leaf spots on Rumex crispus,
is fully described and illustrated.
Key worps — hyphomycetes, Pseudocercospora, weed, cercosporoid fungi
Introduction
During the study of alternative weed hosts for Cercospora beticola Sacc.,
a causal agent of cercospora leaf spot of sugar beet in Northern Iran, a
species of the genus Microcyclospora J. Frank et al. was isolated from Rumex
crispus showing leaf spot symptoms in the Talesh region (Guilan province).
Microcyclospora, with M. pomicola J. Frank et al. designated as type species, was
recently segregated from Pseudocercospora Speg. s. str. based on phylogenetic
and morphological differences (Frank et al. 2010). Currently the three species
known in Microcyclospora are associated with sooty blotch and flyspeck (SBFS)
blemishes on the surfaces of pomaceous fruits, specifically apples (Colby 1920;
Frank et al. 2010). Here we describe a new Microcyclospora species from leaf
spots on Rumex crispus that differs morphologically from the three other
known species of the genus.
Materials & methods
Conditions of isolation, culture, and observation
Leaf samples of Rumex crispus showing leaf spot were collected from Rainforest
Mountains in the Talesh region, Guilan province, in northern Iran near the Caspian
Sea. Single conidial isolates were established directly from symptomatic curly dock
leaves according to Bakhshi et al. (2011). A mass of conidia scraped from the lesion
using a sterile inoculation needle under a stereomicroscope was floated in 10 ml sterile
distilled water and spread on 2% malt extract agar (MEA; Fluka, Germany). After plates
182 ... Arzanlou & Bakhshi
were incubated in a slanted position overnight, germinated conidia were transferred
to new MEA plates, and cultures were incubated in the dark at 25 °C. After 30 days of
incubation, samples from the colony were mounted on glass slides in clear lactic acid
for microscopic examination. Thirty measurements were made for each microscopic
structure, and 95% confidence intervals were derived for the measurements with
extreme values given in parentheses. Line drawings were prepared using a BX41 light
microscope (Olympus, Japan) equipped with a drawing tube; photos were captured
using a Leica camera system. Colony colors on MEA and oatmeal agar (OA; Gams et
al. 2007) [surface and reverse] were determined after one month at 25 °C in the dark.
Nomenclature and descriptions were deposited in MycoBank. The holotype voucher
and an ex-type culture are conserved in CCTU, the culture collection housed at the
Plant Protection Department, Agriculture Faculty, University of Tabriz, Iran.
Taxonomy
Microcyclospora rumicis Arzanlou & Bakhshi, sp. nov. PLATE 1-2
MycoBank MB 563723
Microcyclospora rumicis ab aliis speciebus generis chlamydosporis numerosis, majoribus,
ad 20 um diam distinguenda.
Type: Iran, Guilan, Talesh, on leaves of Rumex crispus L. (Polygonaceae), Sep. 2010, M.
Bakhshi (Holotype, CCTU-H-1; ex-type culture: CCTU 1 = CBS 131546).
Erymo.ocy: Named after the host genus, Rumex.
Culture characteristics — On MEA slow growing, reaching 3 mm diam after 7 d,
and up to 10 mm after 2 weeks at 25 °C, raised, unevenly folded, with moderate,
smoke-gray aerial mycelium; surface irregular, with smooth, lobate margins,
iron-grey; iron-grey in reverse. Colonies on OA reaching up to 2 mm diam
after 7 d, and 6 mm after 2 weeks at 25 °C, flat, submerged, with sparse aerial
mycelium and smooth margin. Microcyclic conidiation commonly observed
on all media in culture.
In vitro on MEA — Mycelium consisting of branched, smooth, septate,
pale brown, 2-4 um wide hyphae developing numerous chlamydospores,
intercalary and terminal, medium brown, 6-20 um diam. Conidiophores
reduced to conidiogenous cells, integrated, lateral on hyphae, mono- to
polyblastic, subdenticulate, 2.5-4 um wide, 8-13 um tall, hyaline, smooth.
Conidia scolecosporous, cylindrical, straight to variously curved, guttulate,
apex obtuse, base truncate, hyaline, (1.5-)2.5(-4) x (15-)37-54(-100) um,
1-10-septate; hila neither thickened nor darkened; microcyclic conidiation
commonly observed; older conidia developing intercalary chlamydospores that
are pale brown, < 9 um diam.
Discussion
The cercosporoids are amongst the major groups of fungi and generally
cause leaf spot diseases on almost all families of flowering plants throughout
Microcyclospora rumicis sp. nov. (Iran) ... 183
PLaTE 1. Microcyclospora rumicis.
Conidia, conidiogenous cells and hyphae from MEA colony. Bar = 10um.
the world. Among these, Pseudocercospora is the second largest cercosporoid
genus, with more than 300 published names (Kirk et al. 2008). Recently it was
shown that Pseudocercospora included taxa that vary considerably in their
conidiomatal morphology, ranging from solitary conidiogenous loci, synnemata,
sporodochia to fascicles. Moreover, conidia in some taxa are transversely
euseptate but with some oblique and longitudinal septa or containing a mixture
of eu- and distoseptation. Conidial hila and scars vary from unnoticeable to
slightly thickened along the rim (Stewart et al. 1999). Even though the conidia
184 ... Arzanlou & Bakhshi
PLaTE 2. Microcyclospora rumicis. a. Chlamydospore in hyphae; b-c. Conidiogenous loci
(arrowed) and conidia with chlamydospore; d. Young conidia; e-f. Hyphae. g. 30-day old
colony on MEA. Scale bars = 10 um.
are commonly solitary, they may in some cases also occur in unbranched
chains (Braun 1995). Frank et al. (2010) established Microcyclospora based on
morphological and molecular data. Morphologically, Microcyclospora can be
distinguished from Pseudocercospora by the arrangement of the conidiophores
that are never fasciculate but reduced to solitary conidiogenous loci on
hyphae and conidia that aggregate in mucoid masses, strongly tending toward
microcyclic conidiation. Only three other species described in the genus
—M. malicola J. Frank et al., M. pomicola, and M. tardicrescens J. Frank et
al.— associated with sooty blotch and flyspeck (SBFS) blemishes on surfaces of
pomaceous fruits (Frank et al. 2010). Here, we introduce a new species based
on morphological characteristics. Microcyclospora rumicis, like M. tardicrescens,
forms intercalary chlamydospores (lacking in M. malicola and M. pomicola)
and grows more slowly in culture. Chlamydospores of M. rumicis are longer
(< 20 um) than those of M. tardicrescens (< 5 um long).
Little is known about sexual stages of the cercosporoid fungi including
Microcyclospora species. Cercosporoids have been traditionally treated as
anamorphs of the ascomycete Mycosphaerella Johanson (e.g., Braun & Mel'nik
1997, Kim & Shin 1998, Crous & Braun 2003). However, most cercosporoids
Microcyclospora rumicis sp. nov. (Iran) ... 185
are considered exclusively asexual, and Mycosphaerella teleomorphs have been
confirmed for only a few species.
Phylogenies derived from multiple sequence analyses place Microcyclospora
with other cercosporoid fungi in the Mycosphaerella clade (Mycosphaerellaceae,
Capnodiales, Dothideomycetidae; Frank et al. 2010). Mycosphaerella, one of the
largest genera in the Ascomycota, comprises several thousand species (Crous et
al. 2001, 2009a,b; Aptroot 2006). Contrary to the assumption that Mycosphaerella
as then defined was monophyletic, Crous and co-workers recently revealed
that the genus is polyphyletic and split the former Mycosphaerellaceae into
several families, of which the Mycosphaerellaceae, Teratosphaeriaceae and
Schizothyriaceae have plant-pathological importance (Crous et al. 2007, 2009a).
Among the vast number of anamorphs in these lineages, up to 30 anamorph
genera have been linked to Mycosphaerella (Crous et al. 2007, 2009a; Arzanlou
et al. 2007). Recent phylogenetic analysis based on multiple sequence data sets,
however, indicate that these interpretations are not quite correct (Crous et al.
2009b) and that the Mycosphaerellaceae encompass instead numerous genera
with morphologically conserved Mycosphaerella-like teleomorphs but quite
distinct anamorphs (Crous et al. 2007, 2009b).
Little is currently known about ecology, host ranges, and sexual stages of the
cercosporoid fungi including Microcyclospora species, and more sampling on
different substrates is needed to address these aspects.
Acknowledgments
The authors are grateful to Prof Walter Gams for the Latin diagnosis and critical
reading of this manuscript and his valuable comments and suggestions, as well as to
Prof. Uwe Braun and Dr. Konstanze Bensch for pre-submission reviews.
Literature cited
Aptroot A. 2006. Mycosphaerella and its anamorphs: 2. Conspectus of Mycosphaerella. CBS Biodiv.
Ser. 5: 1-231.
Arzanlou M, Abeln ECA, Kema GHJ, Waalwijk C, Carlier J, de Vries I, Guzman M, Crous PW.
2007. Molecular diagnostics for the sigatoka disease complex of banana. Phytopathology 97:
1112-1118. http://dx.doi.org/10.1094/PHYTO-97-9-1112
Bakhshi M, Arzanlou M, Babai-Ahari A. 2011. Uneven distribution of mating type alleles in Iranian
populations of Cercospora beticola, causal agent of Cercospora leaf spot disease of sugar beet.
Phytopathol. Mediterranean. 50: 101-109.
Braun U. 1995. A monograph of Cercosporella, Ramularia and allied genera (Phytopathogenic
hyphomycetes). Vol. 1. IHW Verlag, Eching, Germany.
Braun U, Mel'nik VA. 1997. Cercosporoid fungi from Russia and adjacent countries. Trudy Bot.
Inst. V.L. Komarov, St. Petersburg. 20: 1-130.
Colby AS. 1920. Sooty blotch of pomaceous fruits. Trans. Illinois State Acad. Sci. 13: 139-179.
Crous PW, Braun U. 2003. Mycosphaerella and its anamorphs: 1. Names published in Cercospora
and Passalora. Centraalbureau voor Schimmelcultures, Utrecht, Netherlands.
186 ... Arzanlou & Bakhshi
Crous PW, Kang JC, Braun U. 2001. A phylogenetic redefinition of anamorph genera in
Mycosphaerella based on ITS rDNA sequence and morphology. Mycologia 93: 1081-1101.
http://dx.doi.org/10.2307/3761670
Crous PW, Braun U, Groenewald JZ. 2007. Mycosphaerella is polyphyletic. Stud. Mycol. 58: 1-32.
http://dx.doi.org/10.3114/sim.2007.58.01
Crous PW, Schoch CL, Hyde KD, Wood AR, Gueidan C, de Hoog GS, Groenewald JZ. 2009a.
Phylogenetic lineages in the Capnodiales. Stud. Mycol. 64: 17-47.
http://dx.doi.org/10.3114/sim.2009.64.02
Crous PW, Summerell BA, Carnegie AJ, Wingfield MJ, Hunter GC, Burgess TI, Andjic V, Barber
PA, Groenewald JZ. 2009b. Unravelling Mycosphaerella: do you believe in genera?. Persoonia
23: 99-118. http://dx.doi.org/10.3767/003158509X479487
Frank J, Crous PW, Groenewald JZ, Oertel B, Hyde KD, Phengsintham P, Schroers HJ. 2010.
Microcyclospora and Microcyclosporella: novel genera accommodating epiphytic fungi causing
sooty blotch on apple. Persoonia 24: 93-105. http://dx.doi.org/10.3767/003158510X510560
Gams W, Verkley GJM, Crous PW. 2007. CBS course of mycology, 5th edition. Centraalbureau voor
Schimmelcultures, Utrecht, Netherlands.
Kim JD, Shin HD. 1998. Taxonomic studies on Cercospora and allied genera in Korea (I). Korean
J. Mycol. 26: 327-341.
Kirk PM, Cannon PF, David JC, Stalpers LA. 2008. Dictionary of the fungi, 10th edn. CAB
International, Wallingford, Oxon.
Stewart EL, Liu Z, Crous PW, Szabo L. 1999. Phylogenetic relationships among some cercosporoid
anamorphs of Mycosphaerella based on rDNA sequence analysis. Mycol. Res. 103: 1491-1499.
http://dx.doi.org/10.1017/S0953756299008680
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.187
Volume 118, pp. 187-195 October-December 2011
Mycena guldeniana - a new alpine species from Norway
ARNE ARONSEN? & BRIAN A. PERRY?”
'Torodveien 54, N-3135 Torod, Norway
Biology Department, University of Hawai’ at Hilo, 200 W. Kawili St., Hilo, HI 96720, USA.
CORRESPONDENCE TO: ' [email protected] & * [email protected]
AsstTRaAct — Mycena guldeniana (section Polyadelphia) is proposed for an agaric found in
alpine areas of south Norway that is here described, illustrated and compared with other
species of the section. The new species grows on fallen, decaying leaves under Salix spp. or
occasionally on small twigs in the same habitat and is characterized by its small size, greyish
brown pileus, 4-spored basidia, smooth cheilocystidia, prominent, wide terminal cells of
the pileipellis hyphae, and clamp connections. Phylogenetic analyses of nucLSU support the
taxon within Mycena and genetically distinct from the morphologically similar M. terena.
KEY worps — taxonomy, alpine mycology, basidiomycete phylogenetics
Introduction
During a stay at ‘Finse Research Centre’ in south Norway, August 2005, the
first author collected and studied several Mycena species. ‘The research centre
is situated at approximately 60°30'N on the mountain plateau Hardangervidda
1200 m above sea level. The area lies entirely within the alpine zone and is
devoid of trees but in parts is covered with Salix shrubs. The research led to the
proposal of two new Mycena species (Aronsen & Gulden 2007). Two collections
were also made of a small Mycena that initially was misinterpreted as M. terena
Aronsen & Maas Geest., a species found on fallen, decaying leaves of Salix caprea
in the coastal area of South Norway (Aronsen & Maas Geesteranus 1992).
In 2008 the ‘Finse research centre’ was visited again, and the main
investigation was done on the south-facing slope at Nordnut at approximately
1400 m. The slope is formed by basic, phyllitic rocks intermixed with Salix shrubs
and some calcicolous vegetation (Gulden & Jenssen 1982). On small, partially
buried twigs on the ground under the Salix shrubs a tiny Mycena species was
collected. Further investigation showed that not only was it identical with the
taxon found in 2005, it clearly differed from M. terena and did not match any
other known species of Mycena.
188 ... Aronsen & Perry
The same year this taxon was also collected at the base of the mountain
Gaustatoppen at approximately 59°51'N at approximately 1150 m. Gaustatoppen
(1883 m) is the peak of a 7 km long mountain spine consisting of quarzite,
and in the lower slopes there are areas with dense Salix shrubs. In these Salix
shrubs the unknown taxon was found in great numbers together with M. exilis
Aronsen & Gulden. The taxon is herein proposed as a new species.
Materials & methods
The description is based on six collections from two different years and two different
localities including specimens in all stages of age. Preliminary observations and photos
were made in daylight in the field, while more thorough observations and descriptions
were made the same day in lamp light in the laboratory of the research centre. The dried
material was rehydrated in 2% KOH and examined in ammoniated Congo Red and
Melzer’s reagent using a Nikon light microscope with high resolution, 100x oil objective.
For each collection 30 spores were measured. The spore length and width ratios (q) were
calculated and the average quotient value (q, ) is given in the description. Measurements
and drawings were made of basidia, spores, cheilocystidia, pileipellis hyphae, and the
stipe cortical layer. Melzer’s reagent was used to check amyloidity of spore walls and
colour reactions in the lamellar trama. Authors abbreviations follow Index Fungorum
(2011), and the collections are deposited in the university museum of Oslo (O).
To assess the phylogenetic position of M. guldeniana within Mycena, and the
relationship of this taxon to the morphologically similar M. terena, sequences of the
5’ end of the nuclear large ribosomal subunit gene (nucLSU) spanning domains D1
and D2 were analyzed within a broader sampling of taxa representative of Mycena and
the tricholomatoid clade sensu Matheny et al. (2006). Two members of Boletales were
included as outgroup taxa for rooting purposes. Genomic DNA was extracted from
dried basidiomes representing each taxon (TABLE 1) using the E.Z.N.A. Forensic DNA
Kit (Omega Bio-Tek, U.S.A.) according to the manufacturer’s protocols. PCR protocols
followed Perry & Pfister (2007) using primers LROR and LR5 (Moncalvo et al. 2007).
Amplified DNA was cleaned with ExoSAP-IT (USB Molecular Biology Reagents and
Biochemical, U.S.A.) and sent to Elim Biopharmaceuticals (http://www.elimbiopharm.
com/) for cycle sequencing and visualization on an ABI 3700 capillary sequencer
(Applied Biosystems, U.S.A.) using the same primers as above. Sequences were edited
and assembled using Sequencher 4.0 (Gene Codes Corp., U.S.A.). The resulting data
matrix was aligned manually with MacClade 4 (Maddison & Maddison, 2000). Edited
sequences have been deposited in GenBank (TaBLE 1), and the aligned dataset is
available via TreeBase (www.treebase.org; $11538).
Maximum likelihood (ML) analyses were conducted in PAUP* version 4 (Swofford
2003) and employed an iterative approach. Starting trees were built via the Neighbor
Joining method and used to estimate parameters of the model of sequence evolution.
Estimated parameter values were then fixed, and a ML search was conducted. Resulting
topologies were then used to re-estimate and fix parameter values. This process was
repeated for a total of three iterations to insure the analyses had converged on the most
likely topology. Clade support was assessed by non-parametric, maximum likelihood
TABLE 1. List of sequences included in this study and associated GenBank
accession numbers.
Mycena guldeniana sp. nov. (Norway) ... 189
SPECIES COLLECTION GENDENK
ACCESSION #
Asterophora lycoperdoides (Bull.) Ditmar CBS 170.86 AF223190
Boletellus projectellus (Murrill) Singer MB 03-118 NG_027638
Clitocybe dealbata (Sowerby) Gillet HC 95.cp3 AF223175
Collybia tuberosa (Bull.) P. Kumm. TENN53540 NG_027631
Entoloma prunuloides (Fr.) Quél. TJB4765 AY700180
Mycena clavicularis (Fr.) Gillet RV87/6 AF042637
Mycena crocata (Schrad.) P. Kumm. BAYER G 057 AY207241
Mycena galericulata (Scop.) Gray GLM 45970 AY207251
Mycena guldeniana A 36/05 JF944831
Mycena haematopus (Pers.) P. Kumm. HKI ST 22545 AY207252
Mycena insignis A.H.Sm. DAOM208539 AF261413
Mycena leaiana (Berk.) Sacc. DAOM167618 AF261411
Mycena maculata P. Karst GLM 4597 AY207254
Mycena niveipes (Murrill) Murrill GLM 45975 AY207242
Mycena olivaceomarginata (Massee) Massee GLM 45976 AY207255
Mycena plumbea P. Karst. PBM 2718 DQ470813
Mycena polygramma (Bull.) Gray GLM 45977 AY207243
Mycena pura (Pers.) P. Kumm. JM98/136 AF261410
Mycena renati Quél. GLM 45979 AY207256
Mycena rubromarginata (Fr.) P. Kumm. GLM 45981 AY207245
Mycena sanguinolenta (Alb. & Schwein.) P. Kumm. GLM 45982 AY207257
Mycena terena A 41/09 JF944832
Mycena tintinnabulum (Fr.) Quél. GLM 4598 AY207258
Mycena viscidocruenta Cleland DUKE3411 AF261414
Mycena zephirus (Fr.) P. Kumm. GLM 45984 AY207259
Suillus pictus (Peck) A.H. Sm. & Thiers MB03-002 AY684154
Termitomyces sp. ZA164 DQ110875
Tricholoma aestuans (Fr.) Gillet PBM2494 AY700197
bootstrap analyses (Felsenstein 1985) as implemented in GARLI (Zwickl 2006), and
consisted of 1000 replicates with all parameter values estimated by the program. All
analyses were performed under a GTR+I+G model of sequence evolution as determined
using the Akaike Information Criterion in MrModelTest 2.3 (Nylander 2004). Bayesian
190 ... Aronsen & Perry
analyses were performed using Metropolis-coupled Markov Chain Monte Carlo
(MCMCMC) methods as implemented in MrBayes 3.1.2 (Huelsenbeck & Ronquist
2001; Ronquist & Huelsenbeck 2003) using the same model as the ML analyses. Analyses
consisted of two parallel searches, run for 3 million generations and initiated with
random starting trees. Chains were sampled every 300 generations for a total of 10,000
trees per search, sampled from the posterior distribution. Trees sampled prior to the
analysis reaching a split deviation frequency of 0.02 were discarded as the burn-in, while
the remaining trees were used to calculate the posterior probabilities of the individual
clades. Default settings in MrBayes were used to set the incremental heating scheme,
chain number, unconstrained branch lengths and uninformative topology priors.
Taxonomy
Mycena guldeniana Aronsen & B.A. Perry, sp. nov. FIG. 1-7
MycoBank MB 561558
Basidiomata solitaria vel gregaria. Pileus usque ad 2 mm latus, hemisphericus, conicus
vel parabolicus, interdum papillatus, plerumque sulcatus, translucente striatus, pruinosus,
glabrescens, pallide brunneus, pallide griseo-brunneus vel obscure griseus, centro obscurior.
Caro tenuis, pallida, odore nullo. Lamellae 4-8 stipitem attingentes, adnatae vel late
adnatae, pallide brunneae, pallide griseae vel albae. Stipes usque 30 x 0.2 mm, brunneo-
griseus vel griseus deorsum albido-pallescens, basi fibrillis albis instructus.
Basidia 18-33 x 7-11 wm, clavata, (2-)4-spora, fibulata. Sporae 7.5-8.7-10 x
4.8-5.5-6.5 um, amyloideae. Cheilocystidia 21-40 x 6-11 um, cylindracea, subclavata,
sublageniformia, fibulata, laevia. Pleurocystidia nulla. Hyphae pileipellis 5-10(-17)
um latae, fibulatae, diverticulatae, cellulae terminales usque 15 um latae, clavatae
vel subcylindraceae, diverticulatae. Hyphae stipitis corticales 1-7 um latae, fibulatae,
diverticulatae.
Ad Salicis folia decisa, in zona alpina.
Type: NORWAY, Telemark, Tinn, Gaustakneet, UTM(WGS84): MM 8249 3560, altitude
ca. 1150 m., 21 Sept. 2008, leg. A. Aronsen A54/08 (HOLOTYPE O-F300034).
Erymo ocy: The species is named after Prof. Gro Gulden, Oslo, in recognition of her
contributions to the knowledge of arctic and alpine fungi.
Pileus 1-2 mm across, hemispherical, then conical to parabolical, flattening to
convex, becoming more or less plano-convex with or without a small papilla
centrally, occasionally somewhat depressed centrally, pruinose, glabrescent,
shallowly sulcate, more or less translucent-striate, pale brown or pale grey-
brown or grey to dark grey, sometimes pale grey, the centre dark brown to
dark grey. Flesh very thin, whitish. Odour and taste indistinctive. Lamellae
4-8 reaching the stipe, with or without lamellulae, usually well developed and
fairly broad, but occasionally only showing as faint ridges, ascending, the edge
concave to convex, narrowly adnate to broadly adnate, sometimes decurrent
with a very short tooth, pale brown, pale grey to white, the edge pallid. Stipe
up to 30 x 0.2 mm, very thin, hollow, equal, terete, firm, pruinose, glabrescent,
becoming shiny, curved to flexuous, brownish grey to watery grey, becoming
more whitish; sometimes dark grey at the apex in younger specimens; often
Mycena guldeniana sp. nov. (Norway) ... 191
>
oh Ce} .
hee by Mees ; See Se dS fone
7 wna ce
nee +, et
®. ©
e ae 1
.
ee
ees €
6. <
.
a, « e
at i = “
Ss
A ©
° is ,
> ’ ”
a °
. o ‘i
. oy
ye eon
Laas eg ©
Onn ew anata, “Rn % yr,
PL Serer tia s
et etenr tae é
Seen. *
BESS On
1 |
>
OL OD aA
eS nr 8 Set !
PAL ii a ea =>
oan 8 are PSR Rn 4 z.
ee Pa et 4 nD 1
a“ A an fe °
aware ° ear oe a eens 7
"0,8 > Deas salary
Wer o/s soe =
rary 2 ee 2
: 728 4
ge >
yet ;
b
U
=>
FIGURES 1-5. Mycena guldeniana (holotype). 1. Hyphae of the pileipellis with terminal cells.
2. Hypha of the cortical layer of the stipe. 3. Basidia. 4. Cheilocystidia. 5. Spores.
Bar = 20 um.
conspicuously insititious but occasionally attached to the substratum by a
whorl of radiating, flexuous, white mycelial fibrils.
Basidia 18-33 x 7-11 um, clavate, (2- and) 4-spored, with plump sterigmata
up to 5 um long. Spores 7.5-8.7-10 x 4.8-5.5-6.5 um, q = 1.3-1.9, q,, ~ 1.6,
broadly ellipsoid to pip-shaped, smooth, amyloid. Cheilocystidia 21-40 x 6-11
um, occuring mixed with the basidia, cylindrical, subclavate, sublageniform,
smooth. Pleurocystidia absent. Lamellar trama dextrinoid, reddish brown in
Melzer’s reagent. Hyphae of the pileipellis 5-10(-17) um wide, densely covered
with cylindrical, straight excrescences 1-3.5 x 0.5 um; terminal cells up to 40
x 15 um, clavate to subcylindrical, covered with short, straight, cylindrical
excrescences. Hypodermium of broad, cylindrical to subglobose, smooth cells
15-40 x 13-28 um. Hyphae of the cortical layer of the stipe 1-7 um wide, densely
covered with cylindrical, sometimes more thorn-like, straight excrescences 1-6
x 0.5-1 um; terminal cells not typically differentiated but a few observed at
the base of the stipe being clavate, 26-35 x 5-10 um, densely covered with
cylindrical excrescences 1-4 x 0.5-1 um. Clamp connections observed at the
septa of some of the basidia, the cheilocystidia, and the hyphae of the pileipellis
and the stipe cortex.
192 ... Aronsen & Perry
Solitary or in small groups on fallen, decaying leaves of Salix sp.; occasionally
on small, fallen twigs on the ground in dense Salix shrubs.
ADDITIONAL SPECIMENS EXAMINED — NORWAY: HorDALAND, Ulvik, Finse, Nordnut
sor, UTM(WGS84): MN 1667 1903, alt. ca. 1400 m, 27 Aug. 2005, leg. A. Aronsen A 34/05
and A 36/05, GENBANK JF944831; 23 Aug. 2008, leg. A. Aronsen A 30/08; TELEMARK,
Tinn, Gaustakneet, UTM(WGS84): MM 8249 3560, alt. ca 1150 m, 14 Sept. 2008, leg. A.
Aronsen A 44/08; 21 Sept. 2008, leg. A. Aronsen A 63/08.
Discussion
Mycena guldeniana belongs to section Polyadelphia Singer ex Maas Geest.
(Maas Geesteranus 1986) based on its small size, adnate lamellae, pileipellis
and stipitipellis hyphae densely covered with short cylindrical excrescences,
absence of pleurocystidia, and occurrence on decaying leaves. The species of
this section usually possess cheilocystidia that are densely covered with short,
cylindrical excrescences, but Aronsen & Maas Geesteranus (1992) described the
new species M. terena with smooth cheilocystidia. Another species in the same
section known to have more or less smooth cheilocystidia is M. querciphila
Esteve-Rav. & M. Villarreal (Esteve-Raventos & Villarreal 1997).
The smooth cheilocystidia of M. guldeniana suggest a close relationship
with both M. terena and M. querciphila, with M. terena seeming the most
similar. Mycena querciphila differs in the pale olive-yellow to olive-brown
colours of pileus, lamellae, and stipe and in having some cheilocystidia
sparsely diverticulate by warts or short cylindrical excrescences. Additionally,
M. querciphila is typically found growing on fallen, decaying leaves of Quercus
ilex subsp. ballota. Mycena terena, recorded on fallen decaying Salix caprea
leaves in two coastal lowland localities in South Norway, has a pale beige or
very pale grey pileus that soon turns white, a black stipe apex (when young),
somewhat narrower spores, and pileipellis hyphae that lack prominent terminal
cells. The differences are shown in TABLE 2 below.
TABLE 2. A comparison between Mycena guldeniana and M. terena.
: MYCENA GULDENIANA
: MYCENA TERENA
Pateus pale brown to grey-brown pale beige or pale grey,
: soon fading to white
Gar Bc ste Se white to dark grey black
: in young specimens : in young specimens
SPORES q,y ~1.6 q,,~ 1.8
HYPHAE OF THE
PILEIPELLIS
HABITAT
with prominent, inflated
terminal cells
on fallen leaves and twigs under
Salix spp. in alpine area
: without prominent
terminal cells
on fallen leaves of Salix caprea
in coastal lowland
Mycena guldeniana sp. nov. (Norway) ... 193
FiGuRE 6. Mycena guldeniana (holotype).
On 11 Aug. 1979, Gulden & Jenssen (1982) reported an unknown species of
Mycena, collected at Finse, Nordnut, on a dead leaf. Although their material was
‘too scanty for a formal description of a new species, the description indicates
that their unknown species was identical with M. guldeniana.
Phylogenetic analyses
The nucLSU dataset comprises 887 aligned positions for 26 ingroup taxa
and contains 131 parsimony informative characters. Maximum likelihood
analyses converged on a common topology, with each iteration producing trees
that did not differ significantly in their likelihood values. The final ML tree
recovered is shown in FiGuRE 7 (-/nL = 3527.88466). Bayesian analyses reached
a split deviation frequency below 0.02 after approximately 880,000 generations,
and the first 2930 trees sampled were discarded as the burn-in. All Mycena
sequences included in the analyses form a well-supported (ML bootstrap = 100,
posterior probability = 1.0) lineage, sister to the remaining taxa sampled from
the tricholomatoid clade. Although relationships within the Mycena lineage
are not resolved with significant support, M. guldeniana and M. terena are
194 ... Aronsen & Perry
99/1.0
100/1.0
100/1.0
0.05
Mycena clavicularis
94/1.0
Mycena tintinnabulum
Mycena plumbea
-/0.80
Mycena rubromarginata
Mycena zephirus
Mycena insignis
Mycena crocata
Mycena leaiana
Mycena maculata
-/0.89
Mycena niveipes
Mycena polygramma
Mycena guldeniana
Mycena terena
Mycena haematopus
76/0.92
Mycena sanguinolenta
Mycena olivaceomarginata
Mycena viscidocruenta
Mycena renati
Mycena pura
Mycena galericulata
Entoloma prunuloides
Termitomyces sp.
Tricholoma aestuans
Collybia tuberosa
Asterophora lycoperdoides
Clitocybe dealbata
Boletellus projectellus
Suillus pictus
FIGURE 7. Maximum likelihood topology of Mycena guldeniana and other Mycena species inferred
from nucLSU sequence data (-InL = 3527.88466). Numbers separated by / represent maximum
likelihood bootstrap proportions and bayesian posterior probabilities greater than 70% and 0.70,
respectively (- designates a value below 70% / 0.70).
resolved as sister taxa in all topologies recovered by the ML analysis. Although
the relationship between these taxa is not well supported by ML bootstrap or
bayesian posterior probabilities, these results do support our recognition of
M. terena and M. guldeniana as distinct phylogenetic species. While these two
taxa are very similar morphologically, the nucLSU data indicate that genetically
they are as distinct from one another as are the majority of other closely related
Mycena species included in our analyses.
Mycena guldeniana sp. nov. (Norway) ... 195
Acknowledgments
The authors would like to thank Dr. J. Miersch (Halle, Germany) and Dr. T. Leess@e
(Copenhagen, Denmark) for critical revision of the manuscript.
Literature cited
Aronsen A, Gulden G. 2007. Two new species of Mycena from alpine sites in Norway. Mycol.
Progress 6: 1-6. http://dx.doi.org/10.1007/s11557-006-0518-5
Aronsen A, Maas Geesteranus RA. 1992. Mycena terena, a new member of section Polyadelphia
from Southern Norway. Persoonia 15(1): 105-107.
Esteve-Raventdés F, Villarreal M. 1997. Mycena quercophila, a new species of Mycena section
Polyadelphia growing on Quercus ilex leaves. Osterr. Z. Pilzk. 6: 67-70.
Felsenstein J. 1985. Confidence limits on phylogenies - an approach using the bootstrap. Evolution
39: 783-791.
Gulden G, Jenssen KM. 1982. Mycena and related genera in alpine habitats of South Norway. Arctic
and Alpine Mycology (Symposium) 1: 164-197.
Index Fungorum. 2011. http://www.speciesfungorum.org/ (viewed online on 12 Mar 2011).
Heulsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17:
754-755.
Maas Geesteranus RA. 1986. Conspectus of the Mycenas of the Northern Hemisphere - 6. Sections
Polyadelphia and Saetulipedes. Proc. K. Ned. Akad. Wet. (Ser. C) 89(2): 159-182.
Maddison DR, Maddison W. 2000. MacClade 4: Analysis of phylogeny and character evolution.
Version 4.0. Sinauer Associates, U.S.A.
Matheney PB, Curtis JC, Hofstetter V, Aime M.C, Moncalvo J-M, He Z-W, Yang Z-L, Slot JC,
Ammirati JF, Baroni TJ, Bougher NL, Hughes KW, Lodge DJ, Kerrigan RW, Seidl MT, Aanen
DK, DeNitis M, Daniele GM, Desjardin DE, Kropp BR, Norvell LL, Parker A, Vellinga EC,
Vilgalys R, Hibbett DS. 2006. Major clades of Agaricales: a multilocus phylogenetic overview.
Mycologia 98(6): 982-995. http://dx.doi.org/10.3852/mycologia.98.6.982
Moncalvo JM, Lutzoni FM, Rehner SA, Johnson J, Vilgalys R. 2000. Phylogenetic relationships of
agaric fungi based on nuclear large subunit ribosomal DNA sequences. Systematic Biology 49:
278-305.
Nylander JAA. 2004. MrModeltest v2. Program distributed by the author. Evolutionary Biology
Centre, Uppsala University (http://www.abc.se/~nylander/)
Perry BA, Pfister DH. 2007. Chaetothiersia vernalis, a new genus and species of Pyronemataceae
(Ascomycota, Pezizales) from California. Fungal Diversity 28: 65-72.
Ronquist F, Huelsenbeck JP. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Swofford D. 2003. PAUP*. Phylogenetic Analysis Using Parsimony (*and other methods). Version
4. Sinauer Associates, U.S.A.
Zwickl DJ. 2006. Genetic algorithm approaches for the phylogenetic analysis of large biological
sequence datasets under the maximum likelihood criterion. Ph.D. Dissertation, The University
of Texas at Austin.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.197
Volume 118, pp. 197-201 October-December 2011
Neolecta vitellina, first record from Romania,
with notes on habitat and phenology
VASILICA CLAUDIU CHINAN ™* & DAvID HEwITT ”
‘Faculty of Biology, Alexandru Ioan Cuza University, Bd. Carol I, No. 20A, 700505, Iasi, Romania
*Department of Botany, Academy of Natural Sciences
1900 Benjamin Franklin Parkway, Philadelphia, PA 19103 USA
* CORRESPONDENCE TO: [email protected]
Asstract — Neolecta vitellina, one of the rarely collected ascomycete species in Europe,
is reported from Romania for the first time. The species was found on the ground, under
Norway spruce (Picea abies) in 2004, from the Nature Reserve “Tinovul Mare” Poiana
Stampei (Eastern Carpathians, Romania). Subsequent field observations have confirmed the
presence of Neolecta vitellina in the same location, in the period 2005-10. A description and
photographs of the specimens are presented.
Key worps — Ascomycota, Neolectaceae, ITS sequence
Introduction
The genus Neolecta Speg. belongs to the ascomycete family Neolectaceae
(Redhead 1977), order Neolectales (Landvik et al. 1993), class Neolectomycetes
(Taphrinomycotina, Ascomycota). This genus includes three accepted species
—N. flavovirescens Speg., N. irregularis (Peck) Korf & J.K. Rogers, N. vitellina—
with clavate, unbranched to lobed yellow ascomata, up to about 7 cm tall
(Landvik et al. 2003). Of these three species, only N. vitellina has been reported
from Europe (Bresadola 1882, Geitler 1958, Hansen & Knudsen 2000: 48-50,
Krieglsteiner 1993: 421, Landvik et al. 2003, Ohenoja 1975, Redhead 1989).
Work published by European researchers about Neolecta vitellina refers mainly
to phylogeny, morphology and ultrastructure (Landvik 1996, 1998; Landvik
et al. 1993, 2001, 2003). The purpose of this paper is to report the presence
of Neolecta vitellina in Romania and to provide morphological and ecological
notes on this fungus.
Materials & methods
During 2005-2010 the known habitat of Neolecta vitellina in the Nature Reserve
“Tinovul Mare” Poiana Stampei (Eastern Carpathians, Romania) was monitored for
198 ... Chinan & Hewitt
TABLE 1. List of Neolecta vitellina specimens, GenBank (ITS) accession numbers,
and sequence identity compared with the Romanian specimen.
Heras Aceon SequenidentY origin ‘Dat Calle
I 114506 FJ171855.1 N/A Romania 2 July 2005; VC Chinan
FH:DAH-7 FJ171850.1 99% Norway, 14 Aug 2002; S Landvik,
near Oslo DA Hewitt, P Inderbitzin,
S Huhtinen, inter al.
FH:DAH-18 FJ171849.1 99% USA, MA 3 Nov 2005; DA Hewitt, B Wolfe
FH:DAH-22 FJ171847.1 99% USA, MA 15 Nov 2005; WJ Neill
FH:DAH-21A FJ171852.1 99% USA, MA 17 Nov 2005; DA Hewitt
FH:DAH-21B FJ171853.1 99% USA, MA 17 Nov 2005; DA Hewitt
FH:DAH-11 FJ171851.1 99% USA, MA 6 Nov 2003; DA Hewitt, G Riner
FH:KH.04.34 FJ171848.1 100% USA, NM 30 Aug 2004; K Hansen, B Perry
OSC:119159 FJ171854.1 99% USA, OR 3 Oct 2001; M Russell
ascomata. Fresh specimens were photographed in situ prior to collection. Ascomata
were sectioned and mounted in Melzer’s reagent for observation of asci and ascospores
under the light microscope.
The ITS DNA sequence was generated from a dried Neolecta vitellina ascoma
(I 114506) that was crushed using a FASTPREP DNA extraction machine (Qbiogene,
Inc.). DNA was extracted from crushed material using a phenol-chloroform extraction
protocol. The ITS (Internal Transcribed Spacer) region was amplified by PCR using
primers ITS4 and ITS5 (http://www.biology.duke.edu/fungi/mycolab/primers.htm). We
used BlastN (Altschul et al. 1997) to query the GenBank database for similar sequences
and calculate percent identity and gaps. The obtained ITS sequence is deposited in
GenBank (accession number FJ171855.1).
Analyzed specimens are deposited in the Herbarium of Alexandru Ioan Cuza
University, Faculty of Biology, Iasi, Romania (I) and Farlow Herbarium, Harvard
University, Cambridge, USA (FH).
Taxonomy
Neolecta vitellina (Bres.) Korf & J.K. Rogers, Phytologia 21: 204 (1971). Fic. 1
= Geoglossum vitellinum Bres., Rev. Mycol. 4: 212 (1882).
ASCOMATA 20-40 mm long, irregularly clavate, lanceolate or spathulate and
consisting of a sterile zone (stipe) at the bottom and a fertile zone (hymenium)
Neolecta vitellina new to Romania... 199
FiGure 1. Neolecta vitellina.
A-ascomata in habitat; B-ascoma attached to a root of Norway spruce (Picea abies).
Scale bar = 1 cm.
on the top; fertile zone 9-18 mm long, 3-8 mm wide, yellow to bright yellowish,
smooth, sometimes longitudinally subplicate, with margin entire or slightly
irregularly lobate; sterile zone 10-22 mm long, 2-4 mm wide at the fertile zone,
pubescent or tomentose, whitish or pale yellow (Fic. 1A).
Asct 55-75 um long, 4-5.5 um wide above, 3-3.5 um wide below, cylindrical
to cylindrical-clavate, 8-spored. Paraphyses absent. Ascospores uniseriate,
unicellular, 5.5-8 x 3-4 um, reniform, ellipsoid or ovoid, hyaline, smooth.
Phialoconidia not found associated with ascospores.
Hasirat on the ground, among mosses, in coniferous forest under Norway
spruce (Picea abies (L.) H. Karst.) at an altitude of 915 m.
SEQUENCE ANALYSIS BlastN searches of GenBank with the ITS sequence
(646 nucleotides) of the Romanian N. vitellina specimen (I 114506) produced
significant alignments with ITS sequences from N. vitellina specimens collected
from Norway and USA (TABLE 1).
SPECIMENS EXAMINED: ROMANIA. EASTERN CARPATHIANS: Nature Reserve “Tinovul
Mare” Poiana Stampei, 47°18'02.69"N, 25°06'45.59"E, 915 m altitude, on ground under
Picea abies, 4 October 2004, leg. Chinan (I 114507); 2 July 2005, leg. Chinan (I 114506,
FH:DAH-31, GenBank ITS— FJ171855.1); 29 June 2006, leg. Chinan (I 114508); 30
June 2007, leg. Chinan (I 137103); 12 July 2008, leg. Chinan (I 137104); 8 July 2010, leg.
Chinan (I 137105).
Discussion
Neolecta vitellina is rarely collected in Europe, where it has a boreal-montane
distribution. The species has previously been reported in Norway, Sweden,
Finland (Hansen & Knudsen 2000), and Italy (Bresadola 1882, Geitler 1958).
In Romania, N. vitellina was found in the northern part of the country at the
periphery of “Tinovul Mare” Poiana Stampei peat bog on the ground among
200 ... Chinan & Hewitt
mosses under Norway spruce (Picea abies). Our report represents the first
record of this species for Romania and the Carpathian Mountains.
Two ascomata were first found on October 2004. In July 2005, more specimens
were in the same location with 53 ascomata inventoried in approximately a 10
m/’ area. Subsequent monitoring during 2006-10 has confirmed its presence in
the same place and shown that late June and early July seem to be the optimal
time for Neolecta vitellina to form ascomata in Romania. For comparison,
Landvik et al. (2003) reported N. vitellina from Northern Europe in August
while Redhead (1977) reports the species from North America in August-
October. Additionally, a Bresadola collection of Geoglossum vitellinum from
Southern Tyrol (Italy) in the Patouillard collection at the Farlow Herbarium is
dated ‘Aug. 1889; later than the fruiting time recorded herein for the Romanian
populations.
The macroscopic and microscopic characters of the specimens collected
from Romania are in accordance with the literature (Redhead 1977, Hansen &
Knudsen 2000, Landvik 2003) and the ITS sequence derived from one ascoma
(I 114506) matches those of other specimens identified as Neolecta vitellina.
We also confirm that Neolecta vitellina ascomata are attached to Norway
spruce roots (Fic. 1B), on which was observed a whitish sleeve consisting
of mycelium. Regarding this aspect, Redhead (1979) mentions that Neolecta
vitellina is possibly a root parasite, based on morphology and the close
association of the hyphae and the roots to which the hyphae are attached.
The presence of this species in the Nature Reserve “Tinovul Mare” Poiana
Stampei, part of the EUROPEAN ECOLOGICAL NATURA 2000 NETWORK,
emphasizes the importance of this site for macrofungi conservation.
Acknowledgements
The ITS sequence was generated in the laboratory of Joey Spatafora (OSU) with
the invaluable aid of Conrad Schoch, funded by the Assembling the Fungal Tree of
Life project, NSF grant EF-0228671, and NSF grant #0090301 Phylogeny of Kingdom
Fungi. We thank Michaela Schmull (FH) for assistance in locating references. The
authors are grateful to Donald H. Pfister (Harvard University, USA), Conrad L. Schoch
(NIH/NLM/NCBI, USA), and Shaun Pennycook (Manaaki Whenua Landcare Research,
New Zealand) for reviewing the manuscript.
Literature cited
Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped
BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids
Research 25: 3389-3402. http://dx.doi.org/10.1093/nar/25.17.3389
Bresadola J. 1882. Discomycetes nonnulli Tridentini novi. Rev. Mycol. 4: 211-212.
Eriksson OE, Winka K. 1997. Supraordinal taxa of Ascomycota. Myconet 1: 1-16.
Geitler L. 1958. Konidienbildung aus Ascosporen bei Geoglossaceen. Osterreichische botanische
Zeitschrift (Pl. Syst. Evol.) 105(1-3): 159-166. http://dx.doi.org/10.1007/BF01289007
Neolecta vitellina new to Romania... 201
Hansen L, Knudsen H. 2000. Nordic Macromycetes, Vol. 1: Ascomycetes. Nordsvamp-
Copenhagen.
Krieglsteiner GJ. 1993. Verbreitungsatlas der Grofspilze Deutschlands (West), Band 2, Schlauchpilze.
Ulmer Verlag, Stuttgart.
Landvik S. 1996. Neolecta, a fruit-body-producing genus of the basal ascomycetes, as shown by SSU
and LSU rDNA sequences. Mycological Research 100(2): 199-202.
http://dx.doi.org/10.1016/S0953-7562(96)80122-5
Landvik S. 1998. Hall 6gonen 6ppna for Neolecta. Jordstjarnan 19(2): 16-19.
Landvik S, Eriksson OE, Gargas A, Gustafsson P. 1993. Relationships of the genus Neolecta
(Neolectales ordo nov., Ascomycotina) inferred from 18S rDNA sequences. Syst. Ascomycetum
11: 107-115.
Landvik S, Eriksson I, Berbee ML. 2001. Neolecta-a fungal dinosaur? Evidence from B-tubulin
amino acid sequences. Mycologia 93(6): 1151-1163. http://dx.doi.org/10.2307/3761675
Landvik S$, Schumacher TK, Eriksson OE, Moss ST. 2003. Morphology and ultrastructure of
Neolecta species. Mycological Research 107(9): 1021-1031.
http://dx.doi.org/10.1017/S0953756203008219
Ohenoja E. 1975. Leotia, Cudonia, Spathularia and Neolecta (Ascomycetes) in Finland. Annales
Botanici Fennici 100: 193-196.
Redhead SA. 1977. The genus Neolecta (Neolectaceae fam. nov., Lecanorales, Ascomycetes) in
Canada. Can. J. Bot. 55: 301-306. http://dx.doi.org/10.1139/b77-041
Redhead SA. 1979. Mycological observations: 1, on Cristulariella; 2, on Valdensinia; 3, on Neolecta.
Mycologia 71: 1248-1253. http://dx.doi.org/10.2307/3759112
Redhead SA. 1989. A biogeographical overview of the Canadian mushroom flora. Can. J. Bot. 67:
3003-3062. http://dx.doi.org/10.1139/b89-384
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.203
Volume 118, pp. 203-211 October-December 2011
Epitypification, morphology, and phylogeny of Tothia fuscella
Harixia Wu’, WALTER M. JAKLITSCH’,
HERMANN VOGLMAYR’ & KEVIN D. HYDE”* **
‘International Fungal Research and Development Centre, Key Laboratory of Resource
Insect Cultivation & Utilization, State Forestry Administration, The Research Institute
of Resource Insects, Chinese Academy of Forestry, Kunming, 650224, PR China
? Department of Systematic and Evolutionary Botany, Faculty Centre of Biodiversity,
University of Vienna, Rennweg 14, A-1030 Wien, Austria
3 School of Science, Mae Fah Luang University, Tasud, Muang, Chiang Rai 57100, Thailand
4 Botany and Microbiology Department, College of Science, King Saud University,
Riyadh, 11442, Saudi Arabia
*CORRESPONDENCE TO: [email protected]
ABSTRACT — The holotype of Tothia fuscella has been re-examined and is re-described and
illustrated. An identical fresh specimen from Austria is used to designate an epitype with
herbarium material and a living culture. Sequence analyses show T. fuscella to be most closely
related to Venturiaceae and not Microthyriaceae, to which it was previously referred.
Key worps — Dothideomycetes, molecular phylogeny, taxonomy
Introduction
We have been re-describing and illustrating the generic types of
Dothideomycetes (Zhang et al. 2008, 2009, Wu et al. 2010, 2011, Li et al. 2011)
and have tried where possible to obtain fresh specimens for epitypification and
use molecular analyses to provide a natural classification.
Our previous studies of genera in the Microthyriaceae, a poorly known
family within the Dothideomycetes, have resulted in several advances (Wu et
al. 2010, 2011). The Microthyriaceae are characterized by superficial, flattened,
dimidiate ascomata with cells of the upper wall that radiate and open by an
ostiole. Asci are bitunicate and fissitunicate and ascospores are hyaline to brown
(Hawksworth et al. 1995, Kirk et al. 2008).
Tothia is a poorly known monotypic genus forming thyriothecia currently
classified in the Microthyriaceae (Lumbsch & Huhndorf 2010). To reassess the
morphology of T. fuscella, we examined its holotype and re-collected the species
204 ... Wu &al.
from stalks of Teucrium chamaedrys in two different regions of Austria. Cultures
of these fresh collections were prepared to extract DNA and to sequence LSU
and ITS rDNA in order to establish the phylogenetic position of this fungus. In
this paper, we provide a detailed description and illustrations of T: fuscella and
establish its familial placement through nuLSU rDNA sequence analyses.
Materials & methods
Type material of Tothia fuscella was borrowed from URM. Ascomata were rehydrated
in 3% KOH prior to examination and sectioning. Specimens were examined under
a Leica MZ16A stereomicroscope, and fine forceps were used to remove one or two
ascomata, which were mounted in water, Melzer’s, Congo red, or cotton blue reagents.
Observations and photographs were made under a Nikon E800 or Nikon 80i light
microscope. For some hyaline structures differential interference contrast microscopy
was used. Sections were cut by hand with a sharp razor blade or into 8-1m thick slices
using a Leica CM1100 freezing microtome and then were transferred to a drop of water
or cotton blue for examination and photography. Measurement ranges cover a minimum
of 30 ascospores, 25 asci, or 10 ascomata. Microtome sections were made from one or
two ascomata, and ten measurements were made from whole ascoma and peridia.
Fresh specimens were collected in Austria and herbarium material is deposited in
IFRD and WU. Single ascospore isolates were obtained following Choi et al. (1999) and
grown on 2% malt extract agar (MEA). Cultures are deposited at the CBS.
Total DNA was extracted from liquid cultures according to Voglmayr & Jaklitsch
(2011). A ca. 1600 bp fragment containing partial SSU, ITS1, 5.88, ITS2 and partial
LSU rDNA was amplified with primers V9G (de Hoog & Gerrits van den Ende 1998)
and LR5 (Vilgalys & Hester 1990). PCR products were purified by an enzymatic PCR
cleanup as described in Voglmayr & Jaklitsch (2008). DNA was cycle-sequenced using
the ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit v. 3.1
(Applied Biosystems, Warrington) with primers V9G, LR3 (Vilgalys & Hester 1990) and
LRS5, and an automated DNA sequencer (ABI 377 or 3130xl Genetic Analyzer, Applied
Biosystems). The GenBank accession numbers of the sequences obtained in the present
study are listed in TABLE 1.
One Tothia fuscella sequence was aligned with 12 sequences downloaded from
GenBank (TaBLE 1). Preliminary multiple alignments were generated using BioEdit
(Hall 1999) and ClustalX v. 1.83 (Thompson et al. 1997) and then checked visually and
manually optimized.
The alignment was analyzed using PAUP* 4.0b10 (Swofford 2002) and MrBayes v.
3.0b4 (Ronquist & Huelsenbeck 2003). Schismatomma decolorans (Arthoniomycetes),
which is basal to other ascomycetes in a recent study (Schoch et al. 2009), was selected
as outgroup.
A Maximum Parsimony (MP) tree was inferred with PAUP* using the heuristic search
option with 10000 random taxa addition and tree bisection and reconnection (TBR) as
the branch-swapping algorithm. All characters were unordered and of equal weight;
gaps were treated as missing data. Maxtrees were unlimited, zero-length branches were
collapsed, and all most parsimonious trees were saved. Maximum parsimony bootstrap
Tothia fuscella, epitypified ... 205
TABLE 1. Dothideomycetes and Arthoniomycetes specimens analysed
(Newly deposited sequences shown in bold).
(Vuill.) Fabric.
Saueris | CULTURE | FAMILY | GENBANK ACCESSION
| | (Schoch et al. 2009) | nuLSU rDNA
Apiosporina collinsii | CBS118973 | Venturiaceae | GU301798
(Schwein.) Hohn. |
Apiosporina morbosa | dimosp | Venturiaceae | EF114694
(Schwein.) Arx. | |
Dothidea insculpta | CBS189.58 | Dothideacae | DQ247802
Wallr. |
Dothidea sambuci | DAOM231303 | Dothideacae | AY544681
(Pers.) Fr. |
Microthyrium microscopicum | CBS115976 | Microthyriaceae | GU301846
Desm.
Myriangium duriaei | CBS260.36 | Myriangiaceae | DQ678059
Mont. & Berk.
Myriangium hispanicum | CBS247.33 | Myriangiaceae | GU301854
J.B. Martinez |
Schismatomma decolorans |
i DUKE0047570 i Roccellaceae i AY548815
(Turner & Borrer ex Sm.) |
Clauzade & Vézda | | |
Tothia fuscella | (TE)CBS130266 | - | JE927786
Tothia fuscella | (TF1)CBS130267 | - | JE927787
Trichodelitschia bisporula CBS262.69 | Phaeotrichaceae GU348996
(PB Crouan & H. Crouan) Munk |
Trichodelitschia munkii Kruys201 | Phaeotrichaceae DQ384096
N. Lundq. | |
Venturia inaequalis CBS594.70 | Venturiaceae GU301879
(Cooke) G. Winter |
Venturia populina CBS256.38 Venturiaceae | GU323212
analyses were done with the same settings, with ten rounds of random sequence addition
(Hillis & Bull 1993).
The consistency index (CI; Kluge & Farris 1969), retention index (RI; Farris 1989),
and rescaled consistency index (RC; Farris 1989) were obtained from PAUP*.
For Bayesian analyses, evolution was estimated by using MrModeltest 2.2 (Nylander
2004). Posterior probabilities (Rannala & Yang 1996, Zhaxybayeva & Gogarten 2002)
were determined by Markov Chain Monte Carlo sampling (BMCMC) in MrBayes v.
3.0b4 (Huelsenbeck & Ronquist 2001). Six simultaneous Markov chains were run for
1 million generations; trees were sampled every 100th generation, resulting in 10 001
saved trees.
206 ... Wu & al.
The first 2000 trees were discarded and the remaining 8001 trees were used for
calculating posterior probabilities in the majority rule consensus tree (Cai et al. 2006,
2008, Liu et al. 2010). The phylogenetic tree was visualized with TREE-VIEW (Page
1996).
Results
Because the ssu-1Ts-Lsu rDNA sequences obtained for the two Tothia
fuscella isolates are identical, only one (1535 bp) was included in the analyses.
Of the 735 nucleotides analyzed, 478 were constant and 182 variable characters
were parsimony informative. Maximum parsimony analysis produced a single
Schismatomma decolorans § Outgroup
Tothia fuscelia
Venturiaceae
64
100 F
700 Phaeotrichaceae
‘ roti
100 :
700 Dothideaceae
: Dothidea insculpta
| Miriangium duriaei
100 Myriangiaceae
10 nucleotide substitutions Myriangiwn hispanicum
Fic. 1. Phylogram showing the single MP tree of 487 steps, inferred from a heuristic parsimony
analysis of the nuLSU rDNA using PAUP*. MP bootstrap support values = 50 % and Bayesian
values = 90 % are shown above and below branches, respectively.
Tothia fuscella, epitypified ... 207
MP tree of 487 steps (Fic. 1), with CI = 0.729, RI = 0.735, RC = 0.536 and
HI = 0.271. The overall topology of trees sampled in the Bayesian analysis
was compatible with the MP tree. MP bootstrap support values and posterior
probabilities are shown in Fic. 1.
In the phylogenetic analyses (Fic. 1), Tothia fuscella was remote from the
Microthyriaceae clade but clustered near the Venturiaceae clade with 97%
bootstrap support and 1.0 posterior probability.
Taxonomy
Tothia Bat., in Toth, Annls hist.-nat. Mus. natn. hung. 52: 105 (1960).
Saprobic on stems. Ascomata, superficial, thyriothecial; in section conical,
relatively small, opening with a minute flat or slightly papillate ostiole. Asci 8-
spored, bitunicate, fissitunicate, cylindrical or obclavate. Ascospores, 1-septate,
light brown.
ANAMORPHs: None reported for the genus (Hyde et al. 2011).
Tothia fuscella (Sacc.) Bat., in Toth, Annls hist.-nat. Mus. natn. hung.
52: 106 (1960). Fic. 2
= Microthyrium fuscellum Sacc., Michelia 2(6): 57 (1880).
Saprobic on stems of Teucrium chamaedrys. Superficial mycelium absent.
Ascomata, solitary or gregarious, superficial, appearing as small black dots on
the host surface, thyriothecial; in section 130-270 um diam, 60-122 um high,
dome-shaped or flat-conical, dark brown, membranaceous, opening by a short
papillate ostiole. Peridium 7-15 um wide above, dark brown, comprising a
single upper layer of cells of textura angularis; ascoma base, comprising hyaline
ellipsoidal cells. Hamathecium of pseudoparaphyses 1.5-3 um wide, longer
than asci. Asci 57-71 x 9-13 um (mean = 64 x 10.5 um, n = 25), 8-spored,
bitunicate, fissitunicate, obclavate, with a knob-like short pedicel about 4-6 x
5-7 um, lacking an ocular chamber. Ascospores 24-28 x 4-6 um (mean = 25.7
x 4.7 um, n = 30), 2-3 seriate, fusiform or oblong-ellipsoid, light brown, one-
septate, slightly constricted at the septum, upper cell slightly wider than the
lower, with four guttules, smooth-walled.
After critical morphological comparisons showed that the fresh collections
were identical with the holotype, we designated one specimen as the epitype
for T. fuscella.
MATERIALS EXAMINED: AUSTRIA, KARNTEN, St. Margareten im Rosental, Aussicht,
grid square 9452/3, on stalks of Teucrium chamaedrys (Lamiaceae), soc. Ophiobolus
erythrosporus, 3 July 2010, W. Jaklitsch (epitype designated here, WU31396; ex-
epitype culture TF1; LSU-ITS sequence JF927787; iso-epitype IFRD8982); 12 Sep
2010, W. Jaklitsch & O. Siikésd (WU 31397). NIEDEROSTERREICH, Krems, Egelsee, on
stems of Teucrium chamaedrys, soc. Ophiobolus sp., 15 Sep 2010, H. Voglmayr (WU
31398; culture TE; ITS-LSU sequence JF927786). HUNGARY, on stems of Teucrium
chamaedrys, further data not given (holotype, URM 8210).
208 ... Wu &al.
Fic. 2. Tothia fuscella (A, D-E, H, N from epitype; B-C, F-G, I-M, O-P, from holotype).
A. Appearance of ascomata on the host surface. B, C, D. Squash mount of ascoma. E-G. Ascomata
in Section. H-J, L. Asci. K. Hamathecium. M-P. Ascospores. Scale bars: A = 500um, B = 40 um,
C-L= 10 um. M-P =5 um.
ComMMENTS—In this paper we redescribe the type of Tothia fuscella and
designate an epitype with dried material and an associated living ex-type culture.
Ascomata of T. fuscella are morphologically indistinguishable from typical
representatives of Microthyriaceae. Its ascospores resemble Microthyrium in
being one-septate, guttulate, and slightly asymmetrical but differ in their dilute
brown color. Phylogenetic analyses indicate that T: fuscella is most closely
related to the Venturiaceae, to which it should be assigned.
Tothia fuscella, epitypified ... 209
Thyriothecial ascomata are unusual for the Venturiaceae, which illustrates
that this ascoma type has evolved independently several times within
Dothideomycetes. Genera in Venturiaceae usually have yellowish, greenish
brown to brown, one-septate ascospores and obclavate asci (Barr 1968, 1989),
which agrees well with Tothia.
Acknowledgments
The Research Institute of Resource Insects, Chinese Academy of Forestry provided
financial support for the PhD study of Haixia Wu. Funds for research were provided
by the Grant for Essential Scientific Research of National Non-profit Institute (no.
CAFYBB2007002). The curators of herbarium URM are thanked for providing
material on loan for this study. The authors also thank Professor Xiaoming Chen and
Hang Chen (The Research Institute of Resource Insects, Chinese Academy of Forestry,
China), Jiankui Liu; Putarak Chomnunti (Mae Fah Luang University, Thailand, MFU)
and Cai Lei (Institute of Microbiology, Chinese Academy of Sciences, Beijing, China)
for their valuable help. Our deep thanks to Drs Eric McKenzie and Wen- Ying Zhuang
for reviewing the manuscript. K.D. Hyde acknowledges a research grant from the
Biodiversity Research and Training Program (BRT R253012) and Training Program
Grant (BRTR251181) and partial support from the Global Research Network for Fungal
Biology and King Saud University.
Literature cited
Barr ME. 1968. The Venturiaceae in North America. Canadian Journal of Botany 46: 799-864.
http://dx.doi.org/10.1139/b68-111
Barr ME. 1989. The Venturiaceae in North America: revisions and additions. Sydowia 41: 25-40.
Cai L, Jeewon R, Hyde KD. 2006. Phylogenetic investigations of Sordariaceae based on multiple
gene sequences and morphology. Mycological Research 110: 137-150.
http://dx.doi.org/10.1016/j.mycres.2005.09.014
Cai L, Guo XY, Hyde KD. 2008. Morphological and molecular characterisation ofa new anamorphic
genus Cheirosporium, from freshwater in China. Persoonia 20: 53-58.
http://dx.doi.org/10.3767/003158508X314732
Choi YW, Hyde KD, Ho WH. 1999. Single spore isolation of fungi. Fungal Diversity 3: 29-38.
de Hoog GS, Gerrits van den Ende AHG. 1998. Molecular diagnostics of clinical strains of
filamentous basidiomycetes. Mycoses 41: 183-189.
http://dx.doi.org/10.1111/j.1439-0507.1998.tb00321.x
Farris JS. 1989. The retention index and the rescaled consistency index. Cladistics 5: 417-419.
http://dx.doi.org/10.1111/j.1096-0031.1989.tb00573.x
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NTT. Nucleic Acids Symposium Series 41: 95-98.
Hawksworth DL, Kirk PM, Sutton BC, Pegler DN. 1995. Ainsworth & Bisby’s dictionary of the
fungi. 8th edn. CAB International, Wallingford, UK. 616p.
Hillis DM, Bull JJ. 1993. An empirical test of bootstrapping as a method for assessing confidence in
phylogenetic analysis. Systematic Biology 42: 182-192. http://dx.doi.org/10.2307/2992540
Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of phylogenetic trees.
Bioinformatics 17: 754-755. http://dx.doi.org/10.1093/bioinformatics/17.8.754
210 ... Wu &al.
Hyde KD, McKenzie EHC, KoKo TW. 2011. Towards incorporating anamorphic fungi in a natural
classification — checklist and notes for 2010. Mycosphere 2: 1-88.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi.
10th edn. CAB International, Wallingford, UK. 771 p.
Kluge AC, Farris JS. 1969. Quantitative phyletics and the evolution of anurans. Systematic Zoology
18: 1-32. http://dx.doi.org/10.2307/2412407
Li YM, Wu HX, Chen H, Hyde KD. 2011. Morphological studies in Dothideomycetes: Elsinoe
(Elsinoaceae), Butleria and three excluded genera. Mycotaxon 115:507-520.
http://dx.doi.org/10.5248/115.507
Liu Jk, Chomnunti P, Cai L, Phookamsak R, Chukeatirote R, Jones EBG, Moslem M, Hyde KD.
2010. Phylogeny and morphology of Neodeightonia palmicola sp. nov. from palms. Sydowia 62:
261-276.
Lumbsch HT, Huhndorf SM. 2010. Life and Earth Sciences. Myconet 14: 1-64.
Nylander JAA. 2004. MrModeltest 2.0. Program distributed by the author. Evolutionary Biology
Centre, Uppsala University.
Page RDM. 1996. TreeView: an application to display phylogenetic trees on personal computers.
Computer Applications in the Biosciences 12: 357-358.
Rannala B, Yang Z. 1996. Probability distribution of molecular evolutionary trees: a new method of
phylogenetic inference. Journal of Molecular Evolution 43: 304-311.
http://dx.doi.org/10.1007/BF02338839
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572. http://dx.doi.org/10.1093/bioinformatics/btg180
Schoch CL, Crous PW, Groenewald JZ, Boehm EWA, Burgess TI, de Gruyter J, de Hoog GS, Dixon
LJ, Grube M, Gueidan C, Harada Y, Hatakeyama S, Hirayama K, Hosoya T, Huhndorf SM,
Hyde KD, Jones EBG, Kohlmeyer J, Kruys A, Li YM, Liicking R, Lumbsch HT, Marvanova L,
Mbatchou JS, McVay AH, Miller AN, Mugambi GK, Muggia L, Nelsen MP, Nelson P, Owensby
CA, Phillips AJL, Phongpaichit S, Pointing SB, Pujade-Renaud V, Raja HA, Rivas Plata E,
Robbertse B, Ruibal C, Sakayaroj J, Sano T, Selbmann L, Shearer CA, Shirouzu T, Slippers
B, Suetrong S, Tanaka K, Volkmann-Kohlmeyer B, Wingfield MJ, Wood AR, Woudenberg
JHC, Yonezawa H, Zhang Y, Spatafora JW. 2009. A class—wide phylogenetic assessment of
Dothideomycetes. Studies in Mycology 64: 1-15. http://dx.doi.org/10.3114/sim.2009.64.01
Swofford DL. 2002. PAUP*. Phylogenetic analysis using parsimony (* and other methods). Version
4.0 b10. Sinauer Associates, Sunderland, MA: U.S.A.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The CLUSTAL_X windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Research 25: 4876. http://dx.doi.org/0.1093/nar/25.24.4876
Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified
ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238-4246.
Voglmayr H, Jaklitsch WM. 2008. Prosthecium species with Stegonsporium anamorphs on Acer.
Mycological Research 112: 885-905. http://dx.doi.org/10.1016/j.mycres.2008.01.020
Voglmayr H, Jaklitsch WM. 2011. Molecular data reveal high host specificity in the phylogenetically
isolated genus Massaria (Ascomycota, Massariaceae). Fungal Diversity 46: 133-170.
http://dx.doi.org/10.1007/s13225-010-0078-5
Wu HX, Li YM, Chen H, Hyde KD. 2010. Studies on Microthyriaceae: some excluded genera.
Mycotaxon 113: 147-156. http://dx.doi.org/10.5248/113.147
Wu HX, Hyde KD, Chen H. 2011. Studies on Microthyriaceae: placement of Actinomyxa, Asteritea,
Cirsosina, Polystomellina and Stegothyrium. Cryptogamie Mycologie 32: 3-12.
Tothia fuscella, epitypified ... 211
Zhang Y, Fournier J, Pointing SB, Hyde KD. 2008. Are Melanomma_ pulvis-pyrius and
Trematosphaeria pertusa congeneric? Fungal Diversity 33: 47-60.
Zhang Y, Wang HK, Fournier J, Crous PW, Jeewon R, Pointing SB, Hyde KD. 2009. Towards a
phylogenetic clarification of Lophiostoma/Massarina and morphologically similar genera in the
Pleosporales. Fungal Diversity 38: 225-251.
Zhaxybayeva O, Gogarten JP. 2002. Bootstrap, Bayesian probability and maximum likelihood
mapping: exploring new tools for comparative genome analyses. BMC Genomics 3: 4.
http://dx.doi.org/10.1186/1471-2164-3-4
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/118.213
Volume 118, pp. 213-218 October-December 2011
Exserohilum neoregeliae sp. nov.,
a new pathogen of Neoregelia carolinae
TAKUYA SAKODA'& TAKAO TSUKIBOSHI”
'Kobe Plant Protection Station, 1-1 Hatoba-cho, Chuo-ku, Kobe, 650-0042, Japan.
*National Institute of Livestock and Grassland Science, National Agriculture and Food Research
Organization, Senbonmatsu 768, Nasushiobara, Tochigi, Japan.
*CORRESPONDENCE TO: [email protected]
Asstract —Exserohilum neoregeliae is described from Neoregelia carolinae leaves imported
from the Netherlands at plant quarantine inspection in Japan. The new fungal species is
characterized by long rostrate conidia with an obconic basal end cell with a distinct hilum.
ITS + 5.8SrDNA sequence analyses revealed that E. neoregeliae forms a monophyletic group
with E. minor.
Key worps — hyphomycetes, Bromeliaceae, leaf blight, phylogeny
Introduction
Neoregelia carolinae (Beer) L.B. Sm. (Bromeliaceae) is an ornamental plant
native to South America (Takabayashi 1994). In May 2006, brown spindle-
shaped lesions were found on N. carolinae leaves imported from the Netherlands
during plant quarantine inspection at Narita International Airport in Japan.
A new species of Exserohilum isolated from the lesions is described based on its
distinctive conidial morphology. In addition, molecular phylogenetic analyses
were carried out on the internal transcribed spacer of ribosomal DNA (rDNA-
ITS), including 5.8S rDNA.
Materials & methods
Isolates (IM201-c, -pD, -E, -F) were obtained from four lesions on the leaves of N.
carolinae and used for morphological observation, pathogenicity tests, and molecular
phylogenetic analyses. For morphological observation, the isolates were incubated
on V8 juice agar under alternating 12 h black light blue (BLB)/12 h darkness at 25°C
for about 20 days, and the resulting anamorph was observed under light microscopy.
Pathogenicity tests were conducted by placing V8 juice agar pieces, including hyphae,
on needle-wounded leaves of the original host that was grown in a greenhouse for four
214 ... Sakoda & Tsukiboshi
TABLE 1. Conidial morphology of Exserohilum neoregeliae and similar species.
SPECIES neoregeliae * longisporum ° rostratum ° longirostratum ° minor ©
SHAPE Narrowly Fusiform, Ellipsoid, Narrowing Fusiform
obclavate narrowly narrowly gradually to
or rostrate obclavate obclavate, long apical
or rostrate or rostrate beak
COoLoR Pale brown Yellowish Brown or Olivaceous Olivaceous
to brown brown olivaceous brown brown
No. OF 6-20 (6-)8-13 < 18 — 5-11
DISTOSEPTA (-26) (-18)
LENGTH 80.5-285 54-240 15-200 60-475 55-135
WIDTH 12.5-27 11.5-21.5 7-29 12-26 12.5-20
SEPTA Concolorous Concolorous Darker & End cells often Concolorous
thicker at cut off by dark,
basal septum thick septum
BASE Basal cell Basal cell Subhyaline Broadest at base —_ Base truncate
obconic; occ. often sl. obconic;
constricted at/ bulging lower half occ.
below septum constricted
*= Isolate No. IM201-p; ’ = Sun et al. (1996); © = Sivanesan(1986)
months. The aseptic V8 juice agar pieces were placed in the same way as a control. The
inoculated plants were kept in a plastic case with a cover to maintain high humidity for
2 days. Then they were kept at room temperature under natural light after uncovering.
The ITS+5.8S rDNA were amplified with ITS1/4 primers (White et al. 1990), sequenced
directly, and analyzed to reveal the phylogenetic relationship of the new species with
other Exserohilum species registered in the DNA Data Bank of Japan (DDBJ; see also
Berbee et al. 1999, Chung et al. 2005). The DNA sequences were aligned using ClustalX
v2.0.7 (Larkin et al. 2007). Phylogenies were generated using distance methods. The
distance matrix for the aligned sequences was calculated using Kimura’s two-parameter
method (Kimura 1980) and was analyzed with the neighbor-joining method (Saitou &
Nei 1987) using ClustalX v2.0.7 (Larkin et al. 2007). The sequences of isolates IM201-p
and IM201-k were registered in DDBJ as AB607956 and AB607957, respectively.
Symptoms
The brown spindle-shaped lesions were usually observed in the center of
the leaves (Fic. 1A, B) but occasionally near the leaf margin (Fic. 1C). Some
lesions elongated along the veins or turned grayish white with brown margins,
producing leaf blight. No sporulation was detected from any lesions under
natural conditions.
Taxonomy
Exserohilum neoregeliae Sakoda & Tsukib., sp. nov. Fic. 1E-G
MycoBank MB 561917
Coloniae in agaro 'V8 succus' cinereae vel brunneae, floccosae. Hyphae pallide brunneae,
ramosae, septatae, laevis. Stromata absentia. Conidiophora singularia, erecta, vel flexuosa,
Exserohilum neoregeliae sp. nov. (Japan) ... 215
Fic. 1. Exserohilum neoregeliae. A-C. Natural symptoms on Neoregelia carolinae; D. Symptoms
on N. carolinae inoculated with IM201-2; E-F Conidia of IM201-D on V8 juice agar;
G. Germinating conidium. Scale bars: E-G, 100 um.
216 ... Sakoda & Tsukiboshi
supra geniculata, laevia vel verruculosa, pallide brunnea, ad 340 um longa, 5-10 ym lata.
Conidia pallide brunnea vel brunnea, concoloria, lepto-obclavata vel rostrata, recta vel
leviter curvata, laevia, ad vel infra septum basale constricta, apex obtusus, basis obconica,
hilo protrudenti, 6-20(-26)-distoseptata, 80.5-285 x 12.5-27 um. In foliis Neoregeliae
carolinae.
Type: NIAESH 20605 (Holotype IM201-D), dry cultura isolated from affected dead
leaves, Narita, Chiba, Japan, 24 May 2006, T. Sakoda, in Herbarium of the Institute
of National Agro-environmental Science, Tsukuba, Japan. Isotype: NIAESH 20606
(IM201-k).
Colonies on V8 juice agar gray to brown, floccose. Hyphae pale brown, branched,
septate, and smooth. Stromata not formed. Conidiophore solitary, straight, or
flexuous, sometimes geniculate above, smooth to verruculose, pale brown, up
to 340 um long, 5-10 um wide. Conidia pale brown to brown, concolorous,
narrowly obclavate or rostrate, straight or slightly curved, smooth, sometimes
constricted at basal septum or below it, apex obtuse, basal cell obconic, with a
distinctly protruding hilum, 6-20(-26)-distoseptate, 80.5-285 x 12.5-27 um
(av. 187.2 x 20.6).
KEY CHARACTERS — The conidial morphology of E. neoregeliae is similar to
that of E. longisporum G.Y. Sun (Sun et al. 1997), E. rostratum (Drechsler) K.].
Leonard & Suggs, E. longirostratum (Subram.) Sivan., and E. minor Alcorn
(Sivanesan 1987) but does show differences (TABLE 1). Although concolorous
and narrowly obclavate or rostrate conidia are common to both, the conidial basal
end cell often bulges slightly in E. longisporum but is obconic in E. neoregeliae.
While the conidial basal end cells are often cut off by thick dark septa in both
E. rostratum and E. longirostratum, in E. neoregeliae all septa are concolorous.
The conidia of E. neoregeliae are broader than those of E. longisporum and
shorter than those of E. longirostratum. The conidia of E. minor are not rostrate
but fusiform, although the obconic basal end cell is especially similar to that of
E. neoregeliae.
Pathogenicity
Approximately twenty days after inoculation, symptoms similar to the
natural ones were reproduced, and inoculated fungi were readily reisolated
from the lesions (Fic. 1D), whereas controls remained symptom-free.
Phylogenetic analysis & discussion
According to the neighbor-joining tree derived from ITS+5.8S rDNA
sequences made in this study, the two E. neoregeliae isolates (AB607956 and
AB607957) form a monophyletic group (100% bootstrap value) close to
E. minor (AF071341) (Fic. 2). However, the 91.6% (489/534 bp) sequence
similarity between E. neoregeliae and E. minor indicates that those two species
clearly differ. Moreover, despite similar conidial morphologies, E. neoregeliae is
Exserohilum neoregeliae sp. nov. (Japan) ... 217
E. fusiforme (AF 163063)
100 E. pedicellatum (AF229478)
5S E. monoceras (AF071340)
64
E. turcicum (AF 163067)
E. longirostratum (AF 163064)
73
96 E. gedarefense (AF 163068)
Fe E. meginnisii (AF081453)
E. rostratum (AF071342)
100 | E. rostratum (AF 163066)
90
E. minor (AF071341)
86 IM201-D (AB607956)
100 | 1M201-E (AB607957)
Cochliobolus heterostrophus (AF 158107)
——} 0.02 substitutions/site
Fic. 2. A neighbor-joining tree inferred from the ITS+5.8S rDNA sequences from 10 Exserohilum
taxa. The number in front of represented isolates shows the bootstrap values in 1000 bootstrap
replicates. The rDNA-ITS accession numbers in DDBJ are shown in parentheses. The length of
branches is proportional to the number of base changes, indicated by the scale bar. Cochliobolus
heterostrophus (AF158107) is outgroup.
in a different clade from E. rostratum and E. longirostratum. Other Exserohilum
species with relatively short or non-rostrate conidia, including E. turcicum
(Pass.) K.J. Leonard & Suggs and E. pedicellatum (A.W. Henry) K.J. Leonard
& Suggs (Sivanesan 1987), were considerably distant from E. neoregeliae. Both
218 ... Sakoda & Tsukiboshi
morphological and phylogenetic evidence supports E. neoregeliae as a new
species of Exserohilum.
Acknowledgments
The authors are grateful to Dr. Meng Zhang (Henan Agricultural University) and
Dr. Wen-Hsin Chung (National Chung Hsing University) for serving as pre-submission
reviewers. We also express our deep thanks to Dr. Shaun R. Pennycook (Manaaki
Whenua Landcare Research) for nomenclatural review.
Literature cited
Berbee ML, Pirseyedi M, Hubbard S. 1999. Cochliobolus phylogenetics and the origin of known,
highly virulent pathogens, inferred from ITS and glyceraldehyde-3-phosphate dehydrogenase
gene sequences. Mycologia 91: 964-977. http://dx.doi.org/10.2307/3761627
Chung WH,. Tsukiboshi T. 2005. A new species Curvularia from Japan. Mycotaxon 91: 49-54.
Kimura M. 1980. A simple method for estimating evolutionary rates of base substitutions through
comparative studies of nucleotide sequences. J. Mol. Evol. 16: 111-120.
http://dx.doi.org/10.1007/BF01731581
Larkin MA, Blackshields G, Brown MP, Chenna R, McGettigan PA, McWilliam H, Valentin F,
Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. ClustalW and
Clustal X version 2.0. Bioinformatics 23: 2947-2948.
http://dx.doi.org/10.1093/bioinformatics/btm404
Saitou N, Nei M. 1987. The neighbor-joining method: A new method for reconstructing
phylogenetic trees. Mol. Biol. Evol. 4: 406-425.
Sivanesan A. 1987. Graminicolous species of Bipolaris, Curvularia, Drechslera, Exserohilum and
their teleomorphs. Mycological Papers 158: 1-261.
Sun GY, Zhang R, Zhu MQ, Zhang TY. 1997. A new species of Exserohilum from China. Mycol. Res.
101: 776-779. http://dx.doi.org/10.1017/S0953756297003547
Takabayashi S. 1994. Neoregelia L.B. Sm. 1719-1722, in: Y Tsukamoto (ed.). The grand dictionary
of horticulture 2. Shogakukan. Tokyo.
White TJ, Bruns T, Lee SB, Taylor J. 1990. Amplification
and direct sequencing of fungal ribosomal RNA genes for phylogenetics. 315-322, in: M Gelfand
et al. (eds). PCR protocols: A guide to methods and applications. Academic Press, San Diego,
California.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/118.219
Volume 118, pp. 219-230 October-December 2011
Species of Rhytismataceae on Camellia spp.
from the Chinese mainland
JIANG-LIN CHEN’ YING-REN LIN”? CHENG-LIN Hou? & SHI-JUAN WANG?
' School of Life Science, Anhui Agricultural University, &
? School of Forestry & Landscape Architecture, Anhui Agricultural University,
West Changjiang Road 130, Hefei, Anhui 230036, China
* College of Life Science, Capital Normal University,
Xisanhuanbeilu 105, Haidian, Beijing 100048, China
*CORRESPONDENCE TO: [email protected]
ABSTRACT—Six species in five different genera of the Rhytismataceae are reported
from Camellia spp. on the Chinese mainland. Among them Lophodermium sinense on
Camellia sinensis is described as a new species, and Terriera camelliae on C. octopetala is
a new combination, while Bifusella camelliae, Coccomyces sinensis, Hypohelion durum, and
Lophodermium jiangnanense are already known for China. This paper provides descriptions
and a key for all these species as well as illustrations for the new species. All examined
specimens are deposited in the Reference Collection of Forest Fungi of Anhui Agricultural
University, China (AAUF).
Key worps—Rhytismatales, taxonomy, plant pathogens, Theaceae
Introduction
Members of Camellia L. (Theaceae) are evergreen shrubs or trees, with a
total of 280 species distributed in bilateral zones of the Tropic of Cancer in
east Asia, including 238 species in southwestern and south China (Zhang &
Ren 1998). Camellias are economically valuable as ornamentals and sources of
beverages, tea oil, and medicine.
Of the 1072 fungal species known to inhabit Camellia worldwide, only
10 belong in the Rhytismataceae (Farr & Rossman 2011). Cryptomyces theae
Sawada, the first rhytismataceous species recorded on C. sinensis (L.) Kuntze,
was described from Taiwan by Sawada (1919) and later found on the same
host in Japan (Hara 1936). Minter (1982) reported Lophodermium camelliicola
Minter on C. sinensis from India. Kobayashi (2007) recorded L. hysterioides
220 ... Chen & al.
(Pers.) Sacc. (= L. foliicola (Fr.) RE Cannon & Minter) and two Coccomyces
species on C. japonica L. in Japan. Up to now, five species of Rhytismataceae
have been described on Camellia from mainland China (Teng 1933; Hou 2000;
Lin et al. 2001a, 2004a,b). These fungi are mostly plant pathogens leading to
different degrees of economic loss. Lophodermium jiangnanense can cause a
leaf cast of C. oleifera C. Abel (Lin et al. 2004a), while Bifusella camelliae and
Hypohelion durum on C. sinensis can cause serious branch rot (Hou 2000, Lin
et al. 2004b). The present study, based on specimens collected by the authors,
reports one hitherto undescribed species, makes one new combination,
and discusses the four other species known on Camellia from the Chinese
mainland. These records may not be complete, as more rhytismataceous species
on camellias can be expected in this region.
Materials & methods
Macroscopic appearance was described from observations made under the dissecting
microscope at 10-50 x magnification. Reference collection material was rehydrated in
water for 15 min, and 10-15 um thick sections of the fruit bodies were cut using a
freezing microtome. For the observations of outlines of ascomata and conidiomata in
vertical section, sections were mounted in lactic acid or cotton blue with pretreatment
in water. The color of the various structures and of ascospore contents was observed in
water. Gelatinous sheaths surrounding ascospores and paraphyses were examined in
water or 0.1% (w/v) cotton blue in lactic acid. Measurements were made using material
mounted in 5% KOH or Melzer’s reagent and from 30 asci, ascospores, and paraphyses
for each specimen. Line and point integrated illustrations of external shapes and internal
structures of fruit bodies were drawn using a microscopic drawing tube (Panasonic
XSJ-2, Japan).
Taxonomy
Bifusella camelliae C.L. Hou, Mycosystema 19: 7, 2000.
TyPE: CHINA, ANHUI, Yuexi, Wen/ao, alt. ca 1100 m, on Camellia sinensis, 10 May 1992,
C.L. Hou 0210 (AAUF 90085).
ILLUSTRATION: Hou 2000: 8, Fig. 1.
ZONE LINES brown to black-brown, infrequent, thin or slightly broad, sometimes
not closed.
CONIDIOMATA on twigs, scattered. In surface view conidiomata 90-190 x
100-170 um, circular to elliptical, black-brown in the centre and at the edge
of the conidioma, brown elsewhere, flattened or slightly raising the substratum
surface, opening by one apical ostiole. In vertical section subcuticular. CONIDIA
4-6 x ca 1.2 um, cylindrical, hyaline, aseptate.
ASCOMATA scattered in similar positions on the host. In surface view
ascomata 500-1260 x 230-420 um, elliptical, shinning black, edge defined,
slightly raising the substratum surface, opening by a somewhat irregular
Rhytismataceae on Camellia (China) ... 221
longitudinal split nearly extending to the edge of ascoma. Lips absent. In
median vertical section ascomata subcuticular. COVERING STROMA 20-30
um thick near the opening, gradually thinner towards the edge, connecting
to the basal stroma, composed of black-brown textura globulosa-angularis
with cells of 3-5 um diam. BASAL STROMA 5-7 um thick, composed of dark
brown, thick-walled globular and angular cells 3-5 um diam. SUBHYMENIUM
10-15 um thick, consisting of hyaline textura intricata. PARAPHYSES slightly
exceeding the asci, 1.5-2 um wide, filiform, septate, sometimes swollen to 3-5
um at the apex, covered with a thin mucous coating. AscI ripening sequentially,
70-100 x 12.5-14 um, clavate, short-stalked, nearly truncate-conical to obtuse
at the apex, J-, 8-spored. AscosporEs biseriate or multiseriate, 19-25 x 2.5-4
um, bifusiform, isthmus ca 1 um wide, hyaline, aseptate, with a 0.8-2 um thick
gelatinous sheath.
HOsT SPECIES, HABITAT, AND DISTRIBUTION: Camellia sinensis; producing
conidiomata and ascomata in lesions on decaying and dying twigs. Known only
from Anhui Province, China.
SPECIMENS EXAMINED: On Camellia sinensis: CHINA, ANHUI Mt Guniujiang, alt. ca
1600 m, 2 July 2006, Y.R. Lin, S.J. Wang 2104 (AAUF 68212); Mt Tiantangzhai, alt. ca
1200 m, 23 June 2009, J.L. Chen, X.M. Gao 5294 (AAUF 71402).
CoMMENTS—Bifusella tsugae H.S. Cao & C.L. Hou, closely related to B. camelliae,
differs in having ascospores with a wider isthmus, paraphyses not swollen at
the apex, absence of zone lines, and occurrence on needles of Tsuga chinensis
(Franch.) E. Pritz. (Cao et al. 1996, as T! tchekiangensis).
Bifusella camelliae can cause a serious branch rot of the tea plant in regions
where the specimens were collected, the damage of branch tips exceeding 85%
in the tea garden where the disease occurs. It may therefore pose a threat to the
tea-growing industry. According to our observations, this fungus infects new
twigs, gradually causing brown to grey-yellow lesions where conidiomata and
ascomata are successively produced. Between May and June of the second year,
ascomata mature to discharge ascospores, leading to the next infection.
Coccomyces sinensis Y.R. Lin & Z.Z. Li, Mycosystema 20: 3, 2001.
TyPE: CHINA, HUNAN, Changsha, Yuelushan, alt. ca 300 m, on Camellia oleifera, 24 June
1990, Y.R. Lin et al. 0521b (AAUF 66629b).
ILLUSTRATION: Lin et al. 2001a: 4, Fig. 2.
ZONE LINES grey-black, thin, entirely or partly surrounding the bleached spots.
CONIDIOMATA not observed.
Ascomata on both sides of leaves, mostly on the lower side, crowded, in
subcircular bleached spots. In surface view ascomata 600-1150 um diam.,
triangular to pentagonal, black-brown to black, raising the substratum surface
but depressed in the central region, opening by radial splits to expose a light
222 ... Chen & al.
orange-yellow hymenium. Lips absent. In median vertical section ascomata
intraepidermal. COVERING STROMA 25-32 um thick near the opening,
slightly thinner towards the edge, extending to the basal stroma, black-brown,
composed of 3-6 um diam., thick-walled angular cells. Periphysoids absent.
BASAL STROMA 12-18 um thick, composed of dark brown textura angularis
with thick-walled cells 5-8 um diam. ExcipuLum arising from the inner cells
of the covering stroma, 25-30 um wide above, consisting of several rows of
2-3 um diam., multi-septate hyphae. INTERNAL MATRIX STROMA 20-35 um
thick, gelatinized, consisting of loose textura intricata. SUBHYMENIUM 10-15
um thick, composed of textura porrecta-intricata. PARAPHYSES filiform, 2—2.5
um wide below, abruptly enlarged to 4—6.5 um and subfusoid-ventricose above,
with a subcylindrical, ca 1.5 um wide pointed apex, capped with a mass of
yellow-brown, subcylindrical gel 8-15 x 6-8 um, forming a solid refractive
epithecium 18-25 um thick. Asci ripening sequentially, 110-130 x 5.5-6.5 um,
cylindrical, short-stalked, rounded at the apex, with circumapical thickening,
J-, 8-spored. Ascosporss fasciculate, 60-95 x 1-1.2 um, filiform, hyaline,
aseptate, covered by an inconspicuous gelatinous sheath.
HOsT SPECIES, HABITAT, AND DISTRIBUTION: Camellia cf. japonica (Kirschner
et al. 2009), C. chekiangoleosa Hu, C. oleifera; producing ascomata on dead
leaves. Known from southern China and Taiwan (Kirschner et al. 2009).
SPECIMENS EXAMINED: On Camellia chekiangoleosa: CHINA, ZHEJIANG, Hangzhou,
Liuxia, alt. ca 60 m, 6 August 1990, Y.R. Lin 0727 (AAUF 66835).
On C. oleifera: CHINA, ANHUI, Huangshan Arboretum, alt. ca 550 m, 5 Sep. 2009,
J.L. Chen, S.J. Wang 5317 (AAUF 71425); Fuy1an, Fuzhou Arboretum, alt. ca 320 m,
2 July 1990, Y.R. Lin 0644 (AAUF 66752); GUANGDONG, Guangzhou, South China
Botanical Garden, alt. ca 382 m, 22 June 1990, Y.R. Lin 0515 (AAUF 66623); JIANGXI,
Nanchang People Park, alt. ca 25 m, 28 June 1990, Y.R. Lin 0587 (AAUF 66695).
COMMENTS—Coccomyces sinensis is common on camellias in southern
China and was also found recently on fallen leaves of Camellia cf. japonica
in Taiwan (Kirschner et al. 2009). It is very similar in the shape of its
paraphyses (subfusoid-ventricose and pointed apices) to C. mucronatus Korf &
W.Y. Zhuang on Fagaceae, which differs in polygonal to subcircular ascomata,
much narrower asci (4.3-5 um) and ascospores (0.6-0.8 wm), dense
periphysoids, and paraphyses lacking refractive solid gel at the apex (Korf &
Zhuang 1985). Coccomyces urceoloides Spooner, which also somewhat resembles
C. sinensis in paraphyses capped with a mass of subhyaline or yellowish solid
gel and measuring 6-12 x 5-8 um, differs in other aspects (Spooner 1990).
Hypohelion durum Y.R. Lin, C.L. Hou & S.J. Wang, Mycosystema 23: 169, 2004.
TyPE: CHINA, ANHUI, Yuexi, Wen/ao, alt. ca 1100 m, on Camellia sinensis, 27 May 1994,
C.L. Hou 0014 (AAUF 66122).
ILLUSTRATION: Lin et al. 2004b: 170, Fig. 1.
Rhytismataceae on Camellia (China) ... 223
ZONE LINES brown to dark brown, infrequent, narrow to broad, somewhat
diffused.
CONIDIOMATA on twigs, usually crowded. In surface view conidiomata
90-230 um diam., subcircular, black-brown in the centre and at the perimeter
line, brown elsewhere, somewhat raising the substratum surface. In vertical
section subcuticular. UPPER WALL 3-5.5 um thick, dark brown, consisting of
small angular cells. BASAL WALL 5-7 um thick, black-brown. CONIDIOGENOUS
CELLS 7.5-12 x 2—2.5 um, flask-shape. CONIDIA 4.5—-6.5 x 0.8-1 um, cylindrical,
hyaline, aseptate.
Ascomarta in similar positions to conidiomata on the substratum, scattered
to crowded in yellow-brown to grayish-white lesions. In surface view ascomata
450-950 x 260-400 um, elliptical or broad-elliptical, black, with a clear outline,
slightly raising the substratum surface, opening by a longitudinal split. Lips
absent. In median vertical section ascomata subcuticular. COVERING STROMA
20-28 um thick near the opening, slightly thinner towards the edge and
extending to the basal stroma, composed of textura angularis-epidermoidea
with black-brown or brown, thick-walled cells 4-6 um diam. BASAL STROMA
12-18 um thick, composed of 4.5-7 um diam., black-brown, thick-walled
angular and elongate cells. The triangular space between the covering and
basal stroma is filled with grey-brown rather thin-walled, large angular cells.
SUBHYMENIUM 18-25 um thick, consisting of textura porrecta. PARAPHYSES
110-135 x 1.5-2 um, filiform, swollen to 2.5-3.5 um above, surrounded by a
ca 1.5 um thick gelatinous matrix. Asci ripening sequentially, 75-115 x 13-16
um, clavate, somewhat long-stalked, apex rounded to subtruncate, J-, 8-spored.
AscosporEs more or less biseriate, 18-25 x 3-4 um, cylindrical to subclavate,
hyaline, aseptate, with a conspicuous gelatinous sheath 4-6 um thick.
HOST SPECIES, HABITAT, AND DISTRIBUTION: Camellia sinensis; producing
conidiomata and ascomata in lesions on decaying and dying twigs. Common
in southern China.
SPECIMENS EXAMINED: On Camellia sinensis: CHINA, ANHUI, Huangshan Arboretum,
alt. ca 550 m, 20 Oct. 2001, Y.R. Lin et al. 1785 (AAUF 67893); Huangshan Arboretum,
alt. ca 550m, 5 Sep. 2009, J.L. Chen, S.J. Wang 5322 (AAUF 71430); JIANGSU, Nanjing,
alt. ca 90 m, 10 April 1973, DJ. Lu 1308 (AAUF 67416).
CoMMENTS— Hypohelion durum is rather distinctive. It is consistent with
typical features of the genus except for the presence of basal stroma and yet is
far from genera such as Hypoderma De Not. Hypohelion scirpinum (DC.) P.R.
Johnst. is similar but differs by its much larger ascomata (800-3000(-—7000) x
500-800 um) and ascospores with a median septum (40-75 x 4.5-6.5 um), the
absence of dark basal stroma, and its occurrence in marshes on Scirpus spp.
(Johnston 1990). A strong parasite that is common on tea plants in southern
China, H. durum can cause different degrees of branch rot (Lin et al. 2004b).
224 ... Chen & al.
Lophodermium jiangnanense Y.R. Lin & S.J. Wang, Mycosystema, 23: 15, 2004.
Type: CHINA, HUNAN, Changsha, Yuelushan, alt. ca 300 m, on C. oleifera, 24 June 1990,
Y.R. Lin 0521a (AAUF 66629a).
ILLUSTRATION: Lin et al. 2004a: 16, Fig. 2.
ZONE LINES absent.
ConripDIOMATA mostly hypophyllous, usually crowded. In surface view
conidiomata 130-220 um diam., subcircular, black-brown in the centre and at
the perimeter line, brown elsewhere. In vertical section subepidermal. CONIDIA
not observed.
Ascomarta on both sides of leaves, predominantly on the lower side, crowded
in grey-yellow, circular to irregular, bleached spots. In surface view ascomata
600-990 x 280-360 um, elliptical or occasionally 3-lobed, black, slightly shiny,
edge defined, raising the substratum surface, opening by a longitudinal split
which is sometimes branched. Lips absent. In median vertical section ascomata
subepidermal. COVERING STROMA 18-30 um thick, extending to the basal
stroma, composed of grey-brown, thick-walled, angular and elongate cells
3-3.5 um diam., markedly black and brittle near the opening, with several rows
of almost colorless, septate, cylindrical thin-walled cells occurring on the inner
side of the upper margin of the covering stroma. BASAL STROMA 15-28 um
thick, composed of 4—7 um diam., black-brown, thick-walled angular cells. The
triangular space between the covering and basal stroma is filled with a hyaline,
gelatinized reticulate tissue. SUBHYMENIUM 15-20 um thick, consisting of
textura porrecta. PARAPHYSES ca 1.5 um wide, filiform, septate, often gradually
swollen to 2—2.5 um, twisted and intertwined above to form a yellow epithecium
10-15 um thick. Asci ripening sequentially, 95-130 x 6-7.5 um, cylindrical,
rounded at the apex, J-, 8-spored. Ascosporss fasciculate, 60-90 x 1.4-1.6
um, filiform, hyaline, aseptate, with a 0.8-1 um thick gelatinous sheath.
HOsT SPECIES, HABITAT, AND DISTRIBUTION: Camellia oleifera; forming
conidiomata and ascomata on dead part of living leaves or on fallen leaves.
Known from Hunan, Anhui, and Guangdong Provinces, China.
SPECIMENS EXAMINED: On Camellia oleifera: CHINA, ANHUI Guichi, Forest Nursery of
Guichi, alt. ca 600 m, 11 Oct. 1992, Q.S. Liu, Q. Cao 1640 (AAUF 67748); Huangshan,
Renzipu, alt. ca 660 m, 6 Sept. 2009, J.L. Chen, Y.R. Lin 5345 (AAUF 71453);
GUANGDONG, Guangzhou, South China Botanical Garden, alt. ca 382 m, 22 June 1990,
Y.R. Lin 0515b (AAUF 66623b).
CoMMENTS—Lophodermium jiangnanense resembles L. intricatum Spooner,
which differs in its association with zone lines, much larger ascomata
(1000-1200 x ca 500 um) and asci (135-152 x 7-7.5um) with truncate-
conical apices, longer ascospores with a median septum, and much-branched
paraphyses (Spooner 1991). This fungus usually produces fruit bodies on
fallen C. oleifera leaves, but the collection from Anhui Province (AAUF 67748)
shows that it primarily infects living leaves and develops fruit bodies in yellow-
Rhytismataceae on Camellia (China) ... 225
brown to yellowish-white spots near the margin of leaves on which an obvious
brown ridged zone between the healthy and sick areas has formed. It is often
accompanied by Coccomyces sinensis, sometimes growing on the same leaves
(Lin et al. 2004a).
Lophodermium sinense Y.R. Lin, C.L. Hou & Jiang L. Chen, sp. nov. Fics. 1-7
MycoBANnk 561775
Ascomata amphigena, dispersa vel aggregata, (290—)400-730 x (150-)220-290 um,
elliptica, interdum triloba, atra, labiis carentia, ab rima longitudinali vel lobis ternis
aperientia, partim subcuticularia et partim intraepidermalia, cellulis epidermalibus
plus quam 4 successive in stromate basali ordinatis. Paraphyses filiformes, prope apicem
plerumque gradatim tumidae et semel aut iterum ramosae, necnon epithecium formantes.
Asci in successione maturescentes, 80-120 x 6-7 um, cylindrici, brevi-stipitati, J-, 8-spori.
Ascosporae 50-95 x 1.2-1.5 ym, filiformes, hyalinae, aseptatae, vagina gelatinosa 1-1.5
um crassa indutae.
Type: China, Anhui, Mt Guniujiang, alt. ca 1600 m, on leaves of Camellia sinensis, 10
July 2006, Y.R. Lin, S.J. Wang 2103 (Holotype AAUF 68211).
ETyMo_ocy: referring to the country where the specimen was collected.
ZONE LINES absent.
ConipiomaTA on both sides of leaves, scattered to crowded, occasionally
merging into one another. In surface view conidiomata 80-160 um diam.,
circular or subrounded, black-brown in the centre, more or less concolorous
with the substratum surface elsewhere, slightly raising the leaf surface,
discharging spores through a 10-15 um diam. apical ostiole. In vertical section
subcuticular. UPPER WALL only present around the ostiole. BASAL WALL absent.
SUBCONIDIOGENOUS LAYER ca 7 um thick, composed of light thin-walled
angular cells. CONIDIOGENOUS CELLS 6-9 x 2-3 um, cylindrical, slightly
tapering towards the apex, hyaline, proliferating sympodially. Conrp1a 4-6 x 1
uum, cylindrical, hyaline, aseptate.
Ascomarta in similar positions to conidiomata on the substratum, scattered
or crowded in subcircular to irregular, yellow-brown bleached spots 5-15
mm diam. In surface view ascomata (290-)400-730 x (150—)220-290 um,
elliptical, sometimes curved or 3-lobed, with a clear outline, ends rounded or
obtuse, matt black except for a grey-brown area at each end, strongly raising the
substratum surface, opening by a longitudinal split more than 4/5 the length
of the ascoma, which is sometimes branched, to expose a light yellow-brown
hymenium. Lips absent. In median vertical section ascomata subcuticular near
the opening and intraepidermal in the lower part of the covering stroma, more
than four epidermal cells being displaced and lying always successively on the
basal stroma. COVERING STROMA 12-20 um thick, black-brown, connecting
to the basal stroma, composed of textura angularis-globulosa with thick-
walled cells 2-5 um diam., markedly black and brittle near the opening, with
226 ... Chen & al.
fo
2a"
as
i
are
seer as
eet
a.
3
5
$
ie
x
ee
oY
ad.
V7
fee
Ri
gua
Oe
oe
6 ox
TES
fee
ae,
amet
4 SSX QEDY
OVERS
Fics. 1-7. Lophodermium sinense on Camellia sinensis. 1. A leaf bearing fruit bodies. 2. Ascomata
and conidiomata observed under a dissecting microscope. 3. Ascoma in median vertical section.
4, Detail of ascoma in median vertical section. 5. Paraphyses, asci and ascospores. 6. Conidioma in
vertical section. 7. Conidiogenous cells and conidia.
Rhytismataceae on Camellia (China) ... 227
4-5 rows of light thin-walled cells occurring on the inner side of the upper
margin of the covering stroma. BASAL STROMA slightly concave or nearly flat,
10-18 um thick, black-brown, composed of 2-3 layers of thick-walled angular
cells 2.5-5.5 um diam. The triangular space between the covering and basal
stroma filled is with 5-8 um diam., light grey-brown, slightly thick-walled
angular cells. SUBHYMENIUM 10-18 um thick, consisting of textura angularis-
porrecta. PARAPHYSES 1-1.5 um wide, filiform, hyaline, septate, covered in a
thin mucous coating 1.5-2 um thick, often gradually swollen to 2-3 um and
1-2 times branched near the apex, contorted and intertwined to above form
a conspicuous epithecium 12-24 um thick. Ascr ripening sequentially, 80-20
x 6-7 um, cylindrical, short-stalked, apex rounded, thin-walled, without
circumapical thickening, J-, 8-spored. Ascosporgs arranged fasciculately or
somewhat helically, 55-95 x 1.2-1.5 um, filiform, slightly tapering towards the
base, hyaline, aseptate, with a 1-1.5 um thick gelatinous sheath.
HOST SPECIES, HABITAT, AND DISTRIBUTION: Camellia sinensis; ascomata
develop on living leaves but are seen in a mature condition only on fallen leaves.
Known only from the type locality, Anhui, China.
ComMMENTS—Lophodermium sinense is very similar to L. jiangnanense on
the same plant genus, but the latter has larger subepidermal ascomata and
conidiomata, unbranched paraphyses, a covering stroma comprising aliform
and elongate cells, and a well developed basal stroma with hyaline reticulate
tissue in the corner between the covering and basal stroma (Lin et al. 2004a).
Lophodermium intricatum is also similar to the new species but differs in its
much larger ascomata, asci, and ascospores, asci with truncate-conical apices,
ascospores with a median septum and without a gelatinous sheath, and the
presence of zone lines (Spooner 1991). Lophodermium implicatum Y.R. Lin
& Z.S. Xu differs in possessing intraepidermal ascomata associated with dark
brown zone lines, shorter ascospores, and intraepidermal conidiomata with
trichogynes (Lin et al. 2001b).
Lophodermium sinense is a pathogen causing leaf spot. The fungus at first
probably develops within the living leaves but visible symptoms do not show,
after which the anamorphic and teleomorphic fruit bodies sequentially appear
on brown lesions of infected leaves as the vitality of the host declines. Diseased
leaves become reddish-brown and fall between July and August. Mature
ascomata have been observed only on fallen leaves.
Terriera camelliae (Teng) Y.R. Lin & Jiang L. Chen, comb. nov.
MycoBAnk 561774
= Lophodermium camelliae Teng, Sinensia 4: 138, 1933
= Clithris camelliae (Teng) Tehon, Mycologia 31: 675, 1939
= Colpoma camelliae (Teng) Teng, Fungi of China: 759, 1963
228 ... Chen & al.
Type: CHINA, FUJIAN, Fuzhou, on fallen leaves of Camellia sp., Teng 1904 (No.77 in the
Metropolitan Museum, Academia Sinica, Nanking, China).
ILLUSTRATION: Tehon 1939: 682, Fig. 6.
ZONE LINES grey-brown, infrequent, thin, entirely or partly surrounding the
bleached spots.
CONIDIOMATA amphigenous, crowded. In surface view conidiomata 70-130
um diam., subcircular to irregular, flattened, black-brown in the centre and at
the perimeter line of the conidioma, grey-brown elsewhere. In vertical section
intraepidermal to subepidermal. Upper wall only present around the ostiole.
BASAL WALL 8-12 um thick, composed of brown to dark brown tissue with no
obvious structure. CONIDIA 2.5-4 x ca 0.8 um, cylindrical, hyaline, aseptate.
Ascomarta in similar positions to conidiomata on the substratum, scattered
to crowded in grey-yellow, subcircular to irregular bleached spots. In surface
view ascomata 440-870(-1020) x 290-490 um, elliptical or occasionally 3-
lobed, black-brown to black, slightly shiny, edge defined, moderately raising
the substratum surface, opening by a longitudinal split about 4/5-7/8 the length
of the ascoma, which is sometimes branched. Lips absent. In median vertical
section ascomata subepidermal. COVERING STROMA 15-22 um thick near the
opening, slightly thinner towards the edge, extending to the basal stroma,
composed of black-brown, thick-walled angular cells 3-5 um diam. Along the
edge of the ascomatal opening is a 10-15 um thick, flattened extension to the
covering stroma which covers the hymenium, and which comprises markedly
black and brittle carbonized tissue with no obvious cellular structure. BASAL
STROMA composed of 1-2 layers of black-brown, thick-walled, angular to
globular cells. SUBHYMENIUM 12-18 um thick, consisting of textura porrecta.
PARAPHYSES extending 15-30 um beyond the asci, ca 2 um wide, filiform,
sometimes gradually swollen to 2.5-3 um or branched above, septate. Asc
ripening sequentially, 85-120 x 5.5-6.5 um, cylindrical, short-stalked, rounded
at the apex, J-, 8-spored. Ascospores arranged fasciculately or somewhat
helically, 52-80 x 1-1.2 um, filiform, hyaline, aseptate, covered by a ca 0.5 um
thick gelatinous sheath.
HOsT SPECIES, HABITAT, AND DISTRIBUTION: Camellia octopetala Hu,
Camellia sp. (Teng 1933); conidiomata and ascomata were found on fallen
leaves. Known only from Fujian Province, China.
SPECIMENS EXAMINED: On Camellia octopetala: CHINA, Fujian, Fuzhou Arboretum,
alt. ca 320 m, 2 July 1990, Y.R. Lin 0643 (AAUF 66751); 11 June 2009, J.L. Chen, L. Chen
5108 (AAUF 71216).
CoMMENTS—Taxonomic placement of Terrea camelliae has long been
controversial. Teng (1933) originally validly published the fungus as L.
camelliae. Tehon (1939), who examined part of the type (labeled “co-type”
by Teng), felt that it lacked structures characteristic of the Hypodermataceae
Rhytismataceae on Camellia (China) ... 229
(= Rhytismataceae) and transferred it to Clithris (Fr.) Bonord. (= Cenangium
Fr.) in the Helotiaceae Rehm (Kirk et al. 2008). Teng’s later (1963) transfer of
the taxon to Colpoma Wallr. cannot be accepted because Colpoma ascomata
develop on bark (not leaves) and have a well-developed basal stroma.
Eriksson (1970) erected the new genus Terriera B. Erikss. based on the type
species T. cladophila (Lév.) B. Erikss. on Vaccinium myrtillus L. Johnston (2001)
and Ortiz-Garcia et al. (2003) transferred several species to Terriera, including
Clithris arundinacea Penz. & Sacc., C. minor Tehon, Lophodermium fuegianum
Speg., L. javanicum Penz. & Sacc., and L. sacchari Lyon. Terriera differs from
Lophodermium Chevall. by the markedly black and brittle extensions of the
covering stroma and by the thin-walled, prismatic or angular cells in the corner
between the covering and basal stroma. The present species on Camellia sp. and
C. octopetala fits closely the characters of Terriera based on the illustration by
Tehon (1939) and examinations carried out by the authors. Consequently, we
redispose it as T. camelliae.
There are some signs that T: camelliae may be a pathogen associated with
leaf cast of eight-petaled Camellia species.
Key to species of Rhytismataceae on Camellia from the Chinese mainland
LAs PASCOMIATA ONG NIG G4, 44, tale hen naire wea hey Wey ng weet gag nae Bey ngt tiny as bg cake yng gts a 2
LbeAScomate Ghuleaves> Buck. takin wees, eae My ott hohe AN dhs We ih8 Bk Seen Oe Re eens 3
2d ASCOSWORE SIU SH OLE 2% FUN. te ALONG #1 1ane RMS AA Ne A ht Bifusella camelliae
2b. Ascospores cylindrical, elliptical or subclavate .............. Hypohelion durum
3a. Ascomata triangular to pentagonal, opening by radial splits .. Coccomyces sinensis
3b. Ascomata elliptical, opening by a longitudinal split .....................0..0.. 4
4a. Ascomata partly subcuticular and partly intraepidermal § Lophodermium sinense
AD ASCOMALa SHDEPIGCEMIGL: 8.08 wie. 5 UE O2F mE Nt OE tet OL A BO! Ut U8 5
5a. Covering stroma with a markedly black brittle flattened extension covering the
IVT CTUTUTN GS bse as Pe Ss otek = ean 5s leans settee sian le spchea'le We + Terriera camelliae
5b. Covering stroma without such an extension ....... Lophodermium jiangnanense
Acknowledgements
The authors are grateful for the pre-submission comments and suggestions provided
by Dr D.W. Minter and Prof. T.Y. Zhang and for the specimens collected by Dr L. Chen
and Dr X.M. Gao. This study was supported by the National Natural Science Foundation
of China (No. 30870014 and 30770006), the Specialized Research Fund for the Doctoral
Program of Higher Education of China (No. 20070364002), and the Natural Science
Foundation of Anhui Province of China (No. 070411005).
Literature cited
Cao HS, Hou CL, Huang LQ, Ye YQ. 1996. A new species of Bifusella (Rhytismataceae) [in Chinese].
Acta Mycologica Sinica 15: 1-3.
230 ... Chen & al.
Eriksson B. 1970. On Ascomycetes on Diapensales and Ericales in Fennoscandia. 1. Discomycetes.
Symb. Bot. Upsal. 19(4): 1-71.
Farr DF, Rossman AY. 2011. Fungal Databases, Systematic Mycology and Microbiology Laboratory.
ARS, USDA [http://nt.ars-grin.gov/fungaldatabases/fungushost/FungusHost.cfm (viewed
online on 2 April 2011)].
Hara K. 1936. Pathogenic fungi in Japan [in Japanese]. Yokendo. Tokyo. 358 pp.
Hou CL. 2000. A new species of Bifusella on Camellia sinensis [in Chinese]. Mycosystema 19: 7-9.
Johnston PR. 1990. Hypohelion gen. nov. (Rhytismataceae). Mycotaxon 39: 219-227.
Johnston PR. 2001. Monograph of the monocotyledon-inhabiting species of Lophodermium.
Mycol. Pap. 176: 1-239.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi,
10 ed. CAB International. Wallingford. 771 p.
Kirschner R, Hou CL, Chen CJ. 2009. Co-occurrence of Pseudocercospora species and rhytisma-
talean ascomycetes on maple and camellia in Taiwan. Mycol. Progr. 8: 1-8.
http://dx.doi.org/10.1007/s11557-008-0572-2
Kobayashi T. 2007. Index of fungi inhabiting woody plants in Japan. Host, distribution and literature
[in Japanese]. Zenkoku-Noson-Kyoiku Kyokai Publishing Co. Ltd., 1227 p.
Korf RP, Zhuang WY. 1985. Some new species and new records of Discomycetes in China.
Mycotaxon 22: 483-514.
Lin YR, Li ZZ, Xu ZS, Wang JR, Yu SM. 2001a. Studies on the genus Coccomyces from China IV [in
Chinese]. Mycosystema 20: 1-7.
Lin YR, Xu ZS, Li K. 2001b. Two new species of the genus Lophodermium from the Huangshan
mountains [in Chinese]. Mycosystema 20: 457-460.
Lin YR, Xu ZS, Ye GB, Wang SJ. 2004a. Additional species of Lophodermium Chev. from China I [in
Chinese]. Mycosystema 23: 14-17.
Lin YR, Wang SJ, Hou CL. 2004b. Hypohelion durum sp.nov. and Lirula filiformis (Darker) comb.
nov. of Rhytismataceae [in Chinese]. Mycosystema 23: 169-172.
Minter DW, Sharma MP. 1982. Three species of Lophodermium from the Himalayas. Mycologia 74:
702-711. http://dx.doi.org/10.2307/3792855
Ortiz-Garcia S, Gernandt DS, Stone JK, Johnston PR, Chapela IH, Salas-Lizana R, Alvarez-
Buylla ER. 2003. Phylogenetics of Lophodermium from pines. Mycologia 95: 846-859.
http://dx.doi.org/10.2307/3762013
Sawada K. 1919. Descriptive catalogue of the Formosan fungi I. Rep. Dept. Agric. Gov. Res. Inst.
Formosa 19: 1-695.
Spooner BM. 1990. Coccomyces and Propolis (Rhytismataceae) from Mt Kinabalu, Borneo. Kew
Bulletin 45: 451-484. http://dx.doi.org/10.2307/4110513
Spooner BM. 1991. Lophodermium and Hypoderma (Rhytismataceae) from Mt. Kinabalu, Sabah.
Kew Bulletin 46: 73-100. http://dx.doi.org/10.2307/4110745
Tehon LR. 1939. New species and taxonomic changes in the Hypodermataceae. Mycologia 31:
674-692. http://dx.doi.org/10.2307/3754339
Teng SC. 1933. Notes on Hysteriales from China. Sinensia 4: 129-144.
Teng SC. 1963. Fungi of China [in Chinese]. Science Press. Beijing. 808 p.
Zhang HD, Ren SX. 1998. Flora of China, Vol. 49, No. 3, Theaceae [in Chinese]. Science Press.
Beijing. 281 p.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/118.231
Volume 118, pp. 231-235 October-December 2011
A new species of Coccomyces (Rhytismatales, Ascomycota)
from Mt Huangshan, China
Guo-JUN JrA', YING-REN LIN? & CHENG-LIN Hov?
' School of Life Science & ? School of Forestry & Landscape Architecture,
Anhui Agricultural University, West Changjiang Road 130, Hefei, Anhui 230036, China
* College of Life Science, Capital Normal University,
Xisanhuanbeilu 105, Haidian, Beijing 100048, China
*CORRESPONDENCE TO: [email protected]
ABSTRACT—A fungus found on leaves of Osmanthus fragrans from Mt Huangshan in
Anhui Province, China, is described as Coccomyces minimus. The new species is similar
to C. cyclobalanopsis but differs in the extremely small, subepidermal ascomata and in the
presence of conidiomata. The type specimen is deposited in the Forest Fungi Dried Reference
Collection of Anhui Agricultural University, China (AAUF). Both illustration and comments
accompany the description.
KEY woRDs—taxonomy, Rhytismataceae, Oleaceae
Introduction
Coccomyces De Not. is the second-largest genus in the Rhytismataceae
(Rhytismatales, Leotiomycetes, Ascomycota) (Kirk et al. 2008). Members of this
genus are characterized by polygonal to more or less circular ascomata opening
by several radiate or irregular splits, cylindrical to clavate asci, and filiform to
fusiform ascospores, often with gelatinous sheaths (Sherwood 1980; Cannon &
Minter 1986; Johnston 1986, 2000; Spooner 1990; Lin et al. 1994).
Of the 116 Coccomyces species known worldwide (Kirk et al. 2008), 23 have
been reported from China (Korf & Zhuang 1985; Lin 1998; Hou et al. 2006,
2007). They are widely distributed and inhabit leaves, twigs, bark, or wood
of vascular plants, especially Ericaceae, Fagaceae, and Lauraceae (Sherwood
1980). Some species, such as C. guizhouensis Y.R. Lin & B.E. Hu, C. ledi Rehm,
C. leptideus (Fr.) B. Erikss., C. strobi J. Reid & Cain, and C. vilis Syd. et al.,
may cause plant disease of economic significance (Lin et al. 1994, Rehm 1913,
Sherwood 1980, Reid & Cain 1961, Cannon & Minter 1984).
232 ... Jia, Lin & Hou
In the present paper, C. minimus on leaves of Osmanthus fragrans (Thunb.)
Lour. (Oleaceae) from Mt Huangshan in Anhui Province, China, is described
as a new species.
Materials & methods
Pieces of plant material bearing fruit bodies containing asci and ascospores were
selected. Sections of the fruitbodies 10-15 um thick were cut using a freezing microtome
and mounted in water, Melzer’s reagent, 5% KOH, or 0.1% (w/v) cotton blue in lactic
acid for microscopical observation. Gelatinous sheaths surrounding ascospores and
paraphyses were observed in water or cotton blue in lactic acid. Measurements were
made using material mounted in 5% KOH or Melzer’s reagent from more than 20
ascospores, asci and paraphyses per ascoma. Point and line integrated illustrations of
external shapes and internal structures of fruit bodies were prepared using a microscope
drawing device.
Taxonomy
Coccomyces minimus Y.R. Lin, C.L. Hou & GJ. Jia, sp. nov. FIGs. 1-7
MycoBAank 561773
Ascomata amphigena, 300-690 um, trigona usque ad hexagona, per lacinias 3-6
aperientia, subepidermalia. Cellulae labiorum et periphysoidei non visae. Excipulum ex
hyphis septatis aliquantum parallelis constatum, apice 20-25 um crassum. Paraphyses
85-95 x 1.0-1.5 um, filiformes, ad apicem gradatim ad 2-3 ym incrassatae. Asci in
successione maturescentes, 75-88 x 4-5 um, clavati-cylindrici, brevi-stipitati, J-, 8-spori.
Ascosporae 50-72 x 0.8-1.0 um, filiformes, hyalinae, aseptatae, vagina gelatinosa ca 0.8
um crassa indutae.
Type: China, Anhui, Mt Huangshan, Ciguangge, alt. 730 m, on Osmanthus fragrans
leaves, 11 Sept. 2007, Y.R. Lin et al. 2227a (Holotype AAUF 68335a).
ETYMOLOGY: minimus (Latin = very little, smallest), referring to the size of the
ascomata.
ZONE LINES frequent, grey-black or black, thin, entirely or partly surrounding
the bleached spots.
CoNnIDIOMATA developing on both sides of leaves, mostly on the lower
side of the leaf, scattered to crowded. In surface view, conidiomata 100-220
uum diam., rotund or slightly irregular, black-brown in the centre and the
perimeter line of the conidioma, grey-brown elsewhere, somewhat raising the
leaf surface, discharging spores through an apical ostiole. In vertical section,
conidiomata subepidermal, more or less double lens-shaped. UPPER WALL
poorly developed, dark brown, with indefinite structure. BASAL WALL 8-14
um thick, black-brown, strongly black and brittle, consisting of 2-3(—4) layers
of thick-walled angular cells 3-6 um diam. SUBCONIDIOGENOUS LAYER 5-7
um thick, composed of light brown, thin-walled angular cells. TRICHOGYNES
28-36 x 1.5-2 um, subfiliform, septate. CONIDIOGENOUS CELLS 6.5-12 x 2-3
233
Coccomyces minimus sp. nov. (China) ...
7. Coccomyces minimus on Osmanthus fragrans. 1. A leaf bearing fruit bodies. 2. Ascomata
and conidiomata observed under a dissecting microscope. 3. Ascoma in median vertical section.
Fics. 1
4. Detail of ascoma in median vertical section. 5. Paraphyses and asci. 6 Discharged ascospores.
7. Conidioma in vertical section.
234 ... Jia, Lin & Hou
um, flask-shape, holoblastic sympodially proliferating. Conip1a 3-5 x ca 1 um,
cylindrical, hyaline, aseptate.
Ascomara in similar positions on the host, scattered to crowded in yellow-
brown or grey-yellow, irregular bleached spots 5-12 mm diam. In surface view,
ascomata black-brown to black, slightly shiny, triangular to hexagonal, 300-690
um diam., strongly raising the substratum surface but depressed in the central
area, with an obvious performed dehiscence mechanism, opening by 3-6 radial
splits, which nearly extend to the edge of ascoma, to expose the waxy-yellow
hymenium. Lips not seen. In median vertical section, ascomata subepidermal,
150-190 um deep. COVERING STROMA 16-20 um thick near the opening,
slightly thinner towards the edge, connecting to the basal stroma, consisting of
textura angularis-globulosa with dark brown or black-brown, thick-walled cells
3-5 um diam. Periphysoids not seen. BASAL STROMA 12-22 um thick, strongly
black and brittle, composed of textura angularis with 2—3(-4) layers of black-
brown, thick-walled cells 4-6 um diam. INTERNAL MATRIX OF STROMA well
developed, 12-25 um thick, consisting of hyaline, gelatinised textura intricata.
EXCIPULUM arising from the marginal paraphyses, 20-25 um wide above,
becoming thinner towards the base, comprised of rows of hyaline, multi-
septate hyphae. SUBHYMENIUM 10-15 um thick, comprised of hyaline textura
angularis-porrecta. PARAPHYSES 85-95 x 1.0-1.5 um, filiform, not branched,
often gradually swollen to 2-3 um above, covered with aca 1 um thick gelatinous
matrix but not forming an epithecium. ASscI ripening sequentially, 75-88 x 4-5
um, cylindrical-clavate, short-stalked, thin-walled, apex round, J-, 8-spored.
Ascosporss fasciculate, 50-72 x 0.8—1.0 um, hyaline, filiform, aseptate, slightly
tapered towards the base, covered by a ca 0.8 um thick gelatinous sheath.
HOST SPECIES, HABITAT AND DISTRIBUTION: Osmanthus fragrans; producing
conidiomata and ascomata on fallen leaves. Known only from the type locality,
Anhui, China.
COMMENTS—Coccomyces minimus resembles C. cyclobalanopsis Y.R. Lin &
Z.Z. Liin the shape of paraphyses, asci, and ascospores as well as in the color of
the exposed hymenium. However, C. cyclobalanopsis has larger, intraepidermal
ascomata (400-900 um diam.) without conidiomata, a thinner basal stroma
(7-10 um thick), a well-developed subhymenium (20-28 um thick), much
longer paraphyses (110-130 um) and asci (90-115 um), and an upper part of
the excipulum 30-50 um thick arising from inner cells of the covering stroma
(Lin et al. 2000).
Coccomyces multangularis Y.R. Lin & Z.Z. Li is easily distinguished from
C. minimus by its 3-9-sided much larger (500-1100 um diam.) ascomata, the
35-50 um thick upper portion of the excipulum, infrequent periphysoids, and
slightly longer asci (85-105 um) (Lin et al. 2001).
Coccomyces minimus sp. nov. (China) ... 235
The similar C. concolor Sherwood differs in its orbicular ascomata lacking a
performed dehiscence mechanism, the covering stroma comprising 1-2 layers
of loosely interwoven brown hyphae 2-3 um diam. that are not black and
brittle, the thicker (40-50 um) excipulum, the swollen (5-6 um) paraphyses
apices, and the much longer asci (80-120 um) and ascospores (70-100 um)
(Sherwood 1980).
Acknowledgements
Weare grateful to Dr D.W. Minter and Prof. T.Y. Zhang for serving as pre-submission
reviewers, and to Dr L.H. Wang for the identification of the associated plant. The study
was supported by the National Natural Science Foundation of China (No. 30870014
and 30770006), and the Specialized Research Fund for the Doctoral Program of Higher
Education of China (No. 20070364002).
Literature cited
Cannon PF, Minter DW. 1984. Coccomyces vilis. CMI Descr. Path. Fungi & Bact. no. 792.
Cannon PF, Minter DW. 1986. The Rhytismataceae of Indian subcontinent. Mycol. Pap. 155:
1-123.
Hou CL, Piepenbring M. 2007. Two new species of Rhytismataceae on twigs of conifers from
Yunnan Province, China. Mycotaxon 102: 165-170.
Hou CL, Kirschner R, Chen CJ. 2006. A new species and new records of Rhytismatales from Taiwan.
Mycotaxon 95: 71-79.
Johnston PR. 1986. Rhytismataceae in New Zealand 1. Some foliicolous species of Coccomyces de
Notaris and Propolis (Fries) Corda. New Zealand J. Bot. 24: 89-124.
Johnston PR. 2000. Rhytismatales of Australia: the genus Coccomyces. Aust. Syst. Bot. 13: 199-243.
http://dx.doi.org/10.1071/SB98034
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi,
10" ed. CAB International. Wallingford. 771 p.
Korf RP, Zhuang WY. 1985. Some new species and new records of Discomycetes in China.
Mycotaxon 22: 483-514.
Lin YR. 1998. Studies on Coccomyces de Notaris and Neococcomyces gen. nov. in China. [Ph.D.
thesis; in Chinese]. Northeast Forestry University. Harbin. 98 p.
Lin YR, Liu HY, Tang YP, Hu BE 1994. Two new species of the genus Coccomyces from China [in
Chinese]. Acta Mycol. Sin. 13: 8-12.
Lin YR, Li ZZ, Huang CC, Xiang CT. 2000. Studies on the genus Coccomyces from China II [in
Chinese]. Mycosystema 19: 297-301.
Lin YR, Li ZZ, Xu ZS, Wang JR, Yu SM. 2001. Studies on the genus Coccomyces from China IV [in
Chinese]. Mycosystema 20: 1-7.
Sherwood MA. 1980. Taxonomic studies in the Phacidiales: The genus Coccomyces (Rhytismataceae).
Occ. Pap. Farlow Herb. Crypt. Bot. 15: 1-120.
Spooner BM. 1990. Coccomyces and Propolis (Rhytismatales) from Mt Kinabalu, Borneo. Kew
Bulletin 45: 451-484. http://dx.doi.org/10.2307/4110513
Rehm H. 1913. Ascomycetes novi VI. Ann. Mycol. 11: 150-155.
Reid J, Cain RE. 1961. The genus Therrya. Can J.Bot. 39: 1119-1129. http://dx.doi.org/10.1139/b61-098
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/118.237
Volume 118, pp. 237-244 October-December 2011
New records of poaceous rusts from Pakistan
A. IsHAQ’, N.S. AFSHAN”* & A.N. KHALID’
"Department of Botany &*Centre for Undergraduate Studies,
University of the Punjab, Quaid-e-Azam Campus, Lahore, 54590, Pakistan
*CORRESPONDENCE TO: [email protected]
ABSTRACT — Puccinia stipae var. stipae and Uromyces sporobolicola are described and
illustrated as new records for Pakistan. Calamagrostis pseudophragmites for Puccinia sessilis,
Agrostis gigantea for P. recondita, and Dactylis glomerata for P. striiformis are new poaceous
hosts for these rust fungi from Pakistan.
KEY worps — graminicolous, Uredinales, weeds
Introduction
Poaceous weeds are an important competitor of all crop plants worldwide
as well as in Pakistan. Economically important grass species are threatened by
invasive weeds, and several host-specific rust fungi have been used as biological
control agents against certain noxious weeds (Yandoc-Ables et al. 2006). There
are about 158 genera (492 species) of plants from the family Poaceae in Pakistan.
Among the 100 rust species known to infect 130 plant species (Afshan et al.
2010) are 70 species of Puccinia Pers. and 14 species of Uromyces (Link) Unger
(Afshan & Khalid 2009; Afshan et al. 2009, 2010a,b, 2011; Iqbal et al. 2009;
Khalid & Afshan 2009).
In this paper we report Puccinia stipae var. stipae on Stipa sp. and Uromyces
sporobolicola on Sporobolus marginatus as new records and identify new
poaceous hosts for Puccinia sessilis (Calamagrostis pseudophragmite), P. recondita
(Agrostis gigantea), and P. striiformis (Dactylis glomerata) in Pakistan.
Materials & methods
Infected plants with their inflorescences were collected from sampling sites
throughout Pakistan. The rusted specimens were photographed and free hand sections
and scrape mounts of infected portions were observed under the stereomicroscope.
Twenty spores of each spore state found were examined under microscope (Nikon YS
100), and spore dimensions were determined using a Zeiss eyepiece screw micrometer.
238 ... Ishaq, Afshan & Khalid
Sections and spores were photographed by digiporo-Labomed and illustrated using a
Leitz camera lucida (Wetzlar Germany).
Enumeration of taxa
Uromyces sporobolicola J.C. Lindq., Revta Fac. Agron. Vet. Univ. nac. La Plata, Ser.
3, 38: 89 (1963 [“1962”]). Fig. 1
SPERMOGONIA and AECIA not found. URepINniA adaxial, cinnamon-
brown; UREDINIOsPORES light brown to hyaline, echinulate, globose to
subglobose, (19.5-)25-33 x (22-)2-38 um; wall 1.6-2.6 um thick, germ pores
2-4, supraequatorial. TeL1a amphigenous, blackish, covered by the epidermis;
TELIOSPORES 1-celled, brown, ovate, 19-21.5 x 21.5-27 um; apex 2.4-5.4 um
thick, wall 1.4-2 um thick; pedicel short, < 11 um long.
MATERIAL EXAMINED: PAKISTAN, PunyjaB, Sialkot, at 234 m a.s.l., on leaves of
Sporobolus marginatus Hochst. ex A. Rich., stages II + HI, 20 April 2011, AIM # 27
(LAH Herbarium No.1130).
CoMMENTs: Cummins (1971) reported U. sporobolicola, here a new record for
Pakistan, on Sporobolus pyramidatus. Other rusts known to infect Sporobolus
Fic. 1: Uromyces sporobolicola (lucida drawing; scale = 10 um).
A. Urediniospores showing germ pores (arrowed); B. One-celled teliospores.
Poaceous rusts new to Pakistan ... 239
species (S. arabicus, S. coromandelianus) in Pakistan include Puccinia sporoboli-
arabici Afshan et al., P sporoboli-coromandeliani Afshan et al., Uromyces ignobilis
(Syd. & P. Syd.) Arthur and U. tenuicutis McAlpine from Lahore (Ahmad
1956a,b, 1976, Masood et al. 1995) and NWFP (Afshan et al. 2008, 2010a).
Puccinia stipae (Opiz) Arthur, Bull. lowa Agric. Coll. Dept. Bot.: 160 (1884)
var. stipae Fic. 2
Fic. 2: Puccinia stipae var. stipae (lucida drawing; scale = 13 um).
Teliospores showing germ pores (arrows).
SPERMOGONIA, AECIA, & UREDINIA not found. Text1a blackish brown,
adaxial, exposed, compact, 0.14-0.27 x 0.13-0.19 mm. TELIOsPoREs golden
brown, broadly ellipsoid, 23-34 x 45-63 um; wall 1.9-2.6 um thick at the sides,
4.5-8 um thick apically; pedicel long, broken mostly, hyaline, 5.5-9 um wide,
< 112 um long.
MATERIAL EXAMINED: PAKISTAN, GiLGiT & BALTISTAN, Skardu, Shigar valley, at
3000 m a.s.L, on leaves of Stipa sp., stage III, 20 July 2010, AIM # 38 (LAH Herbarium
No.1131).
COMMENTs: (Cummins (1971) previously reported P. stipae var. stipae, here a
new record for Pakistan, on Stipa spartea. Ahmad (1969) reported a different
variety, Puccinia stipae var. stipina (Tranzschel) H.C. Greene & Cummins
(= Puccinia stipina Tranzschel), on Stipa himalaica from Quetta in Pakistan.
240 ... Ishaq, Afshan & Khalid
Fic. 3: Puccinia sessilis var. sessilis (lucida drawings; scale = 14 um).
A. Urediniospores showing echinulate surface ornamentation and germ pores; B. Teliospores.
Puccinia sessilis W.G. Schneid., Jahresber. Schles. Ges. Vaterl. Cult. 49: 19 (1871)
var. sessilis Fic. 3
SPERMOGONIA and AECIA not found. UREDINIA on stipe, brown, naked.
UREDINIOSPORE light brown to hyaline, globose to subglobose, 21-32 x 24-36
um; wall 1.9-2.4 um; germ pores up to 4, scattered or tending to be equatorial.
Poaceous rusts new to Pakistan ... 241
TELIA amphigenous, blackish, covered by epidermis. TELIOsPORE chest nut
brown, 23-32 x 47-68 um; wall 1.5-3 um thick at sides, 6.5-13 um thick
apically, pedicel < 77 um long.
MATERIAL EXAMINED: PAKISTAN, GILGIT & BALTISTAN, Skardu, Shigar valley, at 3000
maz.s.l., on leaves of Calamagrostis pseudophragmites (Haller f.) Koeler, stages II + IIL, 21
July 2010, AIM # 39 (LAH Herbarium No.1132).
ComMENtTs: Khalid & Iqbal (1996) previously reported P. sessilis on leaves
of Phalaris minor from Deosai Plains near Pakora Lake. Calamagrostis
pseudophragmites is a new host for the variety in Pakistan.
Puccinia striiformis Westend., Bull. Acad. Roy. Sci. Belgique 21: 235 (1854)
var. striiformis Fia. 4
SPERMOGONIA and AECIA not found. UREDINIA light brown, adaxial, in linear
series. UREDINIOSPORES globose to subglobose, hyaline, echinulate, 24-31 x
27-36 um; Wall 1.4-2.8 um thick, germ pores 2-many, scattered. PARAPHYSES
Fic. 4: Puccinia striiformis var. striiformis (lucida drawings; scale = 13 um).
A. Paraphyses; B. Urediniospores showing germ pores (arrowed); C. Teliospores.
242 ... Ishaq, Afshan & Khalid
capitate, having cap of 6.5-8.0 um diameter. TELIA blackish, abaxial, sheaths in
linear series, covered by epidermis, with hyaline paraphyses, forming locules.
TELIOSPORES clavate, light brown, 2-celled, 13-19(-22.0) x 34.0-50.0 um;
sometimes upper cell thicker than lower, apex 3.0-7.0(-9.0) um thick, wall
1-2 um thick, pedicel very delicate.
MATERIAL EXAMINED: PAKISTAN, GILGIT & BALTISTAN, Fairy Meadows, at 3036
m a.s.l, on Dactylis glomerata L., stages II + IH, 12 August 2007, AIM # 20 (LAH
Herbarium No.1133).
Comments: Numerous authors have reported P. striiformis var. striiformis
on Triticum aestivum, Hordeum vulgare, and Poa sp. from Quetta, Kalat,
Tandojam, Rawalpindi, Nathia Gali, Shogran (Kaghan valley), and Lahore
(Ahmad 1956a,b, Khan & Kamal 1968, Malik et al. 1968, Malik & Virk 1968,
Kakishima et al. 1993) and on Leersia oryzoides from Fairy Meadows (Afshan
2009). Dactylis glomerata is a new host for the variety in Pakistan.
Puccinia recondita Desm., Bull. Soc. bot. Fr. 4: 798 (1857) Fic. 5
SPERMOGONIA and AEcIA not found. Urepinia abaxial, brown.
UREDINIOSPORES globose to subglobose, hyaline, 15-21 x 17-26 um; walls
1.4-2.6 um thick, echinulate; germ pores 2—many, scattered. TeL1A abaxial,
black, covered by epidermis, 0.1-0.2 x 0.04-0.05 mm. TELIospores light
Fic. 5: Puccinia recondita (lucida drawings; scale = 13 um).
A. Urediniospores showing germ pores; B. Teliospores.
Poaceous rusts new to Pakistan ... 243
brown to hyaline, clavate, 2-celled, 13-19(-21) x 38-52 um; wall 1.6-2.4 um
thick, apex 3-6 um thick; pedicel very delicate.
MATERIAL EXAMINED: PAKISTAN, KHYBER-PAKHTUNKHAWAH (KPK), Sharan, at
2752 m a.s.l., on Agrostis gigantea Roth, stages II + HI, 27 July 2007, AIM # 19 (LAH
Herbarium No.1134).
COMMENTS: Agrostis gigantea is a new host from Pakistan for Puccinia recondita,
which has previously been reported on Agropyron sp., Aquilegia fragrans,
A. pubiflora, Brachypodium sp., Eremopyrum bonaepartis, Lolium perenne,
Triticum aestivum, and Thalictrum minus from Swat, Kaghan valley, Ayubia,
Tandojam, Shogran to Sari, Sharan, Murree, Faisalabad, and Quetta (Ahmad
1956a, Hasnain et al. 1959, Jorstad & Iqbal 1967, Ghaffar & Kafi 1968, Khan &
Kamal 1968, Malik & Virk 1968, Malik et al. 1968, Ahmad & Arshad 1972, Ono
1992, Ono & Kakishima 1992).
Acknowledgements
We sincerely thank Dr. Abdul Rehman Niazi (Department of Botany, University
of the Punjab, Lahore, Pakistan) and Dr. Omar Paino Perdomo (Dominican Society
of Mycology, Santo Domingo, Dominican Republic) for their valuable suggestions to
improve the manuscript and acting as presubmission reviewers. We are also thankful to
Dr. Shaun Pennycook, Nomenclature Editor, for reviewing the manuscript critically.
Literature cited
Afshan NS. 2009. A contribution to the rust flora of AJ & K (Azad Jammu & Kashmir) and adjacent
Northern Areas of Pakistan. Ph.D. Thesis, Department of Botany, University of the Punjab,
Lahore, Pakistan.
Afshan NS, Khalid AN. 2009. New records of Puccinia and Pucciniastrum from Pakistan. Mycotaxon
108: 137-146. http://dx.doi.org/10.5248/108.137
Afshan NS, Khalid AN, Niazi AR. 2008. New records and distribution of rust fungi from Pakistan.
Mycotaxon 105: 257-267.
Afshan NS, Khalid AN, Iqbal SH, Niazi AR, Sultan A. 2009. Puccinia subepidermalis sp. nov. and
new records of rust fungi from Pakistan, Mycotaxon 110: 173-182.
http://dx.doi.org/10.5248/110.173
Afshan NS, Khalid AN, Niazi AR. 2010a. Three new species of rust fungi from Pakistan. Mycological
Progress 9: 485-490. http://dx.doi.org/10.1007/s11557-010-0655-8.
Afshan NS, Khalid AN, Iqbal SH, Niazi AR, Sultan A. 2010b. Puccinia anaphalidis-virgatae, a new
species and a new variety of rust fungi from Fairy Meadows, Northern Pakistan. Mycotaxon
112: 483-490. http://dx.doi.org/10.5248/112.483
Afshan NS, Khalid AN, Niazi AR, Iqbal SH. 2011. New records of Uredinales from Fairy Meadows,
Pakistan. Mycotaxon 115: 203-213. http://dx.doi.org/10.5248/115.203
Ahmad 8.1956a. Uredinales of Pakistan. Biologia 2: 29-101.
Ahmad S. 1956b. Fungi of Pakistan. Biological Society of Pakistan, Lahore Monograph 1: 1-126.
Ahmad S. 1969. Fungi of Pakistan. Biological Society of Pakistan, Lahore, Monograph 5, Suppl. 1.
110 p.
Ahmad S. 1976. Contribution to the fungi of Pakistan. XVII. Sultania 2: 17-21.
Ahmad §, Arshad M. 1972. Contribution to the fungi of West Pakistan. XV. Biologia 18: 113-119.
244 ... Ishaq, Afshan & Khalid
Cummins GB. 1971. The rust fungi of cereals, grasses and bamboos. Springer Verlag, Berlin-
Heidelberg—New York.
Ghaffar A, Kafi A. 1968. Fungi of Karachi. Pak. J. Sc. 20: 5-10.
Hasnain SZ, Khan A, Zaidi AJ. 1959. Rust and smut of Karachi. Department of Botany, University
of Karachi, Monograph 2, 36 p.
Iqbal SH, Afshan NS, Khalid AN, Niazi AR, Sultan A. 2009. Additions to the rust fungi of Fairy
Meadows, Northern Areas of Pakistan. Mycotaxon 109: 1-7. http://dx.doi.org/10.5248/109.1
Jorstad I, Iqbal SH. 1967. Uredinales from West Pakistan. Nytt. Mag. Bot. 14: 31-38
Kakishima M, Okane I, Ono Y. 1993. Graminicolous rust fungi (Uredinales) from Pakistan.
181-186, in: Nakaike & Malik (eds). Cryptogamic flora of Pakistan, vol.2. Nat. Sci. Mus.,
Tokyo.
Khalid AN, Afshan NS. 2009. Additions to the graminicolous rust fungi of Pakistan. Mycotaxon
108: 175-183. http://dx.doi.org/10.5248/108.175
Khalid AN, Iqbal SH. 1996. Addition to the rust flora of Pakistan. Pak. J. Bot. 28(1): 115-117.
Khan SA, Kamal M. 1968. The fungi of South West Pakistan. Part I. Pak. Jour. Sci & Ind. Res. 11:
61-80.
Malik SA, Virk. 1968. Contribution to knowledge of parasitic fungi of Quetta-Kalat Region.
Biologia 14: 27-35.
Malik SA, Javaid MT, Khan MA. 1968. Uredinales of Quetta-Kalat region of Pakistan. Biologia 14:
37-46.
Masood A, Khalid AN, Iqbal SH. 1995. New records of graminicolous rust fungi (Uredinales) from
Pakistan. Sci. Int. 7(3): 415-416.
Ono Y. 1992. Uredinales collected in the Kaghan Valley, Pakistan. Cryptogamic flora of Pakistan
1: 217-240.
Ono Y, Kakishima M. 1992. Uredinales collected in the Swat Valley, Pakistan. Cryptogamic flora of
Pakistan 1: 197-216.
Yandoc-Ables CB, Rosskopf EN, Charudattan R. 2006. Plant pathogens at work: progress
and possibilities for weed biocontrol. Plant Pathology Department, University of Florida,
Gainesville, FL. The American Phytopathological Society.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.245
Volume 118, pp. 245-250 October-December 2011
New records of smut fungi. 5
CvVETOMIR M. DENCHEV' , TEODOR T. DENCHEV'
& BRIAN M. SPOONER?
‘Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Sciences,
2 Gagarin St., 1113 Sofia, Bulgaria
*Mycology Section, Royal Botanic Gardens, Kew, Richmond, Surrey, TW9 3AB, U.K.
* CORRESPONDENCE TO: [email protected]
ABSTRACT — Morphological study of an anthericolous smut fungus on Scilla sardensis
(Chionodoxa sardensis) and S. luciliae (Chionodoxa luciliae) from UK has shown it to
represent Antherospora scillae. This is also known in UK on Scilla verna and S. forbesii,
new host records for this species. The new species, Urocystis bolboschoeni on Bolboschoenus
maritimus, is described and illustrated from UK.
Key worps — taxonomy, Urocystidales, Ustilaginomycetes
Introduction
In the current taxonomic scheme of the Ustilaginomycetes, the genus Ustilago
is restricted to species parasitizing plants of Poaceae (Vanky 1999, 2002).
For species on Liliaceae s. lat. previously referred to Ustilago, Ershad (2000)
erected a new genus, Vankya, with three species: V. heufleri (Fuckel) Ershad
on Erythronium and Tulipa; V. ornithogali (J.C. Schmidt & Kunze) Ershad on
Gagea; and V. vaillantii (Tul. & C. Tul.) Ershad on Albuca, Bellevalia, Eucomis,
Hyacinthus, Muscari, Puschkinia, Scilla (including Chionodoxa), and Urginea.
Vankya was later restricted to the species on leaves and stems of liliaceous
plants: V. heufleri, V. ornithogali, and the recently described V. lloydiae Vanky
on Lloydia triflora (Ledeb.) Baker (Vanky 2009a). For the anthericolous smut
fungus Vankya vaillantii s. lat. on plants of Asparagaceae (syn. Hyacinthaceae;
Liliaceae p.p.), Bauer et al. (2008) described a new genus, Antherospora, with
seven species: A. albucae (Syd. & P. Syd.) R. Bauer et al. on Albuca, A. peglerae
(Bubak et al.) R. Bauer et al. on Ornithogalum, A. scillae on Scilla bifolia L.,
A. tourneuxii (A.A. Fisch. Waldh.) R. Bauer et al. on Bellevalia, A. urgineae
(Maire) R. Bauer et al. on Urginea, A. vaillantii (Tul. & C. Tul.) R. Bauer et al.
246 ... Denchey, Denchev & Spooner
on Muscari, and the cryptic species A. vindobonensis R. Bauer et al. on Scilla
vindobonensis Speta. An eighth species, A. eucomis Vanky on Eucomis, was
added by Vanky (2009b). The narrow host association of these anthericolous
smut fungi (Bauer et al. 2008, Vanky 2009b) warranted closer study of the
morphology of Antherospora species on Chionodoxa (currently treated as
members of Scilla). The result of this study is presented here.
In June 2010, two specimens of Urocystis in leaves of Bolboschoenus maritimus
were collected by Mr N.W. Legon in South Devon, England. No Urocystis has
been previously recorded on Bolboschoenus nor on plants of related genera
(Scirpus, Holoschoenus, Isolepis, Schoenoplectus, Trichophorum). We consider
those specimens as belonging to a new species, described below.
Material & methods
Dried specimens from the mycological collection of the Royal Botanic Gardens, Kew
[K(M)] were examined under light (LM) and scanning electron (SEM) microscopes. For
LM observations, spores were mounted in lactophenol solution on glass slides, gently
heated to boiling point to rehydrate the spores, and then cooled. Spore measurements
are given in the form: min-max [mean + | standard deviation]. In the description, the
total number of spores (n) from all collections (x) measured are given in the form “(n/x).
For SEM, spores were attached to specimen holders by double-sided adhesive tape and
coated with gold with an ion sputter. The surface structure of spores was observed at 10
kV and photographed with a JEOL JSM-5510 scanning electron microscope.
Taxonomy
Antherospora scillae (Cif.) R. Bauer et al., Mycol. Res. 112: 1301, 2008. FIGs 1-4
Sori in the anthers and on the surface of anther filaments. Spore mass
powdery, dark olivaceous brown. INFECTION systemic, all anthers are infected.
Spores variable in shape, globose, subglobose, broadly ellipsoidal, ovoid,
elongated or slightly irregular, sometimes pyriform, 7-12.5 x 6.5-9.5 [9.4 + 1.2
x 7.8 + 0.8] um (n/, = 200), light olivaceous brown; wall even, 0.7—1.0 um thick,
densely verruculose.
SPECIMENS EXAMINED — On Scilla sardensis (Whittall ex Barr & Sugden) Speta: UK,
ENGLAND, Surrey, Kew, Royal Botanic Gardens, 21 April 1947, leg. G.M. Waterhouse
[ex herb. University of Sheffield, no. 764; IMI 15342] (as Ustilago vaillantii on Chionodoxa
sardensis Whittall ex Barr & Sugden, K(M) 116304). — On Scilla luciliae (Boiss.) Speta:
UK, ENGLAND, Surrey, Kew, Royal Botanic Gardens, near Lion Gate, 23 March 1954,
leg. R.W.G. Dennis (as Ustilago vaillantii on Chionodoxa luciliae Boiss., K(M) 69569).
ComMENts — ‘The study of this fungus on these two hosts was provoked by
the high host specialization amongst Antherospora species infecting Scilla
with the presumption that A. scillae is restricted to Scilla bifolia as suggested
by Bauer et al. (2008: 1302). Bauer et al. (2008) described both Antherospora
scillae on Scilla bifolia and A. vindobonensis on Scilla vindobonensis as having
Smut fungi 5 — Urocystis bolboschoeni sp. nov. ... 247
ve)
6 .
"Ss oe.
6S.
Figs 1-4. Spores of Antherospora scillae. 1-2 on Scilla luciliae (K(M) 69569) in LM,
3 on S. sardensis (K(M) 116304) in SEM, 4 on S. luciliae (K(M) 69569) in SEM.
Scale bars: 1-2 = 10 um, 3 = 2 um; 4=5 um.
248 ... Denchey, Denchev & Spooner
Fics 5-8. Spores of Urocystis bolboschoeni on Bolboschoenus maritimus.
1-2 in LM (holotype), 3 in SEM (K(M) 166454), 4 in SEM (holotype).
Scale bars: 5-8 = 10 um.
Smut fungi 5 — Urocystis bolboschoeni sp. nov. ... 249
spore walls with a thickness of ca 0.5 um. The specimens we examined on Scilla
sardensis and S. luciliae have spores with a thicker wall (0.7-1.0 um wide), and
it seemed warranted to make additional observations of the spore wall on S.
bifolia. We found that the spore wall thickness of two specimens on S. bifolia
measured 0.7-0.9 um (Vanky Ustilag. exs. no. 57) and 0.8-1.1 um (SOMF
19206). Additionally, Vanky (2009b) cited a spore wall thickness of 0.8-1.5 um
for Antherospora scillae. Our spore measurements from four specimens of A.
scillae on Scilla bifolia (Vanky Ustilag. exs. no. 57; SOMF 2859, 2888, & 19206)
(7-14.5 x 6.5-10 [9.8 + 1.1 x 8.5 + 0.7] um; n/, = 350) resembled those of the
British specimens we examined.
ADDITIONAL SPECIMENS EXAMINED — On Scilla bifolia: HUNGARY, prope pag.
Makad insulae Csepel sziget, ca. 98 m, 6 April 1965, S. Toth (Vanky Ustilag. exs., no. 57);
BULGARIA, |.d. Papazova Korija prope urb. Elhovo, 21 March 1962, C. Hinkova (SOMF
2859); Ld. Gorna Top¢ija, distr, Jambol, 22 March 1961, C. Hinkova SOMF 2888); Pirin
Mts, Sinanitsa, ca. 2000 m, 24 May 1985, C.M. Denchev (SOMF 19206).
Currently, there is no molecular phylogenetic inference for distinguishing
the anthericolous smut fungus on Scilla sardensis and S. luciliae from that on
S. bifolia. Because no morphological differences were found, we identified
Antherospora scillae as the fungus on the British specimens that we examined.
This anthericolous smut fungus known in UK on Scilla verna Huds. (several
collections) has been recently collected also on S. forbesii (Baker) Speta (=
Chionodoxa forbesii Baker) [K(M) 169982]. Scilla sardensis, S. luciliae, S. verna,
and S. forbesii are new host records for Antherospora scillae.
Urocystis bolboschoeni Denchey, T. Denchev, Spooner & Legon, sp. nov. Fics 5-8
MycoBank MB 561704
Sor! in foliis et vaginis foliorum strias formati. GLOMERULI SPORARUM 16-40 x 14.5-28.5
um, e sporis 1-3 (-5) compositi [numeri sporarum: 1 = 44.6%, 2 = 39.2%, 3 = 11.2%, 4=
4.2%, 5 = 0.8%], strato cellularum sterilium perfecte circumdatis composite. SPORAE 12.5-
18.5 x 10-15 [15.2 1.1 x 12.7 + 1.1] um, rufobrunneae, pariete 0.6-0.9 um crasso.
Type on Bolboschoenus maritimus (L.) Palla: UK, England, South Devon, Budleigh
Salterton, Otter Estuary, 29 June 2010, leg. N.W. Legon, as Urocystis sp. (holotype, K(M)
166455).
EryMo_oey: the name refers to the host genus.
Sori in leaves and leaf sheaths between the veins, as streaks, sometimes
confluent, initially covered by the epidermis, rupturing longitudinally to expose
a powdery, dark reddish brown mass of spore balls. SPORE BALLS subglobose
to ellipsoidal or slightly irregular, composed of 1-3 (-5) central teliospores [1
= 44.6%, 2 = 39.2%, 3 = 11.2%, 4 = 4.2%, 5 = 0.8%; n/, = 950] and a continuous
layer of peripheral sterile cells; 16-25 x 14.5-22.5 um [with 1 teliospore],
21-33.5 x 15.5-24.5 um [with 2 teliospores], 25-40 x 17-28.5 um [with 3
teliospores]. STERILE CELLS broadly elliptical, elliptical, suborbicular or ovate
250 ... Denchev, Denchev & Spooner
in outline, or collapsed, sometimes slightly irregular, 5-11.5 um long, pale or
yellowish, wall 0.6-1.0 um thick, smooth. Sporss globose, subglobose, broadly
ellipsoidal or ovoid, 12.5-18.5 x 10-15 [15.2 + 1.1 x 12.7 + 1.1] um (n/, = 200),
medium reddish brown; wall 0.6-0.9 um thick, finely verruculose.
DISTRIBUTION — On Cyperaceae: Bolboschoenus maritimus, Europe
(England). Known only from the type locality.
ADDITIONAL SPECIMENS EXAMINED — On Bolboschoenus maritimus: UK, England,
SouTH Devon, Budleigh Salterton, Otter Estuary, 22 June 2010, leg. N.W. Legon (as
Urocystis sp., K(M) 166454); 12 May 2011, leg. N.W. Legon (K(M) 170764).
COMMENTS — On Cyperaceae three Urocystis species have been described: (i)
U. fischeri Korn. ex G. Winter on species of Carex, with type on C. acuta L.
from Germany; distributed in Europe, Asia, and North America (sori in leaves
and culms, spore balls 20-40 um long, composed of 1-3 (-4) fertile spores);
(ii) U. littoralis (Lagerh.) Zundel on Carex maritima Gunnerus from Norway
(sori in leaves, spore balls 25-50 um long, composed of (1-) 2-6 (-9) fertile
spores); and (iii) U. chorizandrae Cunningt. et al. on Chorizandra enodis Nees
from Australia (sori in leaves and sterile culms, spore balls 25-50 um long,
composed of 1-5 (-8) fertile spores) (Vanky & Shivas 2003, Vanky 2009c).
It is remarkable that no smut has been previously reported on this common
and widely distributed host species.
Acknowledgements
We gratefully acknowledge Dr Kalman Vanky (Herbarium Ustilaginales Vanky,
Tubingen, Germany) and Dr Roger G. Shivas (Agri-Science Queensland, Australia) for
critically reading the manuscript and serving as pre-submission reviewers.
Literature cited
Bauer R, Lutz M, Begerow D, Piatek M, Vanky K, Bacigalova K, Oberwinkler F. 2008. Anther smut
fungi on monocots. Mycological Research 112: 1297-1306.
http://dx.doi.org/10.1016/j.mycres.2008.06.002
Ershad D. 2000. Vankya, a new genus of smut fungi. Rostaniha 1: 65-72 [in English], 151-161 [in
Farsi], Figs 1-6.
Vanky K. 1999. The new classificatory system for smut fungi, and two new genera. Mycotaxon 70:
35-49.
Vanky K. 2002. Illustrated genera of smut fungi. 2"* edn. APS Press, St. Paul, Minnesota, USA.
238 pp.
Vanky K. 2009a. The genus Vankya (Urocystidaceae) revisited. Mycologia Balcanica 6: 73-78.
Vanky K. 2009b. Taxonomic studies on Ustilaginomycetes - 29. Mycotaxon 110: 289-324.
Vanky K. 2009c. Keys to smut fungi of selected host plant families and genera. Mycologia Balcanica
6: 1-36.
Vanky K, Shivas RG. 2003. Further new smut fungi (Ustilaginomycetes) from Australia. Fungal
Diversity 14: 243-264.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.251
Volume 118, pp. 251-256 October-December 2011
A new species of Marasmius from northern Argentina
BERNARDO LECHNER”* & LEANDRO PAPINUTTI
PROPLAME-PRHIDEB (CONICET), DBBE, Facultad de Ciencias Exactas y Naturales,
Ciudad Universitaria, (C1428EHA) Ciudad de Buenos Aires, Argentina.
*CORRESPONDENCE TO: [email protected]
ABSTRACT — Marasmius tyrius is proposed as a new species. It is characterized by collariate
lamellae, insititious stipe, violet pileus, pileipellis with Siccus-type broom cells, and clavate to
fusoid spores. Detailed description and illustrations of macro- and microscopic characters
are provided.
Key worps — Argentinean mycobiota, Marasmiaceae, taxonomy
Introduction
The genus Marasmius (Marasmiaceae, Agaricales) is represented by a large
number of species, especially in the tropics (Singer 1976, 1986). Itis characterized
by a hymeniform pileipellis composed of broom cells of Siccus- or Rotalis-
type, or of exclusively smooth cells. Siccus-type cells are characterized by apical
appendages or more or less erect setulae, while the Rotalis-type usually have
short appendages and that descend from the apex down towards the middle of
the cell (Singer 1986).
Spegazzini (1880a,b, 1883, 1887, 1891, 1898, 1902, 1909, 1925, 1926a,b),
Singer (1950, 1959, 1965, 1969, 1976, 1989), and Singer & Digilio (1953)
described species of Marasmius from Argentina, Chile, and Paraguay. Singer
(1953) later studied several types of species described by Spegazzini and
included his observations in the exhaustive monographs on Marasmius in
South America and Neotropics (Singer 1959, 1965, 1976). After these reports,
mycological literature on the genus in the region has been scant. Recently, there
has been a renewed worldwide interest in Marasmius (Desjardin et al. 2000,
Antonin 2003, 2004a,b, 2007, Wannathes et al. 2004, 2009, Antonin & Buyck
2006, Desjardin & Ovrebo 2006, Puccinelli & Capelari 2006, Tan et al. 2009,
Antonin & Noordeloos 2010). In Argentina, Lechner et al. (2006) reported new
records of Marasmius collected in the northern region, and several species have
252 ... Lechner & Papinutti
been described and illustrated in the Pictorial Atlas of Iguazi National Park
(Wright et al. 2008).
According to our knowledge, one specimen collected during an expedition
in northern Argentina does not match any described Marasmius. Thus, we
propose Marasmius tyrius as a new species.
Materials & methods
The specimen was photographed and its macroscopic features were recorded when
fresh. Tissues were mounted in 5% KOH + 1% aqueous phloxine or Melzer’s reagent and
observed under a Nikon E-600 microscope. For basidiospore measurements, the length
: width quotient (Q) was calculated, with Qm indicating the mean value of Q quotients.
Line drawings were made with the aid of a light tube. Basidiomata were dried, kept
frozen for a week, and deposited in the BAFC herbarium (Department of Biodiversity
and Experimental Biology, Faculty of Exact and Natural Sciences, Universidad de
Buenos Aires).
Taxonomy
Marasmius tyrius B.E. Lechner & Papinutti, sp. nov. Fics. 1-2
MycoBank MB 518617
Pileo 4-5.5 mm lato, 2-2.7 mm alto, hemisphaerico, centro depresso, violaceo, glabro,
sulcato. Lamellis albis, subdistantibus (proxime 17), collariatis. Stipite castaneo, glabro,
31-37 x 0.2-0.5 mm. Basidiosporis 11.1-14.1 x 2.5-3.7 um, clavatis ad fusiformibus,
laevibus, hyalinis, inamyloideis. Basidiis clavatis, 23-28 x 4-6 um, 1-3 sterigmata.
Cheilocystidiis difformibus: (1) elementis typi Marasmii sicci, 17.3-20.5 x 3.7-9.5 um,
setulis 2-4 um longis, tenuitunicatis vel crassitunicatis, castaneis in KOH, et (2) clavatis,
22.5-27.4 um longis, tenuitunicatis, hyalinis. Elementis epicuticularibus plerumque typi
Marasmii sicci, 11.9-22.5 x 11.2-13.1 um, setulis 4-5 um longis.
Type: Argentina, Chaco, Colonia Benitez, 27°26'19.20"S 58°50'51.39"W, on fallen leaves,
19-IX-2007, col. L. Papinutti, G. Rol6n (HOLOTYPE BAFC 51726).
Erymo.oey: The epithet refers to the similarity of the pileus color to Tyrian purple, the
dye famously produced in the ancient Phoenician city of Tyre (Latin: Tyrus).
Piteus 4-5.5 mm in diam x 2-2.7 mm high, hemispheric, depressed at the
centre, glabrous, deeply sulcate, violet (Plate 42, K10K11, Maerz & Paul 1930),
centre light brown with an outer light violet ring. PILEUS CONTEXT white,
very thin (less than 1 mm). LAMELLAE (Fig. 1c) collariate, subdistant (ca. 17),
whitish, entire, lamellulae absent; edge broad, concolorous with the pileus.
STIPE 31-37 x 0.2-0.5 mm, chestnut-brown, creamy to whitish at the apex,
glabrous, insititious, cylindrical. RHIzomorpPus frequently present, thin, black.
STIPE CONTEXT thin, white.
BASIDIOSPORES (9.3—)11.1-14.1(-15.4) x 2.5-3.7 um, Q = 3.24-4.97, Qm = 4.23,
n = 30, clavate to fusoid, hyaline, inamyloid, smooth, thin-walled. BAsrp1a
clavate, 23-28 x 4-6 um, 1-3 spored. Basidioles clavate, 19.2-25.0 um long.
PLEUROCYSTIDIA absent. LAMELLA EDGE Sterile, with crowded cheilocystidia.
Marasmius tyrius sp. nov. (Argentina) ... 253
Fic. 1. Basidiomes of Marasmius tyrius.
Scale bar = 1 cm.
CHEILOCYSTIDIA of two types: (1) Siccus-type broom cells, body 17.3-20.5 x
3.7-9.5 um, setulae 2-4 um long, thin- to thick-walled, castaneous in KOH, and
(2) clavate, 22.5-27.4 um long, thin-walled, hyaline. HYMENOPHORAL TRAMA
regular to subregular; hyphae hyaline, clamped, 2.1-6.0 um diam. PILEIPELLIS
composed of Siccus-type broom cells, body 11.9-22.5 x 11.2-13.1 um, setulae
4-5 um long, thin- to thick-walled, castaneous in KOH, mostly subvesiculose;
and of clavate, some bifurcate, 20.1-34.1 x 5.4-7.0 um, thin- to thick-walled
elements (wall up to 2.3 um thick), castaneous in KOH. HYPHAE OF PILEUS
CONTEXT hyaline, thin-walled, clamped, 2.6-6.0 um diam, weakly dextrinoid.
HYPHAE OF STIPE CONTEXT generative, hyaline, clamped, thin-walled, 2.6-5.2
um diam, and thick-walled (up to 1.5 um), 4.2-6.3 um diam, scant in upper
zones of the apex; non-dextrinoid.
ECOLOGY AND DISTRIBUTION — Gregarious, abundant in wet forest soil and
litter at Colonia Benitez. Growing on fallen leaves of Phoebe porphyria (Griseb.)
Mez (Lauraceae). Known only from type locality.
COMMENTS — Marasmius tyrius belongs to sect. Marasmius, subsect. Sicciformes
Antonin based on the presence of a collarium, the insititious stipe, and
Siccus-type broom cells in the pileipellis. In his monograph on Neotropical
254 ... Lechner & Papinutti
MONO Ni
Fic. 2. Marasmius tyrius, micromorphology.
a: Spores. b: Basidia. c: Cheilocystidia. d: Elements of the pileipellis.
Scale bar = 10 um.
marasmioid fungi, Singer (1976) did not present any violet-colored species
with the characteristics of the subsect. Sicciformes, but several purple colored
ones. We will mention the three most similar species. Marasmius marthae
Singer has a purple-red pileus, black stipe at maturity, somewhat longer spores,
and grows on wood pieces; M. rubromarginatus Dennis has a carmine-purple
to brown-red pileus, more distant lamellae (11-15), and longer spores; and M.
sanguirotalis Singer has a dark purple pileus, distant lamellae (11-13), much
longer spores, and grows on branches and woody matter. Among the few other
purple or purple tinged species not treated by Singer (1976), the most similar
is M. purpureobrunneolus Henn. from Indonesia. It differs by reddish-brown to
purplish-brown pileus and more distant lamellae (9-14).
The only two violaceous species in subsect. Sicciformes were described by
Singer (1989) from Brazil, both with significantly smaller spores: M. iodactylus
Singer (spores 6-7.5 x 2.5-3.3 um) and M. izonetae Singer (spores 5 x 2.2 um).
Marasmius tyrius sp. nov. (Argentina) ... 255
In sect. Marasmius, subsect. Marasmius (= Pararotulae Singer), Singer (1976)
described M. violeorotalis Singer with a violet-lilac pileus. It has the same
habitat as M. tyrius (on leaves of dicotyledonous trees) but differs in smaller
spores (6.2-9.5 x 2.5-3 um), Rotalis-type broom cells in the pileipellis, and
more distant lamellae (ca. 12). Other Marasmius species with violaceous or
violaceous tinged pileus belong to other sections of the genus.
Acknowledgments
We wish to express our gratitude to Dr. Zdenko Tkaléec and Dra. Marina Capelari
for reviewing the manuscript and offering useful comments. We thank Guillermo Rolén
for the technical assistance with the figures. This work was supported by CONICET
(Consejo Nacional de Investigaciones Cientificas y Técnicas) Argentina and Universidad
de Buenos Aires.
Literature cited
Antonin V. 2003. New species of Marasmius (Basidiomycetes, Tricholomataceae) from tropical
Africa - I. Sect. Epiphylli, Fusicystides, Globulares, Hygrometrici and Neosessiles. Mycotaxon
85: 109-130.
Antonin V. 2004a. New species of marasmioid genera (Basidiomycetes, Tricholomataceae) from
tropical Africa - III. Marasmius sect. Sicci. Mycotaxon 89: 399-422.
Antonin V. 2004b. New species of marasmioid genera (Basidiomycetes, Tricholomataceae) from
tropical Africa - IV. Four new taxa of the genus Marasmius and one new combination.
Mycotaxon 89: 423-431.
Antonin V. 2007. Monograph of Marasmius, Gloiocephala, Palaeocephala and Setulipes in tropical
Africa. Fungus flora of tropical Africa 1. Meise, National Botanic Garden (Belgium). 177 p.
Antonin V, Buyck B. 2006. Marasmius (Basidiomycota, Marasmiaceae) in Madagascar and the
Mascarenes. Fungal Diversity 23:17-50.
Antonin V, Noordeloos ME. 2010. A monograph of marasmioid and collybioid fungi in Europe.
Eching, IHW Verlag. 480 p.
Desjardin DE, Ovrebo CL. 2006. New species and new records of Marasmius from Panama. Fungal
Diversity 21: 19-39.
Desjardin DE, Retnowati A, Horak E. 2000. Agaricales of Indonesia. 2. A preliminary monograph
of Marasmius from Java and Bali. Sydowia 52: 92-194.
Lechner BE, Wright JE, Popoff O. 2006. New taxa and new records for Argentina of fungi from
Iguazu National Park, Misiones. Fungal Diversity 21: 131-139.
Maerz A, Paul M. 1930. Dictionary of color. New York. 207 p.
Puccinelli C, Capelari M. 2006. Two new species of Marasmius (Basidiomycota, Marasmiaceae)
from Brazil. Mycotaxon 95: 295-300.
Singer R. 1950. Die hoheren Pilze Argentiniens. Bulletin Suisse de Mycologie 28: 181-196.
Singer R. 1953. Type studies on agarics III. Lilloa 25: 463-514.
Singer R.1959. Studies toward a monograph of South American species of Marasmius. Sydowia
12: 54-148.
Singer R. 1965. Monographic studies on South American Basidiomycetes, especially those of the
east slope of the Andes and Brazil 2. The genus Marasmius in South America. Sydowia 18:
106-358.
Singer R. 1969. Mycoflora australis. Nova Hedwigia 29: 1-405.
256 ... Lechner & Papinutti
Singer R. 1976. Marasmieae (Basidiomycetes - Tricholomataceae). Flora Neotropica 17: 1-347.
Singer R. 1986. The Agaricales in modern taxonomy. 4th edition. Koenigstein, Koeltz Scientific
Books. 981 p.
Singer R. 1989. New taxa and new combinations of Agaricales (Diagnoses fungorum novorum
Agaricalium IV). Fieldiana Botany 21: 1-133.
Singer R, Digilio APL. 1953. Prodromo de la flora agaricina Argentina. Lilloa 25: 5-461.
Spegazzini CL. 1880a. Fungi Argentini. Pugillus 1. Anales de la Sociedad Cientifica Argentina 9:
158-192.
Spegazzini CL. 1880b. Fungi Argentini. Pugillus 3. Anales de la Sociedad Cientifica Argentina 10:
122-142.
Spegazzini CL. 1883. Fungi Guaranitici. Pugillus I. Anales de la Sociedad Cientifica Argentina 16:
272-284.
Spegazzini CL. 1887. Fungi Fuegiani. Boletin de la Academia Nacional de Ciencias de Cordoba
11: 135-311.
Spegazzini CL. 1891. Fungi Guaranitici nonnulli novi vel critici. Revista Argentina de Historia
Natural 1: 101-111.
Spegazzini CL. 1898. Fungi Argentinici novi vel critici. Anales del Museo de Historia Natural de
Buenos Aires 6: 81-288.
Spegazzini CL. 1902. Mycetes Argentinenses. Series 2. Anales del Museo de Historia Natural de
Buenos Aires 8: 49-89.
Spegazzini CL. 1909. Mycetes Argentinenses. Series 4. Anales del Museo Nacional de Historia
Natural de Buenos Aires 19: 257-458.
Spegazzini CL. 1925. Séptima contribucién a la micologia Chilena. Revista Chilena de Historia
Natural 29: 58-64.
Spegazzini CL. 1926a. Contribucién al conocimiento de la flora micolégica de las Sierras de
Cordoba. Boletin de la Academia Nacional de Ciencias de Cordoba 29: 113-190.
Spegazzini CL. 1926b. Observaciones y adiciones a la micologia argentina. Boletin de la Academia
Nacional de Ciencias de Cordoba 28: 267-406.
Tan Y-S, Desjardin DE, Perry BA, Vikineswary S, Noorlidah A. 2009. Marasmius sensu stricto in
Peninsular Malaysia. Fungal Diversity 37: 9-100.
Wannathes N, Desjardin DE, Retnowati A, Tan YS, Lumyong S. 2004. A redescription of Marasmius
pellucidus, a species widespread in South Asia. Fungal Diversity 17: 203-218.
Wannathes N, Desjardin DE, Hyde KD, Perry BA, Lumyong S. 2009. A monograph of Marasmius
(Basidiomycota) from Northern Thailand based on morphological and molecular (ITS
sequences) data. Fungal Diversity 37: 209-306.
Wright JE, Lechner BE, Popoff O. 2008. Atlas pictérico de los hongos del Parque Nacional Iguazu.
Editorial LOLA, Buenos Aires. 227 p.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.257
Volume 118, pp. 257-264 October-December 2011
Arrasia rostrata (Basidiomycota),
a new corticioid genus and species from Italy
ANNAROSA BERNICCHIA*', SERGIO P. GORJON? & KAREN K. NAKASONE?
"Dipartimento di Scienze e Tecnologie Agroambientali,
Universita degli Studi di Bologna, Via Fanin 42, 40127 Bologna, Italy
*Centro de Investigacion y Extension Forestal Andino Patagonico,
Area de Proteccién. CC 14, 9200 Esquel, Chubut, Argentina
°Center for Forest Mycology Research, U.S. Forest Service,
One Gifford Pinchot Drive, Madison, WI 53726-2398 USA
*CORRESPONDENCE TO: annarosa. bernicchia@unibo. it
ABSTRACT — An unusual corticioid species with distinctive large basidiospores that develop
a distal refractive rostrum when fully mature is described as new. It grows on living bark
of Juniperus phoenicea on the Italian island of Sardinia. Because it is morphologically
distinct from any known genus of corticioid fungi, the new genus Arrasia is proposed to
accommodate it.
Key worps — dendrotheloid fungi, Italy
Introduction
Many new species of polypores and corticioids have recently been described
from Sardinia: Aleurodiscus ilexicola Bernicchia & Ryvarden, Antrodiella
ichnusana Bernicchia et al. Antrodia sandaliae Bernicchia & Ryvarden,
Echinodontium ryvardenii Bernicchia & Piga, Neolentiporus squamosellus
(Bernicchia & Ryvarden) Bernicchia & Ryvarden, Phellinus juniperinus
Bernicchia & S. Curreli, and Vararia maremmana Bernicchia. Sardinia may
be a refugium from the last glacial period, as demonstrated by the presence
of Piloporia sajanensis (Parmasto) Niemela, previously known as a boreal
species, or the occurrence of Echinodontium ryvardenii, while other species of
Echinodontium Ellis & Everh. are known from North America and Asia.
Conservation International (CI 2007) lists the Mediterranean Basin as
a “Biodiversity Hotspot.’ Several basidiomycete species associated with
Mediterranean juniper forests are Echinodontium ryvardenii, Hyphoderma
etruriae Bernicchia, Lenzitopsis oxycedri Malencon & Bertault, Peniophora
258 ... Bernicchia, Gorjon & Nakasone
junipericola J. Erikss., Phellinus juniperinus, Trametes junipericola Manjon et al.,
and Vararia maremmana. Recently, a striking corticioid species was discovered
from Sardinia growing on living bark of Juniperus phoenicea L. (Cupressaceae).
This new species is here fully described and illustrated; because it has no close
relatives in any described corticioid genus, a new genus is proposed.
Materials & methods
For light microscopic studies, samples were mounted in 3% potassium hydroxide
(KOH), Melzer’s reagent (IKI), and 0.1% cotton blue in 60% lactic acid to determine
cyanophily of basidiospore walls. Crystalline deposits were dissolved in a 50% HCl
solution to individualize microscopical elements. Line drawings were made with a
camera lucida attachment. Specimens are deposited in HUBO, CFMR, and SALA.
Taxonomy
Arrasia Bernicchia, Gorjon & Nakasone, gen. nov.
MycoBank MB 561760
Basidiomata effusa, adnata, tenuissima, levia, tenuiter farinosa, margine distincto.
Systema hypharum monomiticum; hyphae generativae fibulatae, tenuitunicatae et
ramosae. Dendrohyphidia filamentosa, ramosa, fibulata. Basidia suburniformia deinde
subclavata, flexuosa, fibulata, tetraspora. Basidiosporae hyalinae, leviter crassitunicatae,
leves, cyanophylae, inamyloideae, indextrinoideae, subfusoideae vel biapiculatae, parte
distali se extendente ad rostrum crassitunicatum et refractivum.
TYPE SPECIES: Arrasia rostrata Bernicchia, Gorjon & Nakasone
ErymMo_oey: the genus is dedicated to Luigi Arras, mycologist and friend, who is always
present during the mycological excursions across Sardinia.
BASIDIOMATA effuse, adnate, thin, white, smooth, finely farinaceous, with a
distinct margin.
HyPHAL SYSTEM monomitic, hyphae clamped. DENDROHYPHIDIA
filamentous, branched, clamped. Basip1a suburniform at first, then flexuous,
clavate to obclavate, sometimes with a basal lobe, basally clamped, with 4
sterigmata. BAstp1ospores broadly subfusiform to biapiculate, distal end
elongating into a thick-walled rostrum, walls hyaline, slightly thickened,
smooth, cyanophilous, inamyloid, nondextrinoid.
REMARKS — ‘The distinctive feature of the new genus is the rostrate
basidiospores.
Arrasia rostrata Bernicchia, Gorjon & Nakasone, sp. nov. PLATES 1-4
MycoBank MB 561761
Basidiomata resupinata, effusa, adnata, tenuissima, 30 mm longa et 5 mm lata, laevia
sed farinosa vel subgausapata in maturitate, subalba vel albocinerea, margine distincto.
Systema hypharum monomiticum; hyphae generativae tenuitunicatae, fibulatae, 1.8-2.3
um latae. Dendrohyphidia filamentosa, ramosa, fibulata ad basim. Cystidia desunt.
Basidia primo suburniformia deinde subclavata, flexuosa, fibulata ad basim, tenuitunicata,
Arrasia rostrata gen. & sp. nov. (Italy) ... 259
PiaTE 1. Echinodontium ryvardenii (center) surrounded by circular to linear patches of
Arrasia rostrata (Bernicchia 8087, holotype). Scale bar = 5 cm.
50-90 x 10-16 ym, tetraspora. Basidiosporae hyalinae, laeves, leviter crassitunicatae,
cyanophylae, inamyloideae, indextrinoideae, late subfusoideae vel biapiculatae, parte
distali se extendente ad rostrum crassitunicatum et refractivum, 27-40 x 10-15 um. Ad
corticem arborum coniferarum viventis.
TyPE: Italy, Sardinia, Nuoro province, Lanaittu valley, 180 m a.s.1., on bark in trunk and
old branches of living Juniperus phoenicea, 30.11I.2010, leg. A. Bernicchia, coll. 8087.
Holotype in HUBO. Isotype in SALA et CFMR.
EryMoLocy: the name rostrata refers to the long refractive rostrum on the
basidiospores.
BASIDIOMATA resupinate, effuse, small, circular to linear patches, becoming
confluent, up to 30 x 5 mm, thin, up to 180 um thick, soft, white, smooth,
initially finely farinaceous to subfelty, finally thickly farinaceous; margin
abrupt, distinct.
HYPHAL SYSTEM monomitic with clamped generative hyphae. Subiculum
thin, a dense tissue of hyphae and crystals; subicular hyphae 1.8-2.3 um in
diam., clamped, moderately branched, walls hyaline, thin, encrusted with
hyaline crystals. Subhymenium not observed. Hymenium a palisade of
dendrohyphidia, basidia, and indistinct, collapsed hymenial elements obscured
by crystals. DENDROHYPHIDIA filamentous, irregular, with short branches near
260 ... Bernicchia, Gorjon & Nakasone
apex, 40-62 x 1.5-2 um, clamped at base, walls hyaline, thin. Cystrp1a absent.
Basip1A obclavate to suburniform at first, then flexuous, narrowly clavate
to obclavate, occasionally with a lateral lobe near base, 50-90 x 10-16 um,
clamped at base, containing resinous globules, often lower part collapsed below
a secondary septum, walls hyaline, thin, smooth, (2-)4-sterigmate, sterigmata
stout, up to 29 x 5 um. Basrprospores broadly subfusiform to bi-apiculate,
initially distal end obtuse, later developing an extended, thick-walled, refractive
rostrum or beak, 27-40 x 10-15 um, rostrum 8-14 x 1.2-2 um long, with a
distinct, refractive, thick-walled apiculus, containing resinous material, walls
hyaline, with distinct walls to slightly thick-walled, smooth, cyanophilous, not
reacting in Melzer’s reagent.
HABITAT AND DISTRIBUTION — Known from Sardinia growing on bark
of living Juniperus phoenicea, frequently in association with Echinodontium
ryvardenii.
ADDITIONAL SPECIMENS EXAMINED — ITALY. SARDINIA, NUORO PROVINCE, Lanaittu
valley, 180 m a.s.l., on trunk and old branches of living Juniperus phoenicea, 14.X1.2009
leg. A. Bernicchia, coll. 8086, 8097; 03.11.2010, leg. L. Arras coll. 8557; 30.11.2010: leg. A.
Bernicchia, coll. 7998, 8070, 8071, 8072, 8073, 8074, 8075, 8076, 8077, 8080, 8085.
ComMENTsS — ‘The most remarkable feature of Arrasia rostrata is its large,
beaked basidiospores. In developing basidiospores still attached to the
basidium, a distal knob forms that will develop into the rostrum. When fully
mature, the rostrum is a straight, thick-walled, refractive structure. By the time
the basidiospore is mature and the rostrum is fully developed, the basidium
is empty and collapsed. The indistinct remnants of post-mature basidia can
be observed if the crystalline matter is dissolved. The apiculus of mature
basidiospores is refractive and thick-walled with a notched appearance.
Arrasia rostrata is probably related to the corticioid genus Dendrothele
Hohn. & Litsch., which shares the same ecology (inhabiting bark of living trees),
crustose basidiomata, suburniform basidia, and hymenial structure with many
dendrohyphidia and abundant crystalline deposits (possibly an adaptation to
dry and exposed habitats). Dendrothele is a polyphyletic genus with species
distributed among several lineages in the hymenochaetoid, russuloid, corticioid,
and agaricoid clades (Goranova 2003, Goranova et al. 2003, Bodensteiner et al.
2004). The type species, Dendrothele papillosa Héhn. & Litsch. [= D. griseocana
(Bres.) Bourdot & Galzin], is included in the Niaceae Julich within the
Agaricales Underw. and closely related to the cyphelloid genera Lachnella Fr.
and Cyphellopsis Donk. Recently, Nakasone & Burdsall (2011) and Gorjén et
al. (2011) observed navicular basidiospores in Dendrothele species from New
Zealand and Argentina, a feature previously also known in some cyphelloid
genera. Convergences in morphological traits and habit seem to have occurred
repeatedly, characterizing the artificial dendrotheloid group. However, no other
Arrasia rostrata gen. & sp. nov. (Italy) ... 261
PLATE 2. Arrasia rostrata. Hymenial elements (Bernicchia 8087, holotype).
a) immature basidiospores, b) basidia, c) generative hyphae, d) dendrohyphidia
basidiospores with a refractive rostrum are known in Dendrothele or any other
corticioid species.
262 ... Bernicchia, Gorjon & Nakasone
PLaTE 3. Arrasia rostrata. Basidia and immature basidiospores.
(Bernicchia 8087, holotype)
It is also interesting to note that some basidiospores in Vararia P. Karst.
(such as in Vararia investiens (Schwein.) P. Karst.) develop an empty amyloid
part separated by a septum in the proximal region (close to the sterigma
attachment). The biological function, if any, of this structure is unknown.
Arrasia rostrata gen. & sp. nov. (Italy) ... 263
NS 0 10 20pm
|
PLATE 4. Arrasia rostrata. Mature basidiospores with a well developed rostrum and immature
(right and center right) basidiospores. (1: Bernicchia 8087, holotype; 2: Bernicchia 8074; 3:
Bernicchia 8071)
264 ... Bernicchia, Gorjon & Nakasone
Morphological similarities may also be drawn with some genera belonging to
Vuilleminiaceae Maire, Punctulariaceae Donk, and Corticiaceae Herter. Among
the Vuilleminiaceae, Vuilleminia Maire, Australovuilleminia Ghobad-Nejhad &
Hallenb., and Cytidia Quél. all share the saprophytic habit growing on attached
recently dead angiosperm wood (not known from coniferous substrata),
basidiomes that are usually gelatinous and decorticating, and allantoid to
ellipsoid basidiospores. Members of the Punctulariaceae, Punctularia Pat.,
Punctulariopsis Ghobad-Nejhad, and Dendrocorticium M.J. Larsen & Gilb.,
grow on fallen angiosperm wood and all species have ellipsoid basidiospores.
Genera in the Corticiaceae, as delimited by Ghobad-Nejhad et al. (2010), show
a more ecological and morphological complexity, but none display the features
that characterize Arrasia rostrata. Preliminary molecular studies indicate that
Arrasia rostrata fits no existing homobasidiomycete genus or order thus far
recognized (data not shown); further analyses are still required.
Acknowledgments
Nils Hallenberg and Alina G. Greslebin acted as presubmission reviewers and their
comments are acknowledged. We thank Luigi Arras and Marco Facchini for their help,
Giovanni Consiglio for revision of Latin diagnosis, and Cristina Spinelli for the colour
photo. The Council of Lanusei (Sardinia, Italy) supported AB and SPG on some collecting
trips. Karl-Henrik Larsson and Ellen Larsson sequenced Arrasia rostrata and conducted
a preliminary molecular analysis, and we are very grateful for their comments about the
molecular relationship of the new species.
Literature cited
Bodensteiner P, Binder M, Agerer R, Moncalvo JM, Hibbett DS. 2004. Phylogenetic diversity of
cyphelloid forms in the Homobasidiomycetes. Molecular Phylogenetics and Evolution 33(2):
501-515. http://dx.doi.org/10.1016/j.ympev.2004.06.007
CI [Conservation International] 2007. Biodiversity hotspots. (accessed online 09.Jun.2011).
http://www. biodiversityhotspots.org/xp/hotspots/mediterranean/Pages/default.aspx
Ghobad-Nejhad M, Nilsson RH, Hallenberg N. 2010. Phylogeny and taxonomy of the genus Vuille
minia (Basidiomycota) based on molecular and morphological evidence, with new insights into
the Corticiales. Taxon 59: 1519-1534. http://dx.doi.org/10.1007/s11557-010-0674-5
Gorjén SP, Greslebin AG, Rajchenberg M. 2011. Dendrothele latenavicularis sp. nov. (Lachnellaceae,
Basidiomycota) from the Patagonian Andes. Mycotaxon 117: 101-108
http://dx.doi.org/10.5248/117.101
Goranova G. 2003. Phylogenetic analyses of rDNA sequences indicate the corticioid genus
Dendrothele is highly polyphyletic. Master of Arts, Clark University, Worcester
Goranova G, Binder M, Hibbett DS. 2003. Molecular phylogenetics indicate that the corticioid
genus Dendrothele is highly polyphyletic. Inoculum 54: 22.
Nakasone KK, Burdsall HH Jr. 2011. The genus Dendrothele (Agaricales, Basidiomycota) in New
Zealand. New Zealand Journal of Botany 49(1): 107-131.
http://dx.doi.org/10.1080/0028825X.2010.512636
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.265
Volume 118, pp. 265-272 October-December 2011
Cortinarius mikedavisii sp. nov. from northern California
DIMITAR BOJANTCHEV
MushroomHobby.com, 345 Shipwatch Lane, Hercules, CA 94547, USA
CORRESPONDENCE TO: [email protected]
ABSTRACT — A new Cortinarius (subg. Phlegmacium) species is described from northern
California. Cortinarius mikedavisii is a brightly colored bulbopodium in sect. Laeticolores.
Phylogenetically it belongs in the /cupreorufus clade.
Key Worps — Cortinariaceae, fungal taxonomy, nrITS data
Introduction
Cortinarius sect. Laeticolores M.M. Moser ex Moénne-Locc. & Reumaux
was erected to accommodate some of the brightly colored bulbopodiums of
subg. Phlegmacium. The section type was originally designated as “Cortinarius
orichalceus” (a misapplied name, not conspecific with Agaricus orichalceus
Batsch); its valid name is Cortinarius cupreorufus Brandrud (Brandrud et al.
1994).
Recent molecular studies (Fraslev et al. 2007, Garnica et al. 2009), congruent
with my own phylogenetic analyses, show that the broad circumscription of
sect. Laeticolores by Moser (1960) and Bidaud et al. (2004) is polyphyletic.
However, a group of species around C. cupreorufus forms a well-supported
clade including C. rufo-olivaceus (Pers.) Fr. and C. prasinus (Schaeff.) Fr. The
/cupreorufus clade, which represents the core of sect. Laeticolores, is well
represented in western North America with Cortinarius mikedavisii, described
here as new, and other undescribed species (Fic 1).
Materials & methods
Methods for morphological studies and DNA extraction, PCR conditions and
primers, PCR product clean up, and sequencing were employed as outlined in Bojantchev
& Davis (2011). Color codes follow Munsell™ soil color charts (Anonymous 2000).
Collections are stored in the private herbarium of the first author or at the University of
California herbarium in Berkeley (UC) where noted.
266 ... Bojantchev
C. prasinus (AY174835) Germany
C. prasinus (AY174843) Germany
C. prasinus (DQ663390) Denmark
C. rufoolivaceus (AY174845) Germany
C. rufoolivaceus (EU088219) Germany
C. rufoolivaceus (DQ663410) Denmark
100) Cortinarius mikedavisii DBB40100 (JF795384) California
Cortinarius mikedavisii DBB12455 (JF795389) California
Cortinarius sp. RMD101203 (JF8&28732) California
57| C. aff. cupreorufus (FJ717580) British Columbia, Canada
C. aff. cupreorufus (FJ039645) British Columbia, Canada
C. cupreorufus (JF828733) Bulgaria
C. cupreorufus (AY174831) Austria
C. cupreorufus (EU056992) Germany
C. piceae (EU056956) Europe
C. sodagnitus (AY174829) Germany
apesa snynsioaidn3/
11
7
Fic 1. Phylogenetic tree inferred by maximum parsimony analysis of 16 Cortinarius subg.
Phlegmacium nrITS sequences. The tree shows the position of C. mikedavisii relative to its
closest neighbors in the /cupreorufus clade. The percentages of clustered replicate trees based
on the bootstrap test (1000 replicates) are shown above the branches while the branch lengths
representing estimated nucleotide substitutions are shown below. GenBank accession numbers
are enclosed in brackets.
PHYLOGENETIC ANALYSIS—During these studies all Cortinarius nrDNA sequences from
the public databases GenBank (http://www.ncbi.nlm.nih.gov) and UNITE (http://unite.
ut.ee/) were downloaded and reviewed. Preliminary phylogenetic analysis (not shown)
of 1012 Phlegmacium nrITS sequences from the northern hemisphere, including
312 sequences from the author's own collections, clarified the closest relatives of
C. mikedavisii and resolved its position within the /cupreorufus clade of the calochroid
super-clade as defined by Froslev et al. (2007) and Garnica et al. (2009).
A set of sixteen Phlegmacium sequences representing eight taxa was selected for
a detailed phylogenetic analysis. Twelve sequences were sourced from GenBank and
four sequences are from the author's collections. Fourteen sequences were from the
/cupreorufus clade, represented by three well known European taxa combined with
C. mikedavisii and two western North American taxa close to C. cupreorufus. Cortinarius
sodagnitus Rob. Henry and C. piceae Froslev et al. {formerly known as C. calochrous
var. coniferarum (M.M. Moser) Nezdojm.} were selected as the outgroup because they
represent the core of the calochroid cortinarii but are distant from the /cupreorufus
clade.
Cortinarius mikedavisii sp. nov. (California) ... 267
Sequence alignments were generated with MAFFT v6.821b (Katoh et al. 2002) with
the G-INS-i global alignment iterative refinement strategy. Minimal gap opening and
extension penalties were set for better resolution of the more variables sectors within the
nrITS. The alignments were visually inspected and corrected where needed.
The evolutionary history was inferred using the Maximum Parsimony method as
implemented by MEGAS (Tamura et al. 2007). The MP trees were generated by the
Close-Neighbor-Interchange algorithm with search level 0 in which the initial trees
were obtained with the random addition of sequences (10 replicates). The percentage
of replicate trees in which the associated taxa clustered together was calculated from
a bootstrap test with 1000 replicates. The search resulted in thirty most parsimonious
trees (length = 97), which differed mainly in the topology of the terminal nodes. One
tree is given in Fie. 1.
Taxonomy
Fic 2. Cortinarius mikedavisii (UC 1860820, holotype).
Cortinarius mikedavisii Bojantchev, sp. nov. FIGs 2-6
MycoBank MB 561221
Pileo 60-220 mm lato, hemispherico, dein planoconvexo, planoconcavo, glutinoso,
roseobrunneo, cum KOH purpureobrunneo, margine involuto. Lamellis emarginatis,
caesiis dein flavidis, purpureobrunneis, in statu senili. Stipite 50-140 mm longo, cylindrico,
bulbo marginato, 30-50 mm lato. Velo universale roseobrunneo. Velo partiale copioso,
flavido. Carne caesio dein albido. Sapore miti. Sporis 10-13 x 6-7 um, amygdaliformibus,
verrucosis, basidiis 28-42 x 8-9 um, tetrasporigeris, fibulis praesentibus.
Type: USA. California: Mendocino County, Caspar, Caspar Cemetery, under Picea
sitchensis, 27 Nov 2010, Bojantchev DBB40100 (Holotype UC 1860820; Genbank nrITS
JF795384).
268 ... Bojantchev
Erymo.oey: In honor of Prof. Mike Davis whose encouragement and support in the
area of molecular genetics made these Cortinarius studies possible.
STATURE pileocarpous bulbopodium. PILEus 60-220 mm diam., hemispherical
to convex when young, plano-convex to plano-concave at age; margin involute
then straight; colors intense, mostly reddish to orange brown on the disk,
varying from carmine brown to rose brown (10R 3/6-4/8), paler on the margin,
copper brown to sulphur yellow (10R 6/8-7.5YR 7/8); surface very glutinous
when wet, glabrous to dull glossy when dry. LAMELLAE crowded, 10-22 mm
broad, blue (GLEY2 6/10G-8/10G) at first, turning olive (SY 6/4-8/4) then
yellowish clay (SY 8/6-8/8) with purplish tinges, then purplish brown as the
spores mature; edge even; attachment sinuate; lamellulae abundant. STIPE
50-140 mm long, 15-30 mm wide, cylindrical to subclavate above the bulb,
pale yellow, with rose brown streaks from universal veil. BuLB 30-80 mm diam
at the widest point, well-developed, abruptly emarginate, tapering below, rose
to purplish brown around margin; the subterrestrial part with a pale to sulphur
yellow cottony mycelial felt and rhizomorphs. UNIVERSAL VEIL rose to purplish
brown, leaving copious remnants on the pileus and bulb margin. CorTINA
yellow, leaving an annular zone of dense fibrils on the stipe. CONTEXT white to
bluish at first, paling to white at maturity with yellow tinges in the bulb. ODoR
earthy. Taste mild, earthy. MACROCHEMICAL REACTIONS 5% KOH strong and
complex, dark purple red on the pileus; on the context pale olive at first, soon
lilac on pileus context, strongly purplish on bulb context and paler on stipe
context. SPoRE Deposit deep rusty brown.
BASIDIOSPORES (9.5—)10.5-13.2(-15.5) x (5.7—)6.2-7.2(-7.8) um (mean 11.5
x 6.7 um), Q = 1.61-1.78, Q. = 1.72 (N = 178, 7 basidiomata, four collections),
amygdaliform, some with apical papilla, strongly verrucose. BAsip1a 28-42
x 8-9 um, 4-spored, cylindro-clavate, clamped. GILL EDGE sparsely fertile.
Fic 3. Cortinarius mikedavisii. a) Basidiospores (UC 1860820, holotype) b) Cuticle hyphae with an
olive to purplish intracellular pigment in 5% KOH (UC 1860820, holotype)
Cortinarius mikedavisii sp. nov. (California) ... 269
Fic 4. Cortinarius mikedavisii. 5% KOH reaction a) UC 1860820, holotype b) DBB12455
CysTIDIA not observed. PILEIPELLIS an ixocutis, simplex, no hypodermium
detected, composed of parallel to interwoven hyphae in a dense gelatinous
matrix 230-300 um thick, made up of 4-12 um wide, irregular hyphae, with
greenish to purplish intracellular pigment when mounted in 5% KOH. No
distinct reactions to Melzer’s reagent were observed. CLAMP CONNECTIONS
common in all parts.
HABITAT AND DISTRIBUTION — Cortinarius mikedavisii appears to be an
uncommon species. Currently it is known from only three locations, at two of
which it fruits regularly. The habitat is mixed woods with Sitka spruce (Picea
sitchensis (Bong.) Carriére) being the one common symbiont in all locations.
The author has never seen it south of Mendocino. Its distribution appears to
be limited to northern California and southern Oregon, where it was collected
once. There are no matching records from Washington and British Columbia
despite the intensive collecting and molecular cataloguing that has taken place
in these regions.
ADDITIONAL COLLECTIONS EXAMINED: USA. CALIFORNIA: MENDOCINO COUNTY,
Caspar, Caspar Cemetery, under Picea sitchensis, 23 Dec 2008, Bojantchev DBB12455,
(UC 1860821, Genbank nrITS JF795389); Jackson State Demonstration Forest, under
Picea sitchensis, 22 Nov 2009, Bojantchev DBB28043; OREGON: CurRY CounrTy, Samuel
Boardman State Park, under Picea sitchensis, 11 Nov 2009, Bojantchev DBB27700.
Discussion
Cortinarius mikedavisii is a beautiful species that so stands out with its large
size and bright colors that it should present no difficulty for field identification.
The distinctive alkaline color reaction indicates the presence of rufoolivacin,
an anthraquinone compound, which Steglich & Oertel (1985) detected in other
members of the /cupreorufus clade.
Phylogenetically, C. mikedavisii (Fic 1) stands almost equidistant in the
clade between the two main branches of C. cupreorufus and C. rufo-olivaceus.
Cortinarius rufo-olivaceus, a beech associate from Europe, is not known from
270 ... Bojantchev
Fic 5. Cortinarius mikedavisii. a) Mature basidiomata can become very large (DBB12455). The
scale is a US quarter dollar coin (~25mm) b) Basidiomata in a button stage (DBB28043)
/ ye REE
4 if / Z
| vy ;
y ? ae E™ , ‘4
Sg
é
*
es,
~
yi
an
ZAI
- * . ers
4 >
44
Fic 6. Cortinarius mikedavisii — a study in the development of a pileocarpous bulbopodium. Note
the changing color of the gills. a) DBB28043 b) DBB28043 c) DBB27700
Ds ne" “ . x q < r
‘ 4 4 “50 . ae v ‘ Lae
ee wa es, A ov ‘ =
— GN ra ‘ Ob Sad) ‘ ¥ ; \
US ee es , aI
Fic 7. Cortinarius mikedavisii. a) DBB12455. The scale is a US quarter dollar coin (~25mm) b)
Yellow mycelial strands (DBB27700)
western North America. Cortinarius cupreorufus (Fic 8a) and its western
American ally differ in the straw yellow lamellae and generally more pale olive
pileus, colors noticeable in all stages of development. The alkaline reactions in
C. mikedavisii are more intense than seen in C. cupreorufus, and the context
turns lilac to purplish red immediately, bypassing the pale olive stage. There is
Cortinarius mikedavisii sp. nov. (California) ... 271
Fic 8. Related species: a) Cortinarius cupreorufus DBB19840 from Europe; b) Cortinarius
sp. RMD101203, an undescribed species from the xeric oak stands of central and southern
California.
an undescribed species in the same clade, represented by coll. “RMD101203”
in Fic. 1, which is only found in xeric oak stands of the central valley and
southern California and differs significantly in colors (Fic. 8b). All members
of the /cupreorufus clade share large (10-13 um) amygdaloid spores with very
rough ornamentation.
Complete iconography of C. mikedavisii and a comparative image study is
available on http://www.mushroomhobby.com.
Acknowledgements
The author is grateful to Dr. Else C. Vellinga and Dr. Boris Assyov for their
presubmission reviews and comments. Dr. Shaun Pennycook was very helpful in
answering nomenclatural questions during the preparation of this manuscript. Boris
Assyov reviewed and corrected the Latin diagnosis.
Literature cited
Anonymous. 2000. Munsell” soil color charts, revised edition. Munsell Color, New Windsor, NY.
Bidaud A, Carteret X, Eyssartier G, Moénne-Loccoz P, Reumaux P. 2004. Atlas des Cortinaires
Vol. 14. Editions Fédération mycologique Dauphiné-Savoie, Lyon.
Bojantchev D, Davis RM. 2011 Cortinarius xanthodryophilus sp. nov. — a common Phlegmacium
under oaks in California. Mycotaxon 116: 317-328. http://dx.doi.org/10.5248/116.317
Brandrud TE, Lindstrém H, Marklund H, Melot J, Muskos S. 1994. Cortinarius Flora Photographica
Vol. 3. Cortinarius HB, Matfords, Sweden.
Froslev TG, Jeppesen TS, Lzessge T, Kjoller R. 2007. Molecular phylogenetics and delimitation of
species in Cortinarius section Calochroi (Basidiomycota, Agaricales) in Europe. Mol. Phylogenet.
Evol. 44: 217-227. http://dx.doi.org/10.1016/j.ympev.2006.11.013
Garnica S, Weif’ M, Oertel B, Ammirati J, Oberwinkler F. 2009. Phylogenetic relationships in
Cortinarius, section Calochroi, inferred from nuclear DNA sequences. BMC Evol. Biol. 9(1):
[1]-[17]. http://dx.doi.org/10.1186/1471-2148-9-1
Katoh K, Misawa K, Kuma KI, Miyata T. 2002. MAFFT: a novel method for rapid multiple
sequence alignment based on fast Fourier transform. Nucleic Acids Res. 30: 3059-3066.
http://dx.doi.org/10.1093/nar/gkf436
272 ... Bojantchev
Moser MM. 1960. Die Gattung Phlegmacium (Schleimk6pfe). Die Pilze Mitteleuropas, Vol. 4.
J. Klinkhart, Bad Heilbrunn.
Steglich W, Oertel B. 1985. Untersuchungen zur Konstitution und Verbreitung der Farbstoffe von
Cortinarius, Untergattung Phlegmacium (Agaricales). Sydowia 37: 284-295.
Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis
(MEGA) software version 4.0. Mol. Biol. Evol. 24: 1596-1599.
http://dx.doi.org/10.1093/molbev/msm092
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.273
Volume 118, pp. 273-282 October-December 2011
Observations on gasteroid Agaricomycetes
from the Brazilian Amazon rainforest
LARISSA TRIERVEILER-PEREIRA™, ALLYNE CHRISTINA GOMES-SILVA?
& IURI GOULART BASEIA?
"Departamento de Micologia, Universidade Federal de Pernambuco,
Av. Nelson Chaves s/n, Recife -PE, 50670-420, Brazil
?Departamento de Botanica, Ecologia e Zoologia, Universidade Federal do Rio Grande do Norte,
Campus Universitario, Natal - RN, 59072-970, Brazil
*CORRESPONDENCE TO: /[email protected]
ABSTRACT — Field trips carried out in an indigenous protected area in the states of Rondénia
and Mato Grosso (Brazil) in 2009 revealed new records: Geastrum albonigrum, new from
South America; and Geastrum lageniforme, Mutinus caninus, and Tulostoma exasperatum,
new from the Brazilian Amazon rainforest. Descriptions, photographs, and line drawings of
the specimens are presented.
Key worps — Basidiomycota, fungal taxonomy, gasteromycetes, neotropical mycota
Introduction
The Amazon rainforest is recognized as one of the areas with higher
biodiversity of the globe. Interesting data on macrofungal taxonomy from
the Brazilian Amazon rainforest have been published recently by Desjardin &
Braga-Neto (2007), Martins-Junior et al. (2008), Gibertoni (2008), Gibertoni et
al. (2008), Gomes-Silva et al. (2008, 2009, 2010a,b, 2011), Sotao et al. (2008),
Gomes-Silva & Gibertoni (2009), Trierveiler-Pereira et al. (2009a), and Baltazar
et al. (2010). However, gasteromycete diversity is poorly known in this Brazilian
ecosystem.
Although more than two hundred species of gasteroid fungi have been
acknowledged from Brazil (Trierveiler-Pereira & Baseia 2009), fewer than
fifteen species are known to occur in the Amazon rainforest, an unexplored
highly diverse area.
Species of gasteroid fungi previously recorded from the Brazilian Amazon
forest are listed in Trierveiler-Pereira et al. (2009a), including the description of
the new species, Cyathus amazonicus Trierveiler-Pereira & Baseia.
274 ... Trierveiler-Pereira, Gomes-Silva & Baseia
“66° =AMAZONAS “60°
go
-
°
PORTO VELHO
RONDONIA
Fic. 1. Location of the “Terra Indigena Sete de Setembro’ (hatched area)
in the states of Rondénia and Mato Grosso (Brazil).
Materials & methods
Fungi were collected along pre-existing trails in a Brazilian indigenous protected area
called “Terra Indigena Sete de Setembro’ (TISS). This territory shelters ten indigenous
tribes distributed in the states of Rondénia (RO) and Mato Grosso (MT) (Fie. 1). In this
area there are about 1200 indigenous individuals from the ethnic group of Paiter-Surui.
The TISS extends over approximately 249 thousand hectares and its territory is mostly
covered by the Amazonian dense ombrophilous forest (RADAMBRASIL 1978, Ferronato
& Nunes 2010).
Field trips were carried out from May 28" to June 06" 2009 in the tribal areas
‘Sertanista Apoena Meirelles’ (Rondolandia, MT; 10°10'15"S 59°28'14"W) and
‘Lapetanha’ (Cacoal, RO; 11°26'19"S 61°26'50"W).
The collected basidiomata were placed in paper bags or plastic containers prior to
analysis. Macroscopic descriptions are based on observations of fresh and dried material
(Miller & Miller 1988). Colors are coded according to Kornerup & Wanscher (1978).
Microscopic observations of tissues from dried specimens mounted in 5% KOH were
made under a light microscope.
Gasteroids from the Amazon (Brazil) ... 275
Voucher specimens were deposited in the Herbarium HFSL and duplicates were sent
to Herbarium URM. Additional specimens deposited in MA-Fungi, ICN, and MBM
were also examined. Gasteromycete specimens cited in Capelari & Maziero (1988) were
borrowed from the Herbarium SP to confirm identification. Herbarium acronyms are
according to Thiers (2011).
Taxonomy
Geastrum albonigrum Calonge & M. Mata, Bol. Soc. Micol. Madrid
28: 332. 2004. FIG 2, 4A
SPECIMENS EXAMINED: BRAZIL. Mato Grosso, RONDOLANDIA, Terra Indigena Sete
de Setembro, Aldeia Apoena Meirelles, 30.V.2009, leg. Gomes-Silva et al. 209 (URM
82098).
IMMATURE BASIDIOMATA epigeous, globose to ovoid, 2.1 cm high x 1.5 cm
broad, grayish brown (4C5) to yellowish brown (5F5), hirsute, with a single
robust rhizomorph attached at the base, rhizomorph ramified or not, 0.6-1.8
cm length, with debris strongly attached. EXPANDED BASIDIOMATA 0.7-1.9 cm
high x 2-3.4 cm broad. ExopEeRipIuM non-hygroscopic, split into 6-7 rays,
saccate or with rays becoming involute, more rarely arched; external layer
hirsute, grayish brown (4C5) to yellowish brown (5F5), peeling off at maturity;
fleshy layer persistent, brown (6E5) to grayish brown (6E3), with a purplish
shade. ENDOPERIDIUM globose to depressed globose, 0.7-1.6 cm high x
1.2-1.6 cm broad, brown (6E6), sessile, without apophysis; peristome fibrillose,
not delimited, slightly darker than endoperidium. GLEBa pulverulent at
maturity, dark brown (6F4).
BASIDIOSPORES globose, 4-4.5 um diam. (including ornamentation),
yellowish brown to dark brown in KOH, ornamented with short columns.
CAPILLITIAL HYPHAE straight, thick-walled, with narrow lumen, pale brown to
yellowish brown in KOH, 3-6 um diam., not branched.
ECOLOGY & DISTRIBUTION: Gregarious on rotten wood, without subiculum.
The Brazilian material represents the first record from South America.
Previously known from Costa Rica, Mexico, and Panama. It is possible that
the species occurs in neotropical rainforests and warmer regions of temperate
America.
ADDITIONAL SPECIMENS EXAMINED: COSTA RICA. GUANACASTE, TEMPISQUE,
Parque Nacional Palo Verde, 27.1X.2003, leg. I. Lopez 4869 (MA-Fungi 59260, isotype);
20.X.2004, leg. I. Lopez 6277 (MA-Fungi 65423); MEXICO. Curapas, Tapachula,
03.X.1993, leg. G. Guzman 30743 (MA-Fungi 59258); PANAMA. IsLa DE Corsas,
Cerro de la X, 14.XII.1996, leg. Pando & Nunez (MA-Fungi 36140-2).
REMARKS: Geastrum albonigrum is characterized by an epigeous hirsute
form when young, a saccate or involute exoperidium that peels off in age, a
sessile endoperidium, and a non-delimited fibrillose peristome. When the
dark hirsute external exoperidial layer peels off, it reveals a white fibrous layer
276 ... Trierveiler-Pereira, Gomes-Silva & Baseia
where the rhizomorph remains attached. The fleshy layer is purplish and the
endoperidium is dark.
Brazilian material differs from the holotype in spore measurements (3-5 um
in the original description) and the presence of a narrow lumen in the capillitial
threads (absent in the material described by Calonge & Mata 2004).
Geastrum albonigrum belongs to the group of epigeous xylophilous Geastrum
species, such as G. schweinitzii (Berk. & M.A. Curtis) Zeller, G. hirsutum Baseia
& Calonge, and G. javanicum Lév., all of which differ by forming a white
subiculum over the substrata (Ponce de Leén 1968, Baseia et al. 2003, Baseia &
Calonge 2006), a character not seen in G. albonigrum.
Geastrum hirsutum also has a hirsute exoperidium that peels off at maturity,
but lacks a robust rhizomorph, has a delimited peristome, and a light-colored
endoperidium and fleshy layer. Similar to G. hirsutum, G. schweinitzii produces
smaller basidiomata lacking a hirsute external layer. Geastrum javanicum has
no hirsute external layer and it rarely peels off completely (Trierveiler-Pereira
et al. 2011).
Geastrum lageniforme Vittad., Monogr. Lycoperd.: 16. 1842. FIG 3A, 4B
SPECIMENS EXAMINED: BRAZIL. Mato Grosso, RONDOLANDIA, Terra Indigena Sete
de Setembro, Aldeia Apoena Meirelles, 30.V.2009, leg. Gomes-Silva et al. 206, 222 (URM
82099, 82100).
IMMATURE BASIDIOMATA not observed. EXPANDED BASIDIOME 0.7-1.0 cm
high x 2.3-3.0 cm diam. Exoperipium non-hygroscopic, split into 6-8 rays,
saccate, rays long, slender, external layer glabrous, with longitudinal ridges,
grayish yellow (1B5) to blond (4C4); fleshy layer persistent, brownish gray
(6C2). ENDOPERIDIUM globose, 0.7-0.9 cm high x 1.0-1.2 cm broad, grayish
beige (4C2) to brownish gray (5D2), sessile, without apophysis; peristome
fibrillose, grayish brown (5E3), delimited by a whitish line. GLEBA pulverulent
at maturity, brownish gray (5E2).
BASIDIOSPORES globose, 3.5-5 um diam. including the ornamentation,
yellowish brown in KOH, ornamentation columnar. CAPILLITIAL HYPHAE
straight to more or less sinuous, slightly thick-walled, with narrow lumen,
yellowish in KOH, 2.5-8.0 um diam., not branched.
ECOLOGY & DISTRIBUTION: Solitary on forest soil. Widespread (Calonge et
al. 2004). In Brazil, the species has been reported from the states of Rio Grande
do Sul (Rick 1961, Cortez et al. 2008), Rio de Janeiro (Hennings 1904), Bahia
(Trierveiler-Pereira et al. 2009b), and Pernambuco (Trierveiler-Pereira et al.
2011). This is the first record from the Brazilian Amazon rainforest.
ADDITIONAL SPECIMEN EXAMINED: SPAIN. BURGOS, QUINTANA DEL PIDIO, 22.X1.1991,
leg. L.A. Parra (MA-Fungi 30752).
REMARKS: Geastrum lageniforme resembles G. saccatum Fr. in a saccate
exoperidium, sessile endoperidium, and fibrillose delimited peristome (Trierveiler-
Gasteroids from the Amazon (Brazil) ... 277
Fic. 2. Geastrum albonigrum.
A. Mature and immature basidiomata in situ.
B. Basidiomata in different stages of development.
Pereira et al. 2011). According to Sunhede (1989), the two species can be
distinguished by the presence of clamped hyphae in the external mycelial layer,
which occur only in G. lageniforme.
278 ... Trierveiler-Pereira, Gomes-Silva & Baseia
Ponce de Leon (1968) considered G. lageniforme a synonym of G. indicum
(Klotzsch) Rauschert (= G. triplex Jungh.), but there are characteristics that can
separate these two species, since G. triplex is usually larger, with involute rays,
and forms a fleshy collar around the endoperidium.
Mutinus caninus (Huds.) Fr., Summa Veg. Scand. 2: 434. 1849. FIG 3C, 4C
SPECIMEN EXAMINED: BRAZIL. RONDONIA, CACOAL, Terra Indigena Sete de Setembro,
Aldeia Lapetanha, 05.VI.2009, leg. Gomes-Silva et al. 126 (URM 82101).
BASIDIOME 5.5 cm high, with a whitish rhizomorph attached at the base,
rhizomorph ramified, up to 2.2 cm long. VoLva saccate, 1.6 cm high x
1 cm broad, yellowish white (1A2). PseuDosTIPE cylindrical, tapering at the
apex, 4.1 cm high x 0.7 cm broad, spongy, light orange (5A4) at the base and
becoming reddish towards the apex, fertile region reddish orange (7B8). GLEBA
mucilaginous, olive brown (4F5), covering the fertile region.
Basiprosporgs cylindrical, 4.5-5.5 x 1.5 um, hyaline to greenish in KOH,
smooth, biguttulate.
ECOLOGY & DISTRIBUTION: Solitary on forest soil. Cosmopolitan, but rare in
the tropics (Baseia et al. 2006). In Brazil the species was reported only from Rio
Grande do Norte (Baseia et al. 2006). This is the first record from the Brazilian
Amazon rainforest.
ADDITIONAL SPECIMENS EXAMINED: Mutinus caninus — SPAIN. GUIPUZCOA, SAN
SEBASTIAN, 16.X.1976, leg. Sociedad de Ciencias Naturales Arazandi (MA-Fungi 22361).
Mutinus elegans - SPAIN. LuGo, CHANTADA, 03.X1.1999, leg. M.T. Jacobo s/n (MA-
Fungi 42064); BRAZIL. Rio GRANDE DO SUL, VIAMAO, Parque Estadual de Itapua,
22.V.2004, leg. V.G. Cortez 016/04 (ICN 139004).
REMARKS: Mutinus caninus is similar to M. elegans (Mont.) E. Fisch. but forms
a well delimited gleba on the apical zone; the glebal zone is not defined in
M. elegans (Calonge 1996). The pseudostipe in the examined material is
yellowish, but according to Calonge (1996) it may also be whitish or pinkish.
Zeller (1944) described a white variant of this species, M. caninus var. albus
Zeller.
Tulostoma exasperatum Mont., Ann. Sci. Nat., Bot., Sér. 2, 8: 362. 1837. FIG 3B, 4D
SPECIMENS EXAMINED: BRAZIL. RONDONIA, CACOAL, Terra Indigena Sete de Setembro,
Aldeia Lapetanha, 06.VI.2009, leg. Gomes-Silva et al. 100, 145 (URM 82102, 82103).
BASIDIOMATA 1.1-7.0 cm high. SporE sac globose to depressed-globose,
0.6-0.8 cm high x 1.8-2.2 cm broad. Exoperidium spiny, light brown (5E7),
peeling off at maturity. Endoperidium reticulate, papery, yellowish white (2A2)
to pale yellow (4A3); peristome conical, slightly lighter than endoperidium,
fibrillose, delimited. GLEBA dull yellow (3B3). Stipe 0.9-6.1 cm high x 0.2-0.25
cm diam., light brown (5E7), with longitudinally arranged scales.
Gasteroids from the Amazon (Brazil) ... 279
Fic. 3. Gasteroid species from the Brazilian Amazon rainforest.
A. Geastrum lageniforme. B. Tulostoma exasperatum. C. Mutinus caninus.
BasIpiosPorEs globose to subglobose, 6-7.5 um diam., yellowish in KOH,
with a columnar-reticulate ornamentation. CAPILLITIAL HYPHAE straight to
tortuous, thick-walled, swollen at the septa, branched, light yellow in KOH,
4-7 um diam.
ECOLOGY & DISTRIBUTION: Gregarious on rotten wood. Widely distributed
in tropical and subtropical regions (Wright 1987). In Brazil the species is known
from Rio Grande do Sul (Rick 1961, Cortez et al. 2009), Parana (Meijer 2006),
Paraiba (Silva et al. 2007), Sao Paulo and Pernambuco (Baseia & Milanez 2002).
This is the first record from the Brazilian Amazon rainforest.
ADDITIONAL SPECIMEN EXAMINED: BRAZIL. RIO GRANDE DO SUL, VIAMAO, Parque
Estadual de Itapua, 25.VI1.2005, leg. R.M. Silveira 456 (ICN 154635); PARANA, TIBAGI,
Quartela, 06.1X.1992, leg. A.A.R. de Meijer 2341 (MBM).
REMARKS: Among the 14 Tulostoma species recorded from Brazil (Baseia &
Milanez 2002, Meijer 2006, Silva et al. 2007, Cortez et al. 2009), T: exasperatum
is the only one with a lignicolous habit. Tulostoma species usually occur on
sandy soil, pastures, humus, forest soil and even flooded areas (Wright 1987).
280 ... Trierveiler-Pereira, Gomes-Silva & Baseia
Fic. 4. Line drawings of microscopic elements.
A. Geastrum albonigrum: capillitial threads and spores.
B. G. lageniforme: capillitial threads and spores. C. Mutinus caninus: spores.
D. Tulostoma exasperatum: capillitial threads and spores (scale bar = 10 um).
Specimens kept in SP
We reviewed and confirmed the identities of the following gasteromycetes
previously reported from the Brazilian Amazon rainforest by Capelari &
Maziero (1988): SP 211544, SP 211545, SP 211547, and SP 211548 as Cyathus
montagnei Tul. & C. Tul.; SP 214636 as C. limbatus Tul. & C. Tul.; and SP 211223
and 211526 as Morganella fuliginea (Berk. & M.A. Curtis) Kreisel & Dring. The
immature basidiomata in SP 211549 could not be identified morphologically.
We did not review SP 211527 (labelled as Morganella sp.) or SP 211301 (labelled
as Lycoperdon sp.).
Acknowledgments
We thank the people of Paiter; Associacao Metareila do Povo Indigena Surut’;; ‘Equipe
de Conservacao da Amazénia - ACT Brasil’; ‘Associagao de Defesa Etnoambiental
Kanindé and ‘Fundacao Nacional do Indio (FUNAI)’ The United States Agency for
International Development (USAID) is acknowledged for financial support. We
also would like to thank the curators of SP, ICN and MBM for specimen loans and
Gasteroids from the Amazon (Brazil) ... 281
Dr. Francisco D. Calonge (CSIC, RJB de Madrid) for the access to the MA-Fungi
exsiccata. LTP acknowledges PROPESQ (‘Pré-Reitoria para Assuntos de Pesquisa e Pés-
Graduacao, UFPE) and PPGBF (‘Programa de Pés-Graduacao em Biologia de Fungos,
UFPE) for financial support. We are grateful to Admir J. Giachini (Universidade Federal
de Santa Catarina, Brazil) and André A.R. de Meijer (Parana, Brazil) for critically reading
the manuscript.
Literature cited
Baltazar JM, Ryvarden L, Gibertoni TB. 2010. The genus Coltricia in Brazil: new records and two
new species. Mycologia 102(6): 1253-1262. http://dx.doi.org/10.3852/09-227
Baseia IG, Calonge FD. 2006. Geastrum hirsutum: a new earthstar fungus with a hairy exoperidium.
Mycotaxon 95: 301-304.
Baseia IG, Milanez AI. 2002. Tulostoma (Gasteromycetes) from the cerrado region, State of Sao
Paulo, Brazil. Acta Bot. Brasil. 16(1): 9-14.
Baseia IG, Cavalcanti MA, Milanez AI. 2003. Additions to our knowledge of the genus Geastrum
(Phallales: Geastraceae) in Brazil. Mycotaxon 85: 409-416.
Baseia IG, Calonge FD, Maia LC. 2006. Notes on the Phallales in the Neotropics. Bol. Soc. Micol.
Madrid 30: 87-93.
Calonge FD. 1996. Claves de identificacién de los Gasteromycetes epigeos ibéricos. Bol. Soc. Micol.
Madrid 21: 359-373.
Calonge FD, Mata M. 2004. A new species of Geastrum from Costa Rica and México. Bol. Soc.
Micol. Madrid 28: 331-335.
Calonge FD, Guzman G, Ramirez-Guillén F. 2004. Observaciones sobre los gasteromycetes de
México depositados en los Herbarios XAL y XALU. Bol. Soc. Bot. Madrid 28: 337-371.
Capelari M, Maziero R. 1988. Fungos macroscépicos do estado de Rond6nia. Regiao dos Rios Jaru
e Ji-Parana. Hoenea 15: 28-36.
Cortez VG, Baseia IG, Silveira RMB. 2008. Gasteromicetos (Basidiomycota) no Parque Estadual
de Itapua, Viamao, Rio Grande do Sul, Brasil. Revista Brasileira de Biociéncias (Porto Alegre)
6(3): 291-299.
Cortez VG, Baseia IG, Silveira RMB. 2009. Gasteroid mycobiota of Rio Grande do Sul, Brazil:
Tulostomataceae. Mycotaxon 108: 365-384.
Desjardin DE, Braga-Neto R. 2007. Mycena lacrimans, a rare species from Amazonia, is
bioluminescent. Edinburgh J. Bot. 64: 275-281. http://dx.doi.org/10.1017/S0960428607004763
Ferronato, Nunes. 2010. A exploracao ilegal de madeiras na Terra Indigena Sete de Setembro,
Cacoal — RO. Revista FACIMED 2(2): 1-12.
Gibertoni TB. 2008. Polyporoid fungi (Agaricomycetes, Basidiomycota) in the Estacao Cientifica
Ferreira Penna (State of Para, Brazilian Amazonia): diversity and ecological aspects. Scientifica
Acta 2(2): 70-74.
Gibertoni TB, Bernicchia A, Ryvarden L, Gomes-Silva AC. 2008. Bresadolas polypore collection at
the Natural History Museum of Trento, Italy 2. Mycotaxon 104: 321-323.
Gomes-Silva AC, Gibertoni TB. 2009. Revisio do Herbaério URM. Novas ocorréncias
de Aphyllophorales para a Amazonia brasileira. Revista Brasil. Bot. 32(3): 587-596.
http://dx.doi.org/10.1590/S0100-84042009000300016
Gomes-Silva AC, Ryvarden L, Gibertoni TB. 2008. Coltricia fragilissima, a new record for Brazil.
Mycotaxon 105: 469-472.
Gomes-Silva AC, Ryvarden L, Gibertoni TB. 2009. New and interesting species of Hymenochaetaceae
from the Brazilian Amazonia. Micol. Progr. 8: 273-279.
http://dx.doi.org/10.1007/ s11557-009-0606-4
282 ... Trierveiler-Pereira, Gomes-Silva & Baseia
Gomes-Silva AC, Baltazar JM, Ryvarden L, Gibertoni TB. 2010a. Amauroderma calcigenum
(Ganodermataceae, Basidiomycota) and its presumed synonym A. partitum. Nova Hedwigia
90(3-4): 449-455. http://dx.doi.org/10.1127/0029-5035/2010/0090-0449
Gomes-Silva AC, Ryvarden L, Gibertoni TB. 2010b. Notes on Trametes from the Brazilian
Amazonia. Mycotaxon 113: 61-71. http://dx.doi.org/10.5248/113.61
Gomes-Silva AC, Ryvarden L, Gibertoni TB. 2011. Newrecords of Ganodermataceae (Basidiomycota)
from Brazil. Nova Hedwigia 92(1-2): 83-94.
http://dx.doi.org/10.1127/0029-5035/ 2011/0092-0083
Hennings P. 1904. Fungi fluminenses a cl. E. Ule collecti. Hedwigia 43: 78-95.
Kornerup A, Wanscher JH. 1978. Methuen Handbook of Colour. 3rd ed. London, Eyre Methuen.
Martins-Junior A, Gibertoni T, Sotao H. 2008. Diplomitoporus allantosporus (Basidiomycetes):
a new record for Brazil. Mycotaxon 106: 195-198.
Meijer AAR. 2006. Preliminary list of the macromycetes from the Brazilian State of Parana. Boletim
do Museu Botanico Municipal, Curitiba 68: 1-55.
Miller OK Jr, Miller HH. 1988. Gasteromycetes: morphology and developmental features. Eureka,
Mad River Press.
Ponce de Leon P. 1968. A revision of the Geastraceae. Fieldiana, Bot. 31: 303-349.
RADAMBRASIL. 1978. Levantamento de recursos naturais. Folha Porto Velho, Vol. 16. Rio de
Janeiro, IBGE.
Rick J. 1961. Basidiomycetes Eubasidii no Rio Grande do Sul. Brasilia. Iheringia 9: 451-480.
Silva BDB, Calonge FD, Baseia IG. 2007. Studies on Tulostoma (Gasteromycetes) in the Neotropics.
Some Brazilian species. Mycotaxon 101: 47-54.
Sotao HMP, Gibertoni TB, Maziero R, Baseia IG, Medeiros PS, Martins-Junior AS, Capelari M.
2008. Fungos macroscdépicos da Floresta Nacional de Caxiuana, Para, Brasil: Basidiomycota
(Agaricomycetes). 383-396, in Lisboa PLB (org.), Caxiuana: desafios para a conservacao de uma
Floresta Nacional na Amazonia. Belém, Museu Paraense Emilio Goeldi.
Sunhede S. 1989. Geastraceae (Basidiomycotina). Morphology, ecology and systematics with special
emphasis on the North European species. Syn. Fungorum 1: 1-534.
Thiers B. 2011 [continuously updated]. Index Herbariorum: a global directory of public herbaria
and associated staff. New York Botanical Garden's Virtual Herbarium. http://sweetgum.nybg.
org/ih/ [accessed April 2011]
Trierveiler-Pereira L, Baseia IG. 2009. A checklist of the Brazilian gasteroid fungi (Basidiomycota).
Mycotaxon 108: 441-444. http://dx.doi.org/10.5248/108.441
Trierveiler-Pereira L, Gomes-Silva AC, Baseia IG. 2009a. Notes on gasteroid fungi of the Brazilian
Amazon rainforest. Mycotaxon 110: 73-80. http://dx.doi.org/10.5248/110.73
Trierveiler-Pereira L, Bezerra KMT, Bezerra JL, Baseia IG. 2009b. First records of Geastraceae and
Nidulariaceae (Basidiomycota, Fungi) from Bahia, northeastern Brazil. Revista Brasileira de
Biociéncias (Porto Alegre) 7(3): 316-319.
Trierveiler-Pereira L, Calonge FD, Baseia IG. 2011. New distributional data on Geastrum
(Geastraceae, Basidiomycota) from Brazil. Acta Bot. Brasil. (in press).
Wright JE. 1987. The genus Tulostoma (Gasteromycetes). A world monograph. Berlin-Stuttgart,
J. Cramer Press.
Zeller SM. 1944. A white variety of Mutinus caninus. Mycologia 36(3): 263-265.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.283
Volume 118, pp. 283-288 October-December 2011
Septobasidium saurauiae sp. nov. (Septobasidiaceae)
and S. pseudopedicellatum new to China
SUZHEN CHEN?” & LIN Guo’*
'Key Laboratory of Systematic Mycology and Lichenology, Institute of Microbiology,
Chinese Academy of Sciences, Beijing 100101, China
?Ocean University of China, Qingdao 266003, China
CORRESPONDENCE TO *: [email protected] & *[email protected]
ABSTRACT—A new species, Septobasidium saurauiae on Saurauia tristyla associated with
Chionaspis sp., and a new Chinese record, Septobasidium pseudopedicellatum on Schefflera
octophylla and Psychotria serpens, are described. They were collected from Hainan Province.
Key worps—Pucciniomycetes, Septobasidiales, taxonomy
Hainan Island is located in the South China Sea. It is a tropical area with a
rich fungal diversity. To date, six new species and one new Chinese record of
Septobasidium have been discovered from this Province (Chen & Guo 2011b,
Lu & Guo 2009a, 2010b,c). An additional new species and a new Chinese record
of Septobasidium are reported as follows:
Septobasidium saurauiae S.Z. Chen & L. Guo, sp. nov. Fics. 1-7
MycoBank MB 561871
Basidiomata resupinata, discontinue crescentia, 6-7 cm longa, 3-4 cm lata, cinnamomeo-
brunnea vel griseo-brunnea, margine determinata, superficie laevia, saepe protuberationibus
rotundis praedita, in sectione 900-1330 um crassa. Subiculum brunneum, 30-50 um
crassum, ab subiculo stratum hypharum vel curtam columnam formans. Columnae
brunneae, 20-50 ym altae, 20-70 um latae. Strata hyphararum 780-970 um alta. Ab
strato hymenii hyphae saepe repullulantes tum stratum hypharum et hymenium secundum
formantes. Stratum hypharum secundum 200-240 um altum. Hymenium hyalinum,
40-50 um crassum. Basidia cylindrica, recta vel leviter curvata, 4-cellularia, 42-50 x 6-8
um, hyalina. Sine probasidio. Basidiosporae 10-25 x 4-6 um, hyalinae. Haustoria hyalina,
ex hyphis irregulariter spiralibus constantia.
Type: China, Hainan Province, Limu Mountain, alt. 529 m, on Saurauia tristyla DC.
(Actinidiaceae), associated with Chionaspis sp. (Diaspididae), 23.X1.2010, Y.R Zhu &
FE. He 520 (holotype, HMAS 263145 ).
284 ... Chen & Guo
1 A
- /
/
B
+4
10 pm
Fic. 1. Basidia and basidiospores of Septobasidium saurauiae (HMAS 263145, holotype).
Basidiomata on branches, resupinate, growing discontinuously, 6-7 cm long,
3-4 cm wide, cinnamon-brown or grey-brown; margin determinate, surface
smooth, frequently with round protuberance. In section 900-1330 um thick.
Subiculum brown, 30-50 um thick. Forming hyphal layer or short pillars.
Pillars brown, 20-50 um high, 20-70 um wide. Hyphal layer 780-970 um
high. From hymenial layer the fungal hyphae often renew growth to form the
second hyphal layer and hymenium. Second hyphal layer 200-240 um high.
Hymenium hyaline, 40-50 um thick. Basidia arising directly from the hyphae
without a probasidial cell, at first obovoid, later cylindrical, straight or slightly
curved, 4-celled, 42-50 x 6-8 um, hyaline. Basidiospores 10-25 x 4-6 um,
hyaline. Haustoria hyaline, consisting of irregularly coiled hyphae.
REMARKS: Morphologically, Septobasidium saurauiaeis similar to S. meizhouense
C.X. Lu et al., which differs in numerous cracks in the basidioma surface and
a thinner section (400-650 um high) and hyphal layer (220-440 um high)
(Lu et al. 2010).
Fics. 2-7 (right). Septobasidium saurauiae (HMAS 263145, holotype). 2. Basidiomata on branch.
3-4. Sections of basidiomata. 5-6. Basidia (arrows). 7. Haustoria.
Septobasidium saurauiae sp. nov. (China) ... 285
286 ... Chen & Guo
Fic. 8. Basidia and probasidia of Septobasidium pseudopedicellatum (HMAS 242745).
Septobasidium pseudopedicellatum Burt, Ann. Mo. bot. Gdn 3: 327, 1916.
Fics. 8-14
Basidiomata on trunks, branches and leaves, resupinate, 0.3-19 cm long,
0.2-9 cm wide, chestnut brown, brown or smoke grey; margin white,
determinate, surface smooth. The pillars near the margin are visible with naked
eyes. In section 850-1700 um thick. Subiculum white or brown, 30-50 um
thick. Pillars brown, 500-700 um high, 50-170 um wide. The pillars branch out
to form hyphal layer, 400-650 um high. From hymenial layer the fungal hyphae
often renew growth to form the second hyphal layer and hymenium, up to
3-strata. Hymenium brown, 40-60 um thick, with closely packed paraphyses
that are parallel, upright and curved at top. Probasidia hyaline or brownish,
obovoid or ellipsoidal, 16-20 x 10-16 um. Basidia cylindrical, straight or
slightly curved, 4-celled, 52-62 x 5-7.5 um, hyaline, with persisting probasidial
cell. Sterigmata conical, 2.5-8 x 2.5-3.5 um. Basidiospores not seen. Haustoria
consisting of irregularly coiled hyphae.
SPECIMENS EXAMINED: CHINA, HaINAN PROVINCE, Bawangling Natural Reserve,
Nanchahe, alt. 600 m, on Schefflera octophylla (Lour.) Harms (Araliaceae), 14.1V.2011,
L.Guo 11611, HMAS 242745; on Psychotria serpens L. (Rubiaceae), 14.IV.2011, L.Guo
11612, HMAS 251216.
Fics. 9-14 (right). Septobasidium pseudopedicellatum (HMAS 242745). 9. Basidiomata on trunk.
10-11. Sections of basidiomata. 12. Probasidia (arrows). 13. Basidium (arrow). 14. Haustoria.
Septobasidium saurauiae sp. nov. (China) ... 287
288 ... Chen & Guo
Including the two species reported in this paper, 35 Septobasidium species have
now been reported in China (Sawada 1933, Couch 1938, Teng 1963, Tai 1979,
Kirschner & Chen 2007, Lu & Guo 2009a,b,c, 2010a,b,c, 2011, Lu et al. 2010,
Chen & Guo 2011a,b).
Acknowledgements
The authors would like to express their deep thanks to Drs. Eric H.C. McKenzie
(Auckland, New Zealand) and Shuanghui He (Beijing Forestry University) for serving
as pre-submission reviewers, to Dr. Shaun Pennycook (Auckland, New Zealand) for
nomenclatural review, to Prof. Jian-Yun Zhuang (Institute of Microbiology, Chinese
Academy of Sciences) for Latin corrections, to Prof. Zhenyu Li and Mr. Ziyu Cao
(Institute of Botany, Chinese Academy of Sciences) and Mr. Qing Chen (Bawangling
Natural Reserve, Hainan Province) for identifying the host plants, to Prof. Sanan Wu
(Beijing Forestry University) for identifying the scale insect, and to Mrs. Xiangfei Zhu
for inking in line drawings. This study was supported by the Foundation of Ministry of
Science and Technology of the People’s Republic of China (No. 2006FY110500-5).
Literature cited
Chen SZ, Guo L. 2011la. Septobasidium sichuanense sp. nov. (Septobasidiaceae) from China.
Mycotaxon 115: 481-484. http://dx.doi.org/10.5248/115.481
Chen SZ, Guo L. 2011b. Septobasidium atalantiae sp. nov. (Septobasidiaceae) and S. henningsii new
to China. Mycotaxon 117: 291-296. http://dx.doi.org/10.5248/117.291
Couch JN. 1938. The genus Septobasidium. Univ. of North Carolina Press, Chapel Hill. 480 p.
Kirschner R, Chen CJ. 2007. New reports of two hypophyllous Septobasidium species from Taiwan.
Fung. Sci. 22(1,2): 39-46.
Lu CX, Guo L. 2009a. Septobasidium maesae sp. nov. (Septobasidiaceae) from China. Mycotaxon
109: 103-106. http://dx.doi.org/10.5248/109.103
Lu CX, Guo L. 2009b. Two new species of Septobasidium (Septobasidiaceae) from China. Mycotaxon
109: 477-482. http://dx.doi.org/10.5248/109.477
Lu CX, Guo L. 2009c. Septobasidium annulatum sp. nov. (Septobasidiaceae) and Septobasidium
kameii new to China. Mycotaxon 110: 239-245. http://dx.doi.org/10.5248/110.239
Lu CX, Guo L. 2010a. Three new species of Septobasidium (Septobasidiaceae) from Gaoligong
Mountains in China. Mycotaxon 112: 143-151. http://dx.doi.org/10.5248/112.143
Lu CX, Guo L. 2010b. Two new species of Septobasidium (Septobasidiaceae) and S. pallidum new to
China. Mycotaxon 113: 87-93. http://dx.doi.org/10.5248/113.87
Lu CX, Guo L. 2010c. Two new species of Septobasidium (Septobasidiaceae) from Hainan province
in China. Mycotaxon 114: 217-223. http://dx.doi.org/10.5248/114.217
Lu CX, Guo L. 2011. Two new species of Septobasidium (Septobasidiaceae) from Gaoligong
Mountains in China. Mycotaxon 116: 395-400. http://dx.doi.org/10.5248/116.395
Lu CX, Guo L, Wei JG, Li JB. 2010. Two new species of Septobasidium (Septobasidiaceae) from
southern China. Mycotaxon 111: 269-274. http://dx.doi.org/10.5248/111.269
Sawada K. 1933. Descriptive catalogue of the Formosan fungi. Part VI. Rep. Dept. Agric. Govt. Res.
Inst. Formosa 61: 1-99.
Tai FL. 1979. Sylloge Fungorum Sinicorum. Science Press, Beijing. 1527 p.
Teng SC. 1963. Fungi of China. Science Press, Beijing. 808 p.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.289
Volume 118, pp. 289-292 October-December 2011
Hallenbergia (Agaricomycetes), a new corticioid genus
G.S. DHINGRA* & PRIYANKA
Department of Botany, Punjabi University, Patiala 147 002, India
* CORRESPONDENCE TO: [email protected]
ABSTRACT - A new corticioid genus, Hallenbergia, and its single species, H. singularis, are
described from Thimphu, Bhutan.
Key worps - Eastern Himalaya, Nawephu, angiosperm host
While conducting a fungal foray in Nawephu of Thimphu, Bhutan, Dhingra
made a collection on decaying angiospermous twigs. On the basis of
macroscopic and microscopic characters it was compared with similar genera
within Corticiaceae s.]. (Rattan 1977, Eriksson & Ryvarden 1976, Hjortstam et
al. 1987) but could not be assigned to any already known, hence the description
of a new genus. Morphological traits show similarities with Hypochnicium and
Intextomyces.
Hallenbergia Dhingra & Priyanka, gen. nov.
MycoBank MB 560467
Basidiocarpum resupinatum, adnatum, effusum, ceraceum; hymenium laevigatum,
farinaceum, subvitrum, continuum, rimosum in sicco; systema hyphale monomiticum;
hyphae tenuitunicatae, septatae, fibulatae; hyphae basilarae irregulariter ramosae, dense
intertextae; hyphae in subhymenio parvae-loculosae, compaginatae et apparenter cellulosae;
cystidia absum; basidia subclavatae ad suburniformes, 4-sterigmatae; basidiosporae
ellipsoidae ad ovoidae vel globosae, laeves, crassitunicatae, cyanophilae, inamyloidae.
Type SpEcIEs: Hallenbergia singularis Dhingra & Priyanka
Erymo.ocy: The name of the genus is in the honour of Prof. Nils Hallenberg.
Basidiocarp resupinate, adnate, effused, thin, ceraceous; hymenial surface
smooth, farinose under the lens, continuous, some cracks developing on
drying; margins not well differentiated. Hyphal system monomitic; generative
hyphae thin-walled, septate, clamped; basal hyphae irregularly branched and
interwoven into a dense texture; subhymenial hyphae short-celled, compactly
packed and appear like a cellular tissue. Cystidia absent. Basidia subclavate to
290 ... Dhingra & Priyanka
Com ayentan
AO / Se
aot st) SSeS
CORT .\ \ \ SN NEEEEY
ae eX
:
sae
anit
Pret .
| CSUMPURG TA
gl
=a
FO Bat \ Ni)
SAAN
=e
AA
eS
Aa
“ere
(}
is
mT LY \ eS
Ses, wn ee \ 3
y\
Gi A (f ( YA\ \
(
a) :
\ (i
\ \\
CSN :
HOY
\
\
\
\
\
\
i
em
aS
SS
DE
N
\t
-4. Hallenbergia singularis: microscopic structures:
1. basidiospores; 2. basidia; 3. generative hyphae; 4. vertical section through basidiocarp.
sterigmate. Basidiospores ellipsoid to ovoid or subglobose,
Fics 1
, with thickened walls, cyanophilous, inamyloid.
REMARKS—Hallenbergia resembles the genus Hypochnicium in having broadly
ellipsoid to subglobose basidiospores with somewhat thick and cyanophilous
walls. There are also affinities with Intextomyces in having a densely interwoven
texture. The new genus differs from both genera by the peculiar hyphal texture,
suburniform, 4-
smooth
Hallenbergia singularis gen. & sp. nov. (Bhutan) ... 291
Fic. 5. Hallenbergia singularis: basidiocarp showing hymenial surface.
with a densely and irregularly branched lower part and a pseudoparenchymatous
upper part. Moreover, it differs from Intextomyces in the way basidia are
formed. In I. contiguus (P. Karst.) J. Erikss. & Ryvarden, basidia are formed
at the apex of penetrating, sinuous hyphae, while in H. singularis the basidia
are directly produced from the surface of the pseudoparenchymatic tissue.
A sample has been studied by Prof. John Eriksson and Prof. Nils Hallenberg,
who both supported the concept of a new genus.
Hallenbergia singularis Dhingra & Priyanka, sp. nov. Fics 1-5
MycoBaAnk MB 560468
Basidiocarpum resupinatum, adnatum, effusum, ceraceum, ad 250 wm crassum;
hymenium laevigatum, farinaceum, subvitrum, continuum, rimosum in sicco; systema
hyphale monomiticum; hyphae ad 4.5 um latae, tenuitunicatae, fibulatae; hyphae
basilariae irregulariter ramosae, intricatae in textura compacta; hyphae in subhymenio
parvae-loculosae, compaginatae et appariter cellulosae; cystidia absum; basidia 15-33 x
7-10.5 um, subclavatae ad suburniformes, 4-sterigmatae; basidiosporae 6-9 x 4.5-7.5 um,
latae ellipsoidae ad ovoidae vel globosae, laeve, crassitunicatae, cyanophilae, inamyloidae,
un-i vel multiguttatae.
Type: Bhutan, Thimphu, Nawephu, on decaying angiospermous twigs, 31 July 1981,
Dhingra 19548 (PAN, holotype).
EryMoLocy: The epithet refers to the uncommon and strange combination of
microscopic features.
Basidiocarp resupinate, adnate, effused, thin, up to 250 um thick in section,
ceraceous; hymenial surface smooth to farinose under the lens, yellowish gray
to orange gray, continuous when fresh, some cracks developing on drying;
292 ... Dhingra & Priyanka
margins not well-differentiated. Hyphal system monomitic; generative hyphae
up to 4.5 um wide, thin-walled, septate, clamped; basal hyphae irregularly
branched and interwoven into a dense texture, covered in the upper half by
some crystalline material, followed by a narrow zone of compactly packed
horizontal hyphae; subhymenial hyphae short-celled, compactly packed and
appear like a cellular tissue. Cystidia absent. Basidia 15-33 x 7-10.5 um, at first
ellipsoid, then broadly subclavate to suburniform, rarely sinuous, basal clamp
not observed, 4-sterigmate, with oily contents; sterigmata up to 7 um long; anew
basidium generally takes the place of a decomposed basidium. Basidiospores
6-9 x 4.5-7.5 um, broadly ellipsoid to ovate or subglobose, smooth, somewhat
thick-walled, cyanophilous, inamyloid, with one large guttule or many small
oil drops.
REMARKS—As mentioned above Hallenbergia singularis is superficially similar
to Intextomyces contiguus. ‘The latter species is easily distinguished by smaller
spores and basidia.
Acknowledgements
Authors thank Prof. Nils Hallenberg (Gothenburg, Sweden) for valuable suggestions
and peer review; Prof. B.M. Sharma, Department of Plant Pathology, COA, CSKHPAU,
Palampur, H.P., India for peer review; Head, Department of Botany, Punjabi University,
Patiala, is thanked for providing research facilities.
Literature cited
Eriksson J, Ryvarden L. 1976. The Corticiaceae of North Europe - IV. Fungiflora, Oslo. pp.
549-886.
Hjortstam K, Larsson KH, Ryvarden L. 1987. The Corticiaceae of North Europe - I. Fungiflora,
Oslo. pp. 1-59.
Rattan SS. 1977. The resupinate Aphyllophorales of the North Western Himalayas. Bibliotheca
Mycologica 60: 1-427.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.293
Volume 118, pp. 293-302 October-December 2011
Cylindrochytridium johnstonii is a member of the Cladochytriales
REBECCA A. STEIGER, D. RABERN SIMMONS” & JOYCE E. LONGCORE
School of Biology & Ecology, University of Maine, 5722 Deering Hall, Orono, ME 04469 USA
* CORRESPONDENCE TO: [email protected]
ABSTRACT — The taxonomy of the Chytridiomycota has been in flux between a classical
system based on thallus morphology and a new system based on zoosporic ultrastructure and
analyses of genetic sequences. Chytridiales sensu Sparrow has been divided into 7 orders plus
undescribed lineages. We found and brought into pure culture Cylindrochytridium johnstonii,
the type species of the genus, which heretofore has not been characterized by molecular
methods. We confirmed that this species is a member of the Cladochytriales, but it does not
lie within a recognized family.
KEY wWORDs — nucLSU rDNA, nucSSU rDNA
Introduction
Molecular studies have led to new orders being segregated from the large
chytridiomycete order Chytridiales sensu Sparrow (Barr 1980; Letcher et al.
2006, 2008; Longcore & Simmons 2012; Mozley-Standridge et al. 2009; Simmons
et al. 2009), yet many genera and species were not represented in these studies
because they were unavailable in culture. Such species, which were classified
in the Chytridiales in the classical literature (e.g., Sparrow 1960, Karling 1977),
remain incertae sedis in the Chytridiomycetes. Therefore, when chytrids that
have not been studied with molecular tools are isolated into pure culture it
is appropriate to determine their taxonomic position in the new system and
provide photographs of developmental morphology. Reporting genetic data for
described species is intended to promote universal taxon concepts. The phylum
Chytridiomycota has previously relied on thallus morphologies and zoosporic
ultrastructure, both of which, at least to some extent, have led to paraphyletic
groupings (e.g. Chytridiales sensu Sparrow 1960, Chytridiales sensu Barr 1980)
compared to molecular phylogenies (James et al. 2000, 2006).
The genus Cylindrochytridium was described by Karling (1941) for C. johnstonii,
a species with unique developmental morphology that occurred on boiled grass
used as bait in samples of aquatic debris. Subsequently, C. johnstonii has been
294 ... Steiger, Simmons & Longcore
reported from sites around the world, including New Zealand (Karling 1968),
South America (Marano et al. 2008a,b; Rocha & Pires-Zottarelli 2002), Europe
(Czeczuga et al. 2007), and India (Karling 1963), but no authors have reported
isolating this fungus into pure culture. Its phylogenetic position therefore has
remained unconfirmed. We found this species growing on the edge of onionskin
bait placed with algae and aquatic debris collected from Smith’s Fen (Schwintzer
1978) during a field trip that was part of the 2008 centennial celebration of the
University of Michigan Biological Station in northern Michigan, USA. Herein
we report that C. johnstonii is a member of the Cladochytriales and support this
conclusion with molecular data. Also, we include photos of the development of
this chytrid in pure culture for comparison with the type description.
Materials & methods
Collection, isolation & morphology
JE Longcore collected algae and plant debris on 22 Sep 2008 from Smith's Fen (pH
= 5.7; Schwintzer 1978), University of Michigan Biological Station, Cheboygan County,
Michigan, USA. The sample was transported at ambient temperature in a Whirlpak®
plastic bag to our laboratory in Maine. We placed the aquatic sample in a finger bowl
at room temperature and baited it with pieces of boiled, white onionskin. After several
weeks we noted thalli with catenulated rhizoids on the bait. Most of the thalli grew at
the edges of the onionskin and produced long, cylindrical zoosporangia. We rinsed
the onionskin with a stream of distilled water and placed it in a depression slide with
distilled water. After ~1 hour, when many active zoospores could be seen, we added
the water to plates of TC agar (0.4 g tryptone, 4 g cellobiose, 10 g agar, 1 L distilled
water) containing 300 mg/L streptomycin and 200 mg/L penicillin G. We monitored
the isolation plates at 100x magnification by inverting them on the stage of a compound
microscope. After nearly two weeks, we selected Cylindrochytridium johnstonii,
recognized by its long, cylindrical zoosporangia, from among the other chytrids on
the isolation plate and removed thalli to clean plates of TC agar. We transferred the
isolate, designated JEL596, to mPmTG slants (Longcore 1992) in screw-topped 125 x
20 mm culture tubes and maintained the stock tubes at room temperature. Stocks were
transferred at 3-month intervals. To document morphology and days to maturity, we
inoculated cultures on mPmTG agar in 9 cm Petri plates stored at 23 °C. To document
morphology on cellulosic substrates, we inoculated a flask of sterilized lake water
containing pieces of white onionskin with thalli near maturity or with motile zoospores
present and incubated the flasks at room temperature. We aseptically removed portions
of agar with thalli from plates and pieces of onionskin from flasks to view the chytrid
by light microscopy. We photographed developmental stages with phase contrast and
Hoffman Modulation Contrast (HMC) optics on a Nikon E400 microscope (Nikon
Instruments, Melville, New York) equipped with a Spot RT digital camera (Diagnostic
Instruments, Sterling Heights, Michigan). Composite images of thalli through multiple
focus planes were assembled from overlapping micrographs of individuals in Adobe
Photoshop 6.0 (Adobe Systems Inc., San Jose, California).
Cylindrochytridium johnstonii (Cladochytriales) ... 295
TABLE 1. Isolates of Cladochytriales used for phylogenetic analyses
of Cylindrochytridium johnstonii
Ae aes ne SOmierk : HABITAT i GENBANK ACCESSION NO.
ISOLATE : NO : ee esata
i ; i NucSSU : NucLSU
INGROUP:
UCC GEAT os oi ats a san OEE, : Soil/detritus ' AF164291S1 | EU828501
expandens : : Carolina, USA : : :
SRE ae ! Ontario, CAN | Sandy soil/detritus { AY349047
age DESHI rs Shera atm, Waseca ona eal ta iets, eI See Ein, Ae SRN Lh
ree a | JELI45 £ Maine,USA | Aquatic/Eriocaulon | EU828475 | EU828503
cae PAGO «2 vargas Maine USA Aquatic/detritus EU828476 EU828504
yes igi «wer gaa | Maine USA Aquatic/detritus EU828478 EU828506
Cladochytrium sp JEL153 Maine, USA Aquatic/maple leaf EU828458 EU828485
Qiindrechy iar cs oi sae: 9 4 Michi enn bate PAquaticldetitus > {P796051
a se ee Ee 3b a 2 Re a Sols it 8 Oe Sd en es
Diplophlyctis sp. : JEL331 : Maine, USA Aquatic/Characeae EU828477. _: EU828505
Endochytrium : JEL402 : Michigan, USA : Aquatic/Cladophora : EU828484 | EU828513
ssl ce LOAN Gt me Aa Nye NR ea items Sah Oe We Mee OE NA ce A ED
ite ae JEL027 Maine, USA Aquatic/Eriocaulon EU828471 EU828498
pe ge JELO70 Maine, USA Aquatic/Eriocaulon EU828472 EU828499
ane JEL324 Maine, USA Aquatic/Elodea EU828473 EU828500
Nephrochytrium : Maine, USA; Aquatic/Sparganium : EU828468 | EU828495
aurantium i ; i
i EU828494
Maine, USA Aquatic/Characeae AF164295S1 } EU828511
: Maine,USA —_ Aquatic/Nitella : BU828467
eee ge JEL046 : Maine, USA Aquatic/detritus EU828463 EU828490
se are JELI27_: Maine, USA Aquatic/Characeae | EU828466 | EU828493
Septochytrium sp. JEL177 Wales, UK : Aquatic/detritus EU828474 EU828502
"Siri Diasec Fae Read caer ult es ane ; : 1 Raat uh ee ma)
Unidentified sp. | JELO72 ! Maine, USA: Aquatic/Eriocaulon : EU828470 : EU828497
OUTGROUP
Karlingiomyces sp. JEL093 Maine, USA Aquatic AF164278 AY349085
Falychy ring : JELI09 : Maine, USA: Aquatic ! AY601711 | AY349084
aggregatum : : i i i
296 ... Steiger, Simmons & Longcore
Sequencing & analyses
DNA of JEL596 was extracted with Whatman® FTA card technology (Whatman
Ltd., Maidstone, Kent, UK; Borman et al. 2006, Simmons 2011). Segments of nucSSU
and nucLSU rDNA were amplified, sequenced, and aligned as in Simmons (2011) with
taxa from Cladochytriales (TABLE 1) after a BLAST search in GenBank grouped JEL596
within that order. A region of nucSSU rDNA was amplified with the NS1/NS4 primer
pair (White et al. 1990), as was a region of nucLSU rDNA with the LROR/LRS primer pair
(Rehner & Samuels 1994, Vilgalys & Hester 1990). The Akaike Information Criterion in
jModeltest 0.1.1 (Guindon & Gascuel 2003, Posada 2008) chose the TIM3+G model of
evolution for the combined dataset. We entered these parameters into MrBayes 3.1.2
(Ronquist & Huelsenbeck 2003), which ran for 1M generations, selecting every 100"
tree. A 50% majority rule phylogram was constructed and MP bootstrap and BPP values
were computed in PAUP* 4.0b10 (Swofford 2002) as in Simmons (2011).
Taxonomy
Cylindrochytridium johnstonii Karling, Bull. Torrey Bot. Club 68: 383 (1941)
FIGURE 1
TYPE: Karling (1941: Figs. 1-16).
SPECIMEN EXAMINED. USA. MICHIGAN. On onionskin substrate added to water culture
of algae and aquatic plant detritus, 22 Sep 2008. JEL596 (nucSSU rDNA sequence
GenBank JF796051; nucLSU rDNA sequence GenBank JF796052).
We emend the description of Cylindrochytridium johnstonii by adding
morphology on agar and axenic onionskin and molecular sequence information
for JEL596.
THALLUS CHARACTERS — In pure culture, isolate JEL596 has morphological
characters similar to Karling’s (1941, 1977) descriptions of C. johnstonii. On
agar, germlings developed endogenously, forming catenulate swellings at a
single axis or multiple rhizoidal axes (Fic. 1A, B). The catenulations and the
spherical base of what would become the zoosporangium developed relatively
FiGurRE 1 (right). Cylindrochytridium johnstonii on mPmTG agar and liquid medium grown at
23 °C and on onion skin grown at room temperature. Micrographs taken with phase contrast
optics unless otherwise noted. A. Germling at 3 days with catenulated rhizoids. B. Developing
thallus at 8 days with two catenulated rhizoidal axes (arrowheads) and diffusely branching
rhizoids. C. Brightfield micrograph of amber, ovoid zoospore cyst on onion skin with ridges
along surface of cell wall and a single, large lipid globule. D. Brightfield composite micrograph
of exogenously developing germling in onion skin, with zoospore cyst (arrow) and catenulated
rhizoids (arrowheads). E. Composite micrograph of broad tube extending from spherical base of
zoosporangium. F. Septum (white arrow) with tapered nipple delimiting zoosporangium base and
apically migrating cytoplasm in thallus. G. Hoffman Modulation Contrast (HMC) micrograph of
zoospores released from apical pore. H. HMC micrograph of spherical zoospores after release from
zoosporangium by dehiscence of operculum (white arrowhead). I. Composite HMC micrograph
of developing thallus with catenulated rhizoids, vacuolated portion of zoosporangium towards
spherical base, and apically migrating cytoplasm. Scale bars = 10 um; bar in A for G-H; bar in
C for D; bar in E for EI.
Cylindrochytridium johnstonii (Cladochytriales) ... 297
298 ... Steiger, Simmons & Longcore
slowly as the rhizoidal system expanded through the agar (Fic. 1B). After nearly
two weeks, one side of the spherical zoosporangium elongated to form a tube
nearly as wide as the spherical base (Fic. 1E). Most of the cytoplasm migrated
toward the apical portion of the broad tube, leaving a highly vacuolated portion
at the zoosporangium base (Fic. 1K, I). At maturity, the basal portion of the
zoosporangium was empty and may have been walled off by a septum (Fie. 1F).
Zoospores exited the zoosporangium through a pore made by the complete
detachment of an apical operculum (Fic. 1H). Zoospores possessed a single
lipid globule (Fic. 1G, H), and flagella were ~35 um long.
Our attempts to reintroduce C. johnstonii to onionskin led to the production
of germlings, but after 1 month, no further development occurred. On onionskin
isolate JEL596 developed exogenously. The amber, ovoid zoospore cyst on the
surface of the onionskin had a cell wall with ridges and generally possessed a
single, large lipid globule (Fic. 1C). Germlings possessed one or two rhizoidal
axes with catenulations (Fic. 1D).
PHYLOGENETICS — A majority rule Bayesian phylogram (Fic. 2) was
constructed from a data matrix with 337 parsimony-informative characters ofa
total matrix of 1410 characters. The phylogeny indicates that Cylindrochytridium
johnstonii is within the Cladochytriales. The species is in a clade that is sister to
a clade containing the type species of Allochytridium Salkin (Salkin 1970) and
Septochytrium Berdan (Berdan 1939), which are the only two genera recognized
in Septochytriaceae (Mozley-Standridge et al. 2009).
Discussion
Our phylogeny (Fic. 2) places Cylindrochytridium johnstonii as sister to an
isolate with Catenochytridium morphology (JEL145). Together these two taxa
are sister to a group of isolates in the Septochytriaceae (Mozley-Standridge
et al. 2009) and are also part of a larger clade (Fic. 2), whose members form
large catenulations in their rhizoids. One species in this clade, Allochytridium
expandens Salkin, also has an elongated zoosporangium, but not to the extent
seen in C. johnstonii. Additionally distinguishing these two taxa, A. expandens
develops exogenously both in natural substrates and on agar medium (Barr
1986) whereas C. johnstonii develops endogenously on agar medium.
Shanor (1944) commented upon the resting spore of C. johnstonii, but he did
not illustrate this feature. He described the resting spore on filter paper as being
light-brown or amber, nearly spherical, with a smooth, thick cell wall and one
large yellow oil globule. This description is very similar to that of the zoospore
cyst that we saw on onionskin, but fine ridges appeared on the surface of most
zoospore cysts we observed. Though the amber zoospore cysts on onionskin
may look like resting spores, their connection to larger portions of the thallus
(Fic. 1D) lead us to conclude they are zoospore cysts. Thus, we believe Shanor
may have mistaken the zoospore cyst for a resting spore.
Cylindrochytridium johnstonii (Cladochytriales) ... 299
o7oof Bart 253 Allochytridium expandens
88/100] = JEL191 Septochytrium variabile
61/98|"™" JEL177 Septochytrium sp.
-/90
JEL145 Catenochytridium sp. 1
JEL596 Cylindrochytridium johnstonii
77/100
CRC = JEL024 Catenochytridium sp. 2
JEL331 Diplophlyctis sp.
ABR JEL044 Catenochytridium sp. 3
98/100
99/100 Barr463 Allochytridium luteum
77/100} YEL324 Endochytrium sp. 1
100 J | | JELO27 Endochytrium sp. 2
— 100] ' JELO70 Endochytrium sp. 3
JELO036 Nephrochytrium aurantium
N
sahing sootoot YEL127 Nowakowskiella elegans
JELO46 Nowakowskiella elegans
-/100
100/100 JEL327 Nephrochytrium sp. 1
E JELO72 Unidentified sp.
4
\ JEL402 Endochytrium ramosum
400/100 JEL125 Nephrochytrium sp. 2
C> JEL153 Cladochytrium sp.
165 JEL109 Polychytrium aggregatum
i. JEL093 Karlingiomyces sp.
== 50 changes
FIGURE 2. Majority rule consensus Bayesian phylogram of combined nucSSU and nucLSU
rDNA for 20 taxa of Cladochytriales and 2 isolates in the Polychytrium clade (James et al. 2006).
Labeled nodes correspond to the catenulated rhizoids clade (CRC) and families within the
Cladochytriales (arrowhead): Septochytriaceae (S), Nowakowskiellaceae (N), Endochytriaceae
(E), and Cladochytriaceae (C) (Mozley-Standridge et al. 2009). Branch support values are listed
as maximum parsimony bootstrap values / Bayesian posterior probabilities. Tree length = 1234,
CI = 0.6183, RI = 0.6235.
300 ... Steiger, Simmons & Longcore
Karling (1941) illustrated elongation of C. johnstonii thalli as beginning
during growth of the germling, with some zoosporangia having basal swellings.
The developing zoosporangia we examined on agar were spherical (Fic. 1B) and
grew an apical elongation only when nearly mature (Fie. 1E, FE, I). Additionally,
young thalli of our isolate on onionskin were also spherical (Fic. 1D).
Considering that Karling (1941) observed C. johnstonii in gross culture
and we studied our isolate in pure culture, our observations agree well with
his drawings, which constitute the type of C. johnstonii. Cylindrochytridium
endobioticum Willoughby (Willoughby 1964) is the only other species in the
genus, but Karling (1977) considered it to be a dubious member because of its
considerable variation from C. johnstonii. Our genetic information provides
the basis for adding additional species to the genus as well as evaluating the
suitability of the genus for C. endobioticum, when it is found and brought into
culture.
Acknowledgments
We thank University of Michigan Biological Station visiting phycology professor
RL Lowe of the Bowling Green State University Department of Biological Sciences for
leading the centennial celebration phycology field trip during which this collection was
made. We thank D Cox and P Singer of the DNA Sequencing Facility at the University
of Maine for their services, DV Neace of the Yale University School of Medicine for
document procurement, and J Shepard and H Reyes for their fastidious diligence. We
thank SE Mozley-Standridge and MJ Powell for reviewing this manuscript. This study
was financially supported by the NSF DEB grant PEET 0529694.
Literature cited
Barr DJS. 1980. An outline for the reclassification of the Chytridiales, and for a new order, the
Spizellomycetales. Canadian Journal of Botany 58: 2380-2394.
Barr DJS. 1986. Allochytridium expandens rediscovered: morphology, physiology, and zoospore
ultrastructure. Mycologia 78: 439-448. http://dx.doi.org/10.2307/3793048
Berdan HB. 1939. Two new genera of operculate chytrids. American Journal of Botany 26:
459-463. http://dx.doi.org/10.2307/2436568
Borman AM, Linton CJ, Miles S, Campbell CK, Johnson EM. 2006. Ultra-rapid preparation of total
genomic DNA from isolates of yeast and mould using Whatman FTA filter paper technology
- areusable DNA archiving system. Medical Mycology 44: 389-398.
http://dx.doi.org/10.1080/13693780600564613
Czeczuga B, Mazalska B, Godlewska A, Muszynska E, Kuc K. 2007. Fungi and fungus-like organisms
(Straminipila) on fruit tree petals floating in water. Biological Letters 44: 41-50.
Guindon S, Gascuel O. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies
by maximum likelihood. Systematic Biology 52: 696-704.
http://dx.doi.org/10.1080/10635150390235520
James TY, Porter D, Leander CA, Vilgalys R, Longcore JE. 2000. Molecular phylogenetics of the
Chytridiomycota supports the utility of ultrastructural data in chytrid systematics. Canadian
Journal of Botany 78: 336-350. http://dx.doi.org/10.1139/cjb-78-3-336
Cylindrochytridium johnstonii (Cladochytriales) ... 301
James TY, Letcher PM, Longcore JE, Mozley-Standridge SE, Porter D, Powell MJ, Griffith GW,
Vilgalys R. 2006. A molecular phylogeny of the flagellated fungi (Chytridiomycota) and
description of a new phylum (Blastocladiomycota). Mycologia 98: 860-71.
http://dx.doi.org/10.3852/mycologia.98.6.860
Karling JS. 1941. Cylindrochytridium johnstonii gen. nov. et sp. nov., and Nowakowskiella profusum
sp. nov. Bulletin of the Torrey Botanical Club 68: 381-387. http://dx.doi.org/10.2307/2481646
Karling JS. 1963. Indian chytrids. I. Eucarpic monocentric species. Sydowia 17: 285-296.
Karling JS. 1968 [“1966”]. Some zoosporic fungi of New Zealand. VII. Additional monocentric
operculate species. Sydowia 20: 119-128.
Karling JS. 1977. Chytridiomycetarum Iconographia. Monticello, New York: Lubrecht & Cramer.
Letcher PM, Powell MJ, Churchill PE Chambers JG. 2006. Ultrastructural and molecular
phylogenetic delineation of a new order, the Rhizophydiales. Mycological Research 110:
898-915. http://dx.doi.org/10.1016/j.mycres.2006.06.011
Letcher PM, Powell MJ, Barr DJS, Churchill PE, Wakefield WS, Picard KT. 2008. Rhizophlyctidales
- anew order in Chytridiomycota. Mycological Research 112: 1031-1048.
http://dx.doi.org/10.1016/j.mycres.2008.03.007.
Longcore JE. 1992. Morphology, occurrence, and zoospore ultrastructure of Podochytrium
dentatum sp. nov. Mycologia 84: 183-192. http://dx.doi.org/10.2307/3760249
Longcore JE, Simmons DR. 2012. The Polychytriales ord. nov. contains chitinophilic members of
the rhizophlyctoid alliance. Mycologia 104. http://dx.doi.org/10.3852/11-193
Marano AV, Barrera MD, Steciow MM, Donadelli JL, Saparrat MCN. 2008a. Frequency, abundance
and distribution of zoosporic organisms from Las Canas stream (Buenos Aires, Argentina).
Mycologia 100: 691-700. http://dx.doi.org/10.3852/07-198.
Marano AV, Steciow MM, Arellano M. 2008b. New records of chytridiaceous fungi (Chytridiomycota)
from the Reserva Natural Selva Marginal Punta Lara (Argentina) with comments on some
previously reported species. Nordic Journal of Botany 26: 248-254.
http://dx.doi.org/10.1111/j.1756-1051.2008.00214.x
Mozley-Standridge SE, Letcher PM, Longcore JE, Porter D, Simmons DR. 2009. Cladochytriales - a
new order in Chytridiomycota. Mycological Research 113: 498-507.
http://dx.doi.org/10.1016/j.mycres.2008.12.004.
Posada D. 2008. jModeltest: phylogenetic model averaging. Molecular Biology and Evolution 25:
1253-1256. http://dx.doi.org/10.1093/molbev/msn083
Rehner SA, Samuels GJ. 1994. Taxonomy and phylogeny of Gliocladium analysed from
nuclear large subunit ribosomal DNA sequences. Mycological Research 98: 625-634.
http://dx.doi.org/10.1016/S0953-7562(09)80409-7
Rocha MD, Pires-Zottarelli CLA. 2002. Chytridiomycota e Oomycota da Represa do Guarapiranga,
Sao Paulo, SP. Acta Botanica Brasilica 16: 287-309.
http://dx.doi.org/10.1590/S0102-33062002000300005.
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Salkin IF, 1970. Allochytridium expandens, gen. et sp. n.: growth and morphology in continuous
culture. American Journal of Botany 57: 649-658. http://dx.doi.org/10.2307/2441289
Schwintzer CR. 1978. Vegetation and nutrient status of northern Michigan fens. Canadian Journal
of Botany 56: 3044-3051. http://dx.doi.org/10.1139/b78-368
Shanor L. 1944. Additional records of aquatic Phycomycetes isolated from Mexican soils. Journal
of the Washington Academy of Sciences 34: 330-333.
Simmons DR. 2011. Phylogeny of Powellomycetaceae fam. nov. and description of Geranomyces
variabilis gen. et comb. nov. Mycologia 103: 1411-1420. http://dx.doi.org/10.3852/11-039
302 ... Steiger, Simmons & Longcore
Simmons DR, James TY, Meyer AF, Longcore JE. 2009. Lobulomycetales, a new order in the
Chytridiomycota. Mycological Research, 113: 450-60.
http://dx.doi.org/10.1016/j.mycres.2008.11.019.
Sparrow FK. 1960. Aquatic Phycomycetes (2nd ed.). Ann Arbor, Michigan: University of Michigan
Press.
Swofford DL. 2002. PAUP*: phylogenetic analysis using parsimony (*and other methods).
Sunderland, Massachusetts: Sinauer Associates.
Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified
ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238-4246.
White TJ, Bruns TD, Lee SB, Taylor JW. 1990. Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ
(Eds.), PCR protocols: a guide to methods and applications: 315-322. San Diego, California:
Academic Press.
Willoughby LG. 1964. A study of the distribution of some lower fungi in soil. Nova Hedwigia
7: 133-150.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.303
Volume 118, pp. 303-309 October-December 2011
A contribution to the study of smut fungi of Israel
KyrRYLO G. SAVCHENKO?”*, VASYL P. HELUTA?,
SOLOMON P. WASSER?” & EVIATAR NEVO’!
‘Institute of Evolution & Department of Evolutionary and Environmental Biology,
Faculty of Natural Sciences, University of Haifa, Mt. Carmel, Haifa 31905, Israel
2M.G. Kholodny Institute of Botany of the National Academy of Sciences of Ukraine,
2 Tereshchenkivska St., Kyiv 01601, Ukraine
* CORRESPONDENCE TO: [email protected]
ABSTRACT — Four species of smut fungi, Antherospora vaillantii, Microbotryum holostei,
Urocystis magica, and U. muscaridis, are reported for the first time in Israel. Urocystis magica
was found in the Judean desert on a new host plant, Allium rothii, and M. holostei is new for
Asia.
Key worps — Urocystales, biodiversity, Microbotryales, Middle East
Introduction
The smut fungi that occur in Israel have been studied by mycologists and
phytopathologists since the start of the 1900s (Magnus 1900; Reichert 1921,
1930, 1931; Savulescu & Rayss 1935; Rayss & Zwirn 1944; Rayss 1952; Palti et
al. 1966). Nevertheless, knowledge about species composition and distribution
of these fungi was incomplete until a critical revision of the published accounts
of smut fungi in Israel that showed 59 species were recorded (Savchenko et al.
2010).
During February-March 2011, we collected plants infected by smut fungi,
mainly in the territory of Mount Carmel, a coastal mountain range in northern
Israel that stretches southeast from the Mediterranean Sea. This region is
botanically very rich in species with a typical East-Mediterranean flora with
luxuriant herbaceous components. Some of them are host plants for smut fungi.
In the present study we report three smut species found in this region and one
species from the Judean Desert.
Materials & methods
Sorus and spore characteristics were studied using both fresh and dried herbarium
specimens. Spores were dispersed in a droplet of lactophenol on a microscope slide,
304 ... Savchenko & al.
covered with a cover glass, gently heated to boiling point to rehydrate the spores,
cooled, and then examined by a Carl Zeiss Axiostar light microscope (LM) at 1000x
magnification. For scanning electron microscopy (SEM), spores were attached to
specimen holders by double-sided adhesive tape and coated with gold. The surface
structure of spores was observed at 15 kV and photographed with a scanning electron
microscope JEOL JSM-6700F. Specimens used in this study are stored in the Herbarium
of Haifa University (HAI).
Results & discussion
Descriptions and critical notes of four new Israeli species of smut fungi are given
below.
Antherospora vaillantii (Tul. & C. Tul.) R. Bauer et al., Mycol. Res. 112: 1304 (2008)
FIGS ET=2
Sort in the anthers and on the surface of inner floral organs, producing dark
olive-brown powdery mass of spores, enclosed by the floral petals. Infection
systemic, all flowers of an inflorescence are infected. SporEs variable in shape
and size, globose, subglobose, ovoid, slightly elongated, 7-8.5 x 8-10(-11) um,
olive-brown. SPORE WALL even, ca. 0.5-0.7 tum thick, finely, densely verruculose.
In SEM spores densely irregularly verruculose. SPORE PROFILE appears wavy.
DISTRIBUTION: Europe, Asia, Africa, North America, Oceania.
SPECIMEN EXAMINED: ISRAEL. HAIFA DISTRICT, Carmel National Park, 32°75'79"N,
35°01'50"E, on Muscari comosum (L.) Mill., 2.11.2011, leg. K.G. Savchenko (HAI 2857).
Norte. The genus Antherospora R. Bauer et al. consists of eight species of
smut fungi that infect the anthers and inner floral organs of host plants in the
Hyacinthaceae (Liliaceae s.1.) (Vanky 2009). The genus differs from all other
taxa of Urocystales by the organogenic specialization, lack of sterile cells, and
development of single spores (Bauer et al. 2008). Most of its species are highly
specialized parasite restricted to certain host plant genera. Only one other
Antherospora species, A. urgineae (Maire) R. Bauer et al. on Urginea maritima
(L.) Baker, is known to occur in Israel (Savulescu & Rayss 1935, Savchenko
et al. 2010). Antherospora vaillantii is easily distinguishable from A. urgineae,
which has smaller spores (9.5-15(-17.5) x 7-12 um in diam.) and hosts in
different genera.
Microbotryum holostei (de Bary) Vanky, Mycotaxon 67: 44 (1998) FIGs. 3-4
Sor! in ovules, fill the capsules with a powdery reddish brown spore mass.
Infection systemic. Spores reddish-brown, globose, sometimes ovoid, 9-14
x 11-14 um. SporE WALL reticulate, 4-6 meshes per spore diam., meshes
1.2-2.4 um in diam.; the bottom of the meshes with conspicuous round low
protuberances.
DISTRIBUTION: Europe, Asia.
Smut fungi (Israel) ... 305
15.0kV 6.500 Tye WD 78
Fics. 1-6. 1-2: spores of Antherospora vaillantii in flowers of Muscari comosum. 3-4: spores of
Microbotryum holostei in flowers of Holosteum umbellatum. 5-6: sori and spores of Urocystis
muscaridis on leaves of Muscari comosum. 1, 3, 6 = LM; 2, 4 = SEM. Scale bars: 1, 3, 6 = 10 um;
2,4=1um;5=3 mm.
306 ... Savchenko & al.
SPECIMEN EXAMINED: ISRAEL. HAIFA DISTRICT, Carmel National Park, 34°74'97"N,
35°03'01"E, on Holosteum umbellatum L. (Caryophyllaceae), 3.11.2011, leg. K.G.
Savchenko (HAI 2858).
Norte. Only three species of Microbotryum Lév. were reported from Israel
before our investigations: M. cordae (Liro) G. Deml & Prillinger on Polygonum
acuminatum Kunth (Polygonaceae), M. jehudanum (Zundel) Vanky on Silene
apetala Willd. (Caryophyllaceae), and M. scorzonerae (Alb. & Schwein.)
G. Dem! & Prillinger on Scorzonera papposa DC. (Asteraceae) (Rayss 1952, Rayss
& Zwirn 1944, Savchenko et al. 2010). All three are typical ovaricolous species.
Israel has a great diversity of potential hosts for smuts from Microbotryum,
especially those parasitizing Caryophyllaceae (43 Silene species grow in the
country; Feinbrun-Dothan & Danin 1998). Microbotryum holostei has probably
been overlooked because of the inconspicuous symptoms of infection and pre-
vernal development. To our knowledge, M. holostei has never been reported
from Asia.
Urocystis magica Pass., in Thiimen, Mycoth. Univ. 3: no. 223 (1875) Fics. 7-9
Sor! as pustules in leaves and bulbs, initially covered by an epidermis that
later ruptures to expose the black mass of spore balls. SPORE BALLS globose to
ovoid, 18-25 x 20-40 um in diam., composed of 1 (90%) to 2 (10%) central
spores and continuous layer of peripheral sterile cells. Spores globose,
subglobose, ovoid, 10-15 x 12-16 um in diam., dark reddish-brown. SPORE
WALL ca. | um thick. STERILE CELLS globose, ovoid, irregular, 4-13 um in diam.,
pale yellowish-brown.
DISTRIBUTION: Europe, Asia, North America, South America, Africa,
Oceania.
SPECIMEN EXAMINED: ISRAEL. SOUTH DISTRICT, Judean Desert, near Arad, Wadi Kidot,
31°15'73"N, 35°13'59"E, alt. 569 m., on Allium rothii Zucc. (Alliaceae), 15.11.2011, leg.
K.G. Savchenko (HAI 2860).
Note. During a collection trip to the Judean Desert in March 2011, one Allium
rothii plant was found infected by a smut fungus. Allium rothii belongs to the
subgenus Melanocrommyum and is distributed in Israel in the Judean Desert,
North and South Negev, and the Dead Sea area on rocky slopes between shrubs
(Kamenetsky 1994). Microscopic examination revealed that the smut was
U. magica s.l., not previously recorded in Israel (Savchenko et al. 2010). Allium
rothii represents a new host plant for this fungus.
Allium L. is a major genus of the monocot family Alliaceae naturally
distributed throughout the northern hemisphere that is represented by
ca. 750 species worldwide (Stearn 1992). Almost 40 species are known in
Israel (Feinbrun-Dothan & Danin 1998). According to recent taxonomical
changes based on nrDNA ITS sequence analyses, Allium is divided into 15
well-delimited monophyletic subgenera (Friesen et al. 2006). Species from
Smut fungi (Israel) ... 307
Figs. 7-9. Urocystis magica on Allium rothii. 7: infected plant; 8: sori: 9: spore balls (in LM).
Scale bars: 7 = 1 cm; 8 = 3 mm; 9 = 10 um.
six subgenera —Allium, Amerallium, Cepa, Melanocrommyum, Polyprason,
Rhizirideum— have been found as hosts for Urocystis Rabenh. ex Fuckel. At
least five different Urocystis taxa have been described from onion plants during
the last two centuries (see Vanky 1994): U. magica, U. cepulae Frost, U. colchici
f. allii-subhirsuti Beltrani, U. allii Schellenb., and Tuburcinia oblonga Massenot
(= U. oblonga (Massenot) H. Zogg). As these taxa are not easily distinguished
from one another, they have been treated asa single taxon, U. magica s.1. However,
these taxa were described from different subgenera of Allium: U. magica s.str.
from subg. Melanocrommyum, U. cepulae from subg. Cepa, U. colchici f. allii-
subhirsuti from subg. Amerallium, and U. allii and T. oblonga from subg. Allium.
Specialization on certain host plant subgenera or even species is not unusual
among smut fungi (cf. Entyloma species on Eryngium L.; Vanky 2009). Thus, it
is not inconceivable that these Urocystis taxa may be recognized as “good” or at
least “cryptic” species after intensive molecular-phylogenetic research.
308 ... Savchenko & al.
Urocystis muscaridis (Niessl) Moesz, Kaérpat-mend. Uszég.: 199 (1950) FIGs. 5-6
Sor! in leaves as ellipsoidal pustules, variable in size, visible on the outer
surface along the viens, filled by a black powdery mass of spore balls. SPORE
BALLS globose, subglobose, ovoid to irregular, 18-40 x 20-45 um in diam.,
composed of 1-7(-8) spores surrounded by almost a continuous layer of sterile
cells. SporEs globose, ovoid to irregular, 9-17(-18) x 10-20(-21) um in diam.,
dark reddish-brown. SPORE SURFACE smooth. STERILE CELLS variable in shape
and size, globose, ovoid to irregular, 4-9 x 5-14 um, yellowish-brown.
DISTRIBUTION: EUROPE, Asia.
SPECIMEN EXAMINED: ISRAEL. HAIFA DISTRICT, Carmel National Park, 32°75'25"N,
35°02'50"E, on Muscari comosum (L.) Mill. 18.11.2011, leg. K.G. Savchenko (HAI
2862).
Note. Urocystis muscaridis infects different species of Muscari Mill. in Europe
and Asia (Vanky 1994). Muscari comosum, a principal host for this smut, is
quite common in Mediterranean forests and semi-steppe shrub lands of Israel.
In March 2011 we examined a large M. comosum population in Carmel National
Park and found one plant with leaves bearing several swollen sori produced by
U. muscaridis. It is interesting that only a single plant in the whole population
was found to be affected. In the Middle East U. muscaridis is also known from
Iran (Ershad & Deghani 2001).
Acknowledgments
The authors thank Dr. Dominik Begerow and Dr. Roger G. Shivas for peer-reviewing
the manuscript, Dr. Shaun R. Pennycook for some useful comments, Dr. Eli Harlev for
organizing a collection trip to the Judean Desert and Mr. Ivan Hurnenko for help with
the SEM microscopy.
Literature cited
Bauer R, Lutz M, Begerow D, Piatek M, Vanky K, Bacigalova K, Oberwinkler F. 2008. Anther smut
fungi on monocots. Mycological Research 112: 1297-1306.
http://dx.doi.org/10.1016/j.mycres.2008.06.002
Ershad D, Deghgani A. 2006. Urocystis muscaridis, a smut fungus new to Iran. Rostaniha 7(1):
TUS P2,
Feinbrun-Dothan N, Danin A. 1998. Analitical flora of Eretz-Israel. 2" edition. CANA Publishing
House, Israel. [in Hebrew].
Friesen N, Fritsch R, Blattner F. 2006. Phylogeny and new intrageneric classification of Allium
(Alliaceae) based on nuclear ribosomal DNA ITS sequences. Aliso 22: 372-395.
Kamenetsky R. 1994. Life cycle, flower initiation, and propagation on the desert geophyte Allium
rothii. International Journal of Plant Sciences 155: 597-605. http://dx.doi.org/10.1086/297198
Magnus P. 1900. Bornmiiller, Iter syriacum 1897. Fungi. Weiterer Beitrag zur Kenntnis der Pilzen
des Orientes. Verhandlungen der Kaiserlich-K6niglichen Zoologisch-Botanischen Gesellschaft
in Wien 50: 432-449.
Palti J, Chorin M, Reichert I. 1966. Ustilaginales in Israel. Israel Journal of agricultural Research
16(3): 125-132.
Smut fungi (Israel) ... 309
Rayss T. 1952. Etudes de quelques Ustilaginées récoltées en Palestine. Palestine Journal of Botany
Jerusalem Series 5: 229-236.
Rayss T, Zwirn E. 1944. Some interesting Ustilaginales new to Palestine. Palestine Journal of Botany
Jerusalem Series 3: 114-116.
Reichert I. 1921. Die Pilzflora Aegyptiens. Botanische Jahrbiicher fiir Systematik, Pflanzengeschichte
und Pflanzengeographie 56: 598-727.
Reichert I. 1930. The susceptibility of American wheat varieties resistant to Tilletia tritici.
Phytopathology 20: 973-980.
Reichert I. 1931. Tilletia tritici on Aegilops. Transactions of the British Mycological Society 16:
133-135. http://dx.doi.org/10.1016/S0007-1536(31)80027-0
Savchenko KG, Heluta VP, Wasser SP, Nevo E. 2010. Smut fungi of Israel: a preliminary check-list.
Mycologia Balcanica 7: 111-116.
Savulescu T, Rayss T. 1935. Contribution alétude de la mycoflore de Palestine. Annales Cryptogamici
Exotici 4: 49-87.
Stearn WT. 1992. How many species of Allium are known? Kew Magazine 9: 180-182.
Vanky K. 1994. European smut fungi. Gustav Fischer Verlag, Stuttgart-Jena-New York.
Vanky K. 2009. Taxonomic studies on Ustilaginomycetes - 29. Mycotaxon 110: 289-324.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.311
Volume 118, pp. 311-323 October-December 2011
Species of Rhytismataceae on Lithocarpus spp.
from Mt Huangshan, China
QIAN ZHENG‘, YING-REN LIN”, SHENG-MING YU? & LI CHEN?
" School of Life Science & ? School of Forestry & Landscape Architecture,
Anhui Agricultural University, West Changjiang Road 130, Hefei, Anhui 230036, China
* Management Committee of Huangshan Scenic Area of Anhui, Huangshan 242709, China
*CORRESPONDENCE TO: [email protected]
ABSTRACT—Seven members of the Rhytismataceae are reported from leaves of tanoaks from
Mt Huangshan, China. Among them Coccomyces mucronatoides and Terriera coacervata
are new species, Terriera illiciicola is a new combination, and the other species are already
known for China. This paper provides descriptions, discussions for these species as well
as a dichotomous key for the eight rhytismataceous species known to occur on tanoaks
worldwide.
Key worps—Rhytismatales, morphology, taxonomy, Fagaceae
Introduction
Worldwide, at least 55 genera (+ 30 synonyms) and 728 species of
Rhytismataceae have been reported (Kirket al. 2008). These fungi are parasites on
leaves, stems, twigs, or fruits of gymnosperms, angiosperms and pteridophytes
or saprobes on plant residues. More than 240 different fungi have been
discovered on Lithocarpus spp. (Fagaceae), but records of the Rhytismataceae
are few (Farr & Rossman 2011). Coccomyces dentatus (J.C. Schmidt & Kunze)
Sacc. on Lithocarpus densiflorus (Hook. & Arn.) Rehd. is known from the USA
(Sherwood 1980), and five Rhytismataceae species —C. delta, C. huangshanensis,
C. mucronatus, Lophodermium agathidis, L. illiciicola— have been reported on
Lithocarpus spp. from China (Lin et al. 2000a,b, 2001, 2005; Wang et al. 2006).
Mt Huangshan in southern Anhui Province is suitable for many
rhytismataceous species because of the warm climate, abundant rainfall, and
high plant diversity. Seven species representing three different genera on
Lithocarpus leaves are described from Mt Huangshan in this paper, including
two new species, one new combination, and four species already known in
China.
312 ... Zheng & al.
Materials & methods
Leaves with bleached spots were collected from plants on Mt Huangshan, and those
with open fruit bodies characteristic of Rhytismataceae were selected. Observations of
the external shape, size, color, opening mechanisms of ascomata and conidiomata, and
zone line characteristics were made using a stereoscope with 10-50x magnification.
Microscopic preparations were made in water, Melzer’s reagent, 5% KOH, or 0.1%
(w/v) cotton blue in lactic acid. For observing the outlines of ascomata and conidiomata,
vertical sections were mounted in lactic acid or cotton blue with water pretreatment.
Gelatinous sheaths surrounding ascospores and paraphyses were observed in water or
cotton blue in lactic acid. The color of structures and ascospore contents were observed
in water. Measurements and drawings of asci, ascospores, and paraphyses were made
from material mounted in 5% KOH or Melzer’s reagent from 30 ascospores, asci and
paraphyses for each specimen. Point and line integrated illustrations of external shapes
and internal structures of the fruit bodies were drawn using a Panasoianic XSJ-2
microscopic painting device.
Taxonomy
Coccomyces delta (Kunze) Sacc., Boletim da Sociedade Broteriana 11: 13, 1893
= Phacidium delta Kunze, Linnaea 5: 551, 1830
Type: MADEIRA, on leaves of Lauraceae. | Without further data. ]
ZONE LINES frequent, black, thin, surrounding the bleached spots.
CONIDIOMATA not observed.
Ascomata on both sides of leaves, scattered in irregular, yellow-brown
bleached spots. In surface view, ascomata (700—)1000-—1600(—1800) um diam.,
triangular or quadrangular, black, shiny, slightly raising the substratum surface,
opening by 3-4 radial splits. Lips present. In median vertical section, ascomata
intraepidermal. COVERING STROMA up to 25-28 um thick near the opening,
black to dark-brown, becoming thinner or firstly thickening then becoming
thinner towards the edge, composed of textura globulosa or angularis with cells
4—7 um diam. Lip cells fringed, 1.5-2.2 um diam., immersed in a gel. BASAL
STROMA Slightly hollow or flat, 4.0-6.5 um thick, dark-brown, composed of
textura globulosa or angularis with cells, connecting to the covering stroma.
INTERNAL MATRIX STROMA only between the covering stroma and basal stroma.
SUBHYMENIUM 15-20 um thick, consisting of textura intricata and porrecta.
PARAPHYSES 100-130 x 1.5-2.0 um, filiform, aseptate, gradually swollen to
2.2-3.0 um above, covered in a thin mucous coating. Asci ripening sequentially,
85-120 x 7.5-9.5(-11) um, cylindric-clavate or subclavate, somewhat long-
stalked, apex thin-walled, J-, 8-spored. Ascosporss fasciculate, 52-85 x
1.5-1.8(—2.0) um, filiform, hyaline, aseptate, with a ca 1 um thick gelatinous
sheath.
ILLUSTRATION: Sherwood (1980: Fig. 18).
Rhytismataceae on Lithocarpus (China) ... 313
ECOLOGY & DISTRIBUTION: Ascomata found on fallen or not yet fallen
diseased leaves. Widely distributed in Europe (Sherwood 1980). In China, it is
known from southern parts (Lin et al. 2000a).
SPECIMENS EXAMINED: On Lithocarpus glaber (Thunb.) Nakai: CHINA, ANHUI, MT
HUANGSHAN, alt. ca 550 m, 11 August 1995, S.M. Yu, Y.R. Lin 1596a (AAUF 67794a);
Ciguangge, alt. ca 800 m, 4 October 2009, Q. Zheng, S.J. Wang 5436 (AAUF 71544).
ComMENTS—The species was originally described from Madeira, and mainly
occurs on plants of the Lauraceae and evergreen Quercus (Sherwood 1980).
Teng (1934) first reported C. delta from China. According to our observation,
it infects living leaves at early stage, and may be followed by other Coccomyces
species as the ascomata mature. Compared with the polygonal species in the
genus, C. delta ascomata are the largest. The asci and ascospores in the Mt
Huangshan specimens are shorter than described by Sherwood (1980).
Coccomyces huangshanensis Y.R. Lin & Z.Z. Li, Mycosystema 19: 449, 2000
Type: CHINA, ANuulI, Mt. HUANGSHAN, Songgu‘n, alt. ca 600 m, on Cyclobalanopsis
glauca (Thunb.) Oerst., 9 August 1995, Y.R. Lin & S.M. Yu 1632 (AAUF 67740).
ZONE LINES frequent, black-brown, thin, surrounding the bleached areas.
ConIDIOMATA with a distribution on the leaf similar to that of the
ascomata. In surface view, conidiomata 180-330 x 150-260 um, subcircular
or elliptical, brown in the centre and at the perimeter line of the conidioma,
concolorous with the substratum surface or light grey-brown over the rest
of the appearance, slightly raising the surface of the leaf. In vertical section,
conidiomata intraepidermal, double lens-shaped. UPPER WALL very thin, brown
to dark-brown, with an indefinite structure. BASAL WALL 4—7 um thick, brown,
composed of thick-walled, angular cells. CONIDIOGENOUS CELLS 5.5-9.0 x
1.5—2.0 um, flask-shape, holoblastic sympodially proliferating. Conip1A 3.5-5.0
x ca 0.8 um, bacilliform, hyaline, aseptate.
AscoMata on both sides of leaves, more on the upper side of the leaf,
scattered in irregular bleached spots. In surface view, ascomata 700-1100 um
diam., triangular or quadrangular, black-brown, slightly raising the substratum
surface, opening by 3-4 radial splits. Lips present at least in the early stages. In
median vertical section, ascomata intraepidermal. COVERING STROMA 15-18
um thick near the opening, becoming thinner towards the edge, extending to
the basal stroma, consisting of brown to dark-brown textura angularis with
cells 3.5-6.5 um diam. The opening often covered by the heavily carbonized
tissue. Lip cells tend to disappear as the ascomata mature. Periphysoids present.
BASAL STROMA 8-12 um thick, dark-brown, consisting of textura angularis or
globulosa with cells 5.5-8 um diam. INTERNAL MATRIX STROMA only between
covering stroma and basal stroma. ExcrpuLuM 22-30 um thick, arising
from the inner layer of the covering stroma. SUBHYMENIUM 10-18 um thick,
314 ... Zheng & al.
consisting of textura porrecta. PARAPHYSES 110-135 x 1.5-2.0 um, filiform,
septate, slightly swollen at the apex. Ascr ripening sequentially, 85-115 x
6.0-7.0 um, cylindrical, short-stalked, apex obtuse, thin-walled, J—, 8-spored.
Ascosporss fasciculate, 60-90 x 1.2-1.5 um, filiform, hyaline, aseptate, with a
thin gelatinous sheath, sometimes with a gelatinous cap at the top.
ILLUSTRATION: Lin et al. (2000b: Fig. 2).
ECOLOGY & DISTRIBUTION: Ascomata found on decaying leaves. Known
only from China (Lin et al. 2000b).
SPECIMENS EXAMINED: On Lithocarpus henryi (Seemen) Rehder & E.H. Wilson: CHINA,
ANHUI, Mt Huancsuan, Tangkou, alt. ca 500 m, 29 September 1993, Y.R. Lin, L. Chen
151la (AAUF 67619a); 2 October 2009, Q. Zheng, X.M. Gao 5389 (AAUF 71497).
COMMENTS—Coccomyces limitatus (Berk. & M.A. Curtis) Sacc. is very similar
to this species but differs in the well developed internal matrix of the stroma, 50
um thick excipulum, and dissimilar asci and ascospores. Its asci are 4.0-5.6 um
wide, and the ascospores are only 0.8-1.0 um wide (Sherwood 1980; Johnston
1986).
Coccomyces mucronatus Korf & W.Y. Zhuang, Mycotaxon 22: 487, 1985
Type: CHINA, SICHUAN, MT QINGCHENG, alt. ca 900 m, on Castanopsis sp., 6 July 1983,
W.Y. Zhuang HMAS 450558 (CUP-CH 2484).
ZONE LINES frequent, black-brown to black, thin, surrounding or separating
the bleached spots.
CONIDIOMATA not observed.
Ascomarta on both sides of leaves, scattered in irregular, grey-yellow bleached
spots. In surface view, ascomata 650-1200 um diam., polygonal to subcircular,
black-brown to black, slightly raising the substratum surface, opening by radial
splits. Lips absent. In median vertical section, ascomata intraepidermal to
subepidermal. COVERING STROMA 15-22 um thick, consisting of grey-brown
to dark-brown textura angularis and globulosa with cells 3.5-7 um diam.,
extending to the basal stroma. Periphysoids, 8-15 x 2.0-3.0 um, cylindrical,
hyaline, 0-3 septate. BASAL STROMA 8-12 um thick, composed of dark-brown
textura angularis and globulose. INTERNAL MATRIX STROMA poorly developed,
10-20 um thick in the center, hyaline, consisting of gelatinous textura intricata.
ExcIPULUM 40-70 um thick in the upper, abruptly thinner towards the base,
arising from the inner layer of the covering stroma. SUBHYMENIUM 15-20
um thick, composed of colourless textura porrecta or angularis. PARAPHYSES
110-140 x 2.0-2.5 um, filiform, abruptly enlarged to 4.5-5.5 um and subfusoid-
ventricose above, with a 2.5-6.0 x 1.0-2.0 um, subcylindrical mucro at the
apex, often agglutinated. Asci ripening sequentially, 104-119 x 4.2-5.0 um,
cylindrical, short-stalked, apex round to obtuse, thin-walled, J-, 8-spored.
Ascosporss fasciculate, 60-86 x 0.6-0.8 um, filiform, hyaline, aseptate, with
an indefinite gelatinous sheath.
Rhytismataceae on Lithocarpus (China) ... 315
ILLUSTRATION: Korf & Zhuang (1985: Fig. 2).
ECOLOGY & DISTRIBUTION: Ascomata found on decaying leaves. Widely
distributed in Indonesia (Korf & Zhuang 1985). In China, it is known from
Sichuan and Anhui provinces (Lin et al. 2001).
SPECIMENS EXAMINED: On Lithocarpus glaber: CHINA, ANHUI, Mt HUANGSHAN,
Tangkou, alt. ca 550 m, 11 August 1995, Y.R. Lin, L. Chen 1596b (AAUF 67704b). On L.
henryi: CHINA, ANHUI, Mt Huancsuan, Tangkou, alt. ca 550m, 29 September 1993,
Y.R. Lin et al. 1511b (AAUF 67619b); Taoyuanting, alt. ca 650 m, 10 June 1994, Y.R. Lin,
S.M. Yu 1569a (AAUF 67677a); Wenquan, alt. ca 700 m, 3 October 2009, Q. Zheng, X.M.
Gao 5411 (AAUF 71519).
ComMENTS— Korf & Zhuang (1985) first described C. mucronatus based
on specimens on fallen leaves of Castanopsis sp. from Sichuan in China and
Java in Indonesia. The Mt Huangshan specimens usually produce fruit bodies
on decaying fallen leaves or leaf fragments, suggesting that the species is not
implicated in any plant disease. The other features of this species agree with
those of the type specimen described by Korf & Zhuang (1985), except for the
inlaid depth of the ascomata and the growth pattern of the excipulum.
Coccomyces mucronatoides Y.R. Lin, Q. Zheng & S.M. Yu, sp. nov. Fics. 1-6
MycoBank MB561883
Ascomata (480-—)600-1100 um, trigona usque ad hexagona, flavo-brunnea, subepidermalia.
Periphysoidei rarissimi. Excipulum 10-15um crassum, ex hyphis hyalinis septatis parallelis
constatum. Paraphyses filiformes, apice abrupte tumidae. Asci 85-120 x 4.5-5.0um,
cylindrico-clavati. Ascosporae 70-105 x 0.8—1.0 um, filiformes, hyalinae, vagina gelatinosa
tenui indutae.
Type: China, Anhui, Mt Huangshan, Tangkou, alt. ca 550 m, on Lithocarpus cleistocarpus
(Seemen) Rehder & E.H. Wilson, 11 September 2007, S.J. Wang, Y.R. Lin 2244b
(Holotype, AAUF 68352b).
EryMo_oey: referring to the similarity of the paraphysis apex to Coccomyces mucronatus
in shape.
ZONE LINES somewhat frequent, black-brown or yellow-brown, thin,
surrounding the bleached spots.
CONIDIOMATA not observed.
AscoMatTa developing on both sides of leaves, more on the upper side of
the leaf, scattered in irregular, yellowish-white or yellowish beached spots. In
surface view, ascomata (480—)600-1100 um diam., triangular to hexagonal,
yellow-brown, not shiny, with a clearly defined edge, somewhat raising the
substratum surface and flattened or slightly concave in the central region, with
an obvious preformed dehiscence mechanism, opening by 3-6 radial splits,
which extend nearly to the edge of ascoma, to expose the sallow hymenium.
Lips absent. In median vertical section, ascomata subepidermal. COVERING
STROMA 25-32 um thick near the opening and 8-15 um thick in other parts,
composed of an upper part of textura globulosa with black-brown cells 5-6 um
316 ... Zheng & al.
—>
———
——
———
PLEA a7
7 OS (FFD
ee Sa a
ps a
g
Sp
KSFO
<—<$<==
‘e
6 20 ym 5
Fics. 1-6. Coccomyces mucronatoides on Lithocarpus cleistocarpus (from holotype). 1. A leaf bearing
ascomata. 2. Ascomata as seen under a dissecting microscope. 3. Ascoma in median vertical section.
4. Detail of ascoma in median vertical section. 5. Paraphyses and asci. 6. Discharged ascospores.
Rhytismataceae on Lithocarpus (China) ... 317
diam., an lower part of textura epidermoidea with dark-brown cells 3.0-4.5 um
diam., and a few yellowish angular cells almost connecting to the basal stroma.
Periphysoids extremely sparse, (5—)8-15 x 2.0-2.5 um, cylindrical, hyaline,
(1-)3-5 septate. BASAL STROMA moderately developed, 10-15(-18) um thick,
composed of black-brown textura angularis or globulosa with thick-walled
cells 5-7 um diam. INTERNAL MATRIX STROMA well developed, 20-30(-45)
um thick, consisting of hyaline, gelatinised textura intricata. ExcIPULUM 10-15
um wide, composed of rows of hyaline, septate, thin-walled, parallel hyphae.
SUBHYMENIUM 15-22 um thick, composed of hyaline textura intricata and
angularis. PARAPHYSES 100-140 x 1.8-2.0 um, filiform, aseptate, abruptly
enlarged to 4.0-6.0 um and elliptical or subfusoid near the apex, cemented in
a thin gel, forming an epithecium 15-20 um thick. Asci ripening sequentially,
85-120 x 4.5-5.0 um, cylindrical, stalked, apex round to obtuse, thin-walled,
J—-, 8-spored. Ascosporgs arranged in a fascicle, 70-105 x 0.8—1.0 um, filiform,
hyaline, aseptate, with a thin gelatinous sheath.
ECOLOGY & DISTRIBUTION: Ascomata found on dead leaves in litter. Known
only from the type locality.
ComMENTS—According to the type descriptions, C. mucronatus differs from
the new species in frequent periphysoids, poorly developed internal matrix that
occurs only between covering stroma and basal stroma, and paraphyses with
an abruptly swollen subfusoid-ventricose upper part with a mucro at the tip
(Korf & Zhuang 1985). Coccomyces mucronatus on Lithocarpus spp. observed
by the authors differs from C. mucronatoides in an excipulum arising from
the inner layers of covering stroma, with 1-2 dark-brown, swollen cells at the
apex. However, the ascomata of the new species from Mt Huangshan have few
periphysoids, a well-developed internal matrix, and non-mucronate paraphyses
with a suddenly enlarged elliptical or subfusoid body near the apex.
Lophodermium agathidis Minter & Hettige, New Zealand Journal of Botany 21: 39,
1983
Type: NEW ZEALAND, AUCKLAND, WAITAKERE RANGES, Oratia, Kelly's Bush, on
Agathis australis (D. Don) Lindl. ex Loudon, 10 November 1979, G. Hettige 259066
(IMI).
ZONE LINES usually frequent, surrounding the bleached spots.
ConipiomarTa with a distribution on the leaf similar to that of the ascomata,
scattered to crowded. In surface view, conidiomata 140-300 um diam.,
somewhat round, black-brown in the centre and at the perimeter line of the
conidioma, concolorous with the substratum surface elsewhere, or grey-brown
to black-brown as a whole. In vertical section, conidiomata subepidermal.
UPPER WALL 4-7 um thick, dark-brown, consisting of thick-walled angular
cells 2-4 diam. BASAL WALL brown to dark-brown, composed of 1-2 layers of
318 ... Zheng & al.
thin-walled angular cells 3-5 um diam. SUBCONIDIOGENOUS LAYER 7-10 um
thick, consisting of thick-walled angular cells. CONIDIOGENOUS CELLS 10-16 x
2.0-3.0 um, flask-shape, proliferating sympodially. Conip1a 3.0-4.0 x ca 1.0
um, elliptical, hyaline, aseptate.
AscomaTa on both sides of leaves scattered in irregular, yellow-brown
bleached spots. In surface view, ascomata 800-1900(—2300) x 390-650 um,
elliptical to elongate-elliptical, black, slightly raising the substratum surface,
opening by a longitudinal split. Lips light reddish-brown. In median vertical
section, ascomata subepidermal. COVERING STROMA consisting of thick-walled
aliform-angular cells 3-7 um diam., 55-70 um thick and heavily carbonized near
the opening, other parts dark-brown, becoming suddenly thinner towards the
edge. Lip cells arranged in a subparallel manner or slightly radially, cylindrical.
BASAL STROMA 6-10 um thick, dark-brown, consisting of thick-walled aliform-
angular cells 4-7 um diam. SUBHYMENIUM ca 12 um thick, hyaline, composed of
angular cells. PARAPHYSES 110-160 x 1.5-2.0 um, filiform, irregularly swollen
to 2.0-3.0 um or occasionally branched above, covered with a mucous coating.
AscI maturing sequentially, 100-145 x 6-7.5 um, cylindrical, short-stalked,
apex round, thin-walled, J-, 8-spored. Ascospores arranged in fascicles
sometimes helically coiled, 70-95 x 1.2-1.6 um, filiform, hyaline, 0-1-septate,
enveloped in a ca 0.5 um thick gelatinous sheath.
ILLUSTRATION: Minter & Hettige (1983: Figs. 1-9).
ECOLOGY & DISTRIBUTION: Ascomata found on dead leaves in litter. Widely
distributed in China (Lin et al. 2005), Malaysia (Spooner 1991) and New
Zealand (Johnston 2001).
SPECIMENS EXAMINED: On Lithocarpus glaber: CHINA, ANHUI, Mr HuANGsHAN,
Tangkou, alt. ca 550 m, 5 April 1994, Y.R. Lin et al. 1655 (AAUF 67763). On L. henryi:
CHINA, Anuul, Mt Huancsuan, Tangkou, alt. ca 550 m, 2 October 2009, Q. Zheng,
X.M. Gao 5385 (AAUF 71493).
ComMMENTS—Lophodermium agathidis occurs on a wide range of gymnosperms
and angiosperms (Minter & Hettige 1983; Johnston 1989a, 2001). Minter &
Hettige (1983) inferred that it is probably a leaf endobiont inhabiting apparently
healthy leaves that fruits only after death of the leaf from some other cause. After
examination of specimens from China, Lin et al. (2005) found that on leaves of
different plants, L. agathidis differs in thickness of the covering stroma, location
of the lip cells, and size of asci and ascospores.
Terriera coacervata Y.R. Lin & Q. Zheng, sp. nov. Fics. 7-13
MycoBank MB561884
Ascomata coalescentia. Singula ascomata (650—)1000-1800(-—2200) x 350-560 yum,
plerumque elliptica, subepidermalia. Extentio valde carbonacea ad apicem stromatis
tegentis affixa. Excipulum maxime debiliter evolutum. Paraphyses filiformes. Asci 90-130
Rhytismataceae on Lithocarpus (China) ... 319
Fics. 7-13. Terriera coacervata on Lithocarpus cleistocarpus (from holotype). 7. A leaf bearing
ascomata. 8. Ascomata as seen under a dissecting microscope. 9. Three coalescent ascomata in
median vertical section. 10. Ascoma in median vertical section. 11. Detail of ascoma in median
vertical section. 12. Paraphyses and asci. 13. Discharged ascospores.
320 ... Zheng & al.
x 6.0-7.0 um, cylindrici. Ascosporae 60-110 x 1.5-1.8 yum, filiformes, hyalinae, vagina
gelatinosa indutae.
Type: China, Anhui, Mt Huangshan, Tangkou, alt. ca 550 m, on leaves of Lithocarpus
cleistocarpus, 11 September 2007, S.J. Wang, Y.R. Lin 2244a (Holotype, AAUF 68352a).
EryMo_oey: referring to the coalescent form of the ascomata.
ZONE LINES infrequent, thin, grey-brown to brown, sometimes not defined,
surrounding or partly surrounding the bleached spots.
CONIDIOMATA absent.
AscomatTa developing on lower side of leaves, 2-9 ascomata coalescent in
irregular, yellowish bleached spots 15-25 um diam. In surface view, ascomata
interlaced or accumulatively coalescent, forming multilocular fruit bodies.
Single ascomata (650—)1000-—1800(—2200) x 350-560 um, elliptical, sometimes
branching into lobed or polygonal shapes, black, slightly shiny, markedly raising
the substratum surface, opening by a longitudinal split more than 4/5 the length
of the ascoma or by not less than 3 lobes. Lips absent. In median vertical section,
ascomata subepidermal with epidermal cells becoming filled with fungal tissue
as ascomata develop. COVERING STROMA 20-30 um thick, composed of black-
brown textura angularis-globulosa with thick-walled cells. Along the edge of
the ascoma opening, there is a short extension, about 12 um thick, adjacent to
the covering stroma, which is comprised of strongly carbonized tissue with no
obvious cellular structure. BASAL STROMA strongly concave, 10-18 um thick,
composed of 3-4 layers of black-brown, angular and globose cells 2.8-4.0 um
diam., extending to the covering stroma. Colorless to light grey-brown textura
prismatica 10-22 um thick exists between the covering stroma and basal
stroma. ExCIPULUM very poorly developed, arising from the inner layer of the
basal stroma, consisting of hyaline textura porrecta. SUBHYMENIUM 8-12 um
thick, composed of hyaline textura angularis. PARAPHYSES 120-160 x 1.4-1.6
um, filiform, usually gradually swollen to ca 2.0 um at the apex, not branched,
covered with a ca 0.8 um thick mucous coating. Asci maturing sequentially,
90-130 x 6.0-7.0 um, cylindrical, short-stalked, apex round, J-, 8-spored.
ASCOSPORES arranged in a fascicle or helically coiled, 60-110 x 1.5-1.8 um,
filiform, hyaline, aseptate, enveloped in a 1.0-1.5 um thick gelatinous sheath.
ECOLOGY & DISTRIBUTION: Ascomata found on dead or fallen leaves and
known only from the type locality.
ComMMENTS— This new species has characteristics typical of Terriera. In each
ascoma, there is a flattened extension comprising strongly carbonized tissue
adjacent to the covering stroma along the edge of the ascomatal opening, a very
poorly developed hyaline textura porrecta excipulum, and a colorless to light
grey-brown textura prismatica between the covering stroma and basal stroma.
Terriera coacervata is unusual and unique in the genus because its ascomata
usually interlace or accumulatively coalesce to form multilocular fruit bodies.
Rhytismataceae on Lithocarpus (China) ... 321
Lophodermium euryae Y.R. Lin & Y.F. He differs from T. coacervata in a different
coalescent form, the oblong, elliptical or broadly elliptical smaller ascomata
(290-650(-870) x 250-350 um), smaller ascospores (45-70 x 0.8-1.2 um),
paraphyses with suddenly swollen to subglobose apices branched to form an
epithecium, and the abundant conidiomata (Lin et al. 2005).
We discovered a hyperparasite — the anamorphic fungus, Cladosporium
lophodermii Georgescu & Tutunaru — in some T! coacervata collections that
infects ascomata to produce dark-brown hyphae and conidia in the interior.
Hyperparasitism is frequent in some Lophodermium taxa (Minter 1981; Lin
1989).
Terriera illiciicola (S.J. Wang, Y.F. He & Y.R. Lin) Q. Zheng & Y.R. Lin, comb. nov.
MycoBank MB561885
= Lophodermium illiciicola S.J. Wang, Y.F. He & Y.R. Lin, Mycosystema 25: 1, 2006.
Type: CHINA, ANHUI, MT HuancsHan, Tangkou,, alt. ca 550 m, on Illicium verum
Hook. f., 25 September 2004, Y.R. Lin et al. 1912 (AAUF 67683).
ZONE LINES frequent, black, thin, surrounding or partly surrounding the
bleached spots.
CONIDIOMATA absent.
AscomMatTa developing on the upper side of leaves, crowded in yellowish to
yellow-brown bleached spots. In surface view, ascomata 300-380 x 280-330
um, subcircular to broad-elliptical, black, shiny, with a clearly defined edge,
moderately raising the surface of the substratum, opening by a longitudinal
split. Lips absent. In median vertical section, ascomata subepidermal. COVERING
STROMA 25-30 um thick, consisting of black-brown textura angularis with
cells 4.5-6.5 um diam. Along the edge of the ascomatal opening, there is
an extension, about 15 um thick, adjacent to the covering stroma, which is
comprised of strongly carbonized tissue with no obvious cellular structure and
tends to disappear as the ascomata mature. BASAL STROMA concave and cup-
shaped, 12-18 um thick, consisting of black-brown textura angularis with 2(-3)
layers of cells 5.0—7.5 um diam., extending to the covering stroma. Colorless or
light brown textura prismatica 15-20 um thick exists between the covering and
basal stromata. SUBHYMENIUM 12-15 um thick, consisting of textura angularis-
porrecta. PARAPHYSES 115-150 x 1.0-1.5 um, filiform, the top not swollen or
branched, covered with an inconspicuous mucous coating. Asci maturing
sequentially, 90-135 x 4.0-5.0 um, narrow-cylindrical or cylindric-clavate,
long-stalked, apex round, J—, 8-spored. Ascosporss fasciculate, 65-95 x ca
1.0 um, filiform, hyaline, aseptate, enveloped in an inconspicuous gelatinous
sheath.
ILLUSTRATION: Wang et al. (2006: Fig. 1).
ECOLOGY & DISTRIBUTION: Ascomata found on fallen leaves and known
only in China (Wang et al. 2006).
322 ... Zheng & al.
SPECIMENS EXAMINED: On Lithocarpus cleistocarpus: CHINA, ANHUI, MT HUANGSHAN,
Shibawan, alt. ca 1000 m, 22 September 2004, S.J. Wang, Y.F. He, Y.R. Lin 1806 (AAUF
67914).
ComMMENTS— This species was originally described as Lophodermium illiciicola
(Wang et al. 2006) and is transferred here because its diagnostic characteristics
agree with those of the genus Terriera. The species resembles T. minor (Tehon)
PR. Johnst. (Ortiz-Garcia et al. 2003), which can be differentiated by oblong
or elliptical larger ascomata (320-800(-1400) x 220-340 um), a flat basal
stroma, and paraphyses that branch 2-3 times at the top, sometimes forming
an epithecium (Johnston 1988, 1989b; Lin et al. 2005).
Key to species of the Rhytismataceae on Lithocarpus spp. worldwide
la. Ascomata polygonal, opening by radial splits .................. 0... eee eee eee 2
1b. Ascomata more or less elliptical or round, opening by a longitudinal split ....... 6
2a. Lip cells:present at-least‘at the:early stage: . foi. wie oe ales Wines lng le etn le 8 ae ea 3
204 Lapreciis absentee oo. Wee ie 0.05 Rk Fe a caer cen oe om, LeBel eae ete ad. 4
3a. Ascomata 700-1100 um diam., with periphysoids ............ C. huangshanensis
3b. Ascomata (700—)1000-1600(-1800) um diam., without periphysoids .... C. delta
4a. Paraphyses gradually swollen at apex ........... 0. cee eee eee eee C. dentatus
4b. Paraphyses‘suddenly swollen’ at‘apex cn... vues ents wast eles Uae oe ee oes 5
5a. Paraphyses swollen to subfusoid-ventricose above, with a subcylindrical
EaL Veh ahr 1G | =>.) A ore Roe, AO Ae AE Sen eee C. mucronatus
5b. Paraphyses swollen to elliptical or subfusoid above, without a mucro at apex
aad ral AEA Re OER A ERATE CARAT SA te AOD LES SD C. mucronatoides
6a. Top of covering stroma with a flattened, strongly carbonized extension ......... 7
6b. Top of covering stroma without an extension ...................06. L. agathidis
7a. Ascomata interlaced or accumulatively coalescent; paraphyses gradually
SWOlleMFADO Ves. p50 Fs oe Rice le Rag ois ape Nae has Eig a Pa T. coacervata
7b. Ascomata crowded; paraphyses not swollen above .................. T. illiciicola
Acknowledgements
The authors are grateful for the pre-submission comments and suggestions provided
by Dr D.W. Minter and Dr C.L. Hou and to Dr S.J. Wang and Dr X.M. Gao for the field
investigations. This study was supported by the National Natural Science Foundation
of China (No. 30870014), the Specialized Research Fund for the Doctoral Program
of Higher Education of China (No. 20070364002), the Natural Science Foundation of
Anhui Province of China (No. 070411005).
Literature cited
Farr DF, Rossman AY. 2011. Fungal Databases, Systematic Mycology and Microbiology Laboratory.
ARS, USDA [http://nt.ars grin.gov/fungaldatabases/fungushost/FungusHost.cfm (viewed
online on 2 April 2011)].
Rhytismataceae on Lithocarpus (China) ... 323
Johnston PR. 1986. Rhytismataceae in New Zealand 1. Some foliicolous species of Coccomyces de
Notaris and Propolis (Fries) Corda. N. Z. J. Bot. 24: 89-124.
Johnston PR. 1988. An undescribed pattern of ascocarp development in some non-coniferous
Lophodermium species. Mycotaxon 31: 383-394.
Johnston PR. 1989a. Rhytismataceae in New Zealand 2. The genus Lophodermium on indigenous
plants. N. Z. J. Bot. 27: 243-274.
Johnston PR. 1989b. Lophodermium (Rhytismataceae) on Clusia. Sydowia 41: 170-179.
Johnston PR. 2001. Monograph of the monocotyledon-inhabiting species of Lophodermium.
Mycol. Pap. 176: 1-239.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi,
10" ed. CAB International, Wallingford. 771 p.
Korf RP, Zhuang WY. 1985. Some new species and new records of Discomycetes in China.
Mycotaxon 22: 483-514.
Lin YR. 1989. Preliminary study of a hyperparasite, Cladosporium lophodermii [in Chinese]. Forest
Pest and Disease 8: 33.
Lin YR, Li ZZ, Huang CL, Xiang CT. 2000a. Studies on the genus Coccomyces from China II [in
Chinese]. Mycosystema 19: 297-301.
Lin YR, Li ZZ, Xie YS, Liang SW. 2000b. Studies on the genus Coccomyces from China IL [in
Chinese]. Mycosystema 19: 449-453.
Lin YR, Li ZZ, Xu ZS, Wang JR, Yu SM. 2001. Studies on the genus Coccomyces from China IV [in
Chinese]. Mycosystema 20: 1-7.
Lin YR, Yu SM, He YF, Wang SJ. 2005. One new species and two new Chinese records of
Lophodermium Chev. [in Chinese]. Mycosystema 24: 1-5.
Minter DW. 1981. Lophodermium on pines. Mycol. Pap. 147: 1-54.
Minter DW, Hettige G. 1983. Lophodermium agathidis and Meloderma richeae, two members of the
Rhytismataceae from Australasia. N. Z. J. Bot. 21: 39-48.
Ortiz-Garcia S, Gernandt DS, Stone JK, Johnston PR, Chapela IH, Salas-Lizana R, Alvarez-
Buylla ER. 2003. Phylogenetics of Lophodermium from pine. Mycologia 95: 846-859.
http://dx.doi.org/10.2307/3762013
Sherwood MA. 1980. Taxonomic studies in the Phacidiales: The genus Coccomyces (Rhytismataceae).
Occas. Pap. Farlow Herb. Cryptogram Bot. Harv. Univ. 15:1-120.
Spooner BM. 1991. Lophodermium and Hypoderma (Rhytismataceae) from Mt. Kinabalu, Sabah.
Kew Bulletin 46: 73-100. http://dx.doi.org/10.2307/4110745
Teng SC. 1934. Notes on Discomycetes from China. Sinensia 5: 431-465.
Wang SJ, He YF, Ye GM, Lin YR. 2006. A new species and a new Chinese record of Rhytismataceae
[in Chinese]. Mycosystema 25: 1-5.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/118.325
Volume 118, pp. 325-329 October-December 2011
Aschersonia conica sp. nov. (Clavicipitaceae)
from Hainan Province, China
JUN-ZHI Qiu, Yu-BIN Su, CHONG-SHUANG WENG & XIONG GUAN"
Key Laboratory of Biopesticide and Chemical Biology, Ministry of Education,
Fujian Agriculture and Forestry University, Fuzhou, 350002 Fujian, P. R. China
* CORRESPONDENCE TO: [email protected]
ABSTRACT — Aschersonia conica, a new anamorphic species of the family Clavicipitaceae,
is described and illustrated based on specimens collected in Hainan Province, China.
The entomogenous fungus is characterized by conical, whitish to pale yellow stromata
that are surrounded by a hypothallus and a wide base, wide ostiolar openings, cylindrical
conidiogenous cells in a compact palisade, filiform sterile elements, and fusiform conidia.
Key worps — morphology, taxonomy, new taxon
Introduction
Aschersonia Mont., a large genus in the family Clavicipitaceae, has been well
studied, especially in America and Europe (Hywel-Jones & Evans 1993; Liu et
al. 2005). Recently, new studies on Aschersonia and Hypocrella were carried out
using both morphological and molecular techniques (Liu et al. 2006; Spatafora
et al. 2007; Sung et al. 2007). Chaverri et al. (2008), who have provided the
most extensive revision of Aschersonia since Petch (1921), accepted 32 species.
They showed that Aschersonia is a form genus that shares similar anamorph
morphologies with Moelleriella and Hypocrella but that both teleomorphic
genera can be distinguished by their ascospore disarticulation and conidial
shape and size. Mongkolsamrit et al. (2009) later published three additional
species based on morphology combined with ITS and B-tubulin sequence
analysis.
In China, Tzean et al. (1997) and Qiu et al. (2009, 2010) studied Aschersonia
and its teleomorphic forms, Hypocrella Sacc., Moelleriella Bres., and Samuelsia
P. Chaverri & K.T. Hodge. During a recent survey on insect pathogenic
fungi in tropical forests in southern China, a previously unknown species
of entomopathogenic Aschersonia was collected in the Jianfengling National
Nature Reserve and is proposed here as a new species.
326 ... Qiu & al.
Materials & methods
Fungal measurements and microscopical observations followed Qiu et al. (2009,
2010). Spore range data exclude 5% of measurements from each end of the range, which
are given in parentheses. Text abbreviations are as follows: CB = Cotton Blue, L = mean
spore length (arithmetic average of all spores), W = mean spore width (arithmetic
average of all spores), Q = variation in the L/W ratios among all specimens studied,
n = number of spores measured from a given number of specimens. Conidiomata
were carefully dissected with a razor blade and mounted in water or lactic acid mixed
with cotton blue on a slide. Special color terms follow Kornerup & Wanscher (1967).
Specimen vouchers are deposited at the Mycological Herbarium, Fujian Agricultural
and Forestry University (MHFAFU).
Taxonomy
Aschersonia conica Jun Z. Qiu, Y.B. Su & C.S. Weng, sp. nov. Fies. 1
MycoBank MB 561561
Stromata pyriformia vel conico-pulvinata, valde convexa, ex hyphis densis composita,
deorsum effusa, hypothallum membranaceum ad 1.8 mm diam. 0.5 mm altum dilute
luteum formantia, in statu recenti albida, superficie aliquot orificiis ut punctis magnis
visibilibus praedita. Pycnidia plerumque singula, in medio stromatis immersa, 252-306
um alta, 103-141 um diam., elongate ampulliformia. Phialides cylindricae, ad 15 um
longae. Paraphyses praesentes, filiformes, flexuosae, ad 116 um longae, 0.7 um latae.
Conidia fusoidea, utrinque acutata, 8.2-10.5 x 0.9-1.3 um.
Type — China, Hainan Prov., Dongfang County, Jianfengling National Nature Reserve,
alt. 1450 m, on Aleyrodidae, 29.X.2008, J.Z. Qiu, Y.B. Su & C.S. Weng 311 (Holotype,
MHFAFU 20811).
EryMo.Locy — Refers to the conical stroma of this species.
TELEOMORPH: Unknown.
STROMATA—Pyriform, conical-pulvinate, markedly convex, consisting of
dense hyphae, base spreading, forming a pale yellow membranous hypothallus
up to 1.8 mm diam., 0.5 mm high, whitish-coloured when fresh, several ostiolar
openings as large dots visible on the surface.
Pycnip1A—Usually single, embedded in the centre of the stroma, CB-,
252-306 um high, 103-141 um diam, elongate flask-shaped. Conidiogenous
cells phialidic, cylindrical, up to 15 um long.
PARAPHYSES— Present, linear, filiform, flexuous, up to 116 um long, 0.7 um
wide.
Conip1A—Fusoid, sometimes narrowly fusiform, with acute ends, 8.2-10.5
x 0.9-1.3 um, L = 9.5 um, W = 1.1um, Q = 8.6-8.7 (n = 60/2).
ADDITIONAL SPECIMEN EXAMINED — CHINA. HAINAN PROv.: LEDONG COUNTY,
Jianfengling National Nature Reserve, alt. 1350 m, on Aleyrodidae, 30.X.2008, J.Z. Qiu,
Y.B. Su & C.S. Weng 358 (MHFAFU 20828).
CoMMENTS—Aschersonia conica is characterized by the whitish to pale yellow
markedly convex conical stromata, long conidia, wide ostiolar openings, and
Aschersonia conica sp. nov. (China) ... 327
:
-
}
:
:
4
FiGuRE 1. Aschersonia conica. A: Stroma; B: Pycnidium; C: Horizontal-section of a flask-shaped
pycnidium; D: Conidiophores and conidiogenous cells; E: Paraphyses; F: Conidia. Scale bars: A = 1
mm; B-C = 100 um; D-E = 30 um; F = 10 um.
328 ... Qiu & al.
presence of paraphyses and hypothallus. Two previously described species, A.
turbinata Berk. and A. juruensis Henn. (Petch 1921, Chaverri et al. 2008), also
have similarly shaped stromata. However, A. turbinata differs in having ovoid
conidia that are longer and wider (10.5-11.2 x 4.5-5.0 um), producing copious
slime, and lacking paraphyses. Aschersonia juruensis differs in pulvinate
stromata with sloping sides (convex), more conidiomata per stroma (>20),
longer wider conidia (14.5-15.5 x 3.7-4.0 um) that are ventricose with acute
ends, and the absence of paraphyses.
Acknowledgements
We express our gratitude to Prof. Guo-Zhong Lt (College of Environment and
Resources, Dalian Nationalities University) and Dr. Ryan Kepler (Department of
Entomology, Cornell University) for serving as pre-submission reviewers. We would
especially like to thank Prof. Wen-Ying Zhuang and Prof. Jian-Yun Zhuang (Institute
of Microbiology, Chinese Academy of Sciences) for providing the Latin diagnoses, and
Dr. Shaun Pennycook for nomenclatural review. This research was supported by the
National Natural Science Foundation of China (30500005, 31070026), the Educational
Programs for Science and Technology Development (JA09085), Fujian Provincial
Science Foundation for Distinguished Young Scholars (2010J06007), and the Key
Program for Constructing the Economic Zone on the Western Side of Taiwan Straits,
Fujian Province (0b08b005).
Literature cited
Chaverri P, Liu M, Hodge KT. 2008. A monograph of the entomopathogenic genera Hypocrella,
Moelleriella and Samuelsia gen. nov. (Ascomycota, Hypocreales, Clavicipitaceae), and their
anamorphs in the Neotropics. Stud. Mycol. 60: 1-66. http://dx.doi.org/10.3114/sim.2008.60.01
Hywel-Jones NL, Evans HC. 1993. Taxonomy and ecology of Hypocrella discoidea and its anamorph,
Aschersonia samoensis. Mycol. Res. 97(7): 871-876.
Kornerup A, Wanscher JH. 1967. Methuen handbook of colour. Methuen, London.
Liu M, Rombach MC, Humber RA, Hodge KT. 2005. What’s in a name? Aschersonia insperata:
a new pleoanamorphic fungus with characteristics of Aschersonia and Hirsutella. Mycologia
97: 246-253.
Liu M, Chaverri P, Hodge KT. 2006. A taxonomic revision of the insect biocontrol fungus
Aschersonia aleyrodis, its allies with white stromata and their Hypocrella sexual states. Mycol.
Res. 110: 537-554. http://dx.doi.org/10.1016/j.mycres.2006.01.013
Mongkolsamrit S, Luangsa-Ard JJ, Spatafora JW, Sung GH, Hywel-Jones NL. 2009. A combined
ITS rDNA and beta-tubulin phylogeny of Thai species of Hypocrella with non-fragmenting
ascospores. Mycol. Res. 113(6-7): 684-699. http://dx.doi.org/10.1016/j.mycres.2009.02.004
Petch T. 1921. Studies in entomogenous fungi. II. The genera of Hypocrella and Aschersonia. Ann.
Roy. Bot. Gard. Peradeniya 7: 167-278.
Qiu JZ, Ma HE, Wang YY, Guan X. 2009. Two Aschersonia species from Fujian new to China.
Mycosystema 28(1): 60-63.
Qiu JZ, Sun CY, Guan X. 2010. A new pathogen of scale insects, Aschersonia fusispora sp. nov.
(Clavicipitaceae) from Guangxi Province, China. Mycotaxon 113: 81-85.
http://dx.doi.org/10.5248/113.81
Aschersonia conica sp. nov. (China) ... 329
Spatafora JW, Sung GH, Sung JM, Hywel-Jones NL, White Jr JE 2007. Phylogenetic evidence for
an animal pathogen origin of ergot and other grass endophytes. Mol. Ecol. 16: 1701-1711.
http://dx.doi.org/10.1111/j.1365-294X.2007.03225.x
Sung GH, Hywel-Jones NL, Sung JM, Luangsa-ard JJ, Shrestha B, Spatafora JW. 2007.
Phylogenetic classification of Cordyceps and the clavicipitaceous fungi. Stud. Mycol. 57: 5-59.
http://dx.doi.org/10.3114/sim.2007.57.01
Tzean SS, Hsieh LS, Wu WJ. 1997. Atlas of entomopathogenic fungi from Taiwan. Council of
Agriculture, Executive Yuan, Taiwan, R.O.C. 214 p.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/118.331
Volume 118, pp. 331-336 October-December 2011
Clarkeinda trachodes (Agaricales, Basidiomycetes),
first record from Bangladesh
Mb. IQBAL HOSEN’ & Z.W. GE?
'Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany,
Chinese Academy of Sciences, Kunming 650204, Yunnan, P. R. China
?Graduate University of Chinese Academy of Sciences, Beijing 100039, P. R. China
CORRESPONDENCE TO: ’” [email protected] & ' [email protected]
ABSTRACT — An interesting agaric, Clarkeinda trachodes, is reported for the first time from
Bangladesh. A full description, discussion, and illustrations are provided. The enigmatic agaric
genus, currently known only from south and southeast Asia, is characterized by the presence
of a fawn colored pellicle on the central pileus surface, a stipe with a superior annulus and
basal volva, and thick-walled pigmented spores with a slightly depressed truncated apex. Our
examination of a voucher specimen from Italy indicates that a recent report of Clarkeinda in
Europe was based on a misidentified Agaricus collection.
KEY worps — Agaricaceae, distribution, morphology, taxonomy
Introduction
Taxonomic reports on macrofungi of Bangladesh are rare in the literature.
As a part of an ongoing effort to document the macrofungi of South Asia,
we report the presence of Clarkeinda trachodes from Bangladesh for the first
time. We provide a detailed morphological description, photographs, and line
drawings of this enigmatic agaric.
Materials & methods
During November 2009 and June 2010 specimens were collected several times in
two different locations in Bangladesh: Bhawal National Park, Gazipur (24°45’N 90°50’E;
altitude 20 m), and Akhanagar, Thakurgaon, in northern Bangladesh, (26°03N’ 88°47’E;
altitude 67 m). Specimens were deposited in the SAU Herbarium of Agarics Flora
(SHAF; Plant Pathology Department, Faculty of Agriculture, Sher-e-Bangla Agricultural
University, Dhaka, Bangladesh) and in the Kunming Institute of Botany Herbarium,
Academia Sinica (KUN, with HKAS numbers), Kunming, Yunnan, China.
332 ... Hosen & Ge
Fresh specimens were described and photographed in the field. Small tissue pieces
were dried in silica gel and the remaining basidiomes were dried using an oven. Color
codes follow Kornerup & Wanscher (1978).
Microscopical observations were made in mounts of H,O, glycerin, 5% aqueous
KOH, Congo red solution, and Melzer’s reagent, and at least 20 basidiospores were
measured for each of the six basidiomes collected. Q = average length/width ratio
derived from each basidiospore measured. Line drawings of microstructures were made
from the rehydrated specimens.
To prepare the basidiospores for scanning electron microscopy (SEM), silica dried
basidiome fragments were mounted on aluminum stubs with double-sided tape, coated
with gold palladium, and photographed with a Hiracui S—4800 SEM.
Taxonomy
Clarkeinda trachodes (Berk.) Singer, Lilloa 22: 413, 1951. Fics 1-11
BASIDIOMATA medium to large, fleshy. PILEUs 80 to 110 mm in diameter,
subglobose or hemispherical when young, and becoming convex to applanate
at maturity; pellicle brown (6E8) to coffee (6E5-6) or chocolate brown (6E5,
6F5), thin to thick when young and somewhat brown to grayish brown (7E3-
5) at maturity; the remaining surface covered with grayish brown (7E3-5)
to vinaceous brown (6D8, 8E8) squamules, together with numerous, small,
revolute and loosely floccose, brown squamules; context up to 9 mm thick
in the center of the pileus, white, instantly turning reddish with exposure.
LAMELLAE 47 x 10 mm, free and remote from stipe, white to dirty white when
young, olive brown when mature, becoming red brown after bruising, crowded
with lamellulae, margin entire, concolorous. STIPE 80-121 x (28—)31—47(-61)
mm, central, subcylindrical, solid but fistulose in aged specimens; surface dirty
white to white at the apex, light brown to brown toward the base, glabrous
above the annulus, lower half densely covered with minute, brown, furfuraceous
squamules. ANNULUS present on the upper part of the stipe but not the top, up
to 18 mm, thick and membranous and remaining up to the maturity, sometimes
detached from the stipe when dry, adaxial part glabrous with fine longitudinal
striation but abaxial part rough with squamules. VoLva present, grayish, dirty
white to white, membranous, usually closely appressed to stipe and eventually
inconspicuous. SPORE DEPOSIT not obtained.
BaAsIDIA 18-26 x 6-9 um, mostly clavate to subclavate, thin-walled,
tetrasporic (occasionally 2- or 3-spored), bearing four short sterigmata, 1.1—2.3
x 0.8—1.2 um, hyaline, smooth, lacking incrustations, clamp connection absent.
BASIDIOLES narrowly clavate to clavate. HYMENOPHORAL TRAMA interwoven,
hyphae cylindrical to slightly inflated, up to 14 um wide, thin-walled, hyaline, and
without clamp connections. BAsiDIosPoREs (FIGs 3, 6—7) (5.0—)5.52—5.96(—6.8)
x (3.4—)3.81—-3.98(—4.3) um, mean Q = (1.38—)1.42—1.54(—1.7), ovoid, sometimes
broadly ellipsoid to ellipsoid, glabrous, thick-walled (up to 0.6 um), apiculus
Clarkeinda trachodes, new to Bangladesh ... 333
ad ete
Fics 1-5: Clarkeinda trachodes. 1. Basidiome: (a) immature, (b) mature, (c) longitudinal section of
mature fruiting body. 2. Basidia with basidioles. 3. Basidiospores. 4. Cheilocystidia. 5. Pileipellis.
334 ... Hosen & Ge
5.00um
Fics 6—13: Clarkeinda trachodes. 6—7. Basidiospores showing distinctly truncated and depressed
apical germ pore under SEM. 8-13. Developmental stages of a basidiome fruiting in its natural
habitat. (Photo: M.I. Hosen).
Clarkeinda trachodes, new to Bangladesh ... 335
eccentric, apex or germinating pore prominent and truncate with slightly
depressed, olive brown to dark, umber brown in deposit and maintaining the
same color after desiccation for 1.5 years at room temperature, dextrinoid
in Melzer’s solution, not metachromatic in Cresyl blue. CHEILOCYSTIDIA
24-32 x 10-16 um, abundant, scattered to more or less crowded, narrowly
clavate, clavate to broadly clavate, obpyriform, hyaline, thin-walled, smooth,
lacking incrustations, sometimes long pedicel and narrow up to 3.4 um.
PLEUROCYSTIDIA absent. PILEIPELLIs consisting of short branching chains of
4-7 cells, slightly interwoven, terminal cells 12—22.5 x 8-14 um, dull brown
vacuolar pigment inside the cells in glycerin, water and 5% KOH solutions,
thin-walled, clavate, cylindrical, obpyriform to fusiform or spindle-shaped in
rare cases, occasionally branching with lateral cells that are mostly clavate, basal
cells nearly subglobose to clavate or cylindrical.
HABIT, HABITAT, DISTRIBUTION— The fleshy basidiomes of C. trachodes fruit
as isolated individuals or in groups of two in disturbed habitats and at forest
edges. Our collections were found along the roadside near a Shorea robusta
(Dipterocarpaceae) forest in Bhawal National Park, Gazipur, and on bare soil
near a bamboo fence around a village residence in Akhanagar, Thakurgaon,
Bangladesh. Known also from China, India, Indonesia, Malaysia, and Sri
Lanka.
SPECIMENS EXAMINED — BANGLADESH. Duaka DIvIsIon: Gazipur, Bhawal
National Park, 20 m a.s.l., 30 September 2009, M. I. Hosen 617, 619 (HKAS 62856,
62857); RANGPUR Division: Thakurgaon, Akhanagar, 67 m a.s.l., 16 June 2010, M. I.
Hosen 85-88 (HKAS 62852-62855).
ADDITIONAL MATERIAL EXAMINED — Agaricus sp.: ITALY, South Italy, on sandy
ground next to Castanea sativa, 1100 m a.s.l., 13 October 1994, Carmine Lavorato
(HKAS 49489, as Clarkeinda trachodes).
ComMENTs — Clarkeinda trachodes is distinguished by a large basidiome size,
prominent chocolate or coffee brown to deep brown pellicle on the pileus disc
surface, presence of an annulus, olive brown to umber brown spore deposit,
slightly thick-walled spores with a truncated apex, and a context that changes
from white to reddish brown when cut. Since Berkeley (1847) first described the
species from Sri Lanka, it has been reported from south and southeast Asia by
Petch & Bisby (1950, as Chitoniella), Leelavathy et al. (1981), and Pegler (1985,
1986). Yang (1991) has also reported it from the tropical region of Yunnan,
China.
Examination of the specimen from Italy reported as C. trachodes by Lavorato
& Contu (2002) shows the European record is based on a misidentified Agaricus
specimen. The Italian specimen bears larger, ellipsoid basidiospores (7—8.5 x
4.5—5.5 um) that lack a germ pore and truncated apex, and pileal squamules that
represent a cutis of filamentous cylindrical hyphae 4—8 (—15) um in diameter.
336 ... Hosen & Ge
Vellinga et al. (2011) and our own sequence analyses (Ge unpub.) nest
Clarkeinda phylogenetically in the Agaricus s.l. clade close to Agaricus and
Heinemannomyces (genera within tribe Agariceae).
Acknowledgments
The authors wish to express sincere thanks to Dr. Zhu L. Yang (Kunming Institute
of Botany, Chinese Academy of Sciences, Kunming, China) for providing access
to important literature, improvements to the article, and valuable suggestions. The
authors are very grateful to Dr. Carmine Lavorato (Italy) for providing a specimen of
Clarkeinda trachodes for comparison. The first author is grateful to Prof. Nasim Akhtar,
Dr. Md. Rafiqul Islam, Dr. M. Salahuddin M. Chowdhury, Dr. EM. Aminuzzaman,
and Dr. Nazneen Sultana (Department of Plant Pathology, Sher-e-Bangla Agricultural
University, Dhaka, Bangladesh) and Dr. Ashraf Uddin Ahmed (SSO, Plant Pathology
Division, Bangladesh Agricultural Research Institute, Gazipur) for allowing him to keep
the samples in their lab. This work is partially supported by the National Natural Science
Foundation of China (No. 30800004), the Natural Science Foundation of Yunnan
Province (No. 2008CD164), and the Knowledge Innovation Program of the Chinese
Academy of Sciences (No. 2010KIBA01). Thanks are also extended to Dr. Matthew E.
Smith (Duke University, USA) and Haruki Takahashi (Japan) for serving as the pre-
submission reviewers and their constructive, thoughtful suggestions.
Literature cited
Berkeley MJ. 1847. Decades of fungi XV—XIX. Ceylon fungi. London Journal of Botany 6:
479-514.
Kornerup A, Wanscher JH. 1978. Methuen handbook of color. London. Eyre Methuen, UK.
Lavorato C, Contu M. 2002. Clarkeinda trachodes, una specie nuova per la micoflora italiana
rinvenuta in Calabria. Boll. Gruppo Micol. G. Bresadola 45 (1): 33-39.
Leelavathy KK, Zachariah S, Sankaran KV. 1981. Clarkeinda trachodes- an agaric new to India.
Mycologia 73: 204-207.
Pegler DN. 1985. The genus Clarkeinda (Basidiomycotina: Agaricaceae). Botanical Journal of the
Linnean Society 91:245—252. doi: 10.1111/j.1095-8339.1985.tb01148.x
Pegler DN. 1986. Agaric flora of Sri Lanka. Kew Bulletin Add Ser 12. HMSO, London.
Petch T, Bisby GR. 1950. The fungi of Ceylon. Peradeniya Manual 6. 11 1p.
Vellinga EC, Sysouphanthong P, Hyde KD. 2011. The family Agaricaceae: phylogenies and two new
white-spored genera. Mycologia 103(3): 494—-509. doi:10.3852/10—204
Yang ZL. 1991. Clarkeinda trachodes, an agaric new to China. Acta Botanica Yunnanica 13(3):
279—282.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/118.337
Volume 118, pp. 337-347 October-December 2011
Glomus cubense sp. nov.,
an arbuscular mycorrhizal fungus from Cuba
Y. RODRIGUEZ’, Y. DALPE?’, S. SEGUIN?, K. FERNANDEZ’,
F. FERNANDEZ” & R.A. RIVERA’
'Departmento de Biofertilizantes y Nutricion de las Plantas, Instituto Nacional de
Ciencias Agricolas (INCA), Carretera a Tapaste km 3 %, PO Box 1, CP 32700,
San José de las Lajas, Mayabeque, Cuba
Eastern Cereal and Oilseed Research Centre, Agriculture and Agri-Food Canada,
960 Carling Ave, Ottawa K1A 0C6, Canada
°SYMBORG S.L. Campus de EspinardoNo 7. Edificio CEEIM, CP 30100, Murcia, Espana
* CORRESPONDENCE TO: [email protected]
ABSTRACT —Glomus cubense (Glomeraceae, Glomeromycetes) was isolated from a lagoon
vegetation area on a clay soil deposition environment in the vicinity of San José de las Lajas,
Cuba. The species description is based on spore morphological parameters from in vivo pot
cultures and molecular analyses. The new species is characterized by its small, generally
irregular in shape, 20-48 x (24—)54-72 um hyaline to faintly yellow spores that have a 2-
layered spore wall and arise in clusters. Phylogenetic analyses of the rDNA ITS region and
H+ATPase place the species into the Glomeraceae without close relatives among named
Glomus species. Glomus cubense forms mycorrhizal associations with sorghum and leek
plants under greenhouse pot-culture growing conditions and with a diversity of crop plants
under field conditions. The name cubense refers to Cuba, the country where the species was
found.
Keyworps — Glomeromycota, molecular phylogeny
Introduction
Since 1973, numerous investigations on the diversity of arbuscular
mycorrhizal fungi (AMF) have been performed in Cuba, and several species
have been described and surveyed from this country (Herrera & Ferrer 1980;
Ferrer & Herrera 1981, Herrera-Peraza et al. 2003). With respect to research
and development on the selection of AMF strains with potential for use as
bio-inoculants for agriculture and horticulture productions, AMF species
populations were surveyed and propagated in pure cultures, characterized
morphologically, and simultaneously tested for performance at stimulating
338 ... Rodriguez & al.
plant yields under both controlled and field conditions (Rivera et al. 2003, 2007;
Herrera-Peraza et al. 2011). Among the AMF strains surveyed and tested, there
was an undescribed species, here named Glomus cubense, which formed small,
hyaline, 2-layered glomoid spores in clusters around roots. Morphological
and molecular comparisons with other light-coloured glomoid spore species
(Blaszkowski et al. 2010) clearly distinguished G. cubense from previously
described species. Once propagated in pot cultures, it showed high root
colonization potential and growth benefits over a variety of crop plants tested.
In the present paper, the fungus is proposed as a new arbuscular mycorrhizal
species, G. cubense, in the Glomeromycota.
Materials & methods
AMF strain propagation and evaluation were conducted in the central greenhouse
of the National Institute of Agricultural Sciences (INCA) in San José de las Lajas, Cuba.
Species morphological and molecular characterizations were done at the Eastern Cereal
and Oilseed Research Centre of Agriculture and Agri-Food Canada, Ottawa, Canada.
AMF sampling and propagation
Soil samples were collected at about 50 cm depth from a lagoon area at “San
Rafael” Pond in “Las Papas” area (San José de las Lajas, Cuba), with a Haplic Cambisol
(chromic) soil (IUSS Working Group WRB, 2006), a natural soil deposition environment
occasionally flooded and mainly covered with Cynodon nlemfuensis and Mimosa pigra.
Mixed soil samples were used to establish pot trap-cultures using Sorghum bicolor as host
plant. After a four months growth period, spores of AMF were isolated by morphotypes
and used as inoculant for the establishment of pure cultures in sterilized (121°C for
3 h during three days) clay substrate from a “Gley vértico calcico” soil (Instituto de
Suelos 1999) from “Guayabal” farm in San José de las Lajas, Cuba. Plants were fertilized
and watered at regular intervals (Hewitt 1966). Pure strain cultures were subsequently
maintained as reference culture on sorghum plants under semi-controlled greenhouse
conditions.
AMF isolation and characterization
Spores were extracted from the substrate by wet-sieving (300-38 um mesh sieves)
and centrifugation in sucrose gradient (Dalpé & Hamel 2007). Spores were then
manually isolated from the supernatant under the dissecting microscope (Olympus
SZ-PT) by micropipetting. Plant roots were washed in water, bleached in 2.5% KOH
and stained with fuchsin acid (0.01% in lacto-glycerol) (Kormanik & McGraw 1982).
Once destained in lacto-glycerol, root sections were mounted on microscope slides in
polyvinyl] alcohol-lactic acid-glycerol (PVLG) (Omar et al. 1979), a mixture of PVLG and
Melzer’s reagent (1:1, v/v), or a mixture of PVLG and Cotton Blue (0.15% in lactic acid)
(1:1, v/v). Spore morphology and spore wall architecture were based on examination
of about a 100 spores. Color observations referred to the color chart code of the
International Culture Collection of Arbuscular and Vesicular-Arbuscular Mycorrhizal
Fungi (INVAM; http://invam.caf.wvu.edu/). Microscopic observations were performed
with a Nikon Eclipse 800 compound microscope equipped with Nomarski differential
Glomus cubense sp. nov. (Cuba) ... 339
interference contrast optics and photographs were taken with a Nikon CoolPix 4500
digital camera. Nomenclature and AMF classification follow SchiiSler & Walker (2010).
Reference specimens were deposited at the Cuban National Herbarium, IES-CITMA
(HAC) Cuba, and at the National Mycological Herbarium (DAOM) Canada.
Molecular analyses
Spore clusters were collected under a low magnification binocular, rinsed with ddH,O
and air-dried. DNA extraction was performed using the PrepMan Ultra (PMU) reagent
(Applied Biosystems). A ratio of 10 spores/ul of PMU reagent were crushed using sterile
plastic micropestle. Initial PCR reaction for H* ATPase was performed following Sokolski
et al. (2010) with primer GmossATPup1058 (5'-cGG TAC TTT GTT CTG ATA AGA C-3’)
and primer mix GintraATPlo2663, GmossATP102663, GcoroATPlo2663. Three nested
PCR were performed using primers pairs:1) GintraATPup1104, GmossATPup1104
with GintraATP102663, GmossATP102663, GcoroATP102663 (Sokolski et al. (2010), 2)
GlomusATPup1150 (5'-wTc HGC YGA ACC TGG TGC-3’) with GlomusATP102557 (5'-cTK
GHT TTW GAW GGC CAK AAT-3’) at 52°C or 3) with GintraATP1l02663, GmossATP102663,
GcoroATP1lo2663 at 58°C. The ITS rDNA primers pair used were: GLO2A-forward
(5'-CGT AAC AAG GTT TCC GTA GG-3’), GLO2R-reverse (5'-GCG GGT ACT CCT ACC TGA
TT-3’)(Sokolski et al. 2010). PCR products were cloned using the TOPO TA Cloning
Kits (Invitrogen, USA). Cloned products were purified using the GenElute™ Plasmid
Miniprep Kit (Sigma, USA). Cloning and DNA extraction were performed following
the instructions of the manufacturer for rDNA ITS. Between two and eight rDNA ITS
molecular clones (av. four) were selected. H+ ATPase and ITS were sequenced using
the BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster
City, Calif.) and run on an ABI 3100-Avant automated sequencer (Applied Biosystems/
Hitachi). Sequence editing was done using SeqMan (DNASTAR, www.dnastar.com/),
resulting in 1305 bp and 537, 546 and 549 bp alignments, respectively. The sequences
obtained were compared with those in the GenBank databases using the BLAST program.
Sequences retrieved from GenBank and those in this study were aligned by Muscle
3.8.31 and a neighbour-joining tree inferred using MEGA 5.0 (Tamura et al. 2011) with
1000 replicates. The best-fit model (General Time Reversible plus Gamma) was selected
using the web-based MODELTEST 3.7 (Posada 2006). Sequences were deposited in
GenBank under accession numbers JF510464 for H+ ATPase and JF692724, JF692725,
JF692726 for ITS rDNA.
Taxonomy
Glomus cubense Y. Rodr. & Dalpé, sp. nov. PLATES 1-2
MycoBank MB561650
Sporocarpia ignota. Sporae singulares vel aggregatae. Sporae hyalinae vel luteolae,
ovoideae, vel irregulares, 20-48 x (24-)54-82 um, raro globosae, 24-54 um diam.
Sporae tunica stratis duobus; stratum exterius hyalinum, subflexuosum, ad 0.8-1.0 um
crassum, stratum interius hyalinum vel luteolum, 0.8-1.7 um crassum, rigidum. Hyphae
sustinentes hyalinae, rectae, subcylindricae vel subinfundibuliformes, 4-10 um crassae ad
basim sporae. Porus apertus, raro septo curvo clausus cum strato interiore. Mycorrhizas
vesicular-arbusculares formantes.
340 ... Rodriguez & al.
Type: Cuba: “Las Papas” area, San José de las Lajas, from a Fersialitico Pardo rojizo
mullido carbonatado soil in “San Rafael” Pond. (Holotype, permanent slides mounted
in PVLG deposited at HAC Cuban National Herbarium, Instituto de Ecologia y
Sistematica, CITMA, La Habana, Cuba; isotype, DAOM 241198). Genbank JF510464,
JF692724, JF 692725, JF692726.
Erymo.oey: Latin, cubense, in reference to Cuba, the country where the species was
found.
SPOROCARP unknown, spores mostly found in loose aggregates of 3 to 12 spores
arising blastically at the top of sporogenous hyphae branched from a parent
hypha continuous with an extraradical mycorrhizal hypha, rarely single in the
soil. Spores (FIGS 1-8) hyaline to very light yellow (0/0/40/0); ovoid, ellipsoid,
pyriform to irregular in shape 20-48 x (24-)54-82 um, rarely globose, 24-54
um in diameter with one subtending hypha. SPORE waLL composed of two
layers. Spore wall layer 1 (Swl 1) hyaline, permanent, flexible to semi-flexible,
0.8-1.0 um thick, with a smooth surface, easily separating from layer 2 in
crushed spores. Swl 2 hyaline to very pale yellow, rigid, 0.8-1.7 um thick. Spore
wall layers do not react to Melzer’s reagent, spore wall layer 1 stained light
blue in Cotton Blue. SUBTENDING HYPHA concolorous to spores; cylindrical
to slightly flared, straight or recurved; 4-10 um wide at spore base. WALL OF
SUBTENDING HYPHAE hyaline to very light yellow; 1.6-2.0 um thick at the spore
base; composed of two layers continuous with spore wall layers 1 and 2. PoRE
usually open, occasionally closed by a curved septum located 6-8 um from the
spore base or sometimes occluded by thickening of spore wall layer 2.
INTRARADICAL STRUCTURES — G. cubense forms vesicular-arbuscular
mycorrhizae with intracellular ellipsoid hyphal coils (FIG. 11), globose, 23-38
um, to ovoid to irregular vesicles, 18-25 x 20-60 um (FIGS 10, 12) and a few
arbuscules.
MYCORRHIZAL ASSOCIATION — In the field, found associated with typical
lagoon vegetation plants such as Cynodon nlemfuensis and Mimosa pigra. In
field trials, developed symbiosis with a diversity of crop plants: avocado trees,
banana, cassava, corn, cucumber, forages (Brachiaria decumbens and Panicum
maximum), guava, malanga, mango, pepper, plantain, potato, rice, soybean,
bean, sweet potato, tobacco, tomato, wheat, yam (Rivera et al. 2007). In the
greenhouse, pot cultured for several years with sorghum (Sorghum bicolor and
leek (Allium porrum) plants.
PHYLOGENETIC POSITION — The ITS rDNA and H+ ATPase analyses (Fics
13-14) placed Glomus cubense in the genus Glomus sensu SchiiBler & Walker
(2010) in the family Glomeraceae with no close relationship with known AMF
species of this family. Moreover, no environmental sequences were found to be
closely related to G. cubense.
Glomus cubense sp. nov. (Cuba) ... 341
‘i
tT)
PAS
y v
|
~~
1,
le
Fics. 1-8. Spores of Glomus cubense (DIC) from pot-cultures. 1. Juvenile spore with hyphal
attachment. 2. Mature spore with hyphal attachment. 3. Mature spore slightly crushed showing
spore wall layers 1 and 2 (swll, swl2). 4-5. Mature spores with spore wall layer 1 stained with
Cotton Blue compared to spore wall layer 2. 6-8. Irregular shaped spores with subtending
hyphae. Bars: 1-3 =10 um; 4-8 = 20 um.
342 ... Rodriguez & al.
Fics. 9-12. Glomus cubense fungal structures inside colonized roots (DIC). 9. Entry point along
a root. 10. Vesicles. 11. Hyphal coil inside cortical root cell. 12. Vesicles inside cortical root cell. Bars:
9-12 = 20 um.
SPECIMENS EXAMINED: CUBA. Spores and roots isolated from Sorghum bicolor pot
cultures, grown in greenhouse on sterilized clay substrate (Gleyic Calcic Vertisol soil
(IUSS Working Group WRB, 2006) with the following chemical characteristics: Na*
0.81, K* 0.42, Ca** 48.1, Mg’* 6.6 (cmol/kg"); P 30.8 (ppm); organic matter 0.84 (%); pH
Glomus cubense sp. nov. (Cuba) ... 343
8.3. CANADA. Spores and roots isolated from Allium porrum pot cultures, grown on
cultivated Brown Chernozem soil (Saskatchewan, Canada) with a loamy sand texture
and the following chemical characteristics after sterilization: NH,-N 19.7 and NO,-N
14.1 (mg. kg"), P 21.3 and K* 324.5 (mg. kg"), pH 6.5 and EC 0.48 mS.
OTHER SPECIMENS EXAMINED: Type specimens of G. bistratum Btaszk. et al.,
G. perpusillum Blaszk. & Kovacs, provided by J. Blaszkowski, G. canadense (Thaxt.)
Trappe & Gerd. (FH 5045), G. fragile (Berk. & Broome) Trappe & Gerd. (K Berkeley
1182) and of G. viscosum T.H. Nicolson (PI Holotype)
DISTRIBUTION AND HABITAT. Glomus cubense is only known from a single
location: “Las Papas” area, San José de las Lajas, Cuba (22°57'41"N 82°09'04"W).
Spores were originally isolated from Haplic Cambisol (chromic) soil collected
at ca. 50 cm depth. The soil corresponds to a “Fersialitico Pardo rojizo mullido
carbonatado’ soil (Instituto de Suelos, 1999). The species was propagated in pot-
culture using the same type of soil originating from the same area in Cuba.
Notes
The main distinctive morphological properties of G. cubense are its small
hyaline to very light yellow, usually irregularly-shaped spores (Fics 1-2, 6-8)
and its 2-layered spore wall (Fics 3-5) composed of a permanent, flexible to
semi-flexible outer layer staining distinctly in Cotton Blue (Fics 4-5) and a rigid
inner layer, non-reactive to Melzer’s reagent. Under the dissecting microscope,
G. cubense may resemble most glomoid small-sized and pale-colored spores
as treated in the Blaszkowski et al. (2010) identification key. However, when
observed under the compound microscope, only six named species produce
glomoid pale coloured, inamyloid and 2-layered spores that are smaller than 80
um. These are G. bistratum (Btaszkowski et al. 2009b), G. cerebriforme McGee
(McGee 1986), G. indicum Blaszk. et al. (Blaszkowski et al. 2010), G. minutum
Blaszk. et al. (Blaszkowski et al. 2000), G. pallidum LR. Hall (Hall 1977; Oehl et
al. 2003), and G. perpusillum Blaszk. & Kovacs (Blaszkowski et al. 2009a).
The G. cerebriforme and G. perpusillum spore wall layer 1 is laminate (vs.
flexible in G. cubense) and much thicker than spore wall layer 2 (vs. opposite in
G. cubense). Additionally, spore wall layer 2 of G. perpusillum stains in Melzer’s
reagent (vs. no staining in G. cubense). In the spore wall of the other species
listed above, layer 1 is a permanent structure, semi-flexible to rigid, thinner
than layer 2 as in G. cubense but layer 2 is laminate. The G. minutum spores
are only hyaline and of globose to subglobose shape (vs. hyaline to very pale
yellow, and mostly of irregular shape in G. cubense). While spore wall layer 1
easily separates from spore wall layer 2 in freshly crushed G. cubense spores,
that of G. minutum generally remains adherent to the laminate spore wall 2. In
G. minutum, spore wall layer 1 sometimes swells and separates from spore wall
layer 2, but only when spores are mounted in lactic acid-based mountants for
at least some hours.
344 ... Rodriguez & al.
84 AM992829 uncultured Glomus (agricultural soil, Netherlands)
fas [eee rere EF393611 uncultured Glomus (Botrychium virginianum Hungary)
; JF692726 Glomus cubense
mu JF692724 Glomus cubense
_____________ JF@92725 Glomus cubense
88 [oT AF185662 Rhizophagus intraradices
59 —_—————— FM992400 Rhizophagus proliferus
61 | | FJ009614 Rhizophagus irregulare
52 — GQ205070 Rhizophagus diaphanus
a6 ——— GQ205074 Rhizophagus custos
ual GQ205083 Rhizophagus clarus
| 83 | FM253379 Glomus achrum
| 7 GU059547 Glomus indicum
1” | | GQ205036 Glomus cerebriforme
FM253382 Glomus bistratum
EF989114 Funneliformis mosseae
0,02
Fic.13. BIONJ tree based on an alignment of the ITS sequences obtained from Glomus cubense
and related representative sequences from GenBank. Branch support values (only values exceeding
50% are given) on branches refer to BIONJ bootstrap (using GTR + G distances) and maximum
likelihood. Scale indicates nucleotide substitution per site.
99 — GQ205021 Rhizophagus irregulare
60 L GQ205023 Rhizophagus diaphanus
[ GQ205031 Rhizophagus custos
| 98 GQ205032 Glomus sp.
89 | ———~ GQ303448 Rhizophagus intraradices
| Ot GQ205027 Rhizophagus proliferus
_____ 6Q205026 Rhizophagus clarus
| = GQ205025 Glomus cerebriforme
Toners SEB 0464 Glomus cubense
"vr po —- GQ205033 Funneliformis mosseae
84 | - GQ205028 Glomus multiforum
93 - GQ205029 Funneliformis caledaium
—————-—-- GQ205030 Claroideoglomus claroideur
0.05
Fic.14. BIONJ (Neighbour-joining) tree based on an alignment of H+ ATPase sequences of Glomus
cubense and of related representative sequences from GenBank. Branch support values (only values
exceeding 60% are given) on branches refer to BIONJ bootstrap (using GTR + G distances) and
maximum likelihood. Scale indicates nucleotide substitution per site.
Glomus cubense sp. nov. (Cuba) ... 345
Glomus microaggregatum Koske et al. also produces small, 2-layered spores
frequently irregular in shape, but the spores are much darker-colored (yellow
to brownish yellow), their spore wall is thicker (up to 4 um vs. up to 2.7 in
G. cubense) and comprises a rigid outer layer and a flexible inner layer (vs.
flexible to semi-flexible outer layer and rigid inner layer in G. cubense).
The spore wall of G. fragile and G. canadense also consists of a hyaline outer
layer and a pale yellow inner layer. However, observation of their respective type
specimens (K Berkeley 1182, FH 5045) revealed that the inner spore wall layer
in both species is thicker than that of G. cubense and laminate (Gerdemann &
Trappe (1974).
Young or small-sized clustered spores of Glomus viscosum may resemble
those of G. cubense, but they usually are globose, have a 3-layered spore wall, of
which layer 3 is distinctively laminate.
Compared with G. cubense, glomoid spores of Paraglomus spp are hyaline to
pale cream, they form only singly (vs. in cluster in G. cubense) and their spore
wall layers clearly differ phenotypically from those of G. cubense (Blaszkowski
et al. 2010).
Ambispora spp. differentiate hyaline but much larger spores (Walker et al.
2007).
The phylogenetic analyses of sequences of the H+ATPase gene clearly
support morphological analyses and separate G. cubense from the few sequences
actually available and confirmed the efficiency of earlier published primers for
sequencing Glomus species (Sokolski et al. 2010). The analyses of ITS region
confirm that the species G. cubense is a member of the genus Glomus sensu
SchiiBler & Walker (2010) in the family Glomeraceae without having any
close described relatives. When comparing ITS sequence data, the best Blast
alignment with Genbank database sequences indicated a maximum of 83 and
85% similarity with an as yet uncultured Glomus sp. thus supporting the status
of G. cubense as a distinct species.
Acknowledgments
This work was supported by the International Scholarships Program of Canada
Government (Emerging Leaders in the Americas Program) and partially by
“International Foundation for Science” (grant no. C-4463) given to Y. Rodriguez. The
authors want to thank Drs. J. Cayouette, J. Tambong, and S. Redhead (Agriculture and
Agri-Food Canada, Ottawa Canada), Dr. J. Blaszkowski (West Pomeranian University
of Technology, Szczecin Poland), and Dr S. Sokolski (Université Laval Québec Canada)
for their scientific support and Drs Blaszkowski and Redhead for presubmission review.
Special thanks to colleagues of the Mycorrhiza team from the Instituto Nacional de
Ciencias Agricolas, San José de las Lajas, Cuba.
Literature cited
Blaszkowski J, Tadych M, Madej M. 2000. Glomus minutum, a new species in Glomales (Zygomycetes)
from Poland. Mycotaxon 76: 187-195.
346 ... Rodriguez & al.
Blaszkowski J, Kovacs GM, Balazs T. 2009a. Glomus perpusillum, a new arbuscular mycorrhizal
fungus. Mycologia 101: 247-255. http://dx.doi.org/10.3852/08-087. PMID:19397199.
Btaszkowski J, Ryszka P, Oehl F, Koegel S$, Wiemken A, Kovacs GM, Redecker D. 2009b. Glomus
achrum and G. bistratum, two new species of arbuscular mycorrhizal fungi (Glomeromycota)
found in maritime sand dunes. Botany 87: 260-271. http://dx.doi.org/10.1139/B08-138.
Blaszkowski J, Wubet T, Harikumar VS, Ryszka P, Buscot F. 2010. Glomus indicum, a new arbuscular
mycorrhizal fungus. Botany 88: 132-143. http://dx.doi.org/10.1139/B09-104
Dalpé Y, Hamel C. 2007. Arbuscular mycorrhizae. 355-377, in: Manual of Soil Sampling and
Methods of Analysis. 4"4 Edition, Canadian Society of Soil Science Lewis Publishers of CRC
Press.
Ferrer RL, Herrera RA. 1981. El género Gigaspora Gerdemann et Trappe (Endogonaceae) en Cuba.
Rev. Jardin. Bot. Nacional, Habana 1: 43-66.
Gerdemann JW, Trappe JM. 1974. The Endogonaceae in the Pacific Northwest. Mycologia Memoirs
DL AG:
Hall IR. 1977. Species and mycorrhizal infections of New Zealand Endogonaceae. Transactions of
the British Mycological Society 68: 341-356.
http://dx.doi.org/10.1016/S0007-1536(77)80186-1.
Herrera RA, Ferrer RL. 1980. Vesicular-arbuscular mycorrhiza in Cuba. 156-162, in: Mikola P (ed).
Tropical mycorrhiza research.
Herrera-Pereza RA, Ferrer TL, Sieverding E. 2003. Glomus brohultii: A new species in the arbuscular
mycorrhizal forming Glomerales. Journal of Applied Botany 77:37-40.
Herrera-Pereza RA, Hamel C, Fernandez F, Ferrer RL, Furrazola E. 2011. Soil-strain compatibility:
the key to effective use of arbuscular mycorrhizal inoculants? Mycorrhiza 21: 183-193.
http://dx.doi.org/ 10.1007/s00572-010-0322-6
Hewitt E, James D, Eaglesham A. 1975. The non-enzymic reduction of nitrite by benzyl viologen
(free-radical) in the presence and absence of ammonium sulphate. Molecular Cell Biochemistry.
6: 101-105.
Instituto de Suelos. 1999. Nueva version de clasificacién genética de los suelos de Cuba, AGRINFOR,
Ministerio de la Agricultura, Ciudad de La Habana.
IUSS Working Group WRB. 2006. World reference base for soil resources 2006. 2nd edition. World
Soil Resources Reports No. 103. FAO, Rome.
Kormanik PP, McGraw AC. 1982. Quantification of vesicular arbuscular mycorrhizae in plant roots.
37-45, in: Schenck NC (ed). Methods and principles of mycorrhizal research. The American
Phytopathological Society, St Paul, Minn.
McGee PA. 1986. Further sporocarpic species of Glomus (Endogonaceae) from South Australia.
Transactions of the British Mycological Society 87: 123-129.
http://dx.doi.org/10.1016/S0007-1536(86)80011-0.
Oehl F, Wiemken A, Sieverding E. 2003. Glomus aureum, a new sporocarpic arbuscular mycorrhizal
fungal species from European grasslands. Journal of Applied Botany 77: 111-115.
Omar MB, Bolland L, Heather WA. 1979. A permanent mounting medium for fungi. Bulletin of the
British Mycological Society 13: 31.
Posada D. 2006. ModelTest Server: a web-based tool for the statistical selection of models of
nucleotide substitution online. Nucleic Acids Research 34(suppl 2): w700-w703.
http://dx.doi.org/10.1093/nar/gkl042
Rivera R, Fernandez FE, Hernandez A, Martin JR, Fernandez K. 2003. El manejo efectivo de
la simbiosis micorrizica, una via hacia la agricultura sostenible. Estudio de caso: El Caribe.
Ediciones INCA, La Habana, Cuba.
Glomus cubense sp. nov. (Cuba) ... 347
Rivera R, Fernandez F, Fernandez K, Ruiz L, Sanchez C, Riera M. 2007. Advances in the management
of effective arbuscular mycorrhizal symbiosis in tropical ecosystems. 151-196, in: Hamel C,
Plenchette C (eds). Mycorrhizae in crop production. Applying knowledge. Haworth Press,
Binghampton, New York.
SchiiBler A, Walker C. 2010. The Glomeromycota. A species list with new families and new genera.
Gloucester, England.
Sokolski $, Dalpé Y, Séguin S$, Khasa D, Lévesque CA, Piché Y. 2010. Conspecificity of DAOM
197198, the model AM fungus, with Glomus irregulare: molecular evidence with three protein-
encoding genes. Botany 88: 829-838. http://dx.doi.org/10.1139/B10-050
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGA5: Molecular
evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum
parsimony methods. Molecular Biology and Evolution (in press).
http://dx.doi.org/10.1093/molbev/msr121
Walker C, Vestberg M, Demircik F, Stockinger H, Saito M, Sawaki H, Nishmura I, SchiiBler A. 2007.
Molecular phylogeny and new taxa in the Archaeosporales (Glomeromycota): Ambispora fennica
gen. sp. nov., Ambisporaceae fam. nov., and emendation of Archaeospora and Archaeosporaceae.
Mycological Research 111: 137-153. http://dx.doi.org/10.1016/j.mycres.2006.11.008
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.349
Volume 118, pp. 349-353 October-December 2011
Two new species of Exserticlava and Spiropes
on decaying wood from Guangdong, China
SHOU-CAI REN?”, JIAN MA’ & XIU-GUO ZHANG"
‘Department of Plant Pathology, Shandong Agricultural University, Taian, 271018, China
*Zaozhuang Vocational College, Zaozhuang, 277800, China
*CORRESPONDENCE TO: [email protected], [email protected]
ABSTRACT — Two new anamorphic fungi, Exserticlava manglietiae on decaying branches
of Manglietia chingii and Spiropes terminaliae on decaying branches of Terminalia mantaly,
are described and illustrated. The specimens were collected from subtropical rainforests in
Guangdong Province, China. Morphological differences between these two fungi and similar
species are summarized.
KEY worps — anamorph, hyphomycete, microfungi, systematics
Hughes (1978) introduced Exserticlava to accommodate Cordana vasiformis
Matsush. and C. triseptata Matsush., two species originally described on wood
and bamboo from Japan (Matsushima 1975). Exserticlava is characterized
by thick-walled, distoseptate conidia from polyblastic, funnel-shaped
conidiogenous cells borne on mononematous, simple conidiophores (Tsui et al.
2001a). Exserticlava is similar to Cacumisporium Preuss and Chloridium Link
in having sympodulo-phialides (Cole & Samson 1979) and holoblastic conidia
formed from the apex of polyblastic conidiogenous cells. Cacumisporium
differs from Exserticlava in euseptate conidia and cylindrical conidiogenous
cells (Tsui et al. 2001b). Conidia in Chloridium are hyaline and aseptate (Gams
& Holubova-Jechova 1976).
Ciferri (1955) established Spiropes with S. guareicola (F. Stevens) Cif. as type
species. The genus is characterized by macronematous unbranched sometimes
geniculate conidiophores, polyblastic, terminal and intercalary, sympodial
cicatrized conidiogenous cells, numerous and conspicuous scars, and solitary
acropleurogenous most commonly obclavate conidia with 1-9 transverse septa
or distosepta.
350 ... Ren, Ma & Zhang
During continuing research on saprobic fungi in subtropical forests of
Guangdong Province, China, we collected two hyphomycetes that possess
the morphological characteristics of Exserticlava and Spiropes. They differ
morphologically from any described species and are, therefore, proposed as
new to science. The type specimens are deposited in HSAUP (Herbarium of
the Department of Plant Pathology, Shandong Agricultural University) and
HMAS (Mycological Herbarium, Institute of Microbiology, Chinese Academy
of Sciences).
Exserticlava manglietiae S.C. Ren & X.G. Zhang, sp. nov. Fig. 1
MycoBank MB563099
CONIDIOPHORA macronematosa, nonramosa, erecta, laevia, atro-brunnea, apicem versus
pallidiora, 6-11-septata, 360-490 x 5-8.5 um. CELLULAE CONIDIOGENAE polyblasticae,
integratae, terminales, proliferationae sympodialiter. Conip1A acrogena, holoblastica,
solitaria, laevia, ellipsoidea, 1-distoseptata, pallide brunnea, 14-16 x 9-11 um, ad basim
truncata.
Type: CHINA. GUNGDONG PROVINCE: subtropical forest of Nanling, on dead branches
of Manglietia chingii Dandy (Magnoliaceae), 10 Dec. 2010, Sh.C. Ren (Holotype, HSAUP
H8363; isotype HMAS 146154).
ETryMoLoey: in reference to the host genus, Manglietia.
CoLtonies effuse, brown. Mycelium partly immersed, partly superficial,
composed of septate, smooth, brown, branched hyphae. CoNnIDIOPHORES
macronematous, mononematous, unbranched, erect, straight or slightly
flexuous, smooth, thick-walled, dark brown, paler towards the apex,
6-11-septate, 360-490 x 5-8.5 um, terminally swollen, 7.5-11 um wide.
CONIDIOGENOUS CELLS polyblastic, integrated, terminal, clavate, proliferating
sympodially and producing a cluster of conidia. Conidial secession schizolytic.
ConlipliA acrogenous, holoblastic, solitary, dry, smooth, ellipsoid, thick-walled,
1-distoseptate, very pale brown, 14-16 x 9-11 um, base truncate.
Notes: Exserticlava species are separated primarily based on conidial shape
and number of septa (Holubova-Jechova 1990). A key to species and a synopsis
of their characters were provided by Tsui et al. (2001a). Of the six previously
described Exserticlava species, E. manglietiae resembles E. globosa V. Rao & de
Hoog (Rao & de Hoog 1986) in possessing concolorous, thick-walled conidia
with a strictly median septum, but E. globosa produces spherical larger (17 x
21 um diam) verrucose conidia. Exserticlava uniseptata Bhat & B. Sutton and
E. yunnanensis L. Cai & K.D. Hyde also produce 1-septate conidia, but E.
uniseptata can be distinguished by its broadly obovoid, larger conidia (15-20 x
11-14 um) with a smaller basal cell and E. yunnanensis differs in hemispherical,
pale brown to subhyaline, larger conidia (16-22 x 10-13 um) with a smaller
apical cell.
Exserticlava manglietiae & Spiropes terminaliae spp. nov. (China) ... 351
Fic. 1. Exserticlava manglietiae.
A-B. Conidiophores, conidiogenous cells and conidia. C. Conidia.
Spiropes terminaliae S.C. Ren & X.G. Zhang, sp. nov. Fic. 2
MycoBank MB563100
ConipIoPHoRA singula vel fasciculate, superus fertilis parte geniculatis efformata, usque
340 um longa, basi 4.5-6.5 um crassa, apice 7-9 um crassa, CELLULAE CONIDIOGENAE
polyblasticae, integratae, terminales et intercalares, proliferationes sympodialite. CONIDIA
acropleurogena, solitaria, late fusiformia vel oblonga, 5-7-distoseptata, laevia, 27-32 x
8.5-10.5 um.
352 ... Ren, Ma & Zhang
Fic. 2. Spiropes terminaliae.
A-C. Conidiophores, conidiogenous cells and conidia. D. Conidia.
Type: CHINA. GUNGDONG PROVINCE: subtropical forest of Nanling, on dead branches
of Terminalia mantaly H. Perrier (Combretaceae), 15 Dec. 2010, Sh.C. Ren (Holotype,
HSAUP H8218; isotype, HMAS 146155).
ETyMoOLoey: in reference to the host genus, Terminalia.
COLONIES on natural substratum effuse, dark blackish brown to black, hairy.
Mycelium partly immersed and partly superficial, composed of branched, pale
brown, smooth, septate, 2-4 um thick hyphae. ConIDIOPHORES arising singly
Exserticlava manglietiae & Spiropes terminaliae spp. nov. (China) ... 353
or in groups terminally and laterally on the hyphae, erect, sterile lower part
straight or flexuous, upper fertile part with zigzag proliferation, sometimes with
geniculate fertile regions separated by sterile areas, brown to dark brown, paler
toward the apex, with numerous dark conidial scars, 6-14-septate, up to 340 um
long, 4.5-6.5 um wide at the base, 7-9 um wide at the apex. CONIDIOGENOUS
CELLS polyblastic, integrated, terminal and intercalary, sympodial, cylindrical,
cicatrized, scars conspicuous. Conrp1A holoblastic, acropleurogenous, solitary,
dry, broadly fusiform to oblong, brown to dark brown, smooth, 5-7-distoseptate,
27-32 um long, 8.5-10.5 um wide, 2.5-3.5 um wide at the truncate base.
Notes: Of the known Spiropes species, S. terminaliae is closely related to
S. guareicola in possessing macronematous unbranched conidiophores where
the upper fertile part has geniculate proliferations and distoseptate conidia.
However, S. terminaliae differs from S. guareicola in conidial shape, size, and
the number of septa. The conidia of S. guareicola are broadly fusiform, much
larger (25-52 x 10-13 um), and with fewer septa (3-5).
Acknowledgments
The authors express gratitude to Dr Eric H.C. McKenzie and Dr R.F. Castafieda-Ruiz
for serving as pre-submission reviewers and for their valuable comments and suggestions.
This project was supported by the National Natural Science Foundation of China (Nos.
31093440, 30499340, 30770015) and the Ministry of Science and Technology of the
People’s Republic of China (Nos. 2006FY120100, 2006FY110500-5).
Literature cited
Ciferri R. 1955. Observations on meliolicolous Hyphales from Santo Domingo. Sydowia 9:
296-330.
Cole GT, Samson RA. 1979. Patterns of development in conidial fungi. Pitman, London. 190 pp.
Gams W, Holubova-Jechova V. 1976. Chloridium and some other dematiaceous hyphomycetes
growing on decaying wood. Stud. Mycol. 13: 1-99.
Holubova-Jechova V. 1990. Problems in the taxonomy of the dematiaceous hyphomycetes. Stud.
Mycol. 32: 41-48.
Hughes SJ. 1978. New Zealand fungi 25. Miscellaneous species. New Zeal. J. Bot. 16: 311-370.
Matsushima T. 1975. Icones microfungorum a Matsushima lectorum. Published by the author,
Kobe, Japan. 209 p.
Rao V, de Hoog GS. 1986. New or critical hyphomycetes from India. Stud. Mycol. 28: 1-84.
Tsui CKM, Goh TK, Hyde KD. 2001a. A revision of the genus Exserticlava, with a new species.
Fungal Diversity 7: 135-143.
Tsui CKM, Goh TK, Hyde KD, Hodgkiss IJ. 2001b. New species or records of Cacumisporium,
Helicosporium, Monotosporella and Bahusutrabeeja on submerged wood in Hong Kong streams.
Mycologia 93: 389-397. http://dx.doi.org/10.2307/3761660
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.355
Volume 118, pp. 355-359 October-December 2011
Discovery of Geastrum xerophilum from the Neotropics
BIANCA DENISE BARBOSA DA SILVA’, JULIETH DE OLIVEIRA SOUSA?
& IURI GOULART BASEIA’
’ Universidade Federal de Pernambuco, Programa de Pés-Graduagdo em Biologia de Fungos,
Depto. Micologia, Centro de Ciéncias Bioldgicas,
Av. Nelson Chaves s/n, 50670-420, Recife, PE, Brazil
? Universidade Federal do Rio Grande do Norte, Depto. Botanica, Ecologia e Zoologia,
Campus Universitario, CEP: 59072-970, Natal, RN, Brazil
CORRESPONDENCE TO *: [email protected]
ABSTRACT — Geastrum xerophilum, a xerophytic species found in the Brazilian semi-arid
region, is reported for the first time from the Neotropics. Descriptions, taxonomic remarks,
and SEM-photos are provided.
Key worps — Brazil, gasteroid fungi, Geastraceae, taxonomy
Introduction
The biological diversity of the Neotropical region is still poorly known,
when compared with the Palearctic and Nearctic regions. Nevertheless, it is
considered a reference area in terms of rich species diversity (Olson et al. 2001,
Sodhi & Ehrlich 2010), encompassing megadiverse countries such as Brazil
(Brooks 2006).
Most Geastrum species commonly grow in shady, humid habitats (Sunhede
1989), but some taxa, such as G. xerophilum, adapt to desert environments
(Bates 2004). The diversity of these fungi in semiarid Brazilian biomes has
always been underestimated and is practically unknown (Drechsler-Santos et
al. 2008). Only since the turn of the century have research agencies in Brazil
begun to sponsor the study of fungal diversity in the semiarid region of the
country. The implementation of the Semiarid Biological Research Program
(PPBio-Semi-Arido) has led to an increase in the study of these environments.
Material & methods
The studied material was collected in the city of Caicd, Rio Grande do Norte, Brazil.
Macroscopic observations were made from fresh and dried materials. Color references
356 ... Silva, Sousa & Baseia
follow Kornerup & Wanscher (1978). For light microscopy, free-hand sections were
mounted in 5% (w/v) KOH. Basidiospore surface features were observed by SEM
from a small portion of the gleba, which was dusted onto double-sided adhesive tape
on a specimen holder, coated with platinum (Monthoux 1982), and examined with a
Philips - XL30 microscope. Twenty randomly selected basidiospores were measured
using an ocular micrometer and scanning electron microscopy (SEM), and all spore
measurements included surface ornamentation. Statistic measures of spore length and
width are given as x + SD (arithmetic mean + standard deviation) and “Qm” (the ratio
of mean spore length to width). The specimens are deposited in the Herbarium of the
Federal University of Rio Grande do Norte (UFRN), Brazil.
Results
Geastrum xerophilum Long ex Desjardin, Pacific Science 65: 493 (2011).
Fics 1-3
Expanded basidiome saccate, 20 mm wide x 13 mm tall. Exoperidium splitting
into 7 rays, non-hygroscopic. Rays involute rolling up under the endoperidium.
Mycelial layer brown (6E4), felted, thin, encrusted with sand, persistent.
Fibrous layer grayish brown (6D3), papery, thin. Pseudoparenchymatous layer
dark brown (6F4), thick, rigid, persistent. Endoperidial body 16 mm wide x
8 mm tall (including peristome), stalked, depressed globose, grayish orange
(5B3) to brownish orange (5C3), furfuraceous becoming glabrous with age.
Apophysis discrete. Stalk <2 mm tall, concolorous with the endoperidium.
Peristome plicate becoming lacerated with age, not delimited, concolorous with
endoperidium, applanate. Gleba brown (6F5).
Basidiospores globose to subglobose 4.3-6.3 um x 4.3-6.3 um [x = 5.6 + 0.7
x 5.6 + 0.7, Qm = 1.0, n = 20], with pedicel rudimentary, densely verrucose,
yellowish brown in 5% KOH. Eucapillitium 3.8—6.3 um diam., glabrous to lightly
encrusted, lumen absent, walls >1 um thick. Mycelial layer composed of thin
sinuous-walled hyphae, lumen absent, 2.5—5.0 um diam., yellow to hyaline in
5% KOH. Fibrous layer composed of thin straight walled hyphae, lumen absent,
1.6-3.8 um diam., yellow to hyaline in 5% KOH. Pseudoparenchymatous layer
composed of sublobose, citriform to elongated hyphae, 16.5-31.7 um diam.
x 12.7-33.0 um in length, walls >1 um thick, hyaline to pale yellowish in 5%
KOH.
Substrate —Solitary in sandy soil.
SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO NOorTE: Caicdé, 06°14'302"S,
37°02'958"W, 163 ma.s.l., 29.V.2010, col. B.D.B. Silva (UFRN 1508).
TAXONOMIC REMARKS — Geastrum xerophilum, a species typical of xerophytic
environments, was collected in Brazil’s Caatinga domain. ‘The collection site is
characterized by xerophilous vegetation and semiarid climate with low irregular
rainfall and high temperature and evapotranspiration (Leal et al. 2005). The
Geastrum xerophilum from the Neotropics (Brazil) ... 357
10 mm
FIGURE 1. Basidiomes of Geastrum xerophilum.
species is morphologically similar to G. campestre Morgan, which differs in its
hygroscopic rays, delimited peristome, and larger spores (6.5-8.0 um diam.)
(Sunhede 1989). Geastrum kotlabae VJ. Stanék is another proximate species,
but it exhibits strongly hygroscopic rays bent around the endoperidium and a
detached mycelial layer and sessile endoperidium (Sunhede 1989, Bates 2004).
Previously the distribution of G. xerophilum was thought to be restricted to
North America, with records from Arizona (Bates 2004), New Mexico (Ponce
de Leon 1968) and Mexico (Esqueda et al. 1995, 2009, Moreno et al. 2010), and
to Hawaii (Smith & Ponce de Leon 1982, Gilbertson et al. 2001, Hemmes &
Desjardin 2011). Therefore G. xerophilum is recorded here for the first time for
the Neotropical region.
Recently, G. xerophilum was recognized as an invalid name and validated by
Hemmes & Desjardin (2011) because Long’s (1942) original description lacked
a Latin diagnosis (McNeill et al. 2006: Art. 36.1).
Acknowledgments
The authors gratefully acknowledge the CTPETRO-INFRA and FINEP/LIEM for
their collaboration with scanning electron microscopy. The authors express their deep
thanks to Dennis E. Desjardin (State University San Francisco, USA) and Taiga Kasuya
(University of Tsukuba, Japan) for reviewing the manuscript. This work was financed
by the Coordenacao de Aperfeigoamento de Pessoal de Nivel Superior (CAPES) and
Conselho Nacional de Desenvolvimento Cientifico e Tecnolégico (CNPq).
Literature cited
Bates ST. 2004. Arizona members of the Geastraceae and Lycoperdaceae (Basidiomycota, Fungi).
Master Thesis, Arizona State University, U.S.A.
Brooks TM, Mittermeier RA, Fonseca GAB, Gerlach J, Hoffmann M, Lamoreux JF, Mittermeier
CG, Pilgrin JD, Rodrigues ASL. 2006. Global biodiversity conservation priorities. Science 313:
58-61. http://dx.doi.org/10.1126/science.1127609.
358 ... Silva, Sousa & Baseia
Magn
12000x
11000x
FIGURES 2-3. Geastrum xerophilum: basidiospores under SEM.
Geastrum xerophilum from the Neotropics (Brazil) ... 359
Drechsler-Santos ER, Wartchow F, Baseia IG, Gibertoni TB, Cavalcanti MAQ. 2008. Revision of the
Herbarium URM I. Agaricomycetes from the semi-arid region of Brazil. Mycotaxon 104: 9-18.
Esqueda M, Pérez-Silva E, Herrera T. 1995. New records of gasteromycetes for Mexico. Documents
Mycologiques 25(98-100): 151-160.
Esqueda M, Sanchez A, Rivera M, Coronado ML, Lizarraga M, Valenzuela R. 2009. Primeros
registros de hongos gasteroides en la Reserva Forestal Nacional y Refugio de Fauna Silvestre
Ajos-Bavispe, Sonora, México. Revista Mexicana de Micologia 30: 19-29.
Gilbertson RL, Desjardin DE, Rogers JD, Hemmes DE. 2001. Fungi from the Mamane-Naio
vegetation zone of Hawai'i. Fungal Diversity 6: 35-69.
Hemmes DE, Desjardin DE. 2011. Earthstars (Geastrum, Myriostoma) of the Hawaiian Islands
including two new species, Geastrum litchiforme and Geastrum reticulatum. Pacific Science 65:
477-496.
Kornerup A, Wansher JE. 1978. Methuen handbook of colour, 3rd edn., London: Methuen.
Leal IR, Silva JMC, Tabarelli M, Lacher Jr TE. 2005. Mudando o curso da conservacao da
biodiversidade na Caatinga do Nordeste do Brasil. Megadiversidade 1(1): 139-146.
Long WH. 1942. Studies in the Gasteromycetes IV. A new species of Geaster. Mycologia 34: 13-16.
McNeill J, Barrie FR, Burdet HM, Demoulin V, Hawksworth DL, Marhold K, Nicolson DH,
Prado J, Silva PC, Skog JE, Wiersema J, Turland NJ. 2006. International Code of Botanical
Nomenclature (Vienna Code). Adopted by the Seventeenth International Botanical Congress,
Vienna, Austria, July 2005. Regnum Vegetabile 146. 568 p.
Monthoux O. 1982. Micromorphologie des spores et capillitiums des Gastéromycetes dés stations
xériques de la région de Geneve, étudée au microscope életronique 4 balayage (SEM). Candollea
3726399.
Moreno G, Lizarraga M, Esqueda M, Coronado M L. 2010. Contribution to the study of gasteroid
and secotioid fungi of Chihuahua, Mexico. Mycotaxon 112: 291-315.
Olson DM, Dinerstein E, Wikramanayake ED, Burgess ND, Powell GVN, Underwood EC,
D’Amico JA, Strand HE, Morrison JC, Loucks CJ, Allnutt TE, Lamoreux JE, Ricketts TH, Itoua I,
Wettengel WW, Kura Y, Hedao P, Kassem K. 2001. Terrestrial ecoregions of the world: A new
map of life on Earth. BioScience 51: 933-938.
http://dx.doi.org/10.1641/0006-3568(2001)051[0933: TEOT WA]2.0.CO;2
Ponce de Leon P. 1968. A revision of the family Geastraceae. Fieldiana Botany 31: 302-349.
Smith CW, Ponce de Leén P. 1982. Hawaiian geastroid fungi. Mycologia 74: 712-717.
doi:10.2307/3792856
Sodhi NS, Ehrlich PR. 2010. Conservation biology for all. Oxford University Press, Oxford, UK.
344 p.
Sunhede S. 1989. Geastraceae (Basidiomycotina). Morphology, ecology, and systematics with special
emphasis on the North European Species. Synopsis Fungorum 1. 534 p.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.361
Volume 118, pp. 361-381 October-December 2011
A preliminary ITS phylogeny of Melanoleuca (Agaricales),
with special reference to European taxa
ALFREDO VIZZINI’*, ROBERTO PARA”, ROBERTO FONTENLA3,
STEFANO GHIGNONE’, ENRICO ERCOLE’
‘Dipartimento di Biologia Vegetale - Universita degli Studi di Torino
Viale Mattioli 25, I-10125, Torino, Italy
? Via Martiri di Via Fani 22, I-61024, Mombaroccio (PU), Italy
> Via Monte Marino 26, I-60125 Ancona, Italy
* Istituto per la Protezione delle Piante, CNR Sezione di Torino,
Viale Mattioli 25, I-10125, Torino, Italy
CORRESPONDENCE TO ”: alfredo. [email protected]
ABSTRACT — Ninety-one Melanoleuca collections were chosen to test the agreement of
current and traditional infrageneric tripartite classifications of Melanoleuca (subgenera
Acystis without cystidia, Urticocystis with urticiform cystidia, and Melanoleuca with
macrocystidia) with molecular phylogenetic data (ITS sequences analysis) and to evaluate
the systematic significance of relevant morphological characters. Melanoleuca is found to be
monophyletic, and only two emended subgenera, Urticocystis and Melanoleuca, are supported.
Subg. Urticocystis comprises all taxa with urticoid cystidia plus the macrocystidiate M. cognata
complex. The artificial subg. Acystis is shown to be polyphyletic and no longer tenable. The
entire genus comprises at least 10 clades with 13 subclades. Melanoleuca sublanipes sp. nov.
and new combinations M. exscissa f. iris, M. exscissa f. sarcophylla, M. exscissa f. diverticulata,
and M. paedida f. electropoda are introduced.
Key worps — Basidiomycota, Agaricomycetes, Kinia, pluteoid clade, taxonomy
Introduction
Kirk et al. (2008) state that the basidiomycete genus Melanoleuca Pat., typified
by M. vulgaris (Pat.) Pat. [= M. melaleuca (Pers.) Murrill] and traditionally
placed in subtribe Leucopaxillineae Singer (Tricholomataceae R. Heim ex
Pouzar, Agaricales Underw.) (Singer 1986), comprises approximately 50 saprobic
species worldwide. However, Index Fungorum (http://www.indexfungorum.
org/, accessed 28 June 2011), lists 332 validly published Melanoleuca names
representing 126 European and 206 extra-European taxa (pers. obs.). Of the 164
names that actually represent the genus as presently circumscribed (cf. Pfister
362 ... Vizzini & al.
1984), many are now known as synonyms with others yet to be listed as such.
New taxa are, however, continuously being described, even from well-studied
areas such as Europe (e.g., Bresinsky 2006, this paper). Melanoleuca species
are cosmopolitan and characterised by the following characters: collybioid to
tricholomatoid basidiomata; convex to slightly depressed (often with a shallow
umbo) pilei; emarginated to adnate to shortly decurrent lamellae; absence of
veils; white to pale-yellowish spore print; cutis to trichoderm pileipellis; hyaline
spores with amyloid ornamentations; cheilocystidia (mostly present) of two
types either urticoid, septate, thin-walled or fusiform to lageniform, mostly
aseptate, slightly thick-walled, sometimes with encrusting crystals at apex;
pleurocystidia similar to cheilocystidia; no clamp connections (Pegler & Young
1973, Gillman & Miller 1977, Kithner 1978, Singer 1986, Boekhout 1988, 1999;
Bon 1991, Vesterholt 2008, Watling & Turnbull 2008). Leucopaxillus Boursier,
a morphologically allied genus, differs from Melanoleuca mainly in abundant
clamp connections and (usually) lacking well-developed hymenial cystidia
(Singer 1986, Bon 1991). But, according to recent molecular analyses (Moncalvo
et al. 2002, Matheny et al. 2006), Melanoleuca and Leucopaxillus are not closely
related: Melanoleuca species cluster within the Pluteoid clade (Pluteaceae
Kotl. & Pouzar), whereas Leucopaxillus belongs to the Tricholomatoid clade,
close to Tricholoma (Fr.) Staude. Sequence analyses by Moncalvo et al. (2000,
2002) place Melanoleuca and Pluteus Fr. as sister to Amanitaceae R. Heim ex
Pouzar, while others place the minute uniloculate gasteromycete, Limnoperdon
incarnatum G.A. Escobar, sister to Melanoleuca and Pluteus (Bodensteiner
et al. 2004; Binder et al. 2006; Vizzini et al. 2010) or to Melanoleuca, Pluteus
and Volvariella Speg. (Matheny et al. 2006). Justo et al. (2011) recently place
Melanoleuca as sister to a monophyletic group formed by Pluteus species and
Volvopluteus Vizzini et al. Finally, Vizzini et al. (2010) reduced the puzzling
genus Kinia Consiglio et al. to a subgenus of Melanoleuca with non-amyloid
spores.
Melanoleuca is one of the less appealing fungal genera, whose members
are mostly tedious and drab in appearance and dull in pileus colours. It is a
character-poor genus with many species macroscopically very similar and
differing only in very subtle features (e.g., basidioma colour, odour, stipe
ornamentation) and a morphology strongly influenced by environmental
factors (Bon 1991, Boekhout 1999). Thus far, infrageneric classifications and
species circumscriptions have relied on morphological characters. Identification
especially depends on microscopic observations of a rather limited set of
characters, such as presence/absence of cheilocystidia, cystidial shape, spore size
and ornamentation, and pileipellis structure. Interpretation of some characters
may rely on personal experience (e.g. shape of cystidia); in some cases the
value ranges overlap (e.g. spore size), in others pileipellis structure and spore
ITS sequence analysis of Melanoleuca ... 363
size show great intra-basidiome variability. From a traditional morphological
perspective, this often makes species identification difficult or even daunting.
The paucity of Melanoleuca characters has been detrimental to establishing a
natural taxonomic framework for rationalizing infrageneric relationships.
The lack of a modern Melanoleuca monograph and the existence of
many short, taxonomically and geographically limited publications further
complicate the situation. In addition, there are many controversies concerning
the interpretations of old descriptions and names (Boekhout 1988).
Several different infrageneric classifications of Melanoleuca have been
published. Singer (1935, 1943, 1986), Métrod (1942, 1948), Kithner (1978), and
Moser (1983) proposed schemes based mainly on macromorphological features
(see Boekhout 1988 for an historical review). Singer (1986), for example,
divided Melanoleuca into four sections —Alboflavidae Singer, Humiles Singer,
Oreinae Singer, Melanoleuca— circumscribed only by pileus colour and stipe
ornamentation.
Bon (1978), the first to present an infrageneric classification based equally on
macro- and micro-morphological characters, divided Melanoleuca into seven
sections. Boekhout (1988), focusing mainly on microscopic features, stressed
the importance of absence/presence and shape of cystidia (first noted by Metrod
1948) and divided the genus into three subgenera (Tas. 1): subg. Melanoleuca—
no cystidia; subg. Urticocystis Boekhout—with urticiform cheilocystidia and no
(or very rare) pleurocystidia; subg. Macrocystis Boekhout—with long fusiform
to lageniform cheilocystidia (macrocystidia) and similar pleurocystidia.
Boekhout recognized two urticiform types: the brevipes-type (with narrow
cylindrical upper part, Fic. la) and the exscissa-type (with rather wide upper
part attenuating towards the apex, Fic. 1b).
Bon (1991) proposed a slightly different infrageneric classification (TaB. 1)
by introducing the spore Q value (the ratio of length to width of the spores in
side view) and stressing the importance of fusiform versus lageniform cystidia
(Fic. lc-d) as important key characters for delimiting subsections.
Finally, Boekhout (1999) reintroduced a simplified classification practically
identical to the 1988 scheme except that sect. Grammopodiae was no longer
subdivided into subsects. Grammopodiae and Exscissae (TaB. 1).
There are only two major monographic treatments of Melanoleuca: Bon
(1991) covers over 80 taxa, most reported only from Europe, and Boekhout
(1999), covers only Dutch taxa and unites species into large complexes thereby
recognizing only 14 species and several forms and varieties.
Bon (1991), who covered a larger number of taxa, was used both for selecting
which species to sample and for testing the effectiveness of Bon’s classification
method. Due to the limitation of morphological characters used, several of his
taxonomical units remain controversial.
364 ... Vizzini & al.
TABLE 1. The tripartite infrageneric classifications of Melanoleuca
by Bon and Boekhout.
BOEKHOUT’S CLASSIFICATION (1988, 1999)
SuBG. MELANOLEUCA - without cystidia.
SusG. Urticocystis - cheilocystidia urticiform and pleurocystidia absent or very rare.
Sect. Humiles - stipe squamulose or verrucose throughout; stipe
usually much longer than diameter of the pileus.
Sect. Grammopodiae — stipe smooth or somewhat fibrillose; stipe much
shorter than or equally large as diameter of pileus.
*Subsect. Grammopodiae - urticiform cystidia of the brevipes-type.
*Subsect. Exscissae — urticiform cystidia of the exscissa-type.
SusG. Macrocystis - cheilocystidia fusiform to lageniform and pleurocystidia similar.
Sect. Cognatae - with a bright coloured pileus.
Sect. Alboflavidae - with a white to cream-whitish pileus.
Sect. Strictipedes - with a grey-brown pileus.
BON’ S CLASSIFICATION (1991)
SuBG. ACYSTIS — species without cystidia.
Sect. Acystis —- spores with a Q<1.4(-1.5).
Sect. Decembres - spores with a Q>(1.5-) 1.6.
SusG. Urticocystis — cheilocystidia urticiform to strictly lageniform, septate,
up to 50(-60) um long.
Sect. Humiles — stipe squamulose to dark-dotted.
Sect. Grammopodiae - stipe smooth or striate, sometimes pruinose or flocky.
Subsect. Rasilinae - spores with a Q<1.4(-1.5), with isolated warts,
cystidia typically urticiform.
Subsect. Grammopodiae - spores with a Q>(1.5-)1.6, cystidia typically urticiform.
Subsect. Exscissae — spores with a Q>(1.5-)1.6, urticiform cystidia of the exscissa-type.
SuBG. MELANOLEUCA — macrocystidia fusiform to lageniform, non-septate,
up to (40-)50-90(-110) um long.
Sect. Alboflavidae - basidiomes white to whitish.
Sect. Cognatae — basidiomes with bright colours, pileus and lamellae concolorous.
Sect. Oreinae — basidiomes small (<4(-6) cm), collybioid, often dark coloured.
Sect. Melanoleuca — basidiomes small to medium-sized (>(5-)
6 cm), with variable colourations.
Subsect. Strictipedinae - cystidia mainly lageniform.
Subsect. Vulgarinae - cystidia mainly fusiform.
* = subsections present in the 1988 classification scheme only.
The present study is based on a large ITS sequence dataset and is the first
to examine Melanoleuca extensively. Our aims were to 1) check whether
Melanoleuca is monophyletic as traditionally circumscribed; 2) test Bon’s
(1991) morphologically based taxonomy against molecular phylogenetic data;
3) evaluate whether traditional or other morphological features (e.g., pileus
colour, spore and cheilocystidia shape) reflect phylogenetic relationships.
Materials & methods
Taxon sampling
Samples from 91 Melanoleuca collections (41 taxa, 18 unidentified Melanoleuca sp.;
TaB. 2) were tested. Specimens were collected fresh, dried, and depositedin ANC (Erbario
ITS sequence analysis of Melanoleuca ... 365
FIGURE 1. Types of cystidia in Melanoleuca.
a-b. Urticiform cystidia (a = brevipes-type; b = exscissa-type).
c-d. Macrocystidia (c = fusiform; d = lageniform).
Bar = 20 um.
366 ... Vizzini & al.
TABLE 2. Melanoleuca collections examined (species with multiple collections
numbered consecutively; see also Fic. 2).
COLLECTIONS
* Melanoleuca albifolia 1
* M. albifolia 2
* M. angelesiana 1
* M. angelesiana 2
* M. arcuata
* M. atripes
* M. bataillei
M. brevipes 1
M. brevipes 2
M. cinereifolia 1
M. cinereifolia 2
M. cinereifolia 3
M. cognata 1
* M. cognata 2
* M. decembris 1
* M. decembris 2
* M. decembris 3
M. decembris 4
* M. diverticulata
* M. electropoda
M. evenosa
* M. exscissa 1
* M. exscissa 2
* M. exscissa 3
* M. exscissa 4
* M. exscissa 5
* M. exscissa 6
* M. friesii
* M. graminicola
* M. grammopodia 1
* M. grammopodia 2
* M. grammopodia 3
* M. grammopodia
f. macrocarpa 1
* M. grammopodia
f. macrocarpa 2
M. grammopodia
f. macrocarpa 3
* M. heterocystidiosa 1
* M. heterocystidiosa 2
* M. iris
* M. “lanipes”
* M. melaleuca
* M. microcephala
* M. nivea 1
* M. nivea 2
M. nivea 3
CoOL. ID./ORIGIN
ANC MO0182/Spain
ANC M0184/Italy
ANC M0203/Italy
ANC M0204/Italy
ANC MO0167/Italy
ANC M0180/Italy
ANC M0185/Italy
MCVE 04574/Italy
MCVE 04505/Italy
MCVE 01471/Italy
MCVE 11243/Italy
MCVE 20748/Italy
MCVE 13939/Italy
ANC M0170/Italy
ANC M0197/Italy
ANC M0199/Italy
ANC M0200/Italy
MCVE 01573/Italy
ANC M0206/Italy
ANC MO0187/Italy
MCVE 14576/Italy
ANC M0207/Italy
ANC M0208/Italy
ANC M0210/Italy
ANC M0210B/Italy
ANC M0212/Italy
ANC M0213/Italy
ANC M0186/Italy
ANC M0201/Italy
ANC M0217/Italy
ANC M0218/Italy
ANC MO0219/Slovenia
ANC M0215/Italy
ANC M0216/Italy
MCVE 04410/Italy
ANC MO0174/Italy
ANC MO175/Italy
ANC M0211/Italy
ANC MO0166/Italy
ANC MO0176/Italy
ANC MO0196/Italy
ANC MO0177/Italy
ANC MO0183/Italy
MCVE 09578/Italy
* = collections newly sequenced in this study.
SUBGENERA / SECTIONS
(BON 1991)
Melanoleuca / Oreinae
Melanoleuca / Oreinae
Acystis / Acystis
Acystis / Acystis
Melanoleuca / Cognatae
Melanoleuca / Oreinae
Melanoleuca / Melanoleuca
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Melanoleuca / Melanoleuca
Melanoleuca / Melanoleuca
Melanoleuca / Melanoleuca
Melanoleuca / Cognatae
Melanoleuca / Cognatae
Acystis / Decembres
Acystis / Decembres
Acystis / Decembres
Acystis / Decembres
Urticocystis /Grammopodiae
Melanoleuca / Oreinae
Melanoleuca / Alboflavidae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Melanoleuca / Melanoleuca
Acystis / Acystis
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Melanoleuca / Melanoleuca
Melanoleuca / Melanoleuca
Urticocystis /Grammopodiae
Melanoleuca / Melanoleuca
Melanoleuca / Melanoleuca
Urticocystis /Grammopodiae
Melanoleuca / Alboflavidae
Melanoleuca / Alboflavidae
Melanoleuca / Alboflavidae
ITS
Acc. No.
JN616418
JN616419
JN616420
JN616421
JN616422
JN616423
JN616424
JF908352
JF908351
JN052138
JF908356
JN052137
JF908360
JN616425
JN616426
JN616427
JN616428
JF908346
JN616429
JN616430
JN052142
JN616431
JN616432
JN616433
JN616434
JN616435
JN616436
JN616437
JN616438
JN616439
JN616440
JN616441
JN616442
JN616443
JF908350
JN616444
JN616445
JN616446
JN616447
JN616448
JN616449
JN616450
JN616451
JN392452
TABLE 2, concluded
COLLECTIONS
M. oreina
* M. paedida 1
* M. paedida 2
M. “paratristis”
* M. privernensis
* M. pseudoluscina 1
* M. pseudoluscina 2
* M. pseudoluscina 3
* M. pseudoluscina 4
* M. pseudoluscina 5
* M. pseudopaedida
* M. rasilis
* M. robertiana
* M. robusta
* M. strictipes 1
* M. strictipes 2
* M. strictipes 3
* M. stridula
* M. striimarginata
M. subalpina
* M. sublanipes 1
* M. sublanipes 2
* M. sublanipes 3
* M. subpulverulenta 1
* M. subpulverulenta 2
* M. substrictipes 1
M. substrictipes 2
* M. substrictipes
var. sarcophylla
M. verrucipes
* Melanoleuca sp. 1
* M. sp. 2
* M. sp. 3
M. sp. 4
M. sp. 5
M. sp. 6
M. sp. 7
M. sp. 8
M. sp. 9
M. sp. 10
M. sp. 11
M. sp. 12
M. sp. 13
M. sp. 14
M. sp. 15
* M. sp. 16
M. sp. 17
M. sp. 18
CoOL. ID./ORIGIN
MCVE 07839/Italy
ANC MO0189/Italy
ANC MO0190/Italy
MCVE 12645/Italy
GC 08310 holotype/Italy
ANC MO0191/Italy
ANC MO0192/Italy
ANC MO0193/Italy
ANC MO0194/Italy
ANC MO0195/Italy
ANC MO0198/Italy
ANC M0220/Italy
ANC M0205/Italy
ANC MO0179/Italy
ANC MO171/Italy
ANC MO0172/Italy
ANC MO0173/Italy
ANC M0007/Italy
ANC M0202/Italy
MCVE 04112/Italy
ANC M0221/Italy
ANC M0222
holotype/Italy
ANC M0223/France
ANC M0004/Italy
ANC MO178/Italy
ANC M0214/Italy
MCVE 13934/Italy
ANC M0209/Italy
MCVE 09962Switzerland
ANC MO18I1/Italy
ANC MO0188/Italy
ANC M0224/Italy
MCVE 12248/Italy
MCVE 13410/Italy
MCVE 09821/Italy
MCVE 01687/Italy
MCVE 01683/Italy
MCVE 19223/Italy
MCVE 08389/Italy
MCVE 08432/Italy
MCVE 14221/Italy
MCVE 08384/Italy
MCVE 03316/Italy
MCVE 19627/Italy
MCVE 24095/Italy
MCVE 01681/Italy
MCVE 14273/Italy
SUBGENERA / SECTIONS
(BON 1991)
Melanoleuca / Oreinae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Acystis / Acystis
Subgen. Kinia (Vizzini
et al. 2010)
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Acystis / Acystis
Urticocystis /Grammopodiae
Acystis / Acystis
Melanoleuca / Melanoleuca
Melanoleuca / Alboflavidae
Melanoleuca / Alboflavidae
Melanoleuca / Alboflavidae
Acystis / Acystis
Acystis / Acystis
Melanoleuca / Alboflavidae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Melanoleuca / Melanoleuca
Melanoleuca / Melanoleuca
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Urticocystis / Humiles
Acystis / Acystis
Acystis / Acystis
Melanoleuca / Melanoleuca
Melanoleuca / Melanoleuca
Melanoleuca / Melanoleuca
Melanoleuca / Melanoleuca
Melanoleuca / Melanoleuca
Melanoleuca / Melanoleuca
Melanoleuca / Melanoleuca
Melanoleuca / Cognatae
Melanoleuca / Melanoleuca
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Urticocystis /Grammopodiae
Acystis / Decembres
ITS sequence analysis of Melanoleuca ... 367
ITS
Acc. No.
JN392450
JN616452
JN616453
JE
908357
JN616454
JN616455
JN616456
JN616457
JN616458
JN616459
JN616460
JN616461
JN616462
JN616463
JN616464
JN616465
JN616466
JN616467
JN616468
JN052139
JN616469
JN616470
JN616471
JN616472
JN616473
JN616474
JF
908359
JN616475
JE
908354
JN616476
JN616477
JN616478
JN052141
JE
908358
JN392453
JN392449
JN392448
JN392446
JE
908353
JN052140
JN392454
JN392451
JE
JE
908349
908344
JN616479
JN392447
JF
908362
368 ... Vizzini & al.
dell’Universita di Ancona, Italy) or acquired from MCVE (the Museo di Storia Naturale
di Venezia Herbarium, Italy) (Tas. 2). MCVE collections were chosen, even where
often misdetermined, because DNA had already been bar-coded by Dr. M. Garbelotto
(University of California, Berkeley). All Melanoleuca collections were identified or
redetermined using i) an unpublished key based on the protologues or referenced to
original collections (Fontenla & Para, ined.) and ii) existing monographs (Bon 1991,
Boekhout 1999, Fontenla et al. 2003). Watling & Turnbull (1983), Horak (2005), and
Vesterholt (2008) were also consulted. When not identifiable, collections are cited in
TaB. 2 and Fic. 2 as Melanoleuca sp. Melanoleuca species were selected to represent
subgenera and sections in Bon (1991; Tas. 1). Each section was represented by at least
two species except for sect. Humiles (represented only by M. verrucipes). Melanoleuca
privernensis (Consiglio et al.) Consiglio et al. [= Kinia privernensis] was also included
in the dataset in accordance with Vizzini et al. (2010). In the species descriptions Q =
quotient of length and width of the spores in side view and Qm = average quotient. The
spore Qm value and cystidia shape are reported for each collection in Fic. 2. Herbarium
abbreviations follow Thiers (2011). Author citations follow the Index Fungorum-
Authors of Fungal Names (http://www.indexfungorum.org/authorsoffungalnames.
htm) and the names of new taxa are deposited in MycoBank (http://www.mycobank.
org/DefaultPage.aspx).
DNA extraction, PCR amplification, DNA sequencing
Genomic DNA was isolated, extracted from 62 dried herbarium specimens (Tas. 2)
using the DNeasy Plant Mini Kit (QIAGEN, Milan, Italy). Universal primers ITS1F/
ITS4 were used for ITS region amplification (White et al. 1990, Gardes & Bruns 1993).
Amplification reactions were performed in a PE9700 thermal cycler (Perkin-Elmer,
Applied Biosystems) in 25 mL reaction mixtures with these final concentrations or total
amounts: 5 ng DNA, 13 PCR buffer (20 mM Tris/HCl pH 8.4, 50 mM KCl), 1 mM each
primer, 2.5mM MgCl2, 0.25mM each dNTP, 0.5 unit Taq polymerase (Promega). The
PCR program was 3 min at 95 C for one cycle, 30 s at 94 C, 45 s at 50 C, 2 min at 72 C
for 35 cycles, 10 min at 72 C for one cycle. PCR products were resolved on a 1.0%agarose
gel and visualized by staining with ethidium bromide. PCR products were purified with
the AMPure XP kit (Beckman) and sequenced by DINAMYCODE srl (Turin, Italy).
Sequences were assembled and edited with the phred/phrap/consed software suite and
submitted to GenBank (Tas. 2).
Sequence alignment and phylogenetic analysis
Sequences included in the phylogenetic analyses were generated in this study
(TaB. 2) or retrieved from GenBank. GenBank sequences were selected based on other
phylogenetic studies on Agaricales (Moncalvo et al. 2002; Matheny et al. 2006; Justo et al.
2011). Limnoperdon incarnatum (DQ097363) was used as outgroup taxon. Other taxa
belonging to the Pluteoid clade were included in the analysis for testing the monophyly
of Melanoleuca.
Sequences obtained in this study were checked and assembled using Geneious v5.3
(Drummond et al. 2010). Alignment of the ITS dataset was generated using MAFFT
v6.814b (Katoh et al. 2002) with default conditions for gap openings and gap extension
penalties. The alignment was then imported into MEGA 5.0 (Tamura et al. 2011) for
ITS sequence analysis of Melanoleuca ... 369
manual adjustment. Best-fit models were estimated by both the Akaike Information
Criterion (AIC) and the Bayesian Information Criterion (BIC) using jModelTest 0.1.1
(Posada 2008) to provide a substitution model for each single alignment. TPM2uf+I+G
model was chosen. Phylogenetic hypotheses were constructed under Bayesian Inference
(BI) and Maximum Likelihood (ML) criteria.
BI of phylogeny using Monte Carlo Markov Chains (MCMC) was carried out with
MrBayes 3.1.2 (Huelsenbeck & Ronquist 2001). Four incrementally heated simultaneous
MCMC were run over 10.000.000 generations, under model assumption. Trees were
sampled every 1.000 generations resulting in an overall sampling of 10.001 trees. The
“burn-in” value was evaluated using Tracer 1.5 (Rambaut & Drummond 2007). The
first 15% of trees was discarded as “burn-in”. For the remaining trees, a majority rule
consensus tree showing all compatible partitions was computed to obtain estimates for
Bayesian Posterior Probabilities (BPP). Branch lengths were estimated as mean values
over the sampled trees. Only BPP values over 50% are reported in the resulting trees.
This Bayesian analysis was repeated three times, always using random starting trees and
random starting values for model parameters to test the independence of the results
from the revisiting of the prior topologies during chain growth (Huelsenbeck et al.
2002).
ML estimation was performed through RAXML v.7.0.4 (Stamatakis 2006) with 1,000
bootstrap replicates (Felsenstein 1985) using the GTRGAMMAT algorithm to perform
a tree inference and search for a good topology. Support values from bootstrapping runs
(MLB) were mapped on the globally best tree using the “-f a” option of RAxML and
“-x 12345” as a random seed to invoke the novel rapid bootstrapping algorithm. Support
values for major clades that are supported by either BI and ML analyses are visualized
in the resulting tree.
Analysis of the pairwise % identity values (hereafter shortened as P%IV) for the
Melanoleuca sequences were calculated using MEGA 5.0 (Tamura et al. 2011).
Results
Our phylogenetic results are presented in Fic. 2. The general ITS data matrix
comprises a total of 105 sequences (including 14 from GenBank). This 898 bp
dataset contains 621 (69.2%) variable sites, of which 525 (58.4%) are parsimony-
informative. The Bayesian and ML tree topologies are congruent. Our analyses
show that Melanoleuca is clearly monophyletic (1.0 BPP and 89% MLB). Two
major clades, A and B, were distinguished within Melanoleuca. Clade A is
supported by only BI tree with 0.79 BPP, while clade B is well supported with
1.0 BPP and 99% MLB. Clade A consists of 5 clades (A1-A5, with 10 subclades)
and clade B of 5 clades (B1-B5, with 3 subclades).
Discussion
Melanoleuca and infrageneric classification
The Bayesian (1.0 BPP) and ML (89% MLB) analyses strongly support
Melanoleuca as monophyletic and distributed throughout the ingroup within
370 ... Vizzini & al.
2 major clades (A and B) with 10 smaller clades (A1—A5 and B1-B5) (Fie. 2).
The two sequences of M. subsejuncta (Peck) Murrill from GenBank (FJ596898;
FJ596898) cluster outside Melanoleuca, sister to Amanitaceae; Pfister (1984),
who examined its type, referred the collection to Tricholoma. Results of
our phylogenetic analyses and the current morphology-based infrageneric
classification of Melanoleuca are not congruent. In particular, our data (Fic.
2) are incompatible with the tripartite infrageneric Melanoleuca classification
of Bon (1991) and Boekhout (1988, 1999) (Tas. 1). Based on molecular data,
species traditionally ascribed to subgenus Acystis Bon (= subgenus Melanoleuca
sensu Boekhout 1988, 1999) do not form a monophyletic assemblage and are
distributed over the Melanoleuca clade (clade A and B, Fig. 2).
The fact that acystidiate taxa are not phylogenetically related implies that
cystidial acquisition and loss have taken place independently during the
evolution of Melanoleuca and also that this character is homoplastic and
unsuitable for a natural classification of these fungi. Subgenus Acystis should
therefore be considered an artificial superfluous taxon that is no longer tenable.
In addition, in some cases (e.g. subclades A4.1 & A4.2; clade B2, Fic. 2),
cystidiate and non-cystidiate taxa are conspecific (syntaxic): the acystidiate
M. sp. 18, M. sp. 2, and M. sp. 1 represent only forms of the cystidiate taxa
M. pseudoluscina Bon, M. paedida (Fr.) Kihner & Maire, and M. atripes
Boekhout/M. albifolia Boekhout, respectively. It is conceivable that the shift
from cystidiate to non-cystidiate basidiomata and vice versa within a single
species is controlled by a limited number of genes that are switched off by so far
unknown environmental factors.
Most macrocystidiate taxa in subg. Melanoleuca (= Macrocystis Boekhout)
form clade B (Fic. 2), while the M. cognata complex (A5 clade, = sect. Cognatae)
nests with all species in subg. Urticocystis to form clade A (Fic. 2). Therefore,
subg. Melanoleuca as traditionally circumscribed (Bon 1991) is polyphyletic
and subg. Urticocystis is paraphyletic when sect. Cognatae is excluded. It would
appear that even cystidial shape is not a reliable character for tracing higher
phylogenetic relationships.
Our analysis therefore implies that only two subgenera (clades A and B)
should be recognized in Melanoleuca:
Melanoleuca Pat. subg. Melanoleuca, emend. Fontenla, Para & Vizzini
Clade B (the autonymous subgenus, including M. melaleuca), characterized by
basidiomata with non-septate macrocystidia, or rarely without cystidia.
Melanoleuca subg. Urticocystis Boekhout, Persoonia 13(4): 400 (1988),
emend. Fontenla, Para & Vizzini
Clade A (type species: M. grammopodia (Bull.) Murrill), comprising taxa mainly with
urticocystidia but also with macrocystidia and brightly coloured pilei (sect. Cognatae),
or lacking cystidia.
ITS sequence analysis of Melanoleuca ... 371
0.84/56 ———— MCVE 08384 M. sp. 13 A-S3
'_____——— ANC M0217 M. grammopodia1 U2-S3
ous [LT ANC M0218 M. grammopodia 2 U1U2-S2
ANC M0219 M. grammopodia3 U1-S2 A1.1
100 | ANC M0216 M. grammopodia f. macrocarpa 2. U1-S3
GC 08310 M. privernensis A-S3
ANC M0215 M. grammopodia f. macrocarpa’1_U1U2-S3
0.84/50 “ MCVE 04410 M. grammopodia f. macrocarpa 3 U1-S3
11100-— MCVE 04574 M. brevipes 1 U1-S2
1/99 [L MCVE 04505 M. brevipes 2 U1-S2
— MCVE 03316 M. sp. 14 U1-S2
0.57). [0-62 199 —— ANC M0220 M. rasilis U1-S3
L MCVE 19627 M. sp.15 U1-S2
195 —————_————— MCVE 24095 M. sp. 16 U1-S2
oT. '_— ANC M0223 M. sublanipes 3 U1-S2
08757 ANC M0222 M. sublanipes 2 U1-S1
1086. MCVE 01681 M. sp. 17 U1-S1
— ANC M0221 M. sublanipes1 U1-S1
-— ANC M0212 M. exscissa5 U2-S3
+ ANC M0213 M. exscissa6 U2-S2
ANC M0210 M. exscissa3 U1U2-S3
0.99/61 | |}——— ANC M0211 M. iris U2-S2
[|/ ANC M0210B M. exscissa 4 U1U2-S3 A2.1
0.54-| - ANC M0209 M. substrictipes var. sarcophylla U2-S2
oss;— ANC M0207 M. exscissa1 U2-S1 A2
9895 |"! ANC M0206 M. diverticulata U2-S2
"™L ANC M0208 M. exscissa 2 U2-S2
196| [-— ANC M0214 M. substrictipes 1 U2-S3 A2.2
oast MCVE 13934 M. substrictipes 2. U1U2-S3 | clade A
x 1100 ; M. verrucipes DQ490642 (U) . .
———L MCVE 09962 M. verrucipes U2-S3 A2.3 su bg enus Urt icocyst. 1S
0.55/--— ANC M0202 M. striimarginata A-S2
0.87/70/-L_ MCVE 12645 M. paratristis A-S1
ose-| “- ANC M0201 M. graminicola A-S1
L180 ANC M0203 M. angelesiana1 A-S1
0.79) 05t/- ANC M0204 M. angelesiana2 A-S1
ral ANC M0198 M. pseudopaedida U1-S1
82} ANC M0197 M. decembris 1 U1-S1
053: | MCVE 01573 M. decembris 4 U1-S1
ss] ANC M0199 M. decembris 2. U1-S1
0.53). mL ANC M0200 M. decembris 3 U1-S2
{___ ANC M0007 M. stridula A-S1
{___ ANC M0205 M. robertiana_A-S1
1198 ANC M0191 M. pseudoluscina1 U1-S1
o.ge6g/L______________ MCVE 14221 M. sp.12 U2-S2
0.65/- ANC M0193 M. pseudoluscina3 U1-S2
061/661 ANC M0192 M. pseudoluscina 2 U1-S2 A4.1
yoo [| MCVE 14273 M. sp.18 A-S2
ANC M0195 M. pseudoluscina5 U2-S1 A4
© ANC M0194 M. pseudoluscina4 U2-S1
ANC M0188 M. sp.2 A-S2
LF ANC M0190 M. paedida2 U1-S1
0.834 | oS] + ANC M0189 M. paedida 1 U1-S2 A42
ANC M0187 M. electropoda U1U2-S1
'_ ANC M0196 M. microcephala A-S1
Al
A1.2
0.95/54
A3
400 - ANC M0170 M. cognata2 M2-S2
1199 MCVE 13939 M. cognata1 M1-S3 A5
> ANC M067 M. arcuata M1M2-S2
1/89 og9i97 - MCVE 08389 M. sp. 10 M1M2-S1
0.97/72,— ANC M0178 M. subpulverulenta2 M1M2-S2
0.7975 | ~ ANC M0004 M. subpulverulenta1 M1M2-S3 B1.1
[- ANC M0176 M. melaleuca MM2-S3
L ANC M0177 M. nivea1 M1-S3
197- MCVE 09821 M. sp. 6 M1-S3
comes [| '—— MCVE 09578 M. nivea3_ M1M2-S3 B1.2
L. ANC M0179 M, robusta M2-S3
-—— ANC M0166 ML. lanipes MiM2-S2
ANC M0175 M. heterocystidiosa 2 M1-S3 | B1.3
195-—|L ANC M0174 M. heterocystidiosa 1 M1-S3
ANC M0224 M. sp. 3. M1M2-S2
MCVE 13410 M. sp.5 M1-S2
MCVE 12248 M. sp. 4 M1-S2
MCVE 08432 M. sp. 11 M2-$3 clade B
os) ANC M0182 M. albifolia 1 M2-S2
ANC M0183 M. nivea2 M2-S1
(ANC Mone Me ae aes Bo | SU bgenus Melanoleuca
os3t oat ANC M0181 M.sp.1 A-S1
| ANC M0180 M. atripes M2-S1
ANC M0184 M. albifolia 2 MiM2-S3
1/89 - ANC M0173 M. strictipes 3 M1-S3
ANC M0172 M. strictipes 2 M1M2-S3
joo (182 ANC MO171 M. strictipes 1 M1-3 B3
B1
MCVE 14576 M. evenosa M1-S3
L MCVE 04112 M. subalpina M1-S3
MCVE 07839 M. oreina M1-S3
om MCVE 01687 M. sp.7 M2-S3 B4
a2 MCVE 19223 M. sp.9 M1-S2
|_____ ANC M0185 M. bataillei_ MM2-S2
0.74)-
MCVE 11243 M. cinereifolia2 M2-S2
o.s464 ++ MCVE 01471 M. cinereifolia1 M2-S3 B5
MCVE 20748 M. cinereifolia3 M2-S2
“ ANC M0186 M. friesii M1-S2
iste Limacella glioderma AY 176451
= Amanita phalloides GQ221842
_ Amanita muscaria var. muscaria AB080790
Macrocystidia cucumis DQ490640
11100 _ Melanoleuca subsejuncta FJ596899
Melanoleuca subsejuncta FJ596898
4400. ———————————— Vol vopluteus gloiocephalus HM562209
0.62/- |_____________ Volvopluteus earlei HI562205
11100 Pluteus salicinus HM562174
Pluteus cervinus var. cervinus EU486448
1/100 -—— Pluteus romellii HM562183
Pluteus aurantiorugosus HM562121
Limnoperdon incarnatum DQ097363
0.08
FIGURE 2. Bayesian phylogram obtained from the ITS rDNA sequences of Melanoleuca and other
taxa of the Pluteoid clade. Limnoperdon incarnatum was used as outgroup taxon. Support values
(BPP in bold >0.5; MLB >50%) are given above branches. Minor supported clades discussed in the
text are numbered A1-A5 and B1-B5. Numbers refer to the collections cited in Tas. 2.
Characters: 1) presence/absence of cheilocystidia and type of cheilocystidia — A = taxa
without cheilocystidia, U1 = taxa with brevipes-type urticiform cystidia, U2 = taxa with exscissa-
type urticiform cystidia, U1-U2 = taxa with both types of urticiform cystidia, M1 = taxa with
fusiform macrocystidia, M2 = taxa with lageniform macrocystidia, M1-M2 = taxa with both type
of macrocystidia [cystidial types are coded in red (A), blue (U), and green (M)]; 2) spore shape
(Qm range) - $1 = Qm < 1.40; $2 = 1.40< Qm $1.60; $3 = Qm > 1.60..
372 ... Vizzini & al.
Basidiospore shape (Qm value) seems to be homoplastic, too variable to use for
circumscribing sections and subsections as proposed by Bon (1991). For example,
in subclade A2.1, collections otherwise assignable to M. exscissa (Fr.) Singer show
a great Qm range, as do M. grammopodia (A1.1) and M. pseudoluscina (A4.1)
collections (Fic. 2).
On the contrary, cystidial subtypes may have some value for delimiting small
clades (Fic. 2). Clades Al and A3 are formed mainly by taxa with brevipes-
type urticocystidia and clade A2 by taxa by mainly exscissa-type urticocystidia.
Clade B1 comprises taxa with mainly fusiform macrocystidia.
Pileus colour is not a reliable phylogenetic marker at any taxonomic level:
three collections (ANC M0177, MCVE 09578, ANC M0183) determined
as M. nivea Métrod ex Boekhout, a species traditionally included in sect.
Alboflavidae based on whitish colouration and presence of macrocystidia (Bon
1991, Boekhout 1988, 1999; Deschuyteneer 2008), are not placed with other
species of that section (clade B3) but distributed throughout clade B. ‘The first
collection represents an albinic form of M. melaleuca (B1.1), the second a taxon
close to M. robusta (Bres.) Fontenla et al. (B1.2), and the third probably an
albinic form of M. albifolia (B2).
In conclusion, taxonomically important morphological characters in
Melanoleuca show a high degree of homoplasy. Although these characters
are useful for species delimitation, and in some cases for the circumscription
of sections or groups, they appear insufficient for a phylogenetically correct
infrageneric concept. A clearer picture will emerge as more Melanoleuca
diversity is included in future analyses.
Groupings and species limits
More extensive sampling of Melanoleuca is needed for a revision of the
whole genus. Additional ITS sequencing is necessary to clarify species limits
and names for taxa occurring in both Europe and North America. For the time
being we only make minor comments on some of the infrageneric clades that
were recovered. These numbered clades and subclades are marked in Fie. 2.
Subgenus Urticocystis (Clade A): clades Al-A5
CLADE Al (0.57 BPP, / MLB), cheilocystidia mainly of the brevipes-type or
rarely absent. Stipe striate longitudinally or not.
SUBCLADE A1.1 (1.0 BPP, 100% MLB) (= M. grammopodia complex = subsect.
Grammopodiae). ‘This well supported subclade comprises M. grammopodia
and M. grammopodia f. macrocarpa Boekhout, all with urticocystidia, and
M. privernensis and M. sp. 13 without cystidia. All taxa have a distinctly
longitudinally striate stipe with a pruinose apex. The eight sequences display
a 96.8 P%IV. Melanoleuca grammopodia f. macrocarpa differs from the type
ITS sequence analysis of Melanoleuca ... 373
only by a stipe that is much shorter than pileus diameter (P%IV = 99.4) and
so should be considered only a growth form of M. grammopodia. Melanoleuca
privernensis is diagnosed by non-amyloid spores, unique in Melanoleuca
(Vizzini et al. 2010). The molecular analysis suggests it might represent an
aberrant neotenic form of M. grammopodia lacking cystidia with non-amyloid
spores.
SUBCLADE A1.2 (0.62 BPP, / MLB) includes M. brevipes (Bull.) Pat., M. rasilis
(Fr.) Singer, and two unidentified species (M. sp. 14, M. sp. 15). Melanoleuca
rasilis is related to M. brevipes based on similar cystidia, grey pileus and stipe
colours, and a non-longitudinally striate stipe but differs by smaller basidiomes,
a stipe length equal to the pileus diameter, and broadly ellipsoid coarsely
ornamented spores (Boekhout 1988, 1999). We also observed that M. rasilis
has a uniformly white context while M. brevipes has a white pileus context and
brown stipe context. Molecularly, the two species are clearly different (P%IV =
94.5; Fic. 2).
SUBCLADE A1.3 (1.0 BPP, 96% MLB) comprises M. sublanipes, M. sp. 16, and
M. sp. 17. Melanoleuca sublanipes (formally described below) is characterized
by a tomentose-woolly pileus margin and stipe base. The two M. sp. could be
conspecific with M. sublanipes, but their collections lack of macromorphological
data and descriptions. We here propose the following new diagnosis:
Melanoleuca sublanipes Fontenla, Para & Vizzini, sp. nov.
MycoBank MB 563140
Pileus -10 cm latus, velutinus, obscure griseo-brunneus, ochraceo-brunneus, griseo-
brunneus, a margine pallescens. Lamellae albae, albidae vel pallide griseo-brunneae. Stipes
1.5-7 x 0.3-1.1 cm, lanatus deinde solum inferne lanato-flocculosus, in senectute omnino
pruinoso-flocculosus, argenteus, a basi griseo-brunneus, cum ripercussis cyaneis. Caro in
pileo albida, in stipite brunnea; odor herbaceus; sapor mitis. Sporae 6.2-9.6 x 3.8-6.6
um; in medio 7.56 x 5.54 um; Q = 1.04-1.70; Qm = 1.36, ellipsoideae, conspicuis verrucis
singulis, globulosis et amyloideis exornatae. Basidia tetraspora. Cheilocystidia numerosa,
31-55 x 5-8 um, pili urticae revocantibus, raro fusoidea. Pilei cutis ad marginem ex
hyphis erectis, 7-8 um latis ad instar trichodermatis efformata; hyphae terminales
cylindricae, usque ad 100 um longae. Stipitis cutis pilis clavatis aggregatis et caulocystidiis
multiformibus ornata. Habitat in herbidis locis.
TyPE: Italy, Veneto, Padova, Montegrotto Terme, 07.X1.2008, leg. G. Zecchin (holotype
ANC M0222).
ErymMo.oey: the specific epithet refers to the tomentose-woolly surface of the stipe
base.
CLADE A2 (1.0 BPP, 96% MLB), cheilocystidia mainly of the exscissa-type:
subclades A2.1, A2.2 and A2.3.
SUBCLADE A2.1 (0.54 BPP, / MLB) (M. exscissa complex) comprises M. exscissa,
M. diverticulata, M. iris, and M. substrictipes var. sarcophylla. The nine sequences
display a 98.5 P%IV. This clade reflects an overemphasis on basidiome colour
37A ... Vizzini & al.
and smell, with some anatomical traits having led to the establishment of
some superfluous species. Melanoleuca iris differs from M. exscissa only in
the strong and sweet smell recalling Lepista irina (Fr.) H.E. Bigelow (Kiihner
1956, Klan 1983, Bon 1991, Boekhout 1988, 1999; Krieglsteiner 2001, Fontenla
et al. 2003). Boekhout (1988, 1999) considered it a variety of M. exscissa and
Krieglsteiner (2001) cited it as only an accidental M. exscissa phenotype; our
molecular data (P%IV between M. iris and M. exscissa sequences = 98.7) clearly
support Krieglsteiner. With an intraspecific variability lower than 3% (Nilsson
et al. 2008), M. iris should be considered a form of M. exscissa. Melanoleuca
diverticulata differs from M. exscissa mainly by the presence of elements with
small outgrowths in the pileipellis (Moreno & Bon 1980). The P%IV between
M. diverticulata and M. exscissa ANC M0207 and ANC M0208 equals 97.9.
Our data show that M. substrictipes var. sarcophylla, which Kihner (1978)
distinguished from the typical variety based on its pinkish lamellae (Kithner
1978, Bon 1991), is more closely related to M. exscissa than to M. substrictipes
Kihner (Fic. 2) and should be considered a form of M. exscissa with coloured
lamellae (P%IV = 98.5).
Therefore, we propose the following new combinations:
Melanoleuca exscissa f. iris (Kiihner) Fontenla, Para & Vizzini,
comb. nov., stat. nov.
MycoBank MB 563141
= Melanoleuca iris Kiithner, Bull. Soc. Linn. Lyon 25(7): 181 (1956).
The holotype of M. iris apparently missing from G (herbarium where Kihner’s collections
of Melanoleuca are kept; Fontenla & Para, unpublished data).
Melanoleuca exscissa f. sarcophylla (Kihner) Fontenla, Para & Vizzini,
comb. nov., stat. nov.
MycoBank MB 563142
= Melanoleuca substrictipes var. sarcophylla Kihner,
Bull. Soc. Linn. Lyon 47(1): 52 (1978).
Holotype (G - K 65-24), with morphological features coincident with those of our
sequenced collection (ANC M0209; Fontenla & Para, unpublished data).
Melanoleuca exscissa f. diverticulata (G. Moreno & Bon) Fontenla, Para & Vizzini,
comb. nov., stat. nov.
MycoBANnkK MB 563143
= Melanoleuca diverticulata G. Moreno & Bon, Docum. Mycol. 11(41): 35 (1980).
Holotype (MA - 3662), with morphological features coincident with those of our
sequenced collection (ANC M0206; Fontenla & Para 2007).
SUBCLADE A2.2 (0.95 BPP, 77% MLB) The two M. substrictipes collections
are very similar (P%IV = 99.1). The first (ANC M0214) has only urticoid
exscissa-type cheilocystidia, whereas the second (MCVE 13934) possesses
ITS sequence analysis of Melanoleuca ... 375
both brevipes- and exscissa-type cheilocystidia. Following Bon (1991) the two
molecularly clearly conspecific collections would be referred to two different
subsections: the first in the subsect. Exscissae (as M. pseudoevenosa Bon ex Bon
& G. Moreno) and the second in subsect. Grammopodiae. The holotype (G-K
66-13) is characterized by both types of urticiform cheilocystidia (Fontenla &
Para 2011).
SUBCLADE A2.3 (1.0 BPP, 100 % MLB) The two M. verrucipes (Fr.) Singer
sequences (GenBank DQ490642 and MCVE 09962) are almost identical
(P%IV = 99.8). The black dotted stipe readily diagnoses the species (Bon 1991,
Boekhout 1999, Gasparini 2001, Fontenla et al. 2003).
CLADE A3 (0.53 BPP, / MLB), cheilocystidia absent or urticocystidia mainly of
the brevipes-type. Both pileus and stipe usually (except for M. robertiana)
dark coloured and lamellae white to whitish. This clade encompasses the
two acystidiate species, M. robertiana Bon and M. stridula (Fr.) Singer, and
subclades A3.1 and A3.2.
SUBCLADE A3.1 (0.66 BPP, / MLB) comprises four acystidiate taxa, M. strii-
marginata Métrod ex Bon, M. “paratristis,’ M. graminicola (Velen.) Kihner
& Maire, and M. angelesiana A.H. Sm. ‘The first three taxa (subg. Acystis sect.
Acystis in Bon 1991) are morphologically and molecularly (P%IV = 98.2)
closely related: they share a collybioid habit, white lamellae, and a whitish stipe,
differing mainly in pileus colour and could probably be reduced to only one
species, M. graminicola (which would have nomenclatural priority). Melanoleuca
angelesiana (the 2 sequences with a P%IV = 99.9) is an independent species
(P%IV = 94.3), distinguished by a tricholomatoid habit, grey lamellae, and
greenish-brown stipe. The two Italian collections (ANC M0203, ANC M0204)
show features consistent with the protologue (Smith 1944) and holotype (MICH
14633) of this North American species (Fontenla & Para, unpub. data).
SUBCLADE A3.2 (0.99 BPP, 89 % MLB) encompasses M. decembris Métrod
ex Bon and M. pseudopaedida Bon. Bon (1991) classified these species as
acystidiate (subg. Acystis, sect. Decembres), but Fontenla & Para (2008) found
numerous urticiform cheilocystidia when they studied the type collections.
Both taxa are characterized by a dark (dark brown-grey to blackish) pileus and
grey lamellae (Bon 1991). Molecular analysis supports M. pseudopaedida as
conspecific with M. decembris (P%IV = 98.1).
CLADE A4 (0.54 BPP, / MLB), cheilocystidia absent or both brevipes- and
exscissa-type urticocystidia, comprising the acystidiate M. microcephala
(P. Karst.) Singer and A4.1 and A4.2 subclades. Bon (1991) described
M. microcephala as having urticiform cystidia, but Fontenla and Para
(unpub. data) found Karsten’s type collection (H 1604) to be acystidiate.
376 ... Vizzini & al.
SUBCLADE A4.1 (1.0 BPP, 99 % MLB) contains M. pseudoluscina, M. sp. 12,
and M. sp. 18. The seven sequences show a P%IV of 97.1. The P%IV (98.6)
between M. sp. 18 and M. pseudoluscina sequences indicates that M. sp. 18 is an
acystidiate form of M. pseudoluscina. Our analysis support M. pseudoluscina as
an independent species and not a variety of M. rasilis (subclade A1.2) as stated
by Boekhout (1988, 1999).
SUBCLADE A4.2 (1.0 BPP, 99 % MLB) encompasses M. paedida, M. sp. 2,
and M. electropoda. The two M. paedida collections are consistent with the
protologue and the observations by Fontenla et al. (2003). Melanoleuca sp. 2
is an acystidiate form of M. paedida. Melanoleuca electropoda was reported by
Bon (1991) as a macrocystidiate species (subg. Melanoleuca, sect. Oreineae);
after finding typical urticoid cheilocystidia in the type collection, Fontenla
et al. (2009) considered M. rufipes Bon a later synonym. As M. electropoda
differs from M. paedida only in an orange red (instead of brown) stipe base
and context, we reduce it to a form of M. paedida based on molecular data
(P%IV = 98.9).
Melanoleuca paedida f. electropoda (Maire & Malencon) Fontenla, Para & Vizzini,
comb. nov., stat. nov.
MycoBank MB 563144
= Melanoleuca electropoda Maire & Malencon, Fl. Champ. sup. Maroc 2: 77 (1975).
CLADE As5 (1.0 BPP, 99% MLB) (= sect. Cognatae), macrocystidiate taxa with
bright coloured pilei.
Melanoleuca cognata (Fr.) Konrad & Maubl. and M. arcuata (Bull.) Singer are
two independent species (P%IV = 95.4). Melanoleuca arcuata differs by having
a brown pileus and yellow-ochre lamellae only at maturity. The collection
named M. sp. 10 is probably referable to a new species (P%IV = 93.1), but its
macromorphological data are lacking.
Subgenus Melanoleuca (Clade B): clades B1-B5 + M. friesii (Fr.) Singer (a
species characterized by a dark-brown blackish, slate-grey pileus, whitish
lamellae and mainly lageniform cystidia).
CLADE Bi (1.0 BPP, 95% MLB), macrocystidia both fusiform and lageniform,
pileus mainly grey-brown and lamellae white to grey. It encompasses the
subclades B1.1, B1.2, B1.3 + 4 M. sp. (M. sp. 3, M. sp. 4, M. sp. 5 and M.
sp. 11).
SUBCLADE B1.1 (0.79 BPP, 75 % MLB) comprises M. subpulverulenta
(Pers.) Singer, M. melaleuca and M. nivea 1. The four collections are closely
related (P%IV = 98.6) despite their morphological differences. Melanoleuca
subpulverulenta is characterized by a pruinose matte grey pileus, pruinose stipe,
ITS sequence analysis of Melanoleuca ... 377
and dark context; M. melaleuca has a grey-brown non-pruinose pileus, non-
pruinose stipe, and whitish context sometimes darkening towards the stipe
base. The M. nivea 1 collection (ANC M0177) we originally referred to M. nivea
due to its whitish colours (sect. Alboflavidae) and <5 cm pileus represents only
an albinic form of the M. subpulverulenta/M. melaleuca complex; its features
nonetheless match those of the M. nivea holotype (PC-2434) (Fontenla & Para,
unpublished data).
SUBCLADE B1.2 (0.56 BPP, 45 % MLB) comprises M. sp. 6, M. nivea 3, and
M. robusta, with the latter distinguished by a grey-brown pileus, grey lamellae,
brown context, caespitose growth, and mainly fusiform macrocystidia.
Melanoleuca nivea 3 is very close to an unidentified collection (M. sp. 6)
characterized by a grey pileus.
SUBCLADE B1.3 (0.62 BPP, 73 % MLB) consists of two molecularly closely
related taxa (P%IV = 98.8), M. “lanipes” and M. heterocystidiosa (Beller &
Bon) Bon that have both lageniform and fusiform macrocystidia. Melanoleuca
lanipes, which has dark grey-brown lamellae, strongly longitudinally striate
dark grey stipe covered with woolly flocci, and blackish stipe base, resembles
M. cognata but with a tomentose-wooly stipe.
CLADE B2 (0.52 BPP, / MLB), mainly lageniform cystidia, longitudinally striate
and brown to dark brown stipe.
CLADE B2 is formed by M. albifolia, M. atripes, M. nivea 2, M. sp. 1 and
M. sp. 8. All six sequences are closely related (P%IV = 97.6). Morphologically,
M. albifolia is well characterized by a rather small size (2.5-5 cm diam), dark
sepia-brown pileus, white lamellae, grey-brown stipe, and lageniform cystidia
(Boekhout 1988, 1999; Bon 1991); M. atripes has a hygrophanous blackish
brown pileus, dark brown stipe, yellowish beige lamellae, and mainly fusiform
cystidia (Boekhout 1988, 1999; Bon 1991). In contrast, our M. atripes collection
(ANC M0180) shows mainly lageniform cystidia.
The sequence analysis did not support any independent species in the
clade. M. nivea 2 is probably an albinic form of the M. albifolia/M. atripes
complex while M. sp. 1 is the only acystidiate collection nested within subgen.
Melanoleuca (clade B).
CLADE B3 (1.0 BPP, 92% MLB), macrocystidia mainly fusiform, basidiome
white to cream-whitish (sect. Alboflavidae).
CLADE B3 comprises M. strictipes (P. Karst.) Jul. Schaff., M. evenosa (Sacc.)
Konrad, and M. subalpina (Britzelm.) Bresinsky & Stangl. The five samples are
very closely related (P%IV = 98.4) and have characters consistent with those of the
original collections. Bon (1991) circumscribed the species in sect. Alboflavidae
mainly based on Qm value, odour, pileus size, and stipe ornamentation. We
378 ... Vizzini & al.
have now examined morphologically the holotype of M. strictipes (H 2432,
Fontenla & Para, unpubl.), lectotype of M. subalpina (Fontenla & Para 2008),
and eight original Tricholoma cnista sensu Bresadola (= M. evenosa) collections
(TR, BPI). This, combined with our thorough study of the original diagnoses
and phylogenetic analysis, lead us to conclude that M. strictipes, M. evenosa,
and M. subalpina are conspecific, with the name M. strictipes having priority.
CLADE Bq (0.52 BPP, / MLB), cystidia fusiform or lageniform, pileus small (up
to 5 cm broad) and not dark-coloured, lamellae whitish-cream, context
white.
CLADE B4 comprises M. oreina (Fr.) Kihner & Maire, M. bataillei Malencon,
M. sp. 7, and M. sp. 9. The first two species, which are phenetically very similar,
differ mainly on cystidial shape. Bon (1991) placed M. oreina (with fusiform
cystidia) into sect. Oreinae and M. bataillei (with mainly lageniform cystidia)
into sect. Melanoleuca. Molecularly, they are quite distinct (P%IV = 92.5).
CLADE Bs5 (0.84 BPP, 54% MLB) consists of the three M. cinereifolia (Bon) Bon
sequences (P%IV = 100).
Melanoleuca cinereifolia is distinguished by a habit reminiscent of Clitocybe
nebularis (Batsch) P. Kumm., always grey lamellae, short stipe, strictly
lageniform (M2) cystidia, and growth in sand dunes.
Acknowledgements
We are grateful to G. Robich (Venice) for having sent us the Melanoleuca samples
from MCVE DNA bar-coded by Dr. M. Garbelotto (University of California, Berkeley).
Dr. Matteo Garbelotto and Dr. Todd Osmundson (University of California, Berkeley)
kindly provided us with pre-submission Melanoleuca sequences. We also thank Dr.
Vladimir Antonin (Brno, Czech Republic) and Dr. Marco Contu (Olbia, Italy) for their
pre-submission reviews and Dr. Shaun Pennycook (Auckland, New Zealand) for the
nomenclatural review.
Literature cited
Binder M, Hibbett DS, Wang Z, Farnham W. 2006. Evolutionary relationships of Mycaureola dilseae
(Agaricales), a basidiomycete pathogen of a subtidal rhodophyte. Am. J. Bot. 93: 547-556.
http://dx.doi.org/10.3732/ajb.93.4.547
Bodensteiner P, Binder M, Moncalvo JM, Agerer R, Hibbett DS. 2004. Phylogenetic relationships of
cyphelloid homobasidiomycetes. Mol. Phylogenet. Evol. 33: 501-515.
http://dx.doi.org/10.1016/j.ympev.2004.06.007
Boekhout T. 1988. Notulae ad floram agaricinam neerlandicam, XVI - New taxa, new combinations
in Melanoleuca Pat. and notes on rare species in the Netherlands. Persoonia 13(4): 397-431.
Boekhout T. 1999. Melanoleuca. 153-165, in: C Bas et al. (eds). Flora Agaricina Neerlandica 4.
A.A. Balkema, Rotterdam.
Bon M. 1978. Tricholomataceae de France et d’ Europe occidentale (Leucopaxilloideae). Doc. Mycol.
9(33): 1-79.
ITS sequence analysis of Melanoleuca ... 379
Bon M. 1991. Flore mycologique d’Europe, 2 - Les Tricholomes et ressemblants. Doc. Mycol.,
Mém. hors-Sér. 2: ii, 163 p.
Bresinsky A. 2006. Observations on Mycobiota in Estonia. Folia Cryptogamica Estonica 42: 1-9.
Deschuyteneer D. 2008. Contribution a létude de Melanoleuca nivea. Revue du Cercle de Mycologie
de Bruxelles 8: 57-64.
Drummond AJ, Ashton B, Cheung M, Heled J, Kearse M, Moir R, Stones-Havas S, Thierer T, Wilson
A. 2010. Geneious v5.3. [Available from http://www.geneious.com].
Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution
39: 783-791. http://dx.doi.org/10.2307/2408678
Fontenla R, Para R. 2007. Osservazioni sul genere Melanoleuca. Studio dei tipi I. Rivista di
Micologia 50(3): 221-236.
Fontenla R, Para R. 2008. Osservazioni sul genere Melanoleuca. Studio dei tipi II. Rivista di
Micologia 51(2): 147-162.
Fontenla R, Para R. 2011. Observations on Melanoleuca. Type studies — 3. Mycotaxon 115: 215-226.
http://dx.doi.org/10.5248/115.215
Fontenla R, Gottardi M, Para R. 2003. Osservazioni sul genere Melanoleuca. Fungi non delineati.
Pars XXV. Ed. Candusso. Alassio.
Fontenla R, Gottardi M, Para R. 2009. Il genere Melanoleuca. 399-405, in: J-C Maire et al. (eds).
Compléments a la Flore des champignons supérieurs du Maroc de G. Malencon et R. Bertault.
Confédération Européenne de Mycologie Méditerranéenne, Nice.
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes — application
to the identification of mycorrhizae and rusts. Mol. Ecol. 2(2): 113-118. http://dx.doi.
org/10.1111/j.1365-294X.1993.tb00005.x
Gasparini G. 2001. Melanoleuca verrucipes: una rara specie segnalata anche in Italia. Rivista di
Micologia 44(2): 171-174.
Gillman LS, Miller OK. 1977. A study of the boreal, alpine, and arctic species of Melanoleuca.
Mycologia 69: 927-951. http://dx.doi.org/10.2307/3758777
Horak E. 2005. Réhrlinge und Blatterpilze in Europa. Spektrum, Elsevier, Heidelberg.
Huelsenbeck JP, Larget B, Miller RE, Ronquist F. 2002. Potential applications and pitfalls of Bayesian
inference of phylogeny. Syst. Biol. 5: 673-688.
Huelsenbeck JP, Ronquist F. 2001. MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics
17: 754-755. http://dx.doi.org/10.1093/bioinformatics/17.8.754
Justo A, Vizzini A, Minnis AM, Menolli Jr N, Capelari M, Rodriguez O, Malysheva E, Contu M,
Ghingnone S, Hibbett DS. 2011. Phylogeny of the Pluteaceae (Agaricales, Basidiomycota):
taxonomy and character evolution. Fungal Biology 115: 1-20.
http://dx.doi.org/10.1016/j.funbio.2010.09.012
Katoh K, Misawa K, Kuma K, Miyata T. 2002. MAFFT: a novel method for rapid multiple sequence
alignment based on fast Fourier transform. Nucleic Acids Res. 30: 3059-3066.
http://dx.doi.org/10.1093/nar/gkf436
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth and Bisby’s dictionary of the fungi.
10" ed. CABI, Wallingford.
Klan J. 1983. Melanoleuca iris in Czechoslovakia (Agaricales, Tricholomataceae). Ceska Mykologie
37(1): 52-55.
Krieglsteiner GJ. 2001. Die Grosspilze Baden-Wirtembergs vol. 3. Stuttgart.
Kihner R. 1956. Un Melanoleuca parfumé: M. iris sp. nov. et lespéce voisine: M. excissa (Fr.) Bull.
Soc. Linn. Lyon 25: 176-181.
Kithner R. 1978. Agaricales de la zone alpine. Genre Melanoleuca. Bull. Soc. Linn. Lyon 47: 12-52.
380 ... Vizzini & al.
Matheny PB, Curtis JC, Hofstetter V, Aime MC, Moncalvo JM, Ge ZW, Yang ZL, Slot JC, Ammirati
JE, Baroni TJ, Bougher NL, Hughes KW, Lodge DJ, Kerrigan RW, Seidl MT, Aanen DK, DeNitis
M, Daniele GM, Desjardin DE, Kropp BR, Norvell LL, Parker A, Vellinga EC, Vilgalys R,
Hibbett DS. 2006. Major clades of Agaricales: a multi-locus phylogenetic overview. Mycologia
98: 982-995. http://dx.doi.org/10.3852/mycologia.98.6.982
Métrod G. 1942. Sur le genre Melanoleuca. Revue Mycol. 7(2-4): 89-96.
Métrod G. 1948. Essai sur le Genre Melanoleuca Patouillard emend. Bull. Soc. Mycol. France 64:
141-165.
Moncalvo JM, Lutzoni FM, Rehner SA, Johnson J, Vilgalys R. 2000. Phylogenetic relationships of
agaric fungi based on nuclear large subunit ribosomal DNA sequences. Syst. Biol. 49: 278-305.
http://dx.doi.org/10.1093/sysbio/49.2.278
Moncalvo JM, Vilgalys R, Redhead SA, Johnson JE, James TY, Aime MC, Hofstetter V, Verduin
SJW, Larsson E, Baroni TJ, Thorn RG, Jacobsson S, Clémencgon H, Miller OK. 2002.
One hundred and seventeen clades of euagarics. Mol. Phylogenet. Evol. 23: 357-400.
http://dx.doi.org/10.1016/S1055-7903(02)00027-1
Moreno G, Bon M. 1980. Quelques espéces intéressantes ou nouvelles du genre Melanoleuca
récoltées en Espagne. Doc. Mycol. 11(41): 35-46.
Moser M. 1983. Die Réhrlinge und Blatterpilze. 5th ed. Kleine Kryptogamenflora, Band II b/2.
G. Fischer, Stuttgart, New York.
Nilsson RH, Kristiansson E, Ryberg M, Hallenberg N, Larsson K-H. 2008. Intraspecific ITS
variability in the Kingdom Fungi as expressed in the International Sequence Databases and its
implications for molecular species identification. Evol. Bioinf. 4: 193-201.
Pegler DN, Young TWK. 1973. Basidiospore form in the British Leucopaxilleae. Kew Bulletin 28(3):
365-379. http://dx.doi.org/10.2307/4108880
Pfister J. 1984. Etudes des types de Peck et de Murrill appartenant ou ayant appartenu au genre
Melanoleuca. Mycotaxon 19: 101-132.
Posada D. 2008. jModeltest: phylogenetic model averaging. Mol. Biol. Evol. 25: 1253-1256.
http://dx.doi.org/10.1093/molbev/msn083
Rambaut A, Drummond AJ. 2007. Tracer v1.4. [Available from http://beast.bio.ed.ac.uk/Tracer].
Singer R. 1935. Etude systématique sur les Melanoleuca d'Europe et clé des espéces observées en
Catalogne. Cavanillesia 7: 122-132.
Singer R. 1943. Das system der Agaricales III. Annales Mycologici 41: 1-189.
Singer R. 1986. The Agaricales in modern taxonomy, 4th edn. Koeltz Scientific Books,
Koenigstein.
Smith AH. 1944. New North American agarics. Mycologia 36(3): 242-262.
http://dx.doi.org/10.2307/3754821
Stamatakis A. 2006. RAxML-VI-HPC: Maximum Likelihood-based phylogenetic analyses with
thousands of taxa and mixed models. Bioinformatics 22: 2688-2690.
http://dx.doi.org/10.1093/bioinformatics/btl446
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGAS5: Molecular
Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and
Maximum Parsimony Methods. Mol. Biol. Evol. (in press).
http://dx.doi.org/10.1093/molbev/msr121
Thiers B. 2011. (continuously updated). Index Herbariorum: A global directory of public herbaria
and associated staff. - New York Botanical Garden's Virtual Herbarium. http://sweetgum.nybg.
org/ih/
Vesterholt J. 2008. Melanoleuca Pat. 347-352, in: H Knudsen, J. Vesterholt (eds). Funga Nordica
- Agaricoid, boletoid and cyphelloid genera. Nordsvamp, Copenhagen.
ITS sequence analysis of Melanoleuca ... 381
Vizzini A, Consiglio G, Setti L, Murat C. 2010. The agaricoid genus Kinia is a new member of the
Pluteoid clade subordinate to Melanoleuca. Mycosphere 1(2): 141-145.
Watling R, Turnbull E. 1998. Cantharellaceae, Gomphaceae and amyloid-spored and xeruloid
members of Tricholomataceae (excl. Mycena). British Fungus Flora, Agarics and Boleti 8. Royal
Botanic Gardens Edinburgh.
White TJ, Bruns TD, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR Protocols. Academic
Press, London.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/118.383
Volume 118, pp. 383-392 October-December 2011
Geastrum species from the Amazon Forest, Brazil
ANILEIDE GOMES LEITE*', HANNAH KATHREN DE ASSIS’,
BIANCA DENISE BARBOSA DA SILVA?, HELEN MARIA PONTES SOTAO?
& IURI GOULART BASEIA’
’ Universidade Federal do Rio Grande do Norte, Depto. Botanica, Ecologia e Zoologia,
Campus Universitario, CEP: 59072-970, Natal, RN, Brazil
? Universidade Federal de Pernambuco, Programa de Pés-Graduagao em Biologia de Fungos,
Depto. Micologia, Centro de Ciéncias Bioldgicas,
Av. Nelson Chaves s/n, 50670-420, Recife, PE, Brazil
° Ministério da Ciéncia e Tecnologia, Museu Paraense Emilio Goeldi, Departamento de Botanica.
Caixa Postal 399, AV: Perimetral 1901 MARCO, 66040-170 - Belém, PA, Brazil
CORRESPONDENCE TO *: [email protected]
ABSTRACT—Six Geastrum species are reported from the Amazon forest: G. entomophilum,
G. fimbriatum, G. javanicum, G. lageniforme, G. lilloi, and G. saccatum. Geastrum javanicum
and G. lilloi represent first records from Brazil. Descriptions and illustrations of the species
and SEM images of microstructures are given.
Key worps— Basidiomycota, Geastraceae, gasteromycetes, taxonomy
Introduction
The family Geastraceae was first described by Corda (1842) as the Geastrideae
and subsequently classified in the Lycoperdales (Lloyd 1902, Ponce de Leon
1968, Kriiger & Chagas 2008), the Phallales (Hibbett et al. 1997) and, based on
molecular data, recently in the Geastrales (Hosaka et al. 2006). With 43 species
reported, the Geastraceae is the second-most represented gasteromycete
family in Brazil (Trierveiler-Pereira & Baseia 2009). The Geastraceae comprise
eight genera: Geastrum, Myriostoma, Trichaster, Geasteropsis, Phialastrum,
Pyrenogaster, Radiigera, and Terrostella, with Geastrum being the largest
(Sunhede 1989) with 50 species recognized worldwide (Kirk et al. 2008).
Tropical regions contain most of the fungi still unknown to science. Tropical
Amazonian rainforests account for 25% of the remaining forests worldwide
and cover nearly half of Brazil, representing enormous strategic value (Braga-
Neto et al. 2008). The Amazon biome, which covers 4,871,000 km? (INPE
384 ... Leite & al.
2004), extends from the Atlantic Ocean to the eastern slopes of the Andes up
to approximately 600 m altitude, encompassing parts of nine South American
countries and with 69% falling within the boundaries of Brazil (AbSaber
1977).
The mycobiota of the Brazilian Amazon has been poorly studied and needs
to be more thoroughly investigated. However, the following existing studies are
noteworthy: Singer & Araujo (1979), Aguiar (1984), Singer (1984), Singer &
Aguiar (1986), Capelari & Maziero (1988), and Bononi (1992). Several studies
on gasteromycetes in the Amazon region have been conducted: Berkeley
& Cooke (1876), Hennings (1904), Capelari & Maziero (1988), Trierveiler-
Pereira et al. (2009). The purpose of this paper is to contribute to the existing
knowledge of this mycobiota, with special reference to the family Geastraceae.
Material & methods
Material was collected from 1995 to 2008 at the Reserva Nacional de Caxiuana, in the
municipality of Melgaco, Para state, Amazonas, Brazil, and deposited in the herbaria of
the Museu Paraense Emilio Goeldi (MG), Belém, Para, and UFRN, Universidade Federal
do Rio Grande do Norte, Natal. These collections are considered reference depositories
for the study of Amazonian biodiversity (Braga-Neto et al. 2008). Additional Brazilian
specimens held in UFRN were also studied. Macro- and microscopic characters were
studied according to Miller & Miller (1988), Sunhede (1989), Ponce de Ledn (1968),
Soto & Wright (2000), Baseia & Milanez (2002), Calonge et al. (2000), Calonge & Mata
(2004), Baseia & Calonge (2006), Leite & Baseia (2007), and Leite et al. (2007). Color
citations were based on Kornerup & Wanscher (1978). Microstructures were analyzed
in sections mounted on slides, using 5% KOH, and SEM was used to study basidiospore
ornamentation.
Results
Geastrum entomophilum Fazolino, Calonge & Baseia, Mycotaxon 104: 450 (2008).
FiG=.t
Expanded basidiome epigeous, 7.3 cm broad. Exoperidium semi-hygroscopic,
arched, split into 6 rays, recurved under the exoperidial disc; mycelial layer
light orange (6A5), covered with adhering humus, leaf and sand; fibrous layer
light orange (6A4); pseudoparenchymatous layer brown (6F4). Endoperidium
sessile, globose to subglobose, 2 cm diam., ornamentation formed by fascicles
of worm-shaped surface hyphae (Fic. 1b), greyish brown (5D3). Peristome
fibrillose, concolorous with rest of endoperidium, indistinctly delimited. Gleba
brownish grey (5F2). Basidiospores globose, ornamentation more or less
columnar, 3.5-4 um diam. Capillitial hyphae with verrucose surface, 3-3.1 um
diam.
SUBSTRATE & DISTRIBUTION— Sandy soil. Known only from South America,
this is the first record of this species from the Amazon rainforest.
Geastrum in the Amazon (Brazil) ... 385
Fic. 1. Geastrum entomophilum. a. Basidiospores; b. Endoperidial hyphal fascicle.
SPECIMEN EXAMINED: BRAZIL. PARA: Melgaco, Floresta Nacional de Caxiuana, Estacao
Cientifica Ferreira Penna, 20.11.1997, col. H. Sotao & al. (MG 199685).
ADDITIONAL SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO NorTE: Natal,
Parque EstapuaL Dunas do Natal, 15.VII.2006, col. E.P. Fazolino & A.G. Leite. (UFRN-
Fungos 354).
TAXONOMIC REMARKS—Geastrum entomophilum is recognized by its sessile
endoperidium, verrucose surface with vermiform hyphae in fascicles, and
fibrillose and lacerated peristome, non-delimited when older. In the original
description (Fazolino et al. 2008) the small beetles (Coleoptera) observed
inside the gleba led to the name ‘entomophilum: Beetles were not observed by
Trierveiler-Pereira & Baseia (2010).
Geastrum fimbriatum Fr., Syst. mycol. 3(1): 16 (1829). Fic. 2
Basidiomata epigeous when young, globose to depressed-globose, 1.7 cm
diam. x 2 cm high, epigeous at maturity, 2-2.5 cm broad, 0.4-0.7 cm high.
Exoperidium non-hygroscopic, saccate, splitting into 4-6 rays; mycelial
layer dark blond (5D4); fibrous layer adherent, greyish yellow (4B3);
pseudoparenchymatous layer brown (5F5). Endoperidium sessile, globose to
subglobose, 0.8-2 cm diam., brown (6E4). Peristome absent to fibrillose. Gleba
dark brown (6F5); columella present. Basidiospores 3-3.5 um diam., globose,
ornamentation columnar. Capillitial hyphae thick-walled, with surface debris
and verrucose, 3.5-5 um diam.
SUBSTRATE & DISTRIBUTION— Sandy soil. Known from South America,
Central America, North America, Europe, and Australasia.
SPECIMEN EXAMINED: BRAZIL. PARA: Melgaco, Floresta Nacional de Caxiuana, Estacao
Cientifica Ferreira Penna, 30.V.1997, col. H. Sotao & al. (MG-199687, UFRN-fungos
1465).
aranee SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO NORTE: Parque
Estadual Dunas do Natal, 02.V1.2007, col. E.P. Fazolino & B.D.B. Silva (UFRN-Fungos
337).
386 ... Leite & al.
Fic. 2. Geastrum fimbriatum. a. Basidiospore; b. Capillitial hypha.
TAXONOMIC REMARKS—Geastrum fimbriatum strongly resembles G. saccatum,
mainly with respect to its basidiospore ornamentation, but it also differs in
having smaller spores, with those of G. saccatum 4-6 um diam. (Soto & Wright
2000). A marked characteristic in this species observed by both Sunhede (1989)
and us is the interspersed hyphal formation in the mycelial layer.
This is the second record of C. fimbriatum from the Amazon rainforest; the
first was made by Trierveiler-Pereira et al. (2009).
Geastrum javanicum Lév., Annls Sci. Nat., Bot., sér. 3, 5: 161 (1846). Fie. 3-4
Basidiomata epigeous when young, 0.7—1.6 cm broad, 0.5—1.5 cm high,
caespitose on a subiculum, white yellowish (4A1-4A2); expanded basidiome
epigeous. Exoperidium hygroscopic, 1.5-1.9 cm diam. when open, split into
5-8 recurving rays; mycelial layer velvety, separates at maturity, greyish brown
(5D3); fibrous layer light yellowish (5C4); pseudoparenchymatous layer
brownish orange (5C4). Endoperidium brown (6F4) to brownish grey (7E2),
sessile, globose, 1-1.2 cm diam. Peristome delimited, fibrillose, concolorous
with rest of endoperidium. Gleba greyish brown (6F3); columella present.
Fic. 3. Geastrum javanicum. a. Basidiospore; b. Capillitial hypha.
Geastrum in the Amazon (Brazil) ... 387
Fic. 4. Geastrum javanicum. a. Immature basidioma; b. Mature basidioma.
Basidiospores globose, 2.5-3 um diam., with irregular warts. Capillitial hyphae,
3-4 um diam., surface rugose, septate and branched.
SUBSTRATE & DISTRIBUTION— Decaying wood. Known from South America,
Central America, North America, Africa, Australasia, Asia.
SPECIMEN EXAMINED: BRAZIL. PARA: Melgaco, Floresta Nacional de Caxiuana, Estacao
Cientifica Ferreira Penna, 12.IV.1995, col. H. Sotao & al. (MG n° 0149528).
ADDITIONAL SPECIMEN EXAMINED: BRAZIL. RIO GRANDE DO NORTE: Parnamirim,
Mata do Jiqui, 22.V1.2007, col. E.P. Fazolino & al. (UFRN-Fungos 550).
TAXONOMIC REMARKS—Geastrum javanicum is generally found growing in
clusters, forming whitish subiculum on dead wood, leaf litter, and occasionally
in sand impregnated with decomposing organic matter (Ponce de Leon 1968).
A diagnostic character is the velvety exoperidium that detaches itself from the
mycelial layer when the basidioma is mature. Ponce de Leén (1968) reviewed
the holotypes of G. velutinum Morgan and G. javanicum and considered them
to be synonyms. However, on the basis of priority, G. javanicum is the correct
name to use. Sunhede (1989) did not study the type of material of G. javanicum,
and therefore did not confirm its synonymy with G. velutinum.
This species has been reported from Brazil by Sobestiansky (2005), de Meijer
(2006), and Sydow & Sydow (1907) as G. velutinum, but this is the first record
from the Amazon rainforest.
Geastrum lageniforme Vittad., Monograph. Lyc.: 16 (1842). Fic. 5
Mature basidiomata 1-2.4 cm broad, 0.8-1.4 cm high. Exoperidium non-
hygroscopic, saccate with 4-6, long, slender-tipped rays, extended or recurved
388 ... Leite & al.
Fic. 5. Geastrum lageniforme. a. Basidiospore; b. Capillitial hypha.
under the exoperidial disc and the rays are markedly tapered and pointed;
mycelial layer blond (4C4), with longitudinal fissures; fibrous layer pale orange
(5A3); pseudoparenchymatous layer yellowish brown (5F8). Endoperidium
dark blond (5D4), sessile, globose to subglobose, 0.8-1.2 cm diam. Peristome
fibrillose, delimited, conical to mammiform. Gleba pale orange (5A3); columella
present. Basidiospores globose 4.5-5 um diam., ornamentation columnar.
Capillitial hyphae thick-walled, 2-2.8 um diam.
SUBSTRATE & DISTRIBUTION—Sandy soil. Known from South America,
Central America, North America, and Europe; this is the first record of this
species from the Amazon rainforest.
SPECIMEN EXAMINED: BRAZIL. PARA: Melgaco, Floresta Nacional de Caxiuana, Estacao
Cientifica Ferreira Penna, 19.11.1997, col. H. Sotao & al. (MG 199683).
ADDITIONAL SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO NortTE: Natal,
Parque Estadual Dunas do Natal, 29.VII.2006, col. E.P. Fazolino & al. (UFRN-fungos
332).
TAXONOMIC REMARKS— This species is characterized by a saccate exoperidium,
sessile endoperidium and fibrillose, well-delimited peristome. It is very similar
to and often confused with G. saccatum and G. triplex Jungh. (Soto & Wright
2000). Fries (1829) mentions nothing about grooves in the mycelial layer in
G. saccatum. In G. lageniforme, after dehiscence of the exoperidium, the rays
are markedly longitudinally cracked. According to Sunhede (1989), G. triplex
exhibits an endoperidial body of 7.5-19.5 mm diam., while in G. lageniforme it
reaches 11-54 mm.
Geastrum lilloi L.S. Dominguez, Mycologia 88: 858 (1996). Fics. 6-7
Young basidiomata epigeous, 0.8 cm broad, 0.4 cm high, surface irregular,
yellowish white pale (2A2), caespitose, growing on a pale yellow (4A3)
subiculum; mature basidiomata 1.1-1.4 cm diam. Open exoperidium saccate,
splitting into 5—6 rays, hygroscopic; mycelial layer with irregular surface, pale
yellowish white (2A2); fibrous layer white (6D4); pseudoparenchymatous layer
Geastrum in the Amazon (Brazil) ... 389
Fic. 6. Geastrum lilloi. a. Basidiospores; b. Mycosclereid.
brown (5F7). Endoperidium brown (6E4), sessile, globose, 0.6-0.8 cm diam.
Peristome fibrillose, mammiform, greyish brown (5D3), indistinctly delimited.
Gleba dark brown (6F3); mycosclereids present, up to 10.2 x 15.9 um diam.;
columella present. Basidiospores globose, 2.8-3.5 um diam., ornamentation
irregularly columnar. Capillitial hyphae 1.8-2 um. diam., covered with
encrusting surface debris.
SUBSTRATE & DISTRIBUTION— Woody debris. Known from South America
(Argentina, Brazil).
SPECIMEN EXAMINED: BRAZIL. Para: Melgaco, Floresta Nacional de Caxiuana, Estacao
Cientifica Ferreira Penna, 29.V.1997, col. H. Sotao & al. (MG 199686).
TAXONOMIC REMARKS—Distinguishing characteristics of G. lilloi are its small
size, gregarious and xylophilous habitat, velvety mycelial layer, the presence of
mycosclereids in the gleba, the endoperidium with a fibrillose, mammiform
pore, and epigeal development (Dominguez de Toledo 1996). Geastrum
schweinitzii (Berk. & M. A. Curtis) Zeller can easily be confused with G. Jilloi
because it also is small-sized and grows on a subiculum on wood. However,
10 mm
Fic. 7. Geastrum lilloi. a. Immature basidioma; b. Mature basidioma.
390 ... Leite & al.
these two species differ in terms of the non-hygroscopic exoperidium, obovate
fruit body, peristome without a ring, and smooth to velvety mycelial layer in
G. schweinitzii.
This is the first record of G. Jilloi, first described from Argentina, from
Brazil.
Geastrum saccatum Fr., Syst. Mycol. 3(1): 16 (1829). Fic. 8
Mature basidiomata 0.5-2 cm diam. Exoperidium non-hygroscopic,
saccate, splitting into 5-7 rays; mycelial layer encrusted with debris of soil
and leaf litter, light orange (6A4); pseudoparenchymatous layer brown (6E4);
fibrous layer adhered to pseudoparenchymatous layer, pale orange (6A3).
Endoperidium brownish beige (6E3), sessile, globose, 0.8-1.2 cm diam.
Peristome well delimited, fibrillose, conical to mammiform, concolorous
with rest of endoperidium. Gleba greyish brown (6F3); columella present.
Basidiospores globose to subglobose, 3.6—4.5 um diam., ornamentation rather
irregular columnar. Capillitial hyphae 3-3.5 um diam, covered with small wart-
like surface outgrowths.
SUBSTRATE & DISTRIBUTION— Sandy soil. Known from South America,
Central America, North America, Africa, Asia, Australasia, and Europe.
Fic. 8. Geastrum saccatum. a. Basidiospore; b. Capillitial hypha.
SPECIMEN EXAMINED: BRAZIL. PARA: Melgaco, Floresta Nacional de Caxiuana, Estacao
Cientifica Ferreira Penna, 19.11.1997, col. H. Sotaéo & al. (MG-199684).
ADDITIONAL SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO Norte: Natal,
Parque Estadual Dunas do Natal, 15.VII.2006, col. E.P. Fazolino & al. (UFRN-Fungos
334).
TAXONOMIC REMARKS—Geastrum saccatum is characterized mainly by its well-
delimited, fibrillose peristome and sac-like, sessile endoperidium. It resembles
G. lageniforme but differs in its smaller and wider rays and a mycelial layer lacking
longitudinal striations (Soto & Wright 2000). Macroscopically it resembles
young G. triplex specimens, but at maturity the pseudoparenchymatous layer of
Geastrum in the Amazon (Brazil) ... 391
G. triplex detaches from the fibrous layer. Another marked difference between
these two species is the much smaller basidioma of G. saccatum.
This is the second record of G. saccatum, first recorded by Hennings (1904),
from the Amazon rainforest.
Acknowledgments
The authors thank the reviewers, Johan C. Coetzee and Admir Giachini, for
their valuable suggestions. We express our gratitude to the Conselho Nacional de
Desenvolvimento Cientifico e Tecnoldgico (CNPq) for partial financial support; to
CTPETRO-INFR, FINEP/LIEM for collaboration with the SEM and MPEG and to
Estacao Cientifica Ferreira Penna for fieldwork logistical support.
Literature cited
Ab’Saber AN. 1977. Os dominios morfoclimaticos na América do Sul. Primeira aproximacao.
Geomorfologia 52: 1-23.
Aguiar IJA. 1984. Contribuigaéo ao conhecimento da familia Cortinariaceae Roze ex Heim
(Agaricales) na Amazonia Brasileira. Tese de Doutorado, Instituto Nacional de Pesquisas da
Amazonia /Universidade do Amazonas, Manaus, AM.
Baseia IG, Calonge FD. 2006. Geastrum hirsutum: a new earthstar fungus with a hairy exoperidium.
Mycotaxon 95: 301-304.
Baseia IG, Milanez AI. 2002. Geastrum setiferum (gasteromycetes): a new species with a setose
endoperidium. Mycotaxon 84: 135-139.
Berkeley MJ, Cooke MC. 1876. The fungi of Brazil, including those collected by J.W.H. Trail, Esq.
M.A. in 1874. Botanical Journal of the Linnean Society 15: 363-398.
http://dx.doi.org/10.1111/j.1095-8339.1876.tb00248.x
Bononi VLR, 1992. Fungos macroscépicos de Rio Branco, Acre, Brasil. Hoehnea 19(1/2): 31-37.
Braga-Neto R, Luizio RCC, Magnusson WE, Zuquim G, Castilho CV. 2008. Leaf litter fungi in a
Central Amazonian forest: the influence of rainfall, soil and topography on the distribution of
fruiting bodies. Biodiversity and Conservation 17: 2701-2712.
http://dx.doi.org/10.1007/s10531-007-9247-6
Calonge FD, Mata M. 2004. A new species of Geastrum from Costa Rica and Mexico. Boletin de la
Sociedad Micoldgica de Madrid 28: 331-335.
Calonge FD, Moreno-Arroyo B, Gémez J. 2000. Aportacion al conocimiento de los Gasteromycetes,
Basidiomycotina, de Bolivia (América del Sur) Geastrum ovalisporum sp. nov. Boletin de la Sociedad
Micolégica de Madrid 25: 271-276.
Capelari M, Maziero R. 1988. Fungos macroscdpicos do estado de Rond6nia. Regiao dos Rios Jaru e
Ji-Parana. Hoehnea 15: 28-36.
Corda ACJ. 1842. Anleitung zum Studium der Mycologie, nebst Kritischer Beschreibung aller
Bekannten Gattungen, und einer kurzen Geschichte der Systematik. Ehrlich: Prague.
De Meijer AAR. 2006. Preliminary list of the macromycetes from the Brazilian State of Parana.
Boletim do Museu Botanico Municipal 68: 1-55.
Dominguez de Toledo LS. 1996. Geastrum lilloi sp. nov. from Argentina. Mycologia 88(5): 853-862.
http://dx.doi.org/10.2307/3760982. http://jstor.org/stable/3760982.
Fazolino EP, Calonge FD, Baseia IG. 2008. Geastrum entomophilum, a new earthstar with an
unusual spore dispersal strategy. Mycotaxon 104: 449-453.
Fries EM. 1829. Systema Mycologicum 3(1). Sumptibus Ernesti Mauritii: Greifswald.
392 ... Leite & al.
Hennings P. 1904. Fungi amazonici I. a cl. Ernest Ule collecti. Hedwigia 43: 154-186.
Hibbett DS, Pine EM, Langer E, Langer G, Donoghue MJ. 1997. Evolution of gilled mushrooms
and puffballs inferred from ribosomal DNA sequences. Proceedings of the National Academy
of Sciences of the USA 94: 12002-12006. http://dx.doi.org/10.1073/pnas.94.22.12002
Hosaka K, Bates ST, Beever RE, Castellano MA, Colgan WII, Dominguez LS, Nouhra ER, Gem J,
Giachini AJ, Kenney SR, Simpson NB, Spatafora JW, Trappe JM. 2006. Molecular phylogenetics
of the gomphoid-phalloid fungi with an establishment of the new subclass Phallomycetidae and
two new orders. Mycologia 98(6): 949-959. http://dx.doi.org/10.3852/98.6.949
INPE (Instituto Nacional de Pesquisas Espaciais). 2004. Monitoramento da Floresta, Sao José dos
Campos.
Kirk PM, Cannon PF, Minter DW, Stalpers JA (eds). 2008. Dictionary of the fungi. 10" edition.
CABI Publishing: Wallingford.
Kornerup A, Wanscher JE. 1978. Methuen Handbook of Colour, 3rd edn, Methuen: London.
Kriiger D, Chagas A. 2008. Secondary structure of ITS2 rRNA provides taxonomic characters
for systematic studies — a case in Lycoperdaceae (Basidiomycota). Mycological Research 112:
316-330.
Leite AG, Baseia IG. 2007. A familia Geastraceae Corda em algumas areas do Nordeste brasileiro.
Sitientibus. Série Ciéncias Bioldgicas 7: 178-183.
Leite AG, Calonge FD, Baseia IG. 2007. Additional studies on Geastrum from Northeastern Brazil.
Mycotaxon 101: 103-111.
Lloyd CG. 1902. The Geastrae. 44 p.
Miller OK Jr, Miller HH. 1988. Gasteromycetes. Morphological and Development Features with
Keys to the Orders, Families, and Genera. Mad River Press: Eureka.
Ponce de Leon P. 1968. A revision of the family Geastraceae. Fieldiana Botany 31: 302-349.
Singer R. 1984. Adaptation of higher fungi to varzea conditions. Amazoniana 8(3): 311-319.
Singer R, Aguiar, IJA. 1986. Litter decomposing and ectomycorrhizal Basidiomycetes in an igapo
forest. Plant Systematics and Evolution 15: 107-117.
Singer R, Araujo IJS. 1979. Litter decomposition and ectomycorrhiza in Amazonian forests 1.
A comparison of litter decomposing and ectomycorrhizal Basidiomycetes in latosolterra- firme
rain forest and white podzol campinarana. Acta Amazonica 9(1): 25-41.
Sobestiansky G. 2005. Contribution to a Macromycete survey of the states of Rio Grande do Sul
and Santa Catarina in Brazil. Brazilian Archives of Biology and Technology 48: 437—457.
http://dx.doi.org/10.1590/S1516-89132005000300015
Soto MK, Wright JE. 2000. Taxonomia del Genero Geastrum (Basidiomycetes, Lycoperdales) en la
Provincia de Buenos Aires, Argentina. Boletin de la Sociedad Argentina de Botanica 34(3-4):
185-201.
Sunhede S. 1989. Geastraceae (Basidiomycotina). Morphology, ecology and systematics with special
emphasis on the North European species. (Synopsis Fungorum 1). Fungiflora: Oslo.
Sydow H, Sydow P. 1907. Verzeichnis der von Herrn F. Noack in Brasilien Gesammelten Pilze.
Annales Mycologici 5(4): 348-363.
Trierveiler-Pereira L, Baseia IG. 2009. A checklist of the Brazilian gasteroid fungi (Basidiomycota).
Mycotaxon 108: 441-444. (http://www.mycotaxon.com/resources/checklists/trierveiler-v108-
checklist.pdf)
Trierveiler-Pereira L, Baseia IG. 2010. Additional data on Geastrum entomophilum (Geastraceae,
Basidiomycota). Boletin de la Sociedad Micologica de Madrid 34: 135-139.
Trierveiler-Pereira L, Gomes-Silva AC, Baseia IG. 2009. Notes on gasteroid fungi of the Brazilian
Amazon rainforest. Mycotaxon 110: 73-80.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.393
Volume 118, pp. 393-401 October-December 2011
Hypoderma siculum sp. nov. from Italy
ANGELA LANTIERI’ , PETER R. JOHNSTON”, DUCKCHUL PARK’,
HENRIK LANTZ? & GIANFRANCO MEDARDI*
‘Dipartimento di Biologia “Marcello La Greca”, Universita di Catania,
Via Antonino Longo 19, I-95125 Catania, Italy
*Landcare Research, Private Bag 92170, Auckland 1142, New Zealand
*Swedish University of Agricultural Sciences, Department of Microbiology,
Box 7025, SE-75007, Uppsala, Sweden
°Via Giuseppe Mazzini 21, I-25086 Rezzato (Brescia), Italy
CORRESPONDENCE TO *: [email protected]
ABSTRACT — Hypoderma siculum is described and illustrated as a new species from
southeast Sicily (Italy) that occurs on remnants of Ferula communis (Apiaceae). Its ecology
and taxonomic and phylogenetic relationships are discussed.
KEY worps — morphology, taxonomy, ITS phylogeny
Introduction
Field investigation of the Ascomycetes of Sicily occurring on decaying
remnants of Ferula communis (Lantieri 2009) revealed a new Hypoderma
species, described here as Hypoderma siculum.
Materials & methods
Collections of the new species were made between 2007 and 2010 at an elevation
of 700 m a.s.l. in southeast Sicily. Morphological and microscopic examinations were
carried out on fresh material and on dried specimens rehydrated in water. Observations
and measurements were made in water and Melzer’s reagent. Ascus and ascospore size
ranges from the holotype were based on 50 measurements, using an Optika optical
microscope (model BK 1301), with 40x or 100x (oil immersion) objectives. All voucher
specimens were deposited in the fungarium of the Royal Botanic Gardens, Kew K(M)
and in the fungal reference collection of Landcare Research in New Zealand (PDD).
DNA was extracted separately from two sets of four fruiting bodies taken from
each of two separate blackened areas on leaf pieces within the isotype specimen (PDD
99894), using REDExtract-N-Amp Plant PCR Kits (Sigma, USA). The perithecia were
394 ... Lantieri & al.
TABLE 1. Specimens used in phylogenetic analysis
COUNTRY OF ORIGIN, COLLECTION GENBANK
SPECIES
HOST VOUCHER ACC. NO.
CeO ES ATEN. ICMP 16772 EF191241
australis Desfontainia spinosa
Hypoderma Sweden, Hanson 2006-451 (UPS) JF690769 *
commune ?Euphorbia sp.
H. cordylines New Zealand, ICMP 17344 JF683421 *
Cordyline australis (ex-holotype culture)
New Zealand, Phormium sp. ICMP 17359 JF683420 *
H. hederae Scotland, Hedera helix Lantz & Minter 421 (UPS) JF690770 *
H. rubi China, host unknown unknown GU138735
China, host unknown unknown GU138736
China, host unknown unknown GU138738
China, host unknown unknown GU138739
China, host unknown unknown GU138741
China, host unknown unknown GU138743
China, host unknown unknown GU138745
China, host unknown unknown GU138746
China, host unknown unknown GU138750
China, host unknown unknown GU138751
China, host unknown unknown GU367895
China, host unknown unknown GU367898
New Zealand, Coprosma sp. ICMP 18768 JF683417 *
New Zealand, ICMP 18325 JE 683418 *
Melicytus ramiflorus
New Zealand, Pseudopanax sp. ICMP 17349 JF683416 *
New Zealand, Rubus cissoides ICMP 17339 JE 683419 *
Sweden, Rubus lindebergii Hanson 2002-230 (UPS) JF690771 *
H. siculum Italy, Ferula communis PDD 99894 (isotype) JF683424 *
H. stephanandrae China, Stephanandra chinensis unknown GU138753
H. vincetoxici Sweden, Lantz 405 (UPS) JF690772 *
Vincetoxicum hirundinaria
Lophodermium New Zealand, ICMP 18327 JF683423 *
agathidis Agathis australis
New Zealand, ICMP 17345 JF683422 *
Metrosideros fulgens
L. eucalypti New Zealand, ICMP 16796 EF191235
Leptospermum scoparium
L. gamundiae Argentina, ICMP 16797 EF191239
Nothofagus dombeyi
* = newly generated for this study).
UPS = Uppsala University; ICMP = International Collection of Microorganisms
from Plants (maintained by Landcare Research)
ground in extraction buffer with a plastic pestle in the Eppendorf tube. Following this,
DNA extraction and PCR were carried out following manufacturer's instructions. ITS
sequences were obtained from each extract following the methods of Johnston & Park
(2005).
Hypoderma siculum sp. nov. (Italy) ... 395
Using ClustalW (Thompson et al. 1994), our newly generated sequences were
aligned with sequences deposited in Genbank as Hypoderma rubi or those that closely
matched H. rubi. Because of the paucity of available data, ITS sequences were generated
from several additional Hypoderma spp. from New Zealand, with DNA extracted from
cultures grown from germinating ascospores. Other taxa included in the analysis were
members Lophodermium eucalypti/Coccomyces tumidus clade recognized by Lantz et al.
(2011) that formed a sister relationship to the core Hypoderma clade, and Lophodermium
agathidis as the outgroup.
The taxa included are listed in TABLE 1, along with the Genbank accession numbers
of our newly generated sequences. A Bayesian phylogenetic analysis was performed
using MrBayes 3.1.2 (Huelsenbeck & Ronquist 2001; Ronquist & Huelsenbeck 2003)
with gaps treated as missing data, using the K80+I+G model which was selected using
the AIC method in MrModelTest 2.3 (Nylander 2004). The data set was run with 2 chains
for 10 million generations, trees sampled every 1000 generations with a burn-in of 25%.
Bayesian posterior probabilities were obtained from 50% majority rule consensus trees.
Taxonomy
Hypoderma siculum Lantieri, P.R. Johnst. & Medardi sp. nov. PLATEs 1-2
MycoBANnkK MB 563145
Ascomata erumpentia inter amplas variiformes nigras areas, haud compositas, supra plantae
superficiem, haud consociata cum zonae lineis. Partes nigrae ex 1-2 stratis hypharum
parietibus obscuris et inflatis, formantibus amplum stratum, 5-8 um latum sub plantae
cuticula, constitutae. Aspectus in superficie: ascomata 1-1.5 x 0.5-0.8 mm, ellipsoidea
vel leviter fusiformia vel navicularia si secta, extremitatibus repente rotundatis vel acutis,
paene mersa in contextu plantae. Ascomata clausa parietibus nigrescentibus, sed plus
minusve obscure griseis ad margines prominentes fissurae. Ascomata aperta per fissuram
longitudinalem, se extendentem in totam longitudinem. Labra dilute griseola adsunt.
Hymenium griseum caesio colore suffusum. Labri cellulae hyalinae ex hyphis inconstanter
cylindricis, inflatis in nonnullis partibus, pariete crassa, cellulis 1 (raro 2) -septatis, 20-25
x 2 um, mersis in involucro gelatino, constitutae. In recta media parte stroma tegens
crassum usque ad 50 um prope ascomatum centrum, sed tenuior ad margines atque tenens
stroma basis ex strato inferiore et obscure brunneo texturae epidermoideae constitutum.
Externa pars parietum cellularum stromatis tegentis obtecta materia densa, nigra, plus
minusve granosa, ex particulis sine structura cellularum manifesta, sed nonnullis cellulis
obscure polygonalibus, efformata. Excipulum abest. Subhymenium 20-40 um crassum,
ex textura intricata, hyphis 3-4 ym latis, parietibus tenuibus et hyalinis constitutum.
Stroma basis 5-15 um crassum, cum 3-4 stratis hypharum hyalinarum, 3-4 um
latarum, parietibus obscure brunneis et leviter inflatis, formantibus texturam intricatam.
Ascosporae fusiformes vel cylindrico-fusiformes, nonnullae leviter curvae, 27-30 x 3-3.5
um, laeves, hyalinae, haud septatae, guttulis haud compositis praeditae, saepe absentibus
prope centrum, cinctae involucro gelatino, laxo, circiter 3 um crasso. Asci clavato-stipitati,
(85—)90-100 x 9-10 um, apice rotundato, haud amyloidei, 8—sporigeri; sporae dispositae
in parte superiore. Paraphyses numerosae, filiformes, 1-2 um latae, emergentes usque ad
30 um supra ascos, curvae, crispatae vel valde plicatae ad apicem, nonnullis parvis guttulis
sparsis per totam longitudinem, sine septis. Specimina cum conidiis haud notata. Habitat:
supra reliqua putrescentia Ferulae communis; inventum solum hieme.
396 ... Lantieri & al.
TyPE: Italy. Sicily, vic. Vittoria (Ragusa), Riserva Naturale Orientata “Pino d’Aleppo’,
on decaying remnants of Ferula communis, 30/12/2007, Leg. Angela Lantieri (holotype,
K(M) 167515; isotype, PDD 99894, GenBank JF683424).
CONIDIOMATA not observed. Ascomata develop among large, irregularly
shaped blackened areas on the plant surface, not associated with zone lines. The
blackened areas have 1-2 layers of hyphae with walls dark and thick forming a
5-8 um wide layer beneath the plant cuticle. In surface view ascomata 1-1.5 x
0.5-0.8 mm, elliptical to slightly fusiform or navicular in outline, with sharply
rounded to acute ends, semi-immersed in the plant tissues. Closed ascomata
with blackish walls, but more or less dark greyish near the prominent edges of
the slit. Ascomata opening by a longitudinal slit, which extends along the whole
length. Lips present, pale greyish. HYMENIUM grey with bluish reflexes. Lip
CELLS hyaline, composed of irregularly cylindrical, in some points enlarged,
thick-walled, 1 (rarely 2) -septate, cells, 20-25 x 2 um embedded in a gelatinous
sheath. IN MEDIAN VERTICAL, covering stroma up to 50 um thick near the
centre of the ascomata, becoming thinner towards the edges, extending to the
basal stroma, consisting of a inner layer of dark brown textura epidermoidea.
OUTER PART of the walls of the cells in the covering stroma with dense, more
or less granulose black matter, composed of small particles with no visible
cellular structure, but some of them obscurely polygonal. ExcipuLuM absent.
SUBHYMENIUM 20-40 um thick, composed of textura intricata, hyphae 1.5-2
um diam. with hyaline, thin walls. BasAL sTroMA 5-15 um thick, comprises
3-4 layers of hyphae 3-4 um diam. with walls dark brown and slightly
thickened, forming a textura intricata. Ascospores fusiform or cylindrical-
fusiform, some slightly curved, 27-30 x 3-3.5 um, smooth, hyaline, aseptate,
containing irregular oil drops often lacking near the middle, surrounded by
loose gelatinous sheath about 3 um thick. Asci clavate-stipitate, (85—)90-100 x
9-10 um, apex rounded, not bluing in iodine, 8-spored, spores confined to the
upper part. PARAPHYSEs abundant, filiform, 1-2 um diam., protruding up to 30
um beyond the asci, curved, curled or remarkably bent at the apex, with some
small oil-drops scattered along the length, without septa.
Hasitat: On decaying remnants of Ferula communis, found only in winter.
ADDITIONAL SPECIMENS EXAMINED: ITALY. SIcILy, vic. Vittoria (Ragusa), Riserva
Naturale Orientata “Pino d’Aleppo’, 13/03/2008, [Leg. A. Lantieri] (K(M) 167516);
06/02/2009, [Leg. A. Lantieri] (K(M) 167517); 13/02/2010, [Leg. A. Lantieri] (K(M)
167518).
Discussion
Hypoderma siculum falls within the Hypoderma sensu stricto clade of Lantz
et al. (2011). Genetic relations within this clade are poorly resolved in the ITS
gene tree (Fic. 3). Despite this, H. siculum is genetically distinct from other
named isolates within the clade, and this genetic isolation and its distinct
Hypoderma siculum sp. nov. (Italy) ... 397
PLATE 1. Hypoderma siculum (Holotype, K(M) 167515). A. fresh ascomata in situ; B. stromatic
tissue surrounding ascomata, vertical section; C. upper wall of ascoma, vertical section; D. detail
of lip cells, vertical section; E. detail of lower wall of ascoma, vertical section; F. detail of lower
wall of ascoma, squash mount; G. asci and ascospores; H. ascospores in KOH; I. ascospores in
water showing gelatinous sheath. Scale bars: A = 1 mm; B, D-H = 20 um; C = 50 um.
398 ... Lantieri & al.
PLATE 2. Hypoderma siculum (Holotype, K(M) 167515).
A. margin of ascoma in vertical section; B. stromatal cells; C. section of stroma;
D. granulose matter; E. asci and ascospores; F. ascospores.
biology supports recognizing the fungus as an independent species. Other
morphologically distinct taxa within this clade, such as Hypoderma cordylines,
are also poorly resolved. More intensive, multi-gene phylogenies of Australasian
species have shown that ITS alone does not adequately resolve relationships
within this clade (unpublished data). The weak quality of the DNA extracted
from the H. siculum dried specimens did not permit reliable sequencing of
single copy genes.
Hypoderma siculum sp. nov. (Italy) ... 399
GU367898 H. rubi China
GU367895 H. rubi China
GU138738 H. rubi China
GU138736 H. rubi China
GU138739 H. rubi China
GU138745 H. rubi China
GU138746 H. rubi China
GU138743 H. rubi China
GU138741 H. rubi China
JF683424 Hypoderma siculum
GU138753 H. stephanandrae
JF690771 H. rubi Sweden on Rubus
GU138750 H. rubi China
GU138751 H. rubi China
JF683416 H. rubi NZ on Pseudopanax
JF683417 H. rubi NZ on Coprosma
JF683418 H. rubi NZ on Melicytus
JF690769 H. commune Sweden
JF690772 H. vincetoxici Sweden
JF690770 H. hederae Sweden
JF683420 H. cordylines NZ
JF683421 H. cordylines NZ
1.00 JF683419 H. rubi NZ on Rubus
EF 191239 Lophodermium gamundiae
EF191235 Lophodermium eucalypti
EF191241 Coccomyces australis
1.00 JF683422 Lophodermium agathidis
JF683423 Lophodermium agathidis
0.99
FIGURE 3. 50% majority-rule consensus phylogenetic tree based on Bayesian analysis of Hypoderma
siculum and related taxa derived from ITS gene sequences. Bayesian posterior probabilities greater
than 90% are shown above the edges. Sclerotinia sclerotiorum was selected as the outgroup.
Ferula communis L. (Apiaceae), a typical herbaceous plant of the
Mediterranean area, is commonly associated with two Hypoderma species,
H. ferulae Lantieri (Lantieri 2009) and H. siculum. Early reports of Hypoderma
rubi (Pers.) DC. and H. commune (Fr.) Duby on F. communis (Duby 1862;
Petrak 1943) are difficult to assess, as neither report is supported by specimens.
It is uncertain in what sense the authors were using these names and impossible
to check whether the specimens they reported match our Ferula-specialised
species.
AOO ... Lantieri & al.
Extensive collecting in Sicily revealed only H. ferulae and H. siculum on
Ferula. Scalia (1900: 37) reported H. commune from Sicily ona species in another
genus of Apiaceae, Thapsia garganica L.; the report included no description of
the fungus, and again there is no material available to verify the record. There
is no evidence from collections made in Sicily that H. siculum occurs on other
genera of Apiaceae (unpubl. data).
Hypoderma siculum is distinguished from H. ferulae by ascospore size and
septation (21-24 x 2.5-3 um and often 1-septate in H. ferulae), by the presence
of an extended area of stromatic subcuticular tissue surrounding the ascomata,
the colour of the hymenium when fresh (yellow-honey with greenish tinges in
H. ferulae), and the lack of an excipular layer.
Hypoderma siculum resembles H. rubi morphologically, but as noted in
the phylogenetic section, the application of this name by different authors is
uncertain, and genetic relationships amongst specimens identified as H. rubi
are poorly resolved. Hypoderma rubi sensu Powell (1974), Johnston (1990), and
Medardi(2006) differs slightly from H. siculum in its ascospore size (20-—25(-26.5)
x 3-4 um) and the fusiform-navicular ascospore shape. Hypoderma commune
differs in having ascomata with yellow-greenish hymenium and smaller, non-
septate spores (17-20 x 3-4 um; Ellis & Ellis 1988).
Acknowledgments
The authors sincerely thank to Prof. G. Consiglio for the Latin diagnosis, Prof. D. Minter
(UK), and Dott. C. Losi (Italy) for critically reviewing the manuscript and G. Cacialli for
significant contributions to the bibliography.
Literature cited
Ellis MB, Ellis JP. 1988. Microfungi on miscellaneous substrates. Croom Helm, London & Sydney.
Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17:
754-755. http://dx.doi.org/10.1093/bioinformatics/17.8.754
Johnston PR. 1990. Rhytismataceae in New Zealand 3. The genus Hypoderma. New Zealand J. Bot.
28: 159-283.
Johnston PR, Park D. 2005. Chlorociboria (Fungi, Helotiales) in New Zealand. New Zealand Journal
of Botany 43: 679-719. http://dx.doi.org/10.1080/0028825X.2005.9512985
Lantieri A. 2009. A new species of Hypoderma (Ascomycota) from Italy. Sydowia 61(2): 267-272.
Lantz H, Johnston PR, Park D, Minter DW. 2011. Molecular phylogeny reveals a core clade of
Rhytismatales. Mycologia 103: 57-74. http://dx.doi.org/10.3852/10-060
Medardi G. 2006. Atlante fotografico degli Ascomiceti d'Italia. A.M.B. Centro Studi Micologici,
Vicenza (Italy).
Nylander JAA. 2004. MrModeltest v2. Program distributed by the author. Evolutionary Biology
Centre, Uppsala University.
Petrak FE 1943. Fungi. Denkschriften der Akademie der Wissenschaften Mathematische-
Naturwissenschaftliche Klasse 105(2): 9-26.
Powell PE. 1974. Taxonomic studies in the genus Hypoderma (Rhytismataceae). Unpublished PhD
thesis, Cornell University.
Hypoderma siculum sp. nov. (Italy) ... 401
Ronquist F, Huelsenbeck JP. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Scalia G. 1900. I funghi della Sicilia orientale e principalmente della regione Etnea (Prima serie).
Atti dell’ Accademia Gioenia di Scienze Naturali di Catania, 4. ser., 13: 1-55.
Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive
multiple sequence alignment through sequence weighting, position-specific gap penalties and
weight matrix choice. Nucleic Acids Res. 22: 4673-4680.
http://dx.doi.org/10.1093/nar/22.22.4673
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.403
Volume 118, pp. 403-410 October-December 2011
Tuber sinoalbidum and T. polyspermum — new species from China
Li FAN’ CHENG-LIN Hou! & JIN-ZHONG Cao?
' College of Life Science, Capital Normal University,
Xisanhuanbeilu 105, Haidian, Beijing 100048, China
? Institute of Mycology, Jilin Agricultural University, Changchun 130118, China
CORRESPONDENCE TO *: [email protected]
ABSTRACT — Two new Tuber species from China are described and illustrated. Tuber
sinoalbidum is recognized by its white mid to large sized ascocarps and spinulose-reticulate
ascospores, while T: polyspermum is characterized by Tuber lyonii-like ascospores and smaller
brown ascomata. A molecular study based on the ITS sequences supports the erection of the
two new species.
Key worps — Ascomycota, Tuberaceae, truffle
Introduction
Tuberis a genus of ascomycetous fungi that form ectomycorrhizae with shrubs
and trees. Species of the genus have been extensively studied because many
form edible hypogeous ascocarps — the truffles. Some of these are renowned
for their flavor and are commercially important, with the two European species,
T; magnatum Picco and T: melanosporum Vittad., commanding the highest
prices. Other species harvested include T! aestivum Vittad., T: borchii Vittad.,
T: gibbosum Harkn., and T. indicum Cooke & Massee (Hall et al. 2007). Over the
past two decades the harvest and sale of the Chinese black truffle, T. indicum,
has increased dramatically and has become a significant source of income for
the local farmers who live in the mountainous truffle-producing regions. The
two new Tuber species we describe here are based on specimens collected by
these local farmers.
Materials and methods
Morphological studies
Fresh fruiting bodies were collected from Kunming, Yunnan and Panzhihua City,
Sichuan and deposited in BJTC (Herbarium Biology Department, Capital Normal
404 ... Fan, Hou & Cao
TABLE 1. Specimens used in molecular studies and GenBank accession numbers.
SPECIES VOUCHER SPECIMEN ITS
Tuber aestivum AF516788
AY226042
Tuber huidongense BJTC FAN104 JF9261163
DQ486032
Tuber lyonii EU394704
EU268568
Tuber polyspermum BJTC FAN131 JF9261165
Tuber rufum Picco DQ329375
FM205665
Tuber sinoalbidum BJTC FAN105 JF9261164
Tuber spinoreticulatum Uecker & Burds. FJ80988
FJ74891
Tuber taiyuanense B. Liu GU979033
DQ478662
Tuber umbilicatum Juan Chen & P.G. Liu FJ797880
FJ797879
GU979031
University). The macroscopic characteristics were described from both fresh and
rehydrated specimens. The microscopic characteristics are described from razor-blade
sections of the specimens mounted in 3% KOH, Melzer’s reagent, or cotton blue. For
scanning electron microscopy (SEM), ascospores were scraped from dried gleba of the
fruit bodies and mounted in distilled water on a cover glass. After air drying the cover
glasses were directly attached to a SEM stub with doubled-sided tape, and then coated
with gold-palladium. The treated materials were examined and photographed with a
Hitachi S-4800 SEM.
Molecular methods
Herbarium samples were crushed by shaking for 3 min at 30 Hz (Mixer Mill MM 301,
Retsch, Haan, Germany) in a 1.5 ml tube together with one 3 mm in diameter tungsten
carbide ball. Total genomic DNA was then extracted using the PeqLab E.Z.N.A._Fungal
DNA kit following the manufacturer's protocol. The ITS region was amplified with
PCR using the primers ITS1/ITS4 (White et al. 1990). PCR was performed in 50 ul
reactions containing DNA template 2 ul, primer (10 uM/L) 2 ul each, 2x Master Mix
(Tiangen Biotech (Beijing) Co. Ltd.) 25 ul. PCR reactions were run as follows: an initial
denaturation at 95 °C for 3 min, followed by 30 cycles at 95 °C for 2 min, 55 °C for 25 s,
72 °C for 2 min, and a final extension at 72 °C for 10 min. The PCR products were sent
to Invitrogen Biotechnology Co. Ltd. (Beijing, China) for purifying, sequencing, and
editing. The other sequence data of ITS rDNA included in this study were downloaded
from GenBank. GenBank numbers are shown in TABLE 1.
Phylogenetic analyses
DNA sequences were aligned with Clustal X (Thompson et al. 1997). The alignment
was manually adjusted with Se-Al v.2.03a (Rambaut 2000). The aligned dataset was
analyzed with maximum parsimony (MP) using PAUP*4.0b10 (Swofford 2002).
Tuber sinoalbidum e& T. polyspermum spp. nov. (China) ... 405
Tuber umbilicatum FJ797880
99
97 Tuber umbilicatum FJ797879
100 Tuber umbilicatum GU979031
Tuber taiyuanense GU979033
71
Tuber taiyuanense DQ478662
Tuber lyonii EU394704
100
Tuber lyonii EU268568
ii6 Tuber huidongense DQ486032
Tuber huidongense JF921163
Tuber sinoalbidum JF921164
97 Tuber rufum DQ329375
Tuber rufum FM205665
100 hé Tuber spinoreticulatum FJ809884
Tuber spinoreticulatum FJ748914
Tuber polyspermum JF921165
Tuber aestivum AF516788
Tuber aestivum AY226042
Fic. 1. Phylogeny derived from maximum parsimony analysis of the ITS rDNA sequences of some
Tuber species with spiny and spinulose-reticulate ornamentation on the ascospore surface, using
T. aestivum as outgroups. Bootstrap values of more than 70% from 1000 replications are shown
above the respective branches.
Maximum parsimony analysis was conducted using heuristic searches with 1000
replicates of random-addition sequence, tree bisection reconnection (TBR) branch
swapping algorithm. All characters were equally weighted and unordered. Gaps were
treated as missing data to minimize homology assumptions. A bootstrap (BS) analysis
was performed with 1000 replicates, each with 10 random taxon addition sequences.
TBR branch swapping was employed.
406 ... Fan, Hou & Cao
Results
Molecular phylogenetics
The maximum parsimony analysis of sequences resulted in one most
parsimonious tree (Fic. 1) with a length (TL) = 1082 steps, consistency index
(CI) = 0.7126, retention index (RI) = 0.7347, homoplasy index (HI) = 0.2874,
and rescaled consistency index (RC) = 0.5731.
Phylogenetic analyses of ITS sequences revealed that all cited species
with light colored ascomata and spiny and spinulose-reticulate ascospore
ornamentations grouped together with a bootstrap support value of 100%.
Tuber polyspermum was placed as a distinct clade in the genus. The sequence
of T: sinoalbidum and two sequences of T: huidongense were grouped in a clade
but with a lower BS support.
Taxonomy
Tuber polyspermum L. Fan & C.L. Hou, sp. nov. FIGs. 2-7
MycoBank MB 519840
Ascomata brunnea vel griseo-brunnea, 0.5-1.5 cm diam, glabra vel subglabra, basi
umbilicata. Peridium 150-200 um crassum, strato exteriore pseudoparenchymato et strato
interiore ex hyphis intricatis instructum. Gleba solida, brunnea vel purpureo-brunnea,
venis albis. Asci 65-85 x 45-60 um, 1-4(-5) spori. Ascosporae ellipsoideae, brunneae vel
flavo-brunneae, 25-37.5(-45)x 20-25(-30) um, spineae vel spineo-reticulatae.
Type: China. Yunnan Province, Kunming, hypogeous, under soil of Pinus yunnanensis
Franch., 20 Dec. 2002, Jin-zhong Cao 2002112001 (Holotype, BJTC FAN131).
EryMo.oecy: polyspermum (Lat.) refers to the large number of ascospores in the
ascomata.
AscoMATa subglobose, 0.5-1.5 cm in diam., usually with an umbilicate
depression at the base, brown to gray-brown when fresh, surface smooth. Odor
pungent when fresh. PERrp1uM 150-200 um in thickness, composed of two
layers; outer layer 50-100 um thick, pseudoparenchymatous, composed of
subglobose or subangular, light brown cells 7.5-15(-20) um in diam.; inner
layer 100-150 um thick, textura intricate, composed of interwoven hyphae with
hyaline, thin-walled cells 2.5-5 um broad. GLEBA brown or purple brown at
maturity, veins white, large and rare, containing a great number of spores. ASCI
globose to subglobose, 65-85 x 45-60 um, sessile or with a short stalk, 1-4
(-5) spored. Ascospores ellipsoid, hyaline at first, brown or yellow brown at
maturity, short spiny or spinulose-reticulate, 25-37.5 (-45) x 20-25 (-30) um
excluding the ornamentation, ornamentations up to 2.5-3 um high, meshes
closed or unclosed, regular to irregular, 5-8 across the spore width.
ComMMENTs — Tuber polyspermum is almost indistinguishable from the
American species T: lyonii Butters in both macro- and micro-morphological
characteristics except for small differences in the shape of the ascomata (more
Tuber sinoalbidum & T. polyspermum spp. nov. (China) ... 407
Fics 2-7. Tuber polyspermum (BJTC FAN131, holotype). 2. Ascocarps. 3. Ascospore observed
under the light microscope. 4-5. Asci and ascospores observed under the light microscope.
6-7. Ascospore observed under the scanning electronic microscope.
or less umbilicate in T’ polyspermum) and the color of the gleba (darker in
T. polyspermum). It is clear that these differences alone are insufficient to erect a
new species. However, the molecular analysis showed that the Chinese material
did not group in the same clade with T. lyonii, and instead was in a clade of its
own (Fic. 1). Because of this and the clear geographic separation between Asia
408 ... Fan, Hou & Cao
and North America, we here treat the Chinese material as a new species that is
similar to, but distinct from, T°: lyonii.
A very interesting characteristic of T: polyspermum is the very large number
of ascospores in the mature ascomata in the type specimen, especially in the
dried specimens, when compared with other Tuber species. ‘The specific epithet
“polyspermum’ refers to this.
Tuber sinoalbidum L. Fan & J.Z. Cao, sp. nov. Fics. 8-12
MycoBank MB 519841
Ascomata albida, 2-4.5 cm diam., subglobosa vel globosa. Peridium 200-250 um crassum,
strato exteriore pseudoparenchymato et strato interiore ex hyphis intricatis instructum.
Gleba solida, griseo-albida, veins albis. Asci 45-60 x 60-80 um, 1-4(-5) spori. Ascosporae
ellipsoideae, brunneae vel flavo-brunneae, 25-37.5(-45) x 17.5-25(-30) um, spineo-
reticulatae.
Type: China. Sichuan Province, Panzhihua City, hypogeous, under soil in forest, 31 Dec.
2007, De-fu Liu (Holotype, BJTC FAN105).
EryMo toy: sinoalbidum (Lat.) refers to a whitish Tuber species from China.
ASCOMATA hypogeous, globose or subglobose, 2-4.5 cm in diam., white
to whitish when fresh, surface smooth to very fine verrucose. Odor light.
PERIDIUM 200-250 um in thickness, composed of two layers; outer layer
50-100 um thick, pseudoparenchymatous, composed of subglobose or subangular
light brown colored cells 7.5-12.5 um in diam.; inner layer 150-200 um thick,
textura intricate, composed of interwoven hyphae with hyaline, thin-walled
cells 2.5-5 um broad. GLEBA white, pale white or grey white at maturity, veins
white at first and light brown at maturity, narrow and numerous. Asci globose
or subglobose, 45-60 x 60-80 tum excluding the stalk, stalk 8-20 x 3-5 um long,
1-4(-5) spored. Ascosporgs ellipsoid to broad ellipsoid, hyaline at first, brown
or yellow brown at maturity, spinulose-reticulate, 25-37.5(-45) x 17.5-25(-30)
um excluding the ornamentation, ornamentations up to 3.5-5(-7.5) um high,
meshes 4-6 across the spore width.
ADDITIONAL SPECIMEN EXAMINED: CHINA. YUNNAN PROVINCE, Kunming, from
market, 17 Dec. 2005, Jin-zhong Cao (BJTC FAN101).
ComMENtTs —Tuber huidongense Y. Wang, a common endemic species in
Sichuan and Yunnan (Deng et al. 2009), is similar to T. sinoalbidum in ascospore
ornamentation, but differs in having brown ascomata when fresh, and a
blackish colored gleba at maturity. Also T. huidongense ascomata are normally
small, rather than medium to large as in T! sinoalbidum. The phylogenetic
analysis (Fic. 1) also shows that while T: huidongense groups in a clade with
T. sinoalbidum, the bootstrap support value is low. This indicates they are
closely related but clearly separate. Therefore, we conclude that T: sinoalbidum
is a distinct species.
Tuber sinoalbidum e& T. polyspermum spp. nov. (China) ... 409
Fics 8-12. Tuber sinoalbidum (BJTC FAN105, holotype). 8. Ascocarps. 9-10. Asci and
ascospores observed under the light microscope. 11-12. Ascospore observed under the
scanning electronic microscope.
410 ... Fan, Hou & Cao
The color of T’ sinoalbidum when fresh is similar to that of T’ magnatum
and T: latisporum Juan Chen & P.G. Liu, but they can be separated easily from
the new species by the typical reticulate ascospore ornamentations in both
T. magnatum and T. latisporum (Riousset et al. 2001; Chen & Liu 2007).
Acknowledgments
The study was supported by NSFC (No. 30770005, 30870008). We are grateful to
Prof. Wen-Ying Zhuang and Dr. Ian R. Hall for serving as the pre-submission reviewers.
We also thank Prof. Ying-Ren Lin for critically correcting the Latin diagnoses.
Literature cited
Chen J, Liu PG. 2007. Tuber latisporum sp. nov. and related taxa, based on morphology and DNA
sequence data. Mycologia 99: 475-481. http://dx.doi.org/10.3852/mycologia.99.3.475
Chen J, Liu PG, Wang Y. 2005. Tuber umbilicatum, a new species from China, with a key to the
spinose-reticulate spored Tuber species. Mycotaxon 94: 1-6.
Deng XJ, Chen J, Yu FQ, Liu PG. 2009. Notes on Tuber huidongense (Tuberaceae, Ascomycota), an
endemic species from China. Mycotaxon 109: 189-199. http://dx.doi.org/10.5248/109.189
Hall IR, Brown G, Zambonelli A. 2007. Taming the truffle: the history, lore, and science of the
ultimate mushroom. Timber Press, Portland. 304 p.
Rambaut A. 2000. Estimating the rate of molecular evolution: incorporating non-contemporaneous
sequences into maximum likelihood phylogenies. Bioinformatics 16: 395-399.
http://dx.doi.org/10.1093/bioinformatics/16.4.395
Riousset L, Riousset G, Chevalier G, Bardet MC. 2001. Truffles d'Europe et de Chine. Institut
National de la Recherche Agronomique, Paris. 181 p.
Swofford DL. 2002. PAUP”, phylogenetic analysis using parsimony. (*and other methods), version
4. Sunderland, MA, USA, Sinauer Associates.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The CLUSTALX windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res. 24: 4876-4882. http://dx.doi.org/10.1093/nar/25.24.4876
Trappe JM, Jumpponen AM, Cazares E. 1996. NATS truffle and truffle-like fungi 5: Tuber lyonii
(= T. texense), with a key to the spiny-spored Tuber species groups. Mycotaxon 60: 365-372.
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR Protocols: a Guide to
Methods and Applications. Academic Press, San Diego.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.411
Volume 118, pp. 411-422 October-December 2011
Hymenochaete in China. 2. A new species and three new records
from Yunnan Province
SHUANG-HuI HE” & HalI-Jiao LI
Institute of Microbiology, P.O. Box 61, Beijing Forestry University, Beijing 100083, China
CORRESPONDENCE TO *: [email protected]
ABSTRACT — A new species and three new Chinese records of Hymenochaete are reported:
H. yunnanensis sp. nov., H. fulva, H. spathulata, and H. sphaerospora. They were all collected
from Caiyanghe Nature Reserve, Yunnan Province, southwestern China. Hymenochaete
yunnanensis (in sect. Hymenochaete) is characterized by setal hyphae and heavily encrusted
hyphae and hymenial cells. Complete descriptions with illustrations are provided for the four
species.
Key worps — Hymenochaetaceae, taxonomy, wood-inhabiting fungi
Introduction
Because of the abundant woody plants and the complex topography, the
diversity of wood-inhabiting fungi is extremely high in Yunnan Province and
adjacent areas of southwestern China. During the last decade, the porioid wood-
inhabiting fungi in these areas have been intensively investigated and many
papers were published (Cui et al. 2011; Dai & Zhou 2000, Dai et al. 2007, Dai
2010, 2011a; Niemela et al. 2001; Yu et al. 2008; Yuan & Dai 2008a,b). However,
the corticioid wood-inhabiting fungi in these areas have not been sufficiently
studied. The corticioid genus, Hymenochaete Lév., is one of the most important
genera in the Hymenochaetaceae. Although it has been studied by several
mycologists (Dai 2010, 2011b; Maekawa & Zang 1995; Xu et al. 2003; Zhang &
Dai 2005), the genus has not yet been systematically studied in southwestern
China.
Caiyanghe Natural Reserve, located in southern Yunnan Province, is one of
the famous nature reserves in China because it is a transitional area from the
tropical to the subtropical zone with the altitude ranging from 980-1707 m.
The main vegetation type is a monsoon evergreen broadleaf forest, comprising
412 ... He & Li
mainly species of Castanopsis, Lithocarpus and Schima (Jing & Chen 2007). In
the summer of 2011, an intensive survey of wood-inhabiting fungi in Caiyanghe
and Xishuangbannan Natural Reserve, southern Yunnan Province, was carried
out and more than 130 Hymenochaete specimens were collected. Among
these specimens, Hymenochaete yunnanensis is identified as a new species. In
addition, H. fulva, H. spathulata and H. sphaerospora are found in China for the
first time. Illustrated descriptions of these species are provided in this paper.
Materials & methods
Voucher specimens are deposited in the herbarium of Beijing Forestry University
(BJFC), and the microscopic procedure follows He (2010). In the text the following
abbreviations are used: L = mean spore length (arithmetical average of all spores), W =
mean spore width (arithmetical average of all spores), Q = variation in the L/W ratios
between the specimens studied (quotient of the mean spore length and the mean spore
width of each specimen), n = the number of spores measured from given number of
specimens. In presenting the size range of spores, 5% of the measurements were excluded
from each end of the range, and the measurements were given in parentheses. IKI stands
for Melzer’s reagent, KOH for 5% potassium hydroxide, and CB is the abbreviation of
Cotton Blue. IKI- = inamyloid and nondextrinoid, CB- = acyanophilous. Special color
terms follow Petersen (1996).
Taxonomy
Hymenochaete yunnanensis S.H. He & Hai J. Li, sp. nov. Fics. 1-2
MycoBANnkK MB 563149
Carpophorum effusum vel effuso-reflexum, laxe adnatum. Cortex, tomentum et stratum
hypharum adsunt. Hymeniis et hyphae cum resinaceus granulum encrustatae. Setosum
hyphae adsunt. Setae 40-75(-80) x 6-7(-9) ums, porae ellipsoideae, 5-6.5(-6.8) x (2.8-
)3-3.5(-3.8) um.
Type: China. Yunnan Prov., Puer, Caiyanghe Nat. Res., alt ca. 1200 m, on fallen
angiosperm branch, 9 VI 2011 He 709 (holotype, BJFC).
ETYMOLOGY: yunnanensis, refers to its type locality of Yunnan Province, China.
FruiTBopy: Annual, effused or effused-reflexed with slightly elevated margins,
loosely adnate, easily detached, coriaceous, brittle when dry, first as small
colonies, later confluent, resupinate part up to 8 cm long or more in longest
dimension, reflexed part projecting up to 0.3 cm, 180-300 um thick in section.
Pileal surface rust-brown to dark brown, silky, tomentose, curving down when
dry. Hymenophore smooth or with scattered tubercles, grayish brown to clay-
buff, usually covered with many yellowish resinous matters, not cracked or with
few deep crevices when dry; resupinate margin thinning out, distinct, silky,
fimbriate, yellowish to yellowish brown when juvenile, becoming indistinct or
slightly elevated, concolorous with hymenium when mature.
Hymenochaete yunnanensis sp. nov. (China) ... 413
Fic. 1. Basidiocarps of Hymenochaete yunnanensis (He 709, holotype).
HyYPHAL STRUCTURE: Hyphal system subdimitic; generative hyphae without
clamp connections; tissue darkening but otherwise unchanged in KOH.
SUBICULUM: Cortex, tomentum and hyphal layer present. Cortex composed
of strongly agglutinated hyphae, 20-50 um thick. Generative hyphae hyaline
to yellowish brown, thin- to thick-walled, septate, moderately branched,
sometimes collapsed, more or less interwoven and agglutinated, usually heavily
encrusted with resinous matters, 2-4 um in diam. Skeletoids with distinctly
thickened walls, reddish brown, rarely septate and branched. Setal hyphae
(embedded setae) frequently present, up to 200 um long.
STRATIFIED HYMENIUM: Hyphae in this layer similar to those in subiculum,
hyaline, thick-walled, agglutinated, uprightly arranged, 2.5-4.5 um in diam.
Setal layer thickening, composed of several rows of overlapping setae. Setae
numerous, subulate or fusiform, reddish brown, with an acute tip, projecting
up to 45 um above the hymenium, 40-75(-80) x 6-7(-9) um. Hymenial cells
usually heavily encrusted with resinous matters. Cystidia and hyphidia absent.
Basidia clavate, with four sterigmata and a simple septum at base, 12-20 x
3.8-5 um; basidioles in shape similar to basidia, but slightly smaller.
Basipiosporss ellipsoid, some with tapering apex, hyaline, thin-walled,
smooth, IKI-, CB-, 5-6.5(-6.8) x (2.8-)3-3.5(-3.8) um, L = 5.79 um, W = 3.16
um, Q= 1.79-1.87 (n = 60/2).
414 ... He & Li
Fic. 2. Microscopic structures of Hymenochaete yunnanensis (drawn from the holotype).
a: Basidiospores. b: Basidia and basidioles. c: Setae. d: Setal hyphae. E: Hyphae from subiculum.
Hymenochaete yunnanensis sp. nov. (China) ... 415
ADDITIONAL SPECIMENS EXAMINED: CHINA. YUNNAN PRov., Puer, Caiyanghe Nat.
Res., alt ca. 1200 m, on fallen angiosperm twig, 9 VI 2011 He 690 (BJFC).
REMARKS: Hymenochaete yunnanensis belongs to sect. Hymenochaete (presence
of cortex, hyphal layer and setal layer; Léger 1998) and is characterized by the
presence of setal hyphae and the heavily encrusted hyphae and hymenial cells.
Usually the hymenial cells are so heavily encrusted that the resinous compounds
form numerous yellowish dots on the hymenophore surface.
Microscopically, the new species is very close to H. ulmicola Corfixen &
Parmasto; however, H. ulmicola differs in growing in the bark fissures of old
living Ulmus trees and in having thicker, harder and smaller basidiocarps and
slightly larger basidiospores (5.5-7.5 x 3-4 um; Corfixen & Parmasto 2005).
Another similar species, H. colliculosa (Sacc.) Parmasto, can be distinguished
from the new species by its larger setae (80-110 x 7.5-11 um) and basidiospores
(5.5-7.5 x 3.6-4.8 um; Parmasto 2005). Hymenochaete fulva also has encrusted
hyphae, but differs from H. yunnanensis in the yellowish brown basidiocarps,
broadly ellipsoid basidiospores (5-6 x 3.2-4 um), and absence of setal hyphae
(Parmasto 2001).
Hymenochaete fulva Burt, Ann. Mo. Bot. Gard. 5: 354, 1918 Fics. 3-4
Fruitsopy: Annual, effused, closely adnate, coriaceous, first as small
colonies, later confluent up to 8 cm or more in longest dimension, 150-300
um thick. Hymenophore smooth, cinnamon-brown, yellowish brown or clay-
Fic. 3. A basidiocarp of Hymenochaete fulva (He 620).
416... He & Li
a
ieee
5 yum
ile
10 pm
OE PEN,
10 pm
DD ASS
SF
Fic. 4. Microscopic structures of Hymenochaete fulva (drawn from He 620).
a: Basidiospores. b: Basidia and basidioles. c: Setae. d: Hyphae from subiculum.
Hymenochaete yunnanensis sp. nov. (China) ... 417
buff, azonate, not cracked or sometimes with numerous deep crevices; margin
thinning out, distinct, paler than hymenophore surface, yellowish brown.
HyPHAL STRUCTURE: Hyphal system monomitic; generative hyphae without
clamp connections; tissue darkening but otherwise unchanged in KOH.
SUBICULUM: Tomentum absent; cortex and hyphal layer present. Cortex
composed of strongly agglutinated hyphae, 10-20 um thick. Generative hyphae
hyaline to yellowish brown, thick-walled with a wide lumen, some lightly or
heavily encrusted with yellowish brown resinous granules, frequently septate,
moderately branched, loosely interwoven, 2.5-5 um in diam.
STRATIFIED HYMENIUM: Hyphae in this layer similar to those in subiculum,
yellowish to yellowish brown, thick-walled, more or less agglutinated,
interwoven, 2-4.8 um in diam. Crystals occasionally present in the hymenium.
Setal layer composed of 1-3 rows of overlapping setae. Setae numerous, reddish
brown, subulate, sometimes enmeshed with a hyphal sheath, with an acute tip,
projecting up to 80 um above the hymenium, 60-100(-110) x 7-10(-11) um.
Hyphidia absent, encrusted cystidia-like hyphal ends present. Basidia clavate,
with four sterigmata and a simple septum at base, 15-22 x 4-5 um; basidioles
in shape similar to basidia, but slightly smaller.
Spores: Basidiospores broadly ellipsoid, hyaline, thin-walled, smooth,
usually bearing a large guttule, IKI-, CB-, (4.8-)5-6 x 3.5-4 um, L = 5.43 um,
W = 3.82 um, Q = 1.40-1.44 (n = 60/2).
SPECIMENS EXAMINED: CHINA. YUNNAN PRov., Puer, Caiyanghe Nat. Res., alt ca. 1400
m, on fallen angiosperm twig, 6 VI 2011 He 620 & 640.
REMARKS: Hymenochaete fulva belongs to sect. Hymenochaete and _ is
characterized by its yellowish brown basidiocarps, encrusted hyphae, and
broadly ellipsoid basidiospores. The “cystidia” of the species cited by Burt
(1918) and Léger (1998) are actually encrusted hyphal ends (Parmasto 2001).
Hymenochaete fulva has also been reported in Mexico and Jamaica (Parmasto
2001). The species is close to H. rhododendricola S.H. He & Hai J. Li and H.
rhabarbarina (Berk.) Cooke; however, both species differ from H. fulva in their
encrusted setae and absence of cortices (He & Li 2011a; Parmasto 2001).
Hymenochaete spathulata J.C. Léger, Bull. Soc. Mycol. Fr. 96: 409,
1981 [“1980"] FIGs. 5-6
Fruitsopy: Annual, effused, closely adnate, coriaceous, first as small
colonies, later confluent up to 20 cm or more in longest dimension, 180-280 um
thick. Hymenophore smooth, pale mouse-gray to light vinaceous gray, azonate,
not cracked; margin thinning out, distinct, whitish, fimbriate when juvenile,
becoming indistinct, concolorous with hymenophore surface when mature.
HyYPHAL STRUCTURE: Hyphal system monomitic; generative hyphae without
clamp connections; tissue darkening but otherwise unchanged in KOH.
A418 ... He & Li
Fic. 5. Basidiocarps of Hymenochaete spathulata (He 685).
SUBICULUM: Tomentum and hyphal layer absent. Cortex locally present,
thin, composed of strongly agglutinated hyphae.
STRATIFIED HYMENIUM: Generative hyphae hyaline to yellowish brown,
thin- to thick-walled with a wide lumen, densely interwoven, 1.8-3.6 um in
diam. Setal layer thickening, composed of several rows of overlapping setae.
Setae scattered, reddish brown, spathulate, with an obtuse tip, usually lightly
encrusted with crystals at the tip, projecting up to 50 um above the hymenium,
65-100 x 8-13 um. Cystidia and hyphidia absent. Basidia clavate, with four
sterigmata and a simple septum at base, 12-16 x 3.5-4 um; basidioles in shape
similar to basidia, but slightly smaller.
Sporss: Basidiospores cylindrical to allantoid, hyaline, thin-walled, smooth,
IKI-, CB-, 6-7.1(-7.5) x 1.8-2.1 pm, L = 6.65 um, W = 1.98 um, Q = 3.36
(n= 30/1).
SPECIMENS EXAMINED: CHINA. YUNNAN PRov., Puer, Caiyanghe Nat. Res., alt ca. 1200
m, on fallen angiosperm twig, 9 VI 2011 He 685 & 704.
REMARKS: Hymenochaete spathulata is distinguished in the genus by its gray
basidiocarps, spathulate setae, and cylindrical to allantoid basidiospores (Léger
1998). Another species with round-tipped setae is H. ryvardenii Parmasto,
which differs from H. spathulata by thicker (< 800 um) basidiocarps and
larger ellipsoid basidiospores (6.5-8 x 3-3.6 um; Parmasto 2000). Previously
Hymenochaete yunnanensis sp. nov. (China) ... 419
1006
G00 2
) 0,0 ¢
10 pm
| ah iechoemmate
10 ym
Fic. 6. Microscopic structures of Hymenochaete spathulata (drawn from the He 685).
a: Basidiospores. b: Basidia and basidioles. c: Setae.
H. spathulata was known only from Gabon and the Central African Republic
(Léger 1998).
Hymenochaete sphaerospora J.C. Léger & Langq., Bull. Soc. Mycol.
Fr. 103: 48, 1987 Figs. 7-8
FruiTBopy: Perennial, effused, closely adnate, woody hard when dry,
confluent up to 20 cm or more in longest dimension, 250-400 um thick.
Hymenophore smooth, pale mouse-gray to grayish brown, azonate, not cracked
or finely cracked when dry; margin thinning out, distinct, fawn to cinnamon,
up to 2 mm wide.
HyPHAL STRUCTURE: Hyphal system monomitic; generative hyphae without
clamp connections; tissue darkening but otherwise unchanged in KOH.
SuBICULUM: Tomentum absent. Cortex and hyphal layer sometimes
present.
A420 ... He & Li
ore
Pi
Ot Te
Fic. 7. A basidiocarp of Hymenochaete sphaerospora (He 691).
STRATIFIED HYMENIUM: Generative hyphae hyaline to yellowish brown,
thick-walled, agglutinated, densely interwoven, 2-3 um in diam. Setal layer
thickening, composed of several rows of overlapping setae. Setae numerous,
reddish brown, subulate, encrusted with fine crystals in the upper part, with
an acute tip, projecting up to 40 um above the hymenium, 65-110 x 9-16(-19)
um. Cystidia absent. Simple hyphidia present. Basidia clavate or cylindrical,
with four sterigmata and a simple septum at base, 23-34 x 4.5-6 um; basidioles
in shape similar to basidia, but distinctly smaller.
Spores: Basidiospores broadly ellipsoid or subglobose, hyaline, thin-walled,
smooth, usually bearing a large guttule, IKI-, CB-, 5-6 x 4-5 um, L = 5.52 um,
W = 4.33 um, Q = 1.27 (n = 30/1).
SPECIMENS EXAMINED: CHINA. YUNNAN PRov., Puer, Caiyanghe Nat. Res., alt ca. 1200
m, on fallen angiosperm twig, 9 VI 2011 He 691 & 715.
REMARKS: Léger (1998) and Parmasto (2005) previously reported H. sphaerospora
from Africa. It is diagnosed by the gray basidiocarps, large encrusted setae,
and broadly ellipsoid or subglobose basidiospores. Hymenochaete macrospora
Y.C. Dai, which has similar basidiospores, differs from H. sphaerospora in the
brownish annual basidiocarps and smooth setae (Dai et al. 2000). The also
similar H. megaspora S.H. He & Hai J. Liis distinguished from H. sphaerospora
by its larger spores (7.5-10 x 5-7) and effused-reflexed basidiocarps (He & Li
2011b).
Hymenochaete yunnanensis sp. nov. (China) ... 421
5 ym
Pe aN
10 um
Fic. 8. Microscopic structures of Hymenochaete sphaerospora (drawn from He 691).
a: Basidiospores. b: Basidia and basidioles. c: Setae.
To date, 19 Hymenochaete species (including the four reported here) have been
reported from Yunnan Province (Maekawa & Zang 1995; Xu et al. 2003; Zhang
& Dai 2005).
Acknowledgments
The authors would like to express their deep thanks to Prof. Yu-Cheng Dai (Institute
of Applied Ecology, Chinese Academy of Sciences) and Dr Masoomeh Ghobad-Nejhad
(Botanical Museum, University of Helsinki) for serving as pre-submission reviewers.
This study was supported by the National Natural Science Foundation of China (No.
31000006), the Fundamental Research Funds for the Central Universities (No. YX2010-
22) and the Beijing Forestry University Young Scientist Fund (No. BLX2009023).
422 ... He & Li
Literature cited
Burt EA. 1918. The Thelephoraceae of North America. X. Hymenochaete. Annals of the Missouri
Botanical Garden 5: 301-372. http://dx.doi.org/10.2307/2989968
Corfixen P, Parmasto E. 2005. Hymenochaete ulmicola sp. nov. (Hymenochaetales). Mycotaxon 91:
465-469.
Cui BK, Du P, Dai YC. 2011. Three new species of Inonotus (Basidiomycota, Hymenochaetaceae)
from China. Mycological Progress 10: 107-114. http://dx.doi.org/10.1007/s11557-010-0681-6
Dai YC. 2010. Hymenochaetaceae (Basidiomycota) in China. Fungal Diversity 45: 131-343.
http://dx.doi.org/10.1007/s13225-010-0066-9
Dai YC. 2011la. Polypore diversity in China with an annotated checklist of Chinese polypores.
Mycoscience 52 http://dx.doi.org/10.1007/s10267-011-0134-3 (in press)
Dai YC. 2011b. A revised checklist of corticioid and hydnoid fungi in China for 2010. Mycoscience
52: 69-79. http://dx.doi.org/10.1007/s10267-010-0068-1
Dai YC, Zhou TX. 2000. A new species of Inonotus (Basidiomycotina) from Yunnan, southern
China. Mycotaxon 74: 331-335.
Dai YC, Zhang XQ, Zhou TX. 2000. Changbai wood-rotting fungi 12. Species of Hymenochaete
(Basidiomycota). Mycotaxon 75: 445-450.
Dai YC, Yu CJ, Wang HC. 2007. Polypores from eastern Xizang (Tibet), western China. Annales
Botanici Fennici 44: 135-145.
He SH. 2010. Hymenochaete (Hymenochaetales) in Hainan. Mycosystema 29: 835-839.
He SH, Li HJ. 2011a. Hymenochaete rhododendricola and H. quercicola spp. nov. (Basidiomycota,
Hymenochaetales) from Tibet, southwestern China. Nordic Journal of Botany 29(4): 484-487.
http://dx.doi.org/10.1111/j.1756-1051.2011.01217.x
He SH, Li HJ. 2011b. Two new species of Hymenochaete (Hymenochaetales) from China. Mycotaxon
115: 375-382. http://dx.doi.org/10.5248/115.375
Jing YB, Chen J. 2007. Evaluation of forest ecosystem service functions in Caiyanghe Nature
Reserve. Forest Resources Management 5: 87-91. [in Chinese]
Léger JC. 1998. Le genre Hymenochaete Léveillé. Bibliotheca Mycologica 171: 1-319.
Maekawa N, Zang M. 1995. Corticiaceous fungi (Aphyllophorales, Basidiomycotina) collected in
Yunnan, China. Bulletin of the National Science Museum, Series B, 21: 87-94.
Niemela T, Wagner T, Fischer M, Dai YC. 2001. Phellopilus gen. nov. and its affinities within
Phellinus s. lato and Inonotus s. lato (Basidiomycetes). Annales Botanicci Fennici 38: 51-62.
Parmasto E. 2000. New taxa and new combinations in hymenochaetoid fungi (Hymenomycetes).
Folia Cryptogamica Estonica 37: 55-66.
Parmasto E. 2001. Hymenochaetoid fungi (Basidiomycota) of North America. Mycotaxon 79:
107-176.
Parmasto E. 2005. New data on rare species of Hydnochaete and Hymenochaete (Hymenochaetales).
Mycotaxon 91: 137-163.
Petersen JH. 1996. Farvekort. The Danish Mycological Society’s colour-chart. Foreningen til
Svampekundskabens Fremme, Greve. 6 p.
Xu SZ, Zhou TX, Wang L, Yao XL, Zhai JW. 2003. A note on the species and new records of
Hymenochaete Lév in Yunnan. Journal of Southwest Forestry College 23: 53-58. [in Chinese]
Yu CJ, Li J, Dai YC. 2008. Two polypores from Yunnan new to China. Mycosystema 27: 145-150.
Yuan HS, Dai YC. 2008a. Polypores from northern and central Yunnan Province, Southwestern
China. Sydowia 60: 147-159.
Yuan HS, Dai YC, 2008b. Two new species of Junghuhnia (Basidiomycota, Polyporales), and a key to
the species of China. Nordic Journal of Botany 26: 96-100
Zhang XQ, Dai YC. 2005. Flora fungorum sinicorum, vol. 29, Hymenochaetaceae. Science Press,
Beijing, 205 p. [in Chinese]
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.423
Volume 118, pp. 423-431 October-December 2011
Lichenological notes 3: Sarcogyne plicata in California
KERRY KNUDSEN’ & JANA KOCOURKOVA?
"The Herbarium, Department of Botany and Plant Sciences, University of California,
Riverside, CA 92521-0124, U.S.A.
*Department of Ecology, Faculty of Environmental Sciences, Czech University of Life Sciences,
Prague, Kamycka 129, Praha 6 - Suchdol, CZ-165 21, Czech Republic
CORRESPONDENCE TO *: [email protected], [email protected]
ABSTRACT — Sarcogyne plicata, a California endemic, is revised and discussed. A taxon
referred to in the literature as Sarcogyne “privigna,” which looks similar to S. plicata and is
sympatric in California, is discussed. The name is considered invalid for the taxon.
KEY worps — Acarosporaceae, caliciphile, Joshua Tree National Park, nomenclature
Introduction
The type of Sarcogyne Flot. is S. corrugata Flot. (= S. clavus (DC.) Kremp.)
(Jorgensen & Santesson 1993). The genus currently comprises species with
lecideine apothecia with an excipulum of melanized (or even carbonized)
hyphae that lack any epihymenial accretions as are found in species currently
included in Polysporina Vézda. The exact number of species in the genus is
unknown, partly because the current generic circumscription is paraphyletic
(Reeb et al. 2004; Westberg, pers. comm.) and partly because many species
need revision or are known only from lost types (Knudsen & Standley 2007;
Lendemer et al. 2009b).
In North America we currently recognize 15 described Sarcogyne species.
Twelve species are known from collections made in the last 15 years: S. arenosa
(Herre) K. Knudsen & S.M. Standl. (Knudsen & Standley 2007; Lendemer et
al. 2009a), S. clavus (Magnusson 1935a, b; Harris & Ladd 2005; Knudsen &
Standley 2007), S. crustacea K. Knudsen & Kocourk. (Knudsen & Kocourkova
2010), S. dakotensis H. Magn. (Magnusson 1935b; Knudsen & Standley 2007),
S. desolata (H. Magn.) K. Knudsen & S.M. Standl. (Knudsen & Standley
2007), S. novomexicana H. Magn. (Knudsen & Lendemer 2005; Knudsen &
Standley 2007), S. plicata (Magnusson 1935b; Knudsen & Kocourkova 2009),
424 ... Knudsen & Kocourkova
S. “privigna” (Magnusson 1935a, b; Harris & Ladd 2005; Knudsen & Standley
2007), S. reebiae K. Knudsen (Knudsen & Standley 2007; Knudsen et al. 2011),
S. regularis Korb. (Knudsen 2007; Harris & Ladd 2005), S. similis H. Magn.
(Magnusson 1935b; Harris & Ladd 2005; Knudsen & Standley 2007), and
S. sphaerospora J. Steiner (Lendemer et al. 2009b). Three species are known
only from lost type collections: S. athroocarpa H. Magn., S. integra B. de Lesd.
ex H. Magn., and S. magnussonii B. de Lesd. (Magnusson 1935b; Knudsen &
Standley 2007). We have not seen any taxa fitting the descriptions of these three
species that could be used for neotypification.
Weare currently researching the biodiversity and taxonomy of the lichenized,
lichenicolous, and rock-inhabiting fungi of Joshua Tree National Park. In the
park, Sarcogyne plicata, originally described from California (Magnusson
1935b), is sympatric with S. “privigna.” Knudsen & Standley (2007) previously
treated S. plicata as a synonym of S. “privigna” because it was unclear how to
delimit many specimens from S. “privigna” as then interpreted (see discussion
below). Unpublished molecular work by Martin Westberg (Westberg, pers.
comm.) supported S. plicata as distinct from S. “privigna,” and we accepted both
species although we were still unclear how to differentiate the two (Knudsen &
Kocourkova 2009). In this paper we revise Sarcogyne plicata.
Materials & methods
Specimens were examined from COLO, FH, NY, UCR, and UPS. Specimens were
studied in hand sections using standard microscopy. Structures were examined in water
and KOH and measured in water. Amyloid reactions were tested with IKI. Hymenial
height does not include the height of the subhymenium, a valuable secondary character
in distinguishing some species. Thin-layer chromatography was performed by J.C.
Lendemer on Sarcogyne plicata, Knudsen 1230 (NY) (Culberson & Kristinsson 1970).
Images were captured using an Olympus DP20 digital camera with Microsuite Special
Edition. The illustrations were prepared using Adobe Photoshop. All measurements are
based on water mounts of hand cut sections unless otherwise indicated.
The species
Sarcogyne plicata H. Magn., Ann. Crypt. Exot. 7: 134 (1935). FIG. 1
Type: U.S.A. CALIFORNIA. SAN BERNARDINO Co., Upland. On plaster of wall. 17.11.1917,
I.M. Johnston s.n. (Holotype, FH!).
DESCRIPTION — Thallus endolithic to chasmolithic, sometimes visible between
granules of substrate or beneath apothecia as white cushion of plectenchyma.
Vegetative hyphae mostly 1-2 um in diam., cells mostly 4-5 um long, thin-
walled, I-, mixed with crystals of substrate, forming a gelatinized mass binding
the substrate, continuous with the hypothecium and excipulum hyphae, not
forming a distinct medulla. Algal layer usually scattered in substrate or not
observable, algae chlorococcoid 10-15 um in diameter.
Sarcogyne plicata in California (USA) ... 425
Fic. 1. Sarcogyne plicata (Knudsen 1230).
A. Apothecia. Scale = 1mm; B. Apothecia. Scale = 0,5 mm.
426 ... Knudsen & Kocourkova
Apothecia usually contiguous and apparently not dividing vegetatively,
dull black, epruinose, black when wetted, round, angular, to long and narrow
(then vaguely resembling an Opegrapha), the disc black, visible or obscure, not
turning red when wetted, often less than 0.5 um in diameter or in length, up to
1 mm. Surface of disc without epihymenial accretions as in Polysporina species
but rarely with an umbo, which is a remnant of the ontogeny of the apothecium.
Excipulum distinct, melanized, up to 100 um thick, outer layer dark (hyphae
not visible), inner layer to 40 um thick, golden yellow to red-brown, raising
above the disc and even hiding it when dry, not melanized beneath the disc,
sometimes swollen like labia, or in segments fused often at angles to each
other through compression. Hymenium 100-140 um tall, hyaline, I+ blue;
epihymenium golden yellow, to 15 um tall, thick, paraphyses septate, mostly
1.5-2.0 um tall, with oil drops, with moderate branching, upper three cells
sometimes becoming wider to 4 um, apices usually expanded up to 4 um, often
in pigment cap. Asci 70-85 x (17-)20-25 um, over 100 ascospores per ascus.
Ascospores hyaline, simple, 3-5 x 1-2 um, variable in size. Subhymenium
golden yellow, to 50-80 thick, I+ blue. Hypothecium continuous with attaching
hyphae, forming the base of apothecia, to 300 um thick, without algal layer.
Conidiomata not seen. No lichen substances found with TLC.
SELECTED SPECIMENS EXAMINED — U.S.A. CALIFORNIA. ORANGE Co., Santa Ana
Mountains, Fremont Canyon, on granite, 268 m, Sept. 22, 2008, K. Knudsen 10329
(UCR); on granite rocks eroded out of sandstone, 343 m, Dec. 6, 2007, K. Knudsen 9354
(UCR); 200 m, on conglomerate rock, Oct. 5, 3007, K. Knudsen 9004.2 (UCR); 956 m,
Sept. 18, 2008, K. Knudsen 10310 (UCR); RiveRsIDE Co., Wildomar, Menifee Hills, on
granite wall along seasonal stream, 558 m, Jan. 2, 2004, K. Knudsen 2124 (UCR); 635
m, granite drainages, Dec. 28, 2005, K. Knudsen 4837 (UCR); 543 m, crumbling granite
along stream, Oct. 14, 2009, K. Knudsen 11782 (UCR); Joshua Tree National Park:
Pleasant Valley, wash crossing Geology Tour Road, 1049 m, on flat granite rock, Dec.
3, 2010, K. Knudsen 12689 (UCR); Malapai Hill, south-facing base on granite rubble,
1165 m, Dec. 2, 201, K. Knudsen 12636.1 & 12636.2 (UCR); Squaw Tank, on dissected
decaying quartz dike on monzogranite dome, 1092 m, Dec. 4, 2010, K. Knudsen 12748
(UCR); desert between Skull Rock & Jumbo Rocks, 1347 m, on monzogranite, Dec.
19, 2010, K. Knudsen 13150 (UCR); San Jacinto Mountains, along Forbes Ranch Road,
on granite on pebble plain, 1651 m, March 26, 2006, K. Knudsen 5698 (UCR); SAN
BERNARDINO Co., Granite Mountains, above Granite Cove, along wash, 1335 m, on
granite slab, June 6, 2008, K. Knudsen 9687 (UCR); Joshua Tree National Park, Key’s
Ranch, 1267 m, on granite in washes, May 26, 2005, K. Knudsen 3041 w/ T. LaDoux
(UCR); San Gabriel Mountains, San Antonio Creek, in wash behind San Antonio Dam,
761 m, on hard granite boulders in flood plain, June 4, 2004, K. Knudsen 1230 (ASU,
MIN, NY, UCR); Santa Ana River Valley, base of San Bernardino Mountains, along
Greenspot Road, on granite boulders in floodplain, 533 m, May 1, 2006, K. Knudsen
5936 w/ M. Knudsen (UCR); Woolly Star Preserve, 327 m, on granite boulder, Feb. 7,
2011, K. Knudsen et al. 13570 (UCR); VENTURA Co., Santa Monica Mountains, Tri-
Peaks near Backbone Trail, 829 m, on Conejo volcanics, May 13, 2007, K. Knudsen
8397 (UCR); Yerba Buena Canyon area, 409 m, March 22, 2006, K. Knudsen 5623 w/ D.
Magney (UCR).
Sarcogyne plicata in California (USA) ... 427
ECOLOGY & DISTRIBUTION — Sarcogyne plicata is frequent in southern
California, often locally abundant, usually occurring on granite in drainages,
washes and flood plains, often a solitary pioneer in full sun, at elevations from
200 to 1651 meters. A few collections from the Santa Monica Mountains are
on Conejo volcanics. No populations have been found on calcareous rock.
It is currently considered endemic to California, occurring in the Mojave
Desert (Granite Mountains and Joshua Tree National Park) and in the coastal
mountains and foothills of southern California in the Peninsular Ranges
(Menifee Hills, Santa Ana Mountains, San Jacinto Mountains) and in the
Transverse Ranges (San Bernardino Mountains, San Gabriel Mountains, and
Santa Monica Mountains).
Discussion — A typical S. plicata specimen (Fic. 1) is quite distinctive from
S. “privigna” (Fic. 2), but many specimens can be quite similar. For instance, a
S. plicata thallus with many round apothecia may resemble S. “privigna,” while
a S. “privigna” thallus with many compressed apothecia may be identified as
S. plicata. While S. “privigna” usually has discs that appear red even when
dry, some thalli have mostly blackish apothecia. Fortunately S. “privigna”
“= Ss eo sas
o oleae
2 &
Fic. 2. Sarcogyne ‘privigna (Harris 42777).
Apothecia. Scale = 250 um.
428 ... Knudsen & Kocourkova
discs always turn red when dampened with water while S. plicata discs
remain black. Otherwise S. plicata has a taller hymenium (100-140 um) and
deeper subhymenium (50-80 um) than S. “privigna” (60-85 um and 30-40
um, respectively). One site where both species occurred was in Joshua Tree
National Park at Key's Ranch. The site has extensive monzogranite boulders
forming a maze of small alkaline washes, which commonly contain rock
crevices and fissures rich in calcium deposited during seasonal flooding and
subsequent evaporation. Sarcogyne “privigna” was common in these calcareous
microhabitats. Sarcogyne plicata was frequent in the more acidic microhabitats
found on the tops of monzogranite boulders that are not inundated during
flooding and thus lack calcium deposits. In areas of the Mojave Desert like
Cactus Flats (San Bernardino Mountains) or in the Clark Mountains, where
limestone predominates, S. “privigna” was abundant and no S. plicata was
collected.
The problem of Sarcogyne “privigna” auct., non (Ach.) A. Massal. Fia. 2
Lichenologists generally agree as to which taxon should be referred to
Sarcogyne “privigna” (for instance: Magnusson 1935a, b; Clauzade & Roux
1985; Golubkova 1988; Knudsen & Standley 2007; Seppelt et al. 1998; Fletcher
& Hawksworth 2009). However, the Acharius type of the basionym Lecidea
privigna Ach. 1803 (and thus Massalongo’s 1854 combination in Sarcogyne)
represents Polysporina simplex (Taylor) Vézda (Magnusson 1935a). The
Acharius types of the other possible basionym, Lecanora milvina var. privigna
Ach. 1810, appear to represent Polysporina simplex and/or an Acarospora. For
descriptions see Clauzade & Roux (1985), Magnusson (1935a, b), Knudsen &
Standley (2007), and Fletcher & Hawksworth (2009). Thus the S. “privigna”
now recognized by many authors does not have a validly published name
(Magnusson 1935a; Knudsen & Standley 2007).
Sarcogyne plicata is restricted to a small area within the range of the more
cosmopolitan S. “privigna”. As noted above S. “privigna,” can generally be
separated from the often similar to S. plicata based on its shorter hymenium
and shallower subhymenium. The species also sometimes retains a vestige
of apothecial development in the form of an umbo in the center of the disc
that usually eventually disappears. Also as noted above, the easiest way to
differentiate the two species is that S. “privigna” discs (usually red or red-orange
when dry) are brighter when wet, while the black S. plicata discs remain black
even when wet. The S. “privigna” pycnidia we observed were ca. 0.1-0.2 mm
diam., while conidia were simple, hyaline, and 1.0-2.0 x 0.5-1.0 um.
SELECTED SPECIMENS EXAMINED — CZECH REPUBLIC. Bouemia, Jeseniky, 500 m,
May 9, 1961, A. Vézda, Lichenes Selecti Exsiccati 95 (COLO); GREECE. RETHIMNO,
Mt. Psiloritis, on calcareous rock, 800 m, March 31, 1993, A. Nordin 3129 (UPS); Samos:
west end of the island, 156 m, on limestone, D.J. Hill s.n. (UCR); ITALY. LomBarpy,
Sarcogyne plicata in California (USA) ... 429
Bormio, 1250 m, on stone fence, July 24, 1927, A.H. Magnusson 10675 (UPS); NORWAY.
Troms, Storfjord Par., rocky slope, 60 m, on horizontal calcareous rock, Aug. 6, 2003,
A. Nordin 5633 (UPS); SLOVAKIA. Bratislavsky Svaty Jur, in vineyard, July 20, 1922,
A.H. Magnusson 6825 (UPS); SWEDEN. GoTLanD, Faré par., Gotska Sand6én, on
human bone, May 14, 1921, T. Vestergren (UPS); LycKsELLE LAPPMARK, Tarna par.,
520 m, Aug. 30, 1963, G.E. Du Rietz 675D (UPS); SODERMANLAND, Ostra Vingaker
par., on calcareous rocks, Aug. 11, 1913, A.H. Magnusson s.n. (UPS) VASTERGOTLAND,
Lerdala pars., Sparresater, on rocks in wood, July 12, 1934, A.LH. Magnusson 14261
(UPS); Meddelplana par., Hallekis, on gneiss, July 12, 1942, A.H. Magnusson 18214
(UPS); U.S.A. CALIFORNIA. Los ANGELES Co., Santa Monica Mountains, Hennessey,
south of Castro Crest, 445 m, on calcium carbonate accretions on sandstone, May 31,
2009, K. Knudsen 11169 (UCR); ORANGE Co., Santa Ana Mountains, Fremont Canyon,
587 m, on sandstone, Sept. 18, 2008, K. Knudsen 10303 (UCR); RIVERSIDE Co., Joshua
Tree National Park, Hexie Mountains, Stirrup Tank, 1040 m, on granite, Dec. 26, 2010,
K. Knudsen 13313 (UCR); base of Hexie Mountains at head of Fried Liver Wash, 983
m, rare on granite rocks along wash, Dec. 12, 2010, K. Knudsen 13013 (UCR); Ryan
Mountain, 1568 m, on small granite rock in drainage, Dec. 6, 2010, K. Knudsen 12842
(UCR); Sheep’s Pass, west-facing slope covered with rubble and pebbles, 1369 m, on
decaying granite, Dec. 20, 2010, K. Knudsen 13218 (UCR); Upper Juniper Flats, on soft
granite, 1497 m, Dec. 18, 2010, K. Knudsen 13107 (UCR); SAN BERNARDINO Co., Clark
Mountains, 1535 m, on limestone, Oct. 11, 2009, K. Knudsen 11768 w/ N. Pietrasiak
(UCR); Granite Mountains, canyon above Yucca Bajada camp, 1219 m, Oct. 20, 2007,
K. Knudsen 9391 (UCR); Joshua Tree National Park, Key’s Ranch, on monzogranite
in alkaline wash, 1283 m, Apr. 1, 2005, K. Knudsen et al. 2622 (UCR); San Bernardino
Mountains, Cactus Flats, 1905 m, common on calcareous rock, June 7, 2005, K. Knudsen
3284 (UCR); Bear Mountain, 2652 m, on dolomite, Aug. 25, 2005, K. Knudsen 1609 w/
C.L. Wagner (ASU, UCR); pebble plain along Polique Canyon Road, on granite rock,
2282 m, Aug. 25, 2011, Knudsen 13674 w/ S. Eliason (UCR); SAN DiEGo Co., Anza
Borrego, Sentenac Canyon, 677 m, on granite in drainage, Dec. 23, 2005, K. Knudsen
4832 et al. (UCR); Laguna Mountains, The Point, 1825 m, on vertical granite walls, June
2, 2004, K. Knudsen 1223 (ASU, UCR); SANTA BARBARA Co., Santa Rosa Island, bottom
of Dry Canyon, 96 m, on sandstone along seasonal stream, Oct. 24, 2008, K. Knudsen
10538 (UCR); GEorGIA. PUTNAM Co., Oconee National Forest, on sandstone, Sept.
16, 1996, W.R. Buck 30477 (NY); KANSAS. RUSSELL Co., west of Bunker Hill, 479 m,
on sandstone, June 25, 2007, C.A. Morse 15459A (KANU, UCR); KENTUCKY. HARLAN
Co., Profile Rock, 763 m, on sandstone, Sept. 16, 1991, R.C. Harris 27175 (NY); MAINE.
KENNEBEC Co., Mud Pond, disturbed area under power lines, Sept. 19, 1987, on granite,
R.C. Harris 20896 (NY). MARYLAND. ANNE ARINDEL Co., On Wishing Rock, Raritan
formation, Nov. 25, 1987, Clyde F. Reed (NY); FREDERICK Co., Sugar Loft Mountain,
on rocks along Mt. Ephram Rd., Apr. 19, 1962, Clyde E Reed (NY); Missourt.
CaRTER Co., bluff on e-side of Current River, on top of granite boulder, R.C. Harris
25629 (NY); Mapison Co., Castor River Shut-Ins Natural Area, on granite bedrock,
Oct. 21, 2001, R.C. Harris 45075, 45069-A (NY). NEw MExIco. SAN JUAN Co., Chaco
Canyon National Monument, 1090 m, on sandstone, Aug. 6, 1979, T.H. Nash III, 16362
(ASU); NoRTH CAROLINA. JACKSON Co., Cedar Cliff Mountains, Oct. 11, 1998, on
schist and gneiss, R.C. Harris 42777 (NY); OHIO. GALLIA Co., Wayne National Forest,
Symes Creek Natural Area, 215 m, May 21, 2006, on sandstone, W.R. Buck 50330 (NY);
PENNSLYVANNIA. BLAIR Co., Tussey Mountain, on sandstone talus, Apr. 22, 2008, R.C.
Harris 54291 (NY); FRANKLIN Co., Michaux State Park, n-slope of Rocky mountain,
c. 350 m, June 1, 2009, J.C. Lendemer 18182 (NY); LycoMiNG Co., Tioga State Forest,
430 ... Knudsen & Kocourkova
Algerine Swamp Natural Area, c. 548 m, May 14, 2009, on rock, J.C. Lendemer 16992
(NY); VERMONT. LAMOILLE Co., Smuggler’s Notch, rocks at base of a cliff, Sept. 21, 1985,
R.C. Harris 18222 (NY); WEsT VIRGINIA. GRANT Co., Shroud Ridge, on sandstone, 425
m, W.R. Buck 38252 (NY).
ECOLOGY & DISTRIBUTION — Sarcogyne “privigna” occurs on calcareous
rock as well as non-calcareous rock such as granite, gneiss, sandstone and
volcanic rock in drainages, washes, and flood plains potentially rich in calcium
carbonate deposited in the fissures of rocks during inundation and subsequent
evaporation. The species is widespread and found in Africa, Asia, Europe, North
America, Antarctica, and Australia (Fletcher & Hawksworth 2009; Golubkova
1988; Seppelt et al. 1998).
Acknowledgments
We thank our reviewers, T. Wheeler and M.G. Halici (Erciyes University, Turkey).
We thank J.C. Lendemer for photographs and TLC. The work of Kerry Knudsen was
supported by a co-operative agreement between UCR and the Joshua Tree National
Park. His visit to New York Botanical Garden was supported by an Academic Fellowship
from the Santa Monica Mountains Fund. The work of Jana Kocourkova was supported
financially by the KONTAKT II, Program of International Cooperation in Research
and Development for scientific cooperation between the CR and USA, LH 11057 from
Ministry of Education, Youth and Sports.
Literature cited
Clauzade G, Roux C. 1985. Likenoj de Okcidenta Europo. Ilustrita Determinlibro. Bulletin de la
Societe Botanique du Centre-Ouest, Nouvelle Serie, Numero Special 7. Royan, France. 893 pp.
Culberson CF, Kristinsson H. 1970. A standardized method for the indentification of lichen products.
Journal of Chromatography 46: 85-93. http://dx.doi.org/10.1016/S0021-9673(00)83967-9
Fletcher A, Hawksworth DL. 2009. Sarcogyne A. Massal. (1851). 829-830, in: CW Smith et al.
(eds.): The lichens of Great Britain and Ireland. British Lichen Society, Natural History Museum
Pub., UK.
Golubkova NS. 1988. The lichen family Acarosporaceae in the U.S.S.R. Komarov Botanical Institute,
Academy of Sciences of the U.S.S.R. (‘Nauka’), Leningrad. 136 pp.
Harris RC, Ladd D. 2005. Preliminary draft: Ozark lichens. Available at:
http://www.duke.edu/~bph8/Harris_and_Ladd_2005_Ozark_Lichens.pdf
Jorgensen PM, Santesson R. 1993. Nine proposals to conserve generic names of lichenized fungi.
Taxon 42(4): 881-887. http://dx.doi.org/10.2307/1223274
Knudsen K, Kocourkova J. 2009. Lichens and lichenicolous fungi of the northwestern Santa Ana
Mountains. Crossosoma 35(2): 66-81.
Knudsen K, Kocourkova J. 2010. Lichenological notes 1: Acarosporaceae. Mycotaxon 112: 361-366.
http://dx.doi.org/10.5248/112.361
Knudsen K, Lendemer JC. 2005. Changes and additions to the checklist of North American lichens
— III. Mycotaxon 93, 277-281.
Knudsen K, Standley SM. 2007. Sarcogyne. 289-296, in: TH Nash III et al. (eds.): Lichen flora of
the Greater Sonoran Desert Region. Volume 3. Lichens Unlimited, Arizona State University,
Tempe.
Sarcogyne plicata in California (USA) ... 431
Knudsen K, Lendemer JC, Harris RC. 2011. Studies in lichens and lichenicolous fungi - no. 15:
miscellaneous notes on species eastern North America. Opuscula Philolichenum 9: 45-75.
Lendemer JC, Kocourkova J, Knudsen K. 2009a. Studies in lichens and lichenicolous fungi: more
notes on taxa from North America. Mycotaxon 110: 373-378.
http://dx.doi.org/10.5248/110.373
Lendemer JC, Kocourkova J, Knudsen K. 2009b. Studies in lichens and lichenicolous fungi: more
notes on some taxa from North America. Mycotaxon 108: 491-497.
http://dx.doi.org/10.5248/108.491
Magnusson AH. 1935a. Acarosporaceae, Thelocarpaceae. 1-318, in: A Zahlbruckner (ed.):
Rabenhorst’s Kryptogamen-Flora von Deutschland, Osterreich, und der Schweiz, 2nd ed. Band
9, Abt. 5(1). Borntraeger, Leipzig.
Magnusson AH. 1935b. On the species of Biatorella and Sarcogyne in America. Annales de
Cryptogamie Exotique 7: 115-145.
Reeb V, Lutzoni FE, Roux C. 2004. Contribution of RPB2 to multilocus phylogenetic studies of
the euascomycetes (Pezizomycotina, Fungi) with special emphasis on the lichen-forming
Acarosporaceae and evolution of polyspory. Molecular Phylogenetics and Evolution 32:
1036-1060. http://dx.doi.org/10.1016/j.ympev.2004.04.012
Seppelt RD, Nimis PL, Castello M. 1998. The genus Sarcogyne (Acarosporaceae) in Antarctica.
Lichenologist 30(3): 249-258. http://dx.doi.org/10.1006/lich.1998.0135
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.433
Volume 118, pp. 433-440 October-December 2011
Homolaphlyctis polyrhiza gen. et sp. nov.,
a species in the Rhizophydiales (Chytridiomycetes)
with multiple rhizoidal axes
Joyce E. LONGCORE™, PETER M. LETCHER’ & TIMOTHY Y. JAMES?
'School of Biology & Ecology, University of Maine
5722 Deering Hall, Orono, ME 04469-5722, USA
*Department of Biological Sciences, The University of Alabama
Box 870344, Tuscaloosa, AL 35487 USA
*Department of Ecology & Evolutionary Biology, University of Michigan
830 North University, Ann Arbor, MI 48109-1048 USA
* CORRESPONDENCE TO: [email protected]
AxsstrRactT — An undescribed cellulosic chytrid with multiple rhizoidal axes, JEL142,
has grouped in molecular hypotheses with Batrachochytrium dendrobatidis, the chytrid
pathogen of amphibians, and thus is of interest for genetic and physiological comparisons.
To describe this member of the Rhizophydiales, we examined its zoospore ultrastructure and
developmental morphology. Based on a reanalysis of rDNA data plus ultrastructural and
morphological characters, we name this fungus Homolaphlyctis polyrhiza gen. et sp. nov.
Key worps — Chytridiomycota, phylogeny, Rhizophlyctis, TEM
Introduction
A chytrid referred to by its isolate number, JEL142, has been in phylogenies
since the first molecular hypotheses of the Chytridiomycota (James et al.
2000, 2006; Letcher et al. 2008b) but has not been identified to species or
received a formal name. This isolate is of interest because it groups as sister
to Batrachochytrium dendrobatidis Longcore et al. (Longcore et al. 1999), the
pathogen of amphibians, and because it is one of the few members of the
Rhizophydiales Letcher (Letcher et al. 2006) that have thalli with multiple
rhizoidal axes. Although the phylogenetic distance based on branch lengths
in phylograms is large and support values for the relationship have been low
(James et al. 2006; Letcher et al. 2008b), JEL142 seems to be the closest relative
to B. dendrobatidis now in culture. In an effort to identify genes that enable
434 ... Longcore, Letcher & James
B. dendrobatidis to be pathogenic, the genome of JEL142 has been sequenced
for comparison (Joneson et al. 2011). In this paper, we reanalyze the phylogenetic
placement of JEL142 and provide a description of the ultrastructure of its
zoospore and its developmental morphology. These analyses place isolate JEL142
in the Rhizophydiales, but outside of described families or genera. Therefore we
describe a new genus and species to accommodate isolate JEL142.
Materials & methods
We first observed this chytrid on onionskin bait (outer, dry bulb scales of white
onions) placed in a gross culture containing the aquatic plant Eriocaulon aquaticum,
associated debris and lake water in a deep Petri dish. The collection site was Mud Pond, a
small (1.7 ha), acidic (pH 4.6), oligotrophic and fishless lake in Hancock County, Maine
(Davis et al. 1994, Rhodes & Davis 1995). With standard methods (Barr 1986) we isolated
JEL142 into pure culture on modified PmTG nutrient agar (Longcore 1992). Since initial
isolation in 1994 this chytrid has grown on nutrient agar slants with transfers at three-
month intervals and storage at ~4 °C after growth. We collected zoospores from growth
on 20 mPmTG plates and fixed them for TEM with s-collidine buffered glutaraldehyde
followed by osmium tetroxide. Zoospores were rinsed, added to agar and en bloc stained
with uranyl acetate before embedment in epon araldite plastic (Barr 1981, Longcore
1992). Sections were examined at 60 kV. We photographed developmental morphology
of thalli grown on mPmTG nutrient agar with a Spot RT digital camera. Phylogenetic
analysis of Rhizophydiales was conducted using the initial alignments of 18S, 28S, and
5.88 rRNA subunits produced by James et al. (2006). Additional sequences were added
from Letcher et al. (2004, 2008b), and the alignment manually adjusted in MacClade
4.08 (Maddison & Maddison 1992). The phylogeny was estimated using maximum
likelihood in RAXML-7.0.4 (Stamatakis 2006) with 100 heuristic searches beginning
from random trees. Support for nodes was established by bootstrapping in RAxML (1000
pseudo-replicates) and Bayesian posterior probabilities in MrBayes v3.1.2 (Huelsenbeck
& Ronquist 2001).
Results
The phylogenetic analysis of Rhizophydiales based on combined 18S, 28S,
and 5.8S subunits provides strong support, 77 bootstrap percentage and
0.99 posterior probability, for a sister relationship between H. polyrhiza and
B. dendrobatidis (Fic. 1). These two species group with a strain identified as
Entophlyctis helioformis (JEL326), and this clade is sister to the other members
of the Rhizophydiales. As seen in previous studies, the phylogenetic distance
between H. polyrhiza and B. dendrobatidis is rather large as suggested by
branch lengths, and the percentage difference between rRNA sequences of the
two species is ~10%.
Homolaphlyctis polyrhiza gen. et sp. nov. ... 435
100/1.0 »MP8 Globomycetaceae clade
85/0.99 --., ARGO68 Globomyces pollinis-pini
ARG046 Pateramyces corrientinensis
JEL136 Rhizophydium brooksianum
JEL316 Rhizophydium clade
JEL223 Operculomyces laminatus
PL163L Coralloidiomyces digitatus
100/1.0--4. JEL171 Rhizophlyctis harderi
2 PLAUS21 Boothiomyces macroporosum
PLO8 Terramyces clade
97/1.0 ARGO008 Angulomyces argentinensis
61/0.99 ARG018 Aquamyces chlorogonii
ARGO71 Protrudomyces lateralis
PL98 Kappamyces laurelensis
a ARGO025 Alphamyces chaetiferum
100/1.0 JEL299 Gorgonomyces clade
83/1.0 ARG026 Gorgonomyces haynaldii
89/1.0 JEL174 Entophlyctis sp.
7710.99 JEL197 Batrachochytrium dendrobatidis
JEL142 Homolaphlyctis polyrhiza
/ JEL326 Entophlyctis helioformis
Si goue Perry UCB-91-10 Gaertneriomyces semiglobifer
62/0.96 ----J96/1.0 ATCC48900 Spizellomyces punctatus
JEL318 Rhizophlyctis rosea
JEL127 Nowakowskiella sp.
100/1.0 JELO6 Rhizoclosmatium globosum
ee 100/1.0 JEL30 Podochytrium dentatum
JEL129 Entophlyctis luteolus
JEL109 Polychytrium aggregatum
0.03
FiGurRE 1. Phylogeny of Rhizophydiales showing sister relationship between Homolaphlyctis
polyrhiza and Batrachochytrium dendrobatidis. The phylogeny was based on a combined
analysis of 18S, 28S and 5.88 ribosomal RNA subunits and was estimated using maximum
likelihood under a GTR+I+I model of evolution with RAxML-7.0.4 (Stamatakis 2006). Values
at nodes indicate support as estimated by maximum likelihood from 1,000 bootstrap pseudo-
replicates followed by Bayesian posterior probabilities. Only nodes receiving >60% bootstrap
support are labeled. Further strain details and GenBank accession numbers can be found in
James et al. (2006) and Letcher et al. (2004, 2008b).
Taxonomy
Homolaphlyctis Longcore, Letcher & T.Y. James, gen. nov.
MycoBank MB561579
Zoosporarum ultrastructura Rhizophydialium characteristica, constans ex microtubulis
separatis duo vel tres e kinetosomate ad rumposoma in globulo solitario extensorum;
microcorpus in latere interiore globuli lipoidei. Calcar kinetosomale et zona vesiculata
436 ... Longcore, Letcher & James
circum kinetosoma absunt. Mitochondrion lobatum. Vesiculae corde denso per cytoplasma
dispersae.
TYPE SPECIES: Homolaphlyctis. polyrhiza Longcore, Letcher & T.Y. James
EryMoLocy: Named for R.L. Homola in whose laboratory this work began, and A.D.
Homola, who helped collect the sample.
Zoospore ultrastructure typical for members of the Rhizophydiales, consisting
of stack of 2-3 separate microtubules leading from the kinetosome to a
rumposome on a single lipid globule; microbody on inner side of lipid.
Lacking kinetosome-associated spur and vesiculated area around kinetosome.
Mitochondrion lobed. Dense-cored vesicles throughout cytoplasm.
Homolaphlyctis polyrhiza Longcore, Letcher & T.Y. James, sp. nov. FIGS. 2, 3
MycoBank MB561580
Thallus axibus rhizoidalibus tres vel pluris extense dispersis. Papillae evacuationis
tubulosae numerosae, breves usque ad longae.
Type: Fic. 2a—-h (holotype) photographed from pure culture JEL142 isolated from
cellulosic substrate placed with a collection of Eriocaulon aquaticum collected from
Mud Pond, (44°38'00.26"N 68°05'15.81"W) Hancock County, Maine on 15 April 1994.
[GenBank DNA sequences: AH009051 (SSU rDNA); EF634247 (LSU rDNA); EF634249
(ITS1-5.8S-ITS2).]
Erymo.oey: The epithet refers to the multiple rhizoidal axes.
Thallus with three or more widely distributed rhizoidal axes. Multiple, short to
long tubular discharge papillae.
EXPANDED DESCRIPTION — ‘The generation time for H. polyrhiza on
mPmTG nutrient agar is 2-3 days at 23 °C. In motion, zoospores are spherical
(Fic. 2h, arrowhead) and contain a single lipid globule near the base of the
flagellum (Fic. 2a). They encyst and within 24 h form a thallus with multiple
rhizoidal axes (Fic. 2b). At maturity rhizoids can extend to more than twice
the diameter of the zoosporangium (Fic. 2c); distally rhizoids are fine (<0.5
um) and isodiametric, but near the thallus they are slightly swollen (Fic. 2d).
Zoosporangia form discharge papillae (Fics. 2e, f) within 52 hr, with the
number of papillae increasing with size of the zoosporangia. Papillae may be
barely raised (Fic. 2f), short tubes (Fic. 2e) or, in crowded conditions, long
tubes (Fic. 2g). Zoospores are elongate when discharged (arrows, Fic. 2h) but
soon become spherical (dia 3.5-4.5 um with flagellum up to 28 um).
ULTRASTRUCTURAL CHARACTERS — ‘The ultrastructure (Fics 3a-e) of
the H. polyrhiza zoospore is nearly identical to Barr's illustration of a typical
Rhizophydium zoospore (Barr & Hadland-Hartmann 1978). A membrane-
bound aggregation of ribosomes is in the center of the zoospore, outside of
which are the nucleus, a single lobed mitochondrion, and a single lipid globule
(Fics. 3a, b). A lobe of a mitochondrion is often anterior to the kinetosome
Homolaphlyctis polyrhiza gen. et sp. nov. ... 437
FiGuRE 2. Developmental morphology of Homolaphlyctis polyrhiza in pure culture on mPmTG
nutrient agar. a. Zoospores with single lipid globule, aggregated ribosomes and single posteriorly
directed flagellum. b. Young thallus with multiple rhizoidal axes (arrows). c. Nearly mature thallus
showing the extent of rhizoids. d. Rhizoidal bases (arrow) are enlarged. e. Papilla (arrowhead) on
nearly mature zoosporangium. f. Short, evenly spaced discharge papillae (arrowheads). g. Long
discharge papilla, nearly ready to release zoospores. Note breakdown of apical, hyaline papillar
material. h. Zoospores (arrows) elongate during discharge through papillar opening (arrowheads)
but become spherical shortly after release (large arrowhead). Scale bar in a, for all figures except c.
(Fic. 3a). The microbody is appressed to the side of the lipid globule toward the
center of the zoospore (Fic. 3b), and a rumposome (= fenestrated cisterna of
Letcher et al. 2004) is appressed to the lipid near the surface of the cell (Fic. 3b).
The non-flagellated centriole is parallel to the kinetosome and joined to it by a
bridge of partly overlapping fibers centrally located between the two structures
(Fras. 3c, d; arrow); the fibrils form a wide (>0.075 um) zone of convergence. The
non-flagellated centriole is shorter than its width (Fras. 3c, e). A microtubular
root, composed of separate, parallel microtubules, extends from the side of the
kinetosome to the rumposome (Fic. 3e). A terminal plate is in the lumen of
438 ... Longcore, Letcher & James
“aaa Sra h 4
tie ee ca $ “”
5 os OL =
Ficure 3. Ultrastructural features of Homolaphlyctis polyrhiza zoospores. a. Longitudinal section
of zoospore with nucleus (N); aggregated ribosomes (R); lobed mitochondrion (M); kinetosome
(K); non-flagellated centriole (nfc). b. Transverse section with lipid globule (L); microbody (mb);
rumposome (Ru); vacuole (Va); and vesicles (arrowheads). c. Longitudinal section of kinetosomal
region with kinetosomal props (P) and terminal plate (T). d. Cross section of kinetosome and
non-flagellated centriole with fibrillar connection and wide zone of convergence (arrow) between
the two structures. Microtubule root (mt) extends from the kinetosome. e. Longitudinal section
through the kinetosome and non-flagellated centriole; microtubules extend from the kinetosome
to the rumposome, shown in face view. Scale bar in b also for a; scale bar in c also for d-e.
the axoneme (Fic. 3c). Typical for members of the Rhizophydiales (Letcher et
al. 2006), a flagellar plug is absent from the transition region of the flagellum.
In the peripheral cytoplasm outside the central core are numerous, large
Homolaphlyctis polyrhiza gen. et sp. nov. ... 439
FiGurE 4. Summary diagram of zoospore ultrastructure of Homolaphlyctis polyrhiza.
Kinetosome (K); lipid globule (L); mitochondrion (M); microbody (mb); microtubule root
(mt); nucleus (N); nonflagellated centriole (nfc); prop (P); vacuole (Va); vesicle (Ve).
(~200 nm diameter) cored vesicles (Fic. 3b; arrowheads); a large vacuole is
often present. Ultrastructural features are summarized in Fic. 4.
ComMENTS — We found this saprobic organism only once, from an oligotrophic,
acidic lake. Based on descriptions of genera of the Chytridiales sensu Sparrow
(1960), it would have been placed in the genus Rhizophlyctis A. Fisch. because
it develops endogenously and has multiple rhizoidal axes. Molecular and
TEM evidence have altered our concept of the importance of morphological
characters (e.g., James et al. 2000, 2006; Mozley-Standridge et al. 2009) and
chytrids with endogenous development and multiple rhizoidal axes occur not
only in the Rhizophlyctidales (Letcher et al. 2008a) but also other orders of the
Chytridiomycetes, now including the Rhizophydiales.
Acknowledgments
This work was supported by NSF: PEET grant DEB-0529694, AFTOL grant DEB-
0732599 and REVSYS grant DEB-0516173. We thank Dr. James Pringle of the Royal
Botanical Garden, Ontario for translating the Latin description.
440 ... Longcore, Letcher & James
Literature cited
Barr DJS. 1981. Ultrastructure ofthe Gaertneriomyces zoospore (Spizellomycetales, Chytridiomycetes).
Can J Bot 59: 83-90. http://dx.doi.org/10.1139/b81-014
Barr DJS. 1986. Allochytridium expandens rediscovered: morphology, physiology and zoospore
ultrastructure. Mycologia 78: 439-448. http://dx.doi.org/10.2307/3793048
Barr DJS, Hadland-Hartmann VE. 1978. Zoospore ultrastructure in the genus Rhizophydium
(Chytridiales). Can J Bot 56: 2380-2404. http://dx.doi.org/10.1139/b78-290
Davis RB, Anderson DS, Norton SA, Whiting MC. 1994. Acidity of twelve northern New England
Lakes. J Paleolimn 12: 103-154. http://dx.doi.org/10.1007/BF00678090
Huelsenbeck JP, Ronquist F. 2001. MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics
17: 754-755. http://dx.doi.org/10.1093/bioinformatics/17.8.754
James TY, Porter D, Leander CA, Vilgalys R, Longcore JE. 2000. Molecular phylogenetics of the
Chytridiomycota supports the utility of ultrastructural data in chytrid systematics. Can J Bot 78:
336-350. http://dx.doi.org/10.1139/cjb-78-3-336
James TY, Letcher PM, Longcore JE, Mozley-Standridge SE, Porter D, Powell MJ, Griffith GW,
Vilgalys R. 2006. A molecular phylogeny of the flagellated fungi (Chytridiomycota) and
description of a new phylum (Blastocladiomycota). Mycologia 98: 860-871.
http://dx.doi.org/10.3852/mycologia.98.6.860
Joneson S, Stajich JE, Shiu S-H, Rosenblum EB. 2011. Genomic transition to pathogenicity in
chytrid fungi. PLoS Pathog 7(11): e1002338. http://dx.doi.org/ 10.1371/journal.ppat. 1002338
Letcher PM, Powell MJ, Chambers JG, Holznagel WE. 2004. Phylogenetic relationships among
Rhizophydium isolates from North America and Australia. Mycologia 96: 1339-1351.
http://dx.doi.org/10.2307/3762150
Letcher PM, Powell MJ, Churchill PE Chambers JG. 2006. Ultrastructural and molecular
phylogenetic delineation of a new order, the Rhizophydiales (Chytridiomycota). Mycol Res 110:
898-915. http://dx.doi.org/10.1016/j.mycres.2006.06.011
Letcher PM, Powell MJ, Barr DJS, Churchill PF, Wakefield WS, Picard KT. 2008a. Rhizophlyctidales
— anew order in Chytridiomycota. Mycol Res 112: 1031-1048.
http://dx.doi.org/10.1016/j.mycres.2008.03.007
Letcher PM, Powell MJ, Viusent MC. 2008b. Rediscovery of an unusual chytridiaceous fungus new
to the order Rhizophydiales. Mycologia 100: 325-334.
http://dx.doi.org/10.3852/mycologia.100.2.325
Longcore JE. 1992. Morphology, occurrence, and zoospore ultrastructure of Podochytrium
dentatum sp. nov. (Chytridiales). Mycologia 84: 183-192. http://dx.doi.org/10.2307/3760249
Longcore JE, Pessier AP, Nichols DK. 1999. Batrachochytrium dendrobatidis gen. et sp. nov., a
chytrid pathogenic to amphibians. Mycologia 91: 219-227. http://dx.doi.org/10.2307/3761366
Maddison WP, Maddison DR. 1992. MacClade: analysis of phylogeny and character evolution.
Sinauer, Sunderland, Mass.
Mozley-Standridge SE, Letcher PM, Longcore JE, Porter D, Simmons DR. 2009. Cladochytriales
— anew order in Chytridiomycota. Mycol Res 113: 498-507.
http://dx.doi.org/10.1016/j.mycres.2008.12.004
Rhodes TE, Davis RB. 1995. Effects of late Holocene forest disturbance and vegetation change on
acidic Mud Pond, Maine, USA. Ecology 76: 734-746. http://dx.doi.org/10.2307/1939340
Sparrow FK. 1960. Aquatic Phycomycetes (2"4 ed.). Ann Arbor, Michigan: The University of
Michigan Press.
Stamatakis A. 2006. RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with
thousands of taxa and mixed models. Bioinformatics 22: 2688-2690.
http://dx.doi.org/10.1093/bioinformatics/btl446
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.441
Volume 118, pp. 441-446 October-December 2011
Eutypella phaeospora, a new species on Chenopodiaceae
JACQUES FOURNIER’ & CHRISTIAN LECHAT”
’ Las Muros, F-09420 Rimont, France
? 64 route de Chizé, F-79360 Villiers en Bois, France
*CORRESPONDENCE TO: [email protected]
ABSTRACT — The authors describe a new species of Eutypella (Diatrypaceae, Xylariales) based
on several collections on Suaeda vera in France and one on Salsola vermiculata in Spain. The
Libertella-like asexual state was obtained in culture.
KEY worpDs — Ascomycota, taxonomy, salt marsh, disjunct distribution, semi-arid land
Introduction
An ascomycete referable to Eutypella (Nitschke) Sacc. was repeatedly
collected on Suaeda vera J.F. Gmel. (Chenopodiaceae), a woody shrub occurring
in salt marshes in Ile de Ré (France), and once on Salsola vermiculata L.
(Chenopodiaceae) in a semi-arid environment in northern Spain. Salt marshes
are known to be peculiar ecosystems in which halophytes associate with both
terrestrial and marine mycota (Barata 2002). Previous investigations have been
carried out mainly on monocots such as Juncus roemerianus (Kohlmeyer et
al. 1995), Spartina sp. (Gessner & Kohlmeyer 1976), S. alterniflora (Gessner
1977), and S. maritima (Barata 2002), but little attention has been paid to
woody shrubs.
Based on extensive collecting of ascomycetes in Ile de Ré, this Eutypella
appears to be somewhat common in salt marshes but was never encountered
on the island out of this biotope. However, its occurrence on S. vermiculata
in a very different environment in Spain suggests a stronger relationship to
Chenopodiaceae than to a specific ecological niche as first assumed.
As it is also remarkable in possessing ellipsoid brown ascospores, we decided
to describe it as new. A typically diatrypaceous anamorph obtained in culture
confirmed its placement in Diatrypaceae and a living culture was deposited in
CBS, allowing further phylogenetic investigations in the future.
442 ... Fournier & Lechat
Materials & methods
Macro and microscopic observations were carried out following Rappaz’s (1987)
methodology, especially by testing the reaction of subapical ring to Melzer’s reagent
after pre-treatment in 3% KOH and by making measurements of asci and ascospores in
heated lactic cotton blue. Micrographs of asci were taken in Lugol's solution (IKI), those
of conidiogenous structures and conidia were taken in dilute Waterman blue ink and
water. Cultures were made from single ascospores which were isolated on malt extract
agar (Difco™ Malt Extract Agar) according to Rossman’s (1999) method. The material
collected, along with duplicates of holotype, is kept in the the authors’ private herbaria
(JF and CLL numbers). The holotype is deposited in LIP herbarium (Lille) and cultures
at CBS.
Taxonomy
Eutypella phaeospora J. Fourn. & Lechat, sp. nov. PLATE 1
MyYCOBANK 561649
Ab alteribus speciebus generis Eutypella differt combinatione crescentiae in
Chenopodiaceae, ascosporarum ellipsoidearum et brunneorum et apiculi annuli leviter
amyloidei.
TyPeE: France, Charente Maritime: Ile de Ré, Loix, Le Feneau, edge of a salt marsh, on
dead or dying stems of Suaeda vera, 16 Apr. 2008, leg. MH, CLL & JF (Holotype, LIP
JF08078; ex-type culture, CBS129148).
Erymo oey: The epithet is derived from the unusual brown colour of ascospores.
STROMATA corticolous or lignicolous, pustulate, pustules 0.8-1.8 mm diam,
comprising 2-8 perithecia, irregularly scattered, separate to sometimes
confluent; in bark, stromata irregularly rounded, hardly raising the periderm,
under a conspicuous dorsal black line which is absent when the periderm
is tightly adherent, cortical tissue hardly altered, without differentiated
entostroma; in wood, stromata fully immersed to slightly raising wood surface,
elongated in the grain of wood, substrate not altered but surface more or less
blackened. OsTIOLEs emerging collectively as small bunches 0.5-1 mm diam,
shiny black, rectangular with cruciform apices and deeply sulcate sides, (80-)
150-840 um high, 210-290 um diam. PerirHeciA subglobose, 380-420
um diam, in contact, with short to long convergent necks. Ascr unitunicate,
thin-walled, long-pedicellate, the spore-bearing parts cylindrical to fusiform
PLATE 1. Eutypella phaeospora (holotype). A: Surface view of host bark showing bunches of ostioles
erumpent through the periderm. B: Cross section through a stroma in bark showing convergent
ostiolar necks. C-D: close-ups showing the stout cruciform ostioles. E: Cross section through a
stroma in wood showing convergent ostiolar necks. F: Mature and immature asci mounted in
Lugol’s solution showing the very faint reaction of apical ring. G: Ascospores mounted in lactic
cotton blue. H: Conidiophores, conidiogenous cells and conidia of the Libertella-like anamorph
mounted in dilute Waterman blue ink. I: Culture in Petri dish. J: Conidia in water.
Scale bars: A = 5 mm; B-C,E = 1 mm; D = 0.5 mm; F-H,J = 10 um; I= 1 cm.
Eutypella phaeospora sp. nov. ... 443
444 ... Fournier & Lechat
with a truncate apex, 35-40 um long x 7.5-8.5 um broad with a minute, very
inconspicuous subapical ring bluing in Lugol's solution or in Melzer’s reagent
after pre-treatment with 3% KOH, the stipes 30-35 um long, filiform, very
fragile. Paraphyses copious, persistent, hyphae-like, hyaline, septate, 4-5 tm at
base, tapering above asci. ASCOSPORES 6-7.5 x 3.4—4 um, oblong to ellipsoid-
equilateral with broadly rounded ends, brown, one-celled, smooth, obliquely
uniseriate to irregularly biseriate in the ascus.
ADDITIONAL SPECIMENS EXAMINED: FRANCE, CHARENTE MARITIME: Ars en Ré, edge
of a salt marsh, on dead or dying stems of Suaeda vera, 07 May 2007, leg. C. Lechat,
CLL7129. SPAIN, Navarra: Arguedas, 80 km south of Pamplona, on roadside in the
semi-desert of Bardenas Reales, 310 alt., on a dead corticated stem of Salsola vermiculata,
26 Sep. 2010, leg. Jean-Paul Priou, CLL10033.
ANAMORPH in culture: After two months on MEA, colony wrinkled, 2.5-3 cm
diam., 0.3-0.5 cm high, producing a Libertella-like anamorph, white at first,
then covered by greyish-white hyphal elements, white at margin, diffusing a
brown to blackish coloration in the medium; reverse side greyish-yellow in
the center, blackish at margin. Conidiophores branched, conidiogenous cells
cylindrical, producing holoblastic conidia 16-23(-—26) x 1.1-1.3 um, hyaline,
white en masse, cylindrical, tapered at ends, irregularly curved, e.g. curved on
upper third of length or regularly and strongly curved, produced in whitish
clusters on the median part of the colony.
Discussion
This ascomycete meets all the key features of the family Diatrypaceae Nitschke
in macromorphology, ascal morphology, and Libertella-like anamorph. It
only deviates in possessing ascospores that are ellipsoid and brown instead
of allantoid and yellowish as encountered in typical taxa. However, several
species in Anthostoma Nitschke, Cryptosphaeria Ces. & De Not., Diatrype
Fr. and Eutypella are known to have brown ascospores (Rappaz 1987, 1992),
and several of them —A. decipiens (DC.) Nitschke, C. subcutanea (Wahlenb.)
Rappaz, D. whitmanensis J. D. Rogers & Glawe, E. grandis (Nitschke) Sacc.,
E. corynostomoides (Rehm) Rappaz— produce such ellipsoid ascospores along
with broadly allantoid ones (Rappaz 1987).
The new taxon appears best accommodated in Eutypella as defined by
Rappaz (1987) based on its pustulate stromata with stout, converging ostiolar
necks. Although the recent ITS sequence analysis of Diatrypaceae by Acero et al.
(2004) showed that Eutypella as currently conceived is most likely polyphyletic,
those authors did not propose any formal taxonomic changes. We therefore
refer the present fungus to Eutypella and await further molecular studies that
might shed some light on its affinities within Diatrypaceae. A case was made
to reconsider its placement following Carmaran et al. (2006), who reinstated
Peroneutypa Berl. for taxa differing from Eutypella in ascal morphology.
Eutypella phaeospora sp. nov. ... 445
Although we did not use fluorescence microscopy to study the morphology of
asci in E. phaeospora, the ascal shape and subapical ring clearly point towards
type I as defined by the authors and therefore suggest a closer affinity with
Eutypella as currently accepted (Rappaz 1987).
Eutypella phaeospora can be readily distinguished from other Eutypella
species through its consistently ellipsoid brown ascospores and occurrence on
members of Chenopodiaceae. The usually uniseriate ascospore arrangement
in the ascus correlated with the cylindrical shape of its spore-bearing part is
likewise a distinctive feature contrasting with the spindle-shaped ascus most
often encountered in Diatrypaceae. The fungus seems to be a common saprobe
occurring on Suaeda vera in France and on Salsola vermiculata in Spain.
Eutypella kochiana Rehm and E. alsophila (Durieu & Mont.) Berl. (which
occur on Chenopodiaceae in marine environments) are worth notice here, but
their asci have a clearly amyloid subapical ring and their ascospores markedly
differ in being yellowish and allantoid. Eutypella kochiana var. salsolae Urries,
collected on Salsola vermiculata in Spain, resembles E. phaeospora in slightly
larger ascospores (4.8-8 x 1.8-2.2 um —vs. 4.8-6 x 1.5-1.8 um in E. kochiana)
that are sometimes oblong to broadly ellipsoid (Rappaz 1987). However that
variety still differs in having asci with a clearly amyloid subapical ring and
narrower, yellowish ascospores. The above collection of E. kochiana var. salsolae
does suggest that at least two different Eutypella species do occur on Salsola
vermiculata, whereas E. phaeospora is the only Eutypella species known thus
far to occur on Suaeda vera.
Based on many occurrences of E. phaeospora on S. vera in salt marshes
in Ile de Ré and absence inland, it was first assumed that the new species was
restricted to coastal environments. However, the material collected in Spain
from a very different environment —a semi-arid area far inland— points
towards a disjunct distribution not correlated with salt marshes. The fact that
Salsola vermiculata is an invasive shrub that can thrive in both coastal wetlands
and inland semi-arid areas may explain this apparent discrepancy. ‘Therefore,
it could be assumed that Eutypella phaeospora exhibits a strong preference
for Chenopodiaceae species regardless of ecological niche. Occurrence of
E. phaeospora on S. vermiculata in salt marshes is predictable but should be
confirmed by further sampling in coastal areas. Whether E. phaeospora occurs
on other members of Chenopodiaceae or possibly on other shrubs is likewise
still unknown, and it is hoped the morphological characterization given above
will help elucidate its apparently complex ecology.
Acknowledgements
The authors gratefully acknowledge Dr. Frangois Rappaz (Switzerland), Dr. Shaun
Pennycook (New Zealand), and Prof. Jack D. Rogers (USA) for their remarks and
valuable suggestions to improve the text, Michel Hairaud and Jean Paul Priou (France)
446 ... Fournier & Lechat
for help with collecting, and Dr. Marc Stadler (Germany) and Prof. Kevin D. Hyde
(Thailand) for help with literature.
Literature cited
Acero FJ, Gonzalez V, Sanchez-Ballesteros J, Rubio V, Checa J, Bills GF, Salazar O, Platas G, Peldez
EF, 2004. Molecular phylogenetic studies on the Diatrypaceae based on rDNA-ITS sequences.
Mycologia 96(2): 249-259. http://dx.doi.org/10.2307/3762061
Barata M. 2002. Fungi on the halophyte Spartina maritima in salt marshes. 179-193, in: KD Hyde
(ed.). Fungi in Marine Environments. Fungal Diversity Research Series 7.
Carmaran CC, Romero AI, Giussani LM. 2006. An approach towards a new phylogenetic
classification in Diatrypaceae. Fungal Diversity 23: 67-87.
Gessner RV. 1977. Seasonal occurrence and distribution of fungi associated with Spartina alterniflora
from Rhode Island estuary. Mycologia 69: 479-491. http://dx.doi.org/10.2307/3758551
Gessner RV, Kohlmeyer J. 1976. Geographical distribution and taxonomy of fungi from salt marsh
Spartina. Canadian Journal of Botany 54: 2023-2037. http://dx.doi.org/10.1139/b76-216
Kohlmeyer J, Volkmann-Kohlmeyer B, Eriksson O. 1995. Fungi on Juncus roemerianus. 2. New
dictyosporous ascomycetes. Botanica Marina 38: 165-174.
http://dx.doi.org/10.1515/botm.1995.38.1-6.165
Rappaz F. 1987. Taxonomie et nomenclature des Diatrypacées a4 asques octosporés, Mycologia
Helvetica 2(3): 285-648.
Rappaz E. 1992. Anthostoma decipiens et sa position systématique. Mycologia Helvetica 5: 21-32.
Rossman AY, Samuels GJ, Rogerson CT, Lowen R. 1999. Genera of Bionectriaceae, Hypocreaceae
and Nectriaceae (Hypocreales, Ascomycetes). Studies in Mycology 42: 1-248.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.447
Volume 118, pp. 447-453 October-December 2011
New combinations in Lactifluus. 1. L. subgenera Edules,
Lactariopsis, and Russulopsis
A. VERBEKEN’ , J. NUYTINCK' & B. BUYCK?
'Ghent University, Department of Biology, Research Group Mycology,
K.L. Ledeganckstraat 35, B-9000 Gent, Belgium
?Muséum National d’Histoire Naturelle, Dépt. Systématique et Evolution,
CP39, UMR7205, 12 Rue Buffon, F-75005 Paris, France
*CORRESPONDENCE TO: [email protected]
AsBsTRACT — In this first of a series of three papers, new combinations in the genus
Lactifluus are proposed. This paper treats the subgenera Edules, Lactariopsis, and Russulopsis
(all proposed here as new combinations in Lactifluus). In Lactifluus subg. Edules, eight
combinations at species level are proposed. In Lactifluus subg. Lactariopsis, the following
three new combinations are proposed at sectional level: Lactifluus sect. Lactariopsis with
seven newly combined species, L. sect. Chamaeleontini with eight newly combined species,
and L. sect. Albati with four newly combined species plus two species previously combined
in Lactifluus. Finally, in L. subg. Russulopsis, eight new combinations at species level are
proposed.
Key worps — milkcaps, nomenclature
Introduction
Multigene-based phylogenies of the Russulaceae show that Lactarius and
Russula, described by Persoon in 1797 and 1796 respectively, are not supported
as two monophyletic clades (Buyck et al. 2008). Russula appears to be
monophyletic only when a small group of species (R. subsect. Ochricompactae)
is removed. This small group of species, which forms a clade where Lactarius
and Russula are mixed, was described recently as the new genus Multifurca
Buyck & V. Hofst. (Buyck et al. 2008).
Apart from the representatives that belong to Multifurca, Lactarius divides
into two clades, a larger and a smaller one, and splitting the genus seems a
better solution than lumping everything in a giant genus Russula.
In a proposal to conserve Lactarius with a conserved type (Buyck et al.
2010), arguments were given to justify the conservation of Lactarius torminosus
448 ... Verbeken, Nuytinck & Buyck
(Schaeff.: Fr.) Pers. as the type of Lactarius. This has the advantage of retaining
the name Lactarius for the larger clade, so that only the smaller clade (containing
20% of the species) would require new combinations. Since most of the species
in the smaller clade are tropical, almost all temperate milkcaps would remain
in Lactarius.
The subgenera Lactarius subg. Piperites, Lactarius subg. Russularia, and
Lactarius subg. Plinthogalus would constitute the larger genus Lactarius
sensu novo, while the former subgenera Lactarius subg. Lactarius, Lactarius
subg. Lactariopsis, Lactarius subg. Russulopsis, Lactarius subg. Lactifluus, and
Lactarius subg. Gerardii, and the former section Lactarius sect. Edules would
constitute the genus Lactifluus (Pers.) Roussel.
The proposal (Buyck et al. 2010) was supported by the Nomenclatural
Committee for Fungi (Norvell 2011) and has been approved by the General
Committee and accepted by the 2011 International Botanical Congress (Barrie
2011, McNeill et al. 2011). This first paper proposes new combinations in
Lactifluus, recombinations of species from the subgenera Lactariopsis and
Russulopsis, and the section Edules.
Taxonomy
Lactifluus subg. Edules
Molecular phylogenies show that Lactarius sect. Edules is a well-supported,
monophyletic clade (Buyck et al. 2008). It is preferable to treat it at the subgenus
rank. Currently, this group consists of eight species, all endemic for tropical
Africa.
Lactifluus subg. Edules (Verbeken) Verbeken, comb. nov.
MycoBank MB 563158
= Lactarius section Edules Verbeken, Belg. J. Bot. 132: 176. 2000 (“1999”).
TYPE SPECIES: Lactarius edulis Verbeken & Buyck
Lactifluus aureifolius (Verbeken) Verbeken, comb. nov.
MycoBank MB 563150
= Lactarius aureifolius Verbeken, Bull. Jard. Bot. Belg. 65: 198. 1996.
Lactifluus densifolius (Verbeken & Karhula) Verbeken, comb. nov.
MycoBank MB 563151
= Lactarius densifolius Verbeken & Karhula, Bull. Jard. Bot. Belg. 65: 200. 1996.
Lactifluus edulis (Verbeken & Buyck) Buyck, comb. nov.
MycoBank MB 563152
= Lactarius edulis Verbeken & Buyck, Champ. Comest. Ouest Burundi: 103. 1994.
Lactifluus inversus (Gooss.-Font. & R. Heim) Verbeken, comb. nov.
MycoBank MB 563153
= Lactarius inversus Gooss.-Font. & R. Heim, Bull. Jard. Bot. Etat 25: 78. 1955.
Lactifluus combs. nov. and new subgenera ... 449
Lactifluus latifolius (Gooss.-Font. & R. Heim) Verbeken, comb. nov.
MycoBAnk MB 563154
= Lactarius latifolius Gooss.-Font. & R. Heim, Bull. Jard. Bot. Etat 25: 82. 1955.
Lactifluus nodosicystidiosus (Verbeken & Buyck) Buyck, comb. nov.
MycoBank MB 563155
= Lactarius nodosicystidiosus Verbeken & Buyck, Mycol. Res. 111: 794. 2007.
Lactifluus phlebophyllus (R. Heim) Buyck, comb. nov.
MycoBank MB 563156
= Lactarius phlebophyllus R. Heim, Candollea 7: 378. 1938.
Lactifluus roseolus (Verbeken) Verbeken, comb. nov.
MycoBAnk MB 563157
= Lactarius roseolus Verbeken, Bull. Jard. Bot. Belg. 65: 207. 1996.
Lactifluus subg. Lactariopsis
Three sections are recognized in this subgenus. One, L. sect. Lactariopsis, is
characterized by species with a distinct veil resulting from pseudoangiocarpic
development (Heim 1937) and is known only in tropical Africa and South
America. Lactifluus sect. Chamaeleontini also has its major distribution in
tropical Africa but contains some Asian species. Lactifluus sect. Albati is
mainly temperate with representatives from North America and Europe,
but some Asian species are also placed in this group. The molecular analyses
contradict the monophyly of L. subgenus Lactariopsis. Lactifluus sect. Albati is
an evolutionarily distinct group that is not closely related to L. sect. Lactariopsis
and L. sect. Chamaeleontini. The monophyly of both latter sections remains to
be further investigated. We provisionally maintain the traditional division of L.
subg. Lactariopsis in three sections here for practical reasons.
Lactifluus subg. Lactariopsis (Henn.) Verbeken, comb. nov.
MycoBank MB 563214
= Lactariopsis Henn., Bot. Jahrb. Syst. 30: 51. 1901.
= Lactarius sect. Lactariopsis (Henn.) Singer, Ann. Mycol
40: 111. 1942 (as “Lactariopsideae”).
= Lactarius subg. Lactariopsis (Henn.) R. Heim, Prodr.
Fl. Mycologique Madagascar 1: 36. 1938.
TYPE SPECIES: Lactariopsis zenkeri Henn.
Lactifluus sect. Lactariopsis Verbeken, sect. nov.
MycoBank MB 563215
Velum praesens distinctumque, annulum formans. Pileipellis et stipitipellis cum pilis
crassiparietini abundantes. Pseudopleurocystidia abundantia, fusiformia, emergentia.
TYPE SPECIES: Lactariopsis zenkeri Henn.
450 ... Verbeken, Nuytinck & Buyck
Lactifluus annulatoangustifolius (Beeli) Buyck, comb. nov.
MycoBank MB 563170
= Russula annulatoangustifolia Beeli, Bull. Jard. Bot. Etat 14: 87. 1936.
= Lactarius annulatoangustifolius (Beeli) Buyck, Bull. Jard. Bot. Belg. 59: 241. 1989.
Lactifluus annulifer (Singer) Nuytinck, comb. nov.
MycoBank MB 563171
= Lactarius annulifer Singer, Beih. Nova Hedwigia 77: 290. 1983.
Lactifluus heimii (Verbeken) Verbeken, comb. nov.
MycoBank MB 563172
= Lactarius heimii Verbeken, Bull. Jard. Bot. Belg. 65: 201. 1996.
Lactifluus neotropicus (Singer) Nuytinck, comb. nov.
MycoBank MB 563173
= Lactarius neotropicus Singer, Kew Bull. 7: 299. 1952.
Lactifluus pelliculatus (Beeli) Buyck, comb. nov.
MycoBANnkK MB 563174
= Armillaria pelliculata Beeli, Bull. Soc. Roy. Bot. Belgique 59: 111. 1927.
= Lactarius pelliculatus (Beeli) Buyck, Bull. Jard. Bot. Belg. 59: 142. 1989.
Lactifluus velutissimus (Verbeken) Verbeken, comb. nov.
MycoBank MB 563175
= Lactarius velutissimus Verbeken, Bull. Jard. Bot. Belg. 65: 212. 1996.
Lactifluus zenkeri (Henn.) Verbeken, comb. nov.
MycoBank MB 563176
= Lactariopsis zenkeri Henn., Bot. Jahrb. Syst. 30: 51. 1902 (“1901”).
= Lactarius zenkeri (Henn.) Singer, Ann. Mycol. 40: 111. 1942.
Lactifluus sect. Chamaeleontini (Verbeken) Verbeken, comb. nov.
MycoBank MB 563216
= Lactarius section Chamaeleontini Verbeken, Mycotaxon 66: 393. 1998.
TYPE SPECIES: Lactarius chamaeleontinus R. Heim
Lactifluus chamaeleontinus (R. Heim) Verbeken, comb. nov.
MycoBank MB 563217
= Lactarius chamaeleontinus R. Heim, Bull. Jard. Bot. Etat 25: 87. 1955.
Lactifluus emergens (Verbeken) Verbeken, comb. nov.
MycoBank MB 563218
= Lactarius emergens Verbeken, Syst. Geogr. Pl. 70(1): 192. 2000.
Lactifluus indusiatus (Verbeken) Verbeken, comb. nov.
MycoBank MB 563219
= Lactarius indusiatus Verbeken, Bull. Jard. Bot. Belg. 65: 201. 1996.
Lactifluus laevigatus (Verbeken) Verbeken, comb. nov.
MycoBank MB 563220
= Lactarius laevigatus Verbeken, Bull. Jard. Bot. Belg. 65: 203. 1996.
Lactifluus combs. nov. and new subgenera ...
Lactifluus leoninus (Verbeken & E. Horak) Verbeken, comb. nov.
MycoBank MB 563221
= Lactarius leoninus Verbeken & E. Horak, Austr. Syst. Bot. 12: 775. 1999.
Lactifluus madagascariensis (Verbeken & Buyck) Buyck, comb. nov.
MycoBank MB 563222
= Lactarius madagascariensis Verbeken & Buyck, Mycol. Res. 111: 791. 2007.
Lactifluus pruinatus (Verbeken & Buyck) Verbeken, comb. nov.
MycoBank MB 563223
= Lactarius pruinatus Verbeken & Buyck, Mycotaxon 66: 399. 1998.
Lactifluus sesemotani (Beeli) Buyck, comb. nov.
MycoBank MB 563224
= Russula sesemotani Beeli, Bull. Soc. Roy. Bot. Belgique 60(2): 169. 1928.
= Lactarius sesemotani (Beeli) Buyck, Bull. Jard. Bot. Belg. 59: 241. 1989.
Lactifluus sect. Albati (Bataille) Verbeken, comb. nov.
MycoBank MB 563735
= Lactarius [unranked] Albati Bataille, Fl. Monogr. Astéro.: 35. 1908.
= Lactarius subsect. Albati (Bataille) Konrad, Bull. Soc. Mycol. France 51: 188. 1935.
= Lactarius sect. Albati (Bataille) Singer, Ann. Mycol 40: 109. 1942.
TYPE SPECIES: Agaricus vellereus Fr. : Fr.
Lactifluus bertillonii (Neuhoff ex Z. Schaef.) Verbeken, comb. nov.
MycoBank MB 563226
= Lactarius vellereus var. bertillonii Neuhoff ex Z. Schaef., Ceska Mykol. 33: 9. 1979.
= Lactarius bertillonii (Neuhoff ex Z. Schaef.) Bon, Doc.
Mycol. 10(37-38): 92. 1980 (“1979”).
Lactifluus deceptivus (Peck) Kuntze, Revis. Gen. Pl. 2: 856. 1891.
= Lactarius deceptivus Peck, Annual Rep. New York State Mus. 38: 125. 1885.
Lactifluus pilosus (Verbeken, H.T. Le & Lumyong) Verbeken, comb. nov.
MycoBank MB 563227
= Lactarius pilosus Verbeken, H.T. Le & Lumyong, Mycotaxon 102: 287. 2007.
Lactifluus puberulus (H.A. Wen & J.Z. Ying) Nuytinck, comb. nov.
MycoBank MB 563228
= Lactarius puberulus H.A. Wen & J.Z. Ying, Mycosystema 24(2): 155. 2005.
Lactifluus subvellereus (Peck) Nuytinck, comb. nov.
MycoBank MB 563229
= Lactarius subvellereus Peck, Bull. Torrey Bot. Club 25: 369. 1898.
Lactifluus vellereus (Fr. : Fr.) Kuntze, Revis. Gen. Pl. 2: 857. 1891.
= Agaricus vellereus Fr. : Fr., Syst. Mycol. 1: 76. 1821.
= Lactarius vellereus (Fr. : Fr.) Fr., Epicr. Syst. Mycol.: 340. 1838.
451
452 ... Verbeken, Nuytinck & Buyck
Lactifluus subg. Russulopsis
Currently, this group comprises eight species, all endemic for tropical Africa.
All species are recombined in the genus Lactifluus here.
Lactifluus subg. Russulopsis (Verbeken) Verbeken, comb. nov.
MycoBank MB 563736
= Lactarius subg. Russulopsis Verbeken, Mycotaxon 77: 439. 2001.
TYPE SPECIES: Lactarius ruvubuensis Verbeken
Lactifluus sect. Russulopsidei (Verbeken) Verbeken, comb. nov.
MycoBank MB 563737
= Lactarius sect. Russulopsidei Verbeken, Mycotaxon 77: 440. 2001.
TYPE spEcIEs: Lactarius ruvubuensis Verbeken
Lactifluus brachystegiae (Verbeken & C. Sharp) Verbeken, comb. nov.
MycoBank MB 563230
= Lactarius brachystegiae Verbeken & C. Sharp, Syst. Geogr. Pl. 70(1): 187. 2000.
Lactifluus claricolor (R. Heim) Verbeken, comb. nov.
MycoBank MB 563231
= Lactarius claricolor R. Heim, Candollea 7: 381. 1938.
Lactifluus corbula (R. Heim & Gooss.-Font.) Verbeken, comb. nov.
MycoBank MB 563232
= Lactarius corbula R. Heim & Gooss.-Font., Bull. Jard. Bot. Etat 25: 64. 1955.
Lactifluus cyanovirescens (Verbeken) Verbeken, comb. nov.
MycoBank MB 563233
= Lactarius cyanovirescens Verbeken, Bull. Jard. Bot. Belg. 65: 199. 1996.
Lactifluus longipes (Verbeken) Verbeken, comb. nov.
MycoBank MB 563234
= Lactarius longipes Verbeken, Bull. Jard. Bot. Belg. 65: 203. 1996.
Lactifluus pseudotorminosus (R. Heim) Verbeken, comb. nov.
MycoBank MB 563235
= Lactarius pseudotorminosus R. Heim, Candollea 7: 379. 1938.
Lactifluus ruvubuensis (Verbeken) Verbeken, comb. nov.
MycoBank MB 563236
= Lactarius ruvubuensis Verbeken, Bull. Jard. Bot. Belg. 65: 208. 1996.
Lactifluus urens (Verbeken) Verbeken, comb. nov.
MycoBank MB 563237
= Lactarius urens Verbeken, Bull. Jard. Bot. Belg. 65: 211. 1996.
Acknowledgments
The authors acknowledge Lorelei Norvell, Shaun Pennycook, and Scott Redhead for
valuable comments.
Lactifluus combs. noy. and new subgenera ... 453
Literature cited
Barrie FR. 2011. Report of the General Committee: 11. Taxon 60: 1211-1214.
Buyck B, Hofstetter V, Eberhardt U, Verbeken A, Kauff F. 2008. Walking the thin line between
Lactarius and Russula: the dilemma of Russula sect. Ochricompactae. Fungal Diversity 28:
15-40.
Buyck B, Hofstetter V, Verbeken A, Walleyn R. 2010. Proposal to conserve Lactarius nom. cons.
(Basidiomycota) with a conserved type. Taxon 59(1): 295-296.
Heim R. 1937. Observations sur la flore mycologique malgache V. Les Lactario-Russulés a anneau:
ontogénie et phylogénie. Rev. Mycol. (Paris) 2: 4-17, 61-75, 109-117.
McNeill J, Turland NJ, Monro AM, Lepschi BJ. 2011. XVII International Botanical Congress:
Preliminary mail vote and report of Congress action on nomenclature proposals. Taxon 60:
1507-1520.
Norvell LL. 2011. Report of the Nomenclature Committee for Fungi: 16. Taxon 60: 223-226.
ISSN (print) 0093-4666 © 2011. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/118.455
Volume 118, pp. 455-458 October-December 2011
Validation of combinations with basionyms published by Fries
in 1861
Scott A. REDHEAD’, JOSEPH F. AMMIRATI’, LORELEI L. NORVELL’,
ALFREDO VIZZINI* & MARCO CONTU®
' National Mycological Herbarium, Eastern Cereal & Oilseed Research Centre C.E.F.,
Agriculture & Agri-Food Canada, Ottawa, Ontario, Canada, K1A 0C6
? Department of Biology, 351330, University of Washington, Seattle, WA 98195 USA
> Pacific Northwest Mycology Service,
6720 NW Skyline Boulevard, Portland, OR 97229-1309 USA
* Dipartimento di Biologia Vegetale, Universita degli Studi di Torino,
Viale Mattioli 25, I-10125, Torino, Italy
° Via Marmilla, 12 (I Gioielli 2), I-07026 Olbia (OT), Italy
* CORRESPONDENCE TO: [email protected]
Axstract — Authors (including some of us) have incorrectly cited as basionyms names
treated by Fries in 1863 that were actually originally published by him in 1861. As these
basionym citation errors mean that the intended new combinations are not validly published,
the following combinations are again proposed as new: Chromosera cyanophylla, Mythicomyces
corneipes, Tephrocybe misera, T. tesquorum. Three other intended combinations are noted as
also not validly published, but the species are currently treated under the different (and validly
published) names Haasiella venustissima, Phaeoclavulina curta, and Rhodonia placenta.
KEY worps — Ceriporiopsis, Gerronema, Ramaria, International Code of Botanical
Nomenclature
Introduction
Fries (1861) published a series of observations on new or little known
hymenomycetes from Sweden. Most of his new taxa were included again under
the same names in his MONOGRAPHIA HYMENOMYCETUM SUECIAE (Fries
1863). In his subsequently published HYMENOMYCETES EuROPAEI (Fries 1874),
Fries referred back only to the 1863 publication for each of the names originally
published in 1861. This has led to a series of citation errors by later authors and
indices, some of which affect the valid publication of proposed combinations.
456 ... Redhead & al.
In 1863, Fries did refer back to the 1861 publication as the source for
each of the names corrected below. Therefore the authors, who proposed the
new combinations after 1 January 1953 and who cited only the 1863 or later
publications, violated Articles 33.4 and 33.7 of the INTERNATIONAL CODE OF
BOTANICAL NOMENCLATURE (McNeill et al. 2006) and did not validly publish
their new combinations.
Under Art. 33.5 & 33.7(a), such citation errors are not correctable. Here we
validate the previously proposed binomials that are now generally accepted and
in current use, despite their current lack of status under the CopE (McNeill
et al. 2006). With one exception in Haasiella, we are unaware of incidental
subsequent validations.
Chromosera cyanophylla (Fr.) Redhead, Ammirati & Norvell, comb. nov.
MycoBank MB 563787
= Agaricus cyanophyllus Fr., Ofvers. K. Svensk. Vetensk.-
Akad. Forhandl. 18(1): 23 (1861).
Redhead et al. (1995) proposed the genus Chromosera Redhead, Ammirati &
Norvell, citing as type “Chromosera cyanophylla” and listing Fries (1863) (and
not the earlier Fries 1861) for the basionym. They did, however, list as obligate
synonyms three validly published names: Agaricus cyanophyllus Fr. (albeit with
the incorrect citation), Omphalia cyanophylla (Fr.) Quél. (Quélet 1872: 99),
and Omphalina cyanophylla (Fr.) Quél. (Quélet 1886: 45). This indication of
the type fulfilled the requirements for valid publication of the generic name
(Art. 37.2), but the incorrect citation did not meet the requirements for valid
publication of the binomial. Notably, the requirements for valid publication of
new combinations prior to 1953 were far more lenient.
Mythicomyces corneipes (Fr.) Redhead & A.H. Sm. comb. nov.
MycoBank MB 563788
= Agaricus corneipes Fr., Ofvers. K. Svensk. Vetensk.-Akad. Férhandl. 18(1): 25 (1861).
Similarly, Redhead & Smith (1986) proposed the genus Mythicomyces Redhead &
A.H. Sm., citing as type “Mythicomyces corneipes (Fries) comb. nov.’ They listed
as obligate synonyms two validly published names: the first, Agaricus corneipes
Fr., incorrectly cited Fries (1863), and the second was Psilocybe corneipes (Fr.)
P. Karst. (Karsten 1879: 504). These actions fulfilled the requirements for valid
publication of the generic name (Art. 37.2) but failed to meet requirements for
valid publication of the binomial, and so we publish it here.
Tephrocybe misera (Fr.) M.M. Moser ex Contu & Vizzini comb. nov.
MycoBank MB 563789
= Agaricus miser Fr., Ofvers. K. Svensk. Vetensk.-Akad. Férhandl. 18(1): 21 (1861).
Validation of Chromosera, Mythicomyces & Tephrocybe spp. ... 457
Tephrocybe tesquorum (Fr.) M.M. Moser ex Contu & Vizzini, comb. nov.
MycoBank MB 563790
= Agaricus tesquorum Fr., Ofvers. K. Svensk. Vetensk.-Akad. Férhandl. 18(1): 22 (1861).
Moser (1967) proposed two combinations in Tephrocybe but cited Fries (1863)
rather than (1861).
Notes on other cases of names not being validly published
Haasiella venustissima (Fr.) Kotl. & Pouzar ex Chiaffi & Surault, Bull. Soc. Mycol.
Fr. 112: 127 (1996).
= Agaricus venustissimus Fr., Ofvers. K. Svensk. Vetensk.-
Akad. Forhandl. 18(1): 21 (1861).
Kotlaba & Pouzar (1966) erected the genus Haasiella Kotl. & Pouzar, typified
by H. splendidissima Kotl. & Pouzar, and included a second species, for which
they proposed the combination “Haasiella venustissimus,” citing Fries (1863)
for the basionym. Their combination was inadvertently validated by Chiafhi &
Surault (1996), who cited the basionym and correct place of publication. The
proposed combination “Gerronema venustissimum” by Singer (1962) is not
validly published, as only Fries (1863) was cited.
Phaeoclavulina curta (Fr.) Giachini, Mycotaxon 115: 190 (2011).
= Clavaria curta Fr., Ofvers. K. Svensk. Vetensk.-Akad. Férhandl. 18(1): 31 (1861).
The intended combination in Ramaria by Schild (1994) was not validly
published because he referred only to Fries (1863) “Monogr. Hym. Suec.,”
which he mistakenly cited as “1857,” the date of the earlier parts of that title.
Giachini & Castellano (2011) correctly cited Fries (1861).
Rhodonia placenta (Fr.) Niemela, K.H. Larss. & Schigel, Karstenia 45(2): 79 (2005).
= Polyporus placenta Fr., Ofvers. K. Svensk. Vetensk.-Akad. Férhandl. 18(1): 30 (1861).
Domanski’s (1963) intended combination in Ceriporiopsis Domanski, where he
cites Fries (1874), was not validly published. Niemela et al. (2005) correctly
cited Fries (1861).
Acknowledgements
We thank Shaun Pennycook and John McNeill for reviewing the manuscript and
confirming that the genus Chromosera was validly published according to the ICBN even
though the earlier combination of Chromosera cyanophylla was not validly published.
Literature cited
Chiafhi M, Surault J-L. 1996. Une espéce rare et remarquable, Haasiella venustissima (Fr.) Kotl. &
Pouz. Bull. Soc. Mycol. France 112: 127-135.
Domaniski S. 1963. Dwa nowe rodzaje grzyboéw z grupy “Poria Pers. ex S.F. Gray”. Acta Soc. Bot.
Poloniae 32: 731-739.
458 ... Redhead & al.
Fries EM. 1861. Hymenomycetes novi vel minus cogniti, in Suecia 1852-1860 observati. Ofvers. K.
VetenskAkad. Forh. 18(1): 19-34.
Fries EM. 1863. Monographia Hymenomycetum Sueciae 2: [147]-355. Uppsala, CA Leffler.
Fries EM. 1874. Hymenomycetes Europaei sive Epicriseos systematis mycologici. Editio altera.
Upsaliae, E. Berling.
Giachini, AJ, Castellano MA. 2011. A new taxonomic classification for species in Gomphus sensu
lato. Mycotaxon 115: 183-201. http://dx.doi.org/10.5248/115.183
Karsten PA. 1879. Rysslands, Finlands och den Skandinaviska half6ns Hattsvampar. Forra Delen:
Skifsvampar. Bidr. Kann. Finl. Nat. Folk 32. XXVIII + 571 p.
Kotlaba F, Pouzar Z. 1966. Haasiella, a new agaric genus and H. splendidissima sp. nov. : Ceska
Mykologie 20: 135-140.
McNeill J, Barrie FF, Burdet HM, Demoulin V, Hawksworth DL, Marhold K, Nicolson DH, Prado
J, Silva PC, Skog JE, Wiersema J, Turland NJ (eds.) 2006. International code of botanical
nomenclature (Vienna Code). Adopted by the Seventeenth International Botanical Congress
Vienna, Austria, July 2005. Reg. Veget. 146: i-xvi, 1-568.
Moser M. 1967. Basidiomyceten II. Teil. Die ROhrlinge und Blatterpilze (Agaricales). Kleine
Kryptogamenflora, ed. 3, IIb/2. 443 p.
Niemela T, Kinnunen J, Larsson K-H, Schigel DD, Larsson E. 2005. Genus revisions and new
combinations of some North European polypores. Karstenia 45: 75-80.
Quélet L. 1872. Les champignons du Jura et des Vosges. Mém. Soc. Emul. Montbéliard, sér. II, 5:
43-332.
Queélet L. 1886. Enchiridion fungorum in Europa media et prasertim in Gallia vigentium. Lutetiae.
a5 2}
Redhead SA, Smith AH. 1986. Two new genera of agarics based on Psilocybe corneipes and
Phaeocollybia perplexa. Canad. Jour. Bot. 64: 643-647. http://dx.doi.org/10.1139/b86-082
Redhead SA, Ammirati JF, Norvell LL. 1995. Omphalina sensu lato in North America 3: Chromosera
gen. nov. Beih. Sydowia 10: 155-167.
Schild E. 1994. Ramaria-Studien Clavaria curta Fries (1857) eine eigene Art. Z. Mykol. 60: 123-130.
Singer R. 1962 (1961). Diagnoses fungorum novorum Agaricalium II. Sydowia 15: 45-83.
ISSN (print) 0093-4666 © 2011 Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/118.459
Volume 118, pp. 459-462 October-December 2011
BOOK REVIEWS AND NOTICES
ELSE C. VELLINGA, Book Review Editor*
861 Keeler Avenue, Berkeley CA 94708 U.S.A.
CORRESPONDENCE TO: [email protected]
INTRODUCTION
Three totally different books are reviewed here: a beautifully illustrated
French book on myxomycetes, an Indian book on the smut fungi of the
subcontinent, and a well-written, popular-science introduction to mushroom
forming fungi, succinctly titled ‘Mushroom,
Book announcements include the 2011 publications in the series ‘FUNGI
NON DELINEATI, a very nicely illustrated book on tropical fungi in China, anda
checklist for all fungi and myxomycetes of Rhode Island (U.S.A.).
MYXOMYCETES
Les myxomycetes. By M. Poulain, M. Meyer & J. Bozonnet, 2010. FMBDS, 8,
Avenue de la Plaine, 74000 Annecy, France, <[email protected]>. 2 vols,
pp. 1119, col. plates 544. ISBN 978-2-9518540-2-4. Price 159.00 €
As anyone who has ever studied myxomycetes knows, the monograph by Martin
and Alexopoulos, published by the University of Iowa Press in 1969, represents
the single most definitive treatment of this group of organisms published to date.
This monograph (THE MyxomyceteEs) has long since been out of print, but it
still remains—more than 40 years after it first appeared—the standard against
which any of the more recently published works on the myxomycetes are judged.
The two volumes that make up Les Myxomycétes undoubtedly represent the
most noteworthy recent contribution to the study of myxomycetes. Although
not totally comprehensive, since some species (particularly tropical examples)
are not included, this work covers virtually any species one is likely to encounter
“Books for consideration for coverage in this column should be mailed to the Book Review Editor
at the address above. All unsigned entries are by the Book Review Editor.
460 ... Vellinga, BOOK REVIEW EDITOR
during a lifetime of collecting. Information is provided on 853 taxa (species
and varieties), and 530 of these are illustrated with color images. These images
represent the most important feature of the work itself. Never before have so
many high-quality (often stunning) macroscopic color images been provided
for so many different myxomycetes. For anyone studying myxomycetes, this
alone is reason enough to obtain a copy of Les Myxomycetes. The first of the
two volumes begins with a short introduction to the biology, ecology and
morphology of myxomycetes. Since the primary language used throughout the
work is French, this information is not readily available to everyone. However,
the remainder of the first volume is devoted to keys and short descriptions
of the species being considered, and this material is presented in both French
and English, which is a major plus for those of us whose knowledge of the
former language is limited. The descriptions include both macroscopic as well
as microscopic characters, and reference is made to the number of the image
provided for a particular species in the second volume. ‘The first volume also
contains a glossary of terms, an index to all of the taxa being considered and a
list of relevant bibliographical references. The nomenclature used throughout
both volumes is that found in the current version of Nomenmyx (www.nomen.
eumycetozoa.com), which is generally followed by most of us who work with
myxomycetes.
The second volume contains the color images of the 530 taxa. The general
approach used throughout is to have each page devoted to a single image that
shows the habit of the species in question, but some pages contain several
images of the same species. Also included are line drawings that show various
microscopic structures (e.g., spores, capillitium and peridium) that are relevant
to that species. Altogether, the images, drawings and descriptions provide
enough information to allow most specimens of myxomycetes to be identified
with a high degree of certainty. Since the authors are especially well known
for their studies of nivicolous (“snowbank”) myxomycetes, there is extensive
coverage of this group. In fact, information on some of the nivicolous taxa
they have included in this work was available previously only in the primary
literature. The majority of the color images are truly outstanding, and the only
complaint that anyone might have is that in a few instances (e.g., Physarum
pusillum) the specimen photographed might not have been absolutely typical
for a given species. I found the images of the various species of Licea particularly
well done and thus potentially very useful when working with members of this
genus.
Overall, Les Myxomycétes is an extraordinary work that is the result of an
enormous amount of time and effort on the part of the three authors. Simply
looking through the color images in the second volume is enjoyable, but
the complementary information provided in the first volume makes this an
MycotTaxon 118 Book Reviews ... 461
exceedingly useful scientific work on the myxomycetes. Anyone with even the
slightest interest in this group of organisms should have a copy of this work.
STEVEN L. STEPHENSON
Department of Biological Sciences, University of Arkansas
Fayetteville, Arkansas 72701, U.S.A.
[email protected]
USTILAGINALES
Ustilaginales of India. By R.V. Gandhe, 2011. Bishen Singh Mahendra Pal Singh,
23-A, New Connaught Place, Dehra Dun, 248001 India, <[email protected]>. ISBN
978-81-211-0788-4. Pp. 414, col. pl. 22, figs. Price circa US$ 154
Dedicated to ‘the doyen of mycology in India the late Professor M_J.
Thirumalachar, this book gives an overview of the Ustilaginales (s.l.) species
in India.
The economically important smut fungi of crop plants and the smut fungi
of native plants are treated in this book. It gives descriptions of 343 species in
45 genera, several of them new for science (e.g., three new Sorosporium species
and two new Sphacelotheca species), the genera and species per genus are
treated in alphabetical order. The genus Sporisorium is the largest, represented
by 96 species, followed by Tilletia with 46, and Ustilago with 42.
Besides an introduction to smut fungi and coverage of their economic
importance, diversity, and morphological variations, a useful host index is
provided.
The author, who has spent 2 decades studying smut fungi and especially
their germination patterns, places a strong emphasis on morphotaxonomy and
symptomatology, and although in many cases descriptions are literally the same
as in Vanky (2007), morphological characters have been added to the keys. The
illustrations entail eight colour plates and over 50 drawings of infected plants,
spores, and germinating spores.
The book makes the impression of having been written at the same time as
Vanky’s treatment of the smut fungi of the Indian subcontinent was published,
although that publication is lacking from the list of references. There are no
post-2007 publications cited, not even the phylogenetic paper by Begerow et
al. (2007). The illustrations in Vanky’s 2007 work are of higher quality than the
ones in the present book, but I doubt whether the former is easily available in
India, where it should be used.
Begerow D, Stoll M, Bauer R. 2007 ['2006’] A phylogenetic hypothesis of
Ustilaginomycotina based on multiple gene analyses and morphological data.
Mycologia 98: 906-916.
Vanky, K. 2007. Smut fungi of the Indian Subcontinent. Polish Botanical Studies 26.
462 ... Vellinga, BOOK REVIEW EDITOR
MISCELLANEOUS
Mushroom. By N.P. Money, 2011. Oxford University Press, 198 Madison Avenue,
New York, NY 10016, U.S.A. <www.oup.com>. ISBN 978-0-19-973256-2. Pp. 201,
col. pl. 16, figs. Price US$ 24.95
In eight chapters the reader is given a dazzling, fast-spaced and thorough
introduction into the development of mushrooms (including life cycles), spore
launching, diversity in shape and function, edible mushrooms and conservation,
mushroom cultivation, toxicity, intoxication, and the medicinal mushroom
industry. The text moves back and forth between the author's experiences in
the England of his youth and present-day life, science, and economics and
yet is always anchored safely in the writings and illustrations of the scientists
of the past. Central to all is the biology of the mushroom, as masterpiece of
bioengineering. It is by no means a text book or field guide. Nonetheless,
MUSHROOM gives a huge amount of information in its 200 pages, makes for
excellent reading, and would be a good present to friends, family, and all who
are intrigued by nature.
Book ANNOUNCEMENTS
Characteristic and rare species of gasteromycetes in Eupannonicum. By I. Riméczo.
M. Jeppson & L. Benedek, 2011. FUNGI NON DELINEATI 56-57. Edizioni Candusso, Via
Ottone Primo 90, 17021 Alassio SV, Italy. <[email protected]>. Pp. 230, col. plates
108, figs. Price 28.00 €
Cortinarius Ibero-insulares - 3. By Grupo Iberoinsular de Cortinariologos (GIC), 2011.
FUNGI NON DELINEATI 58-59. Edizioni Candusso, Via Ottone Primo 90, 17021 Alassio
SV, Italy. <[email protected]>. Pp. 236, col. plates 236. Price 33.00 €
Fungi of tropical China. By W. Xingliang et al., 2011. Chinese Corporation for
Promotion of Humanities. ISBN-13: 9787030294708. Pp. 548, col. plates 495. Price circa
US$ 220
Inocybe dai litorali alla zona alpina. By E. Ferrari, 2011. FUNGI NON DELINEATI 54-55.
Edizioni Candusso, Via Ottone Primo 90, 17021 Alassio SV, Italy. <maxcandusso@libero.
it>. Pp. 216, col. plates 106, figs 69. Price 23.00 €
Mycota of Rhode Island: A checklist of the fungi recorded in Rhode Island (including
lichens and myxomycetes). By R.D. Goos, 2010. THE BioTA OF RHODE ISLAND
vol. 4. Rhode Island Natural History Survey, P.O. Box 1858, Kingston, RI 02881,
<[email protected]>. ISBN 1-887771-09-3. Pp. 228. Price US$60.00
Rare and noteworthy species of agarics from the western Caucasus. By E.F. Malysheva
& T. Yu. Svetasheva, 2011. FUNGI NON DELINEATI 60. Edizioni Candusso, Via Ottone
Primo 90, 17021 Alassio SV, Italy. <[email protected]>. Pp. 104, col. plates 45.
Price 12.00 €
ISSN (print) 0093-4666 © 2011 Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/118.nom
Volume 118, pp. 463-465 October-December 2011
NOMENCLATURAL NOVELTIES AND TYPIFICATIONS
PROPOSED IN MYCOTAXON 118
Amicodisca castaneae J.G. Han, Hosoya & H.D. Shin, p. 90
Arrasia Bernicchia, Gorjon & Nakasone, p. 258
Arrasia rostrata Bernicchia, Gorjon & Nakasone, p. 258
Aschersonia conica Jun Z. Qiu, Y.B. Su & C.S. Weng, p. 326
Asterophora salvaterrensis Blanco-Dios, p. 84
Chromosera cyanophylla (Fr.) Redhead, Ammirati & Norvell (validated), p. 456
Coccomyces minimus Y.R. Lin, C.L. Hou & GJ. Jia, p. 232
Cortinarius mikedavisii Bojantchev, p. 267
Corynespora carrisae R. Singh & Kamal, p. 124
Corynespora peristrophicola R. Singh & Kamal, p. 126
Diversispora clara Oehl, B. Estrada, G.A. Silva & Palenz., p. 75
Eremiomyces magnisporus G. Moreno, P. Alvarado, Manjon & Sanz p. 105
Eutypella phaeospora J. Fourn. & Lechat, p. 442
Exserohilum neoregeliae Sakoda & Tsukib., p. 214
Exserticlava manglietiae S.C. Ren & X.G. Zhang, p. 350
Fomitiporia apiahyna (Speg.) Vlasak & Kout, p. 161
Glomus cubense Y. Rodr. & Dalpé, p. 339
Hallenbergia Dhingra & Priyanka, p. 289
Hallenbergia singularis Dhingra & Priyanka, p. 291
Homolaphlyctis Longcore, Letcher & T.Y. James, p. 435
Homolaphlyctis polyrhiza Longcore, Letcher & TY. James, p. 436
Hymenochaete yunnanensis S.H. He & Hai J. Li, p. 412
Hypoderma siculum Lantieri, P.R. Johnst. & Medardi, p. 395
Lactifluus subg. Edules (Verbeken) Verbeken, p. 448
Lactifluus subg. Lactariopsis (Henn.) Verbeken, p. 449
Lactifluus subg. Russulopsis (Verbeken) Verbeken, p. 452
Lactifluus sect. Albati (Bataille) Verbeken, p. 451
Lactifluus sect. Chamaeleontini (Verbeken) Verbeken, p. 450
Lactifluus sect. Lactariopsis Verbeken, p. 449
464 ... MYCOTAXON 118
Lactifluus sect. Russulopsidei (Verbeken) Verbeken, p. 452
Lactifluus annulatoangustifolius (Beeli) Buyck, p. 450
Lactifluus annulifer (Singer) Nuytinck, p. 450
Lactifluus aureifolius (Verbeken) Verbeken, p. 448
Lactifluus bertillonii (Neuhoff ex Z. Schaef.) Verbeken, p. 451
Lactifluus brachystegiae (Verbeken & C. Sharp) Verbeken, p. 452
Lactifluus chamaeleontinus (R. Heim) Verbeken, p. 450
Lactifluus claricolor (R. Heim) Verbeken, p. 452
Lactifluus corbula (R. Heim & Gooss.-Font.) Verbeken, p. 452
Lactifluus cyanovirescens (Verbeken) Verbeken, p. 452
Lactifluus densifolius (Verbeken & Karhula) Verbeken, p. 2448
Lactifluus edulis (Verbeken & Buyck) Buyck, p. 448
Lactifluus emergens (Verbeken) Verbeken, p. 450
Lactifluus heimii (Verbeken) Verbeken, p. 450
Lactifluus indusiatus (Verbeken) Verbeken, p. 450
Lactifluus inversus (Gooss.-Font. & R. Heim) Verbeken, p. 448
Lactifluus laevigatus (Verbeken) Verbeken, p. 450
Lactifluus latifolius (Gooss.-Font. & R. Heim) Verbeken, p. 449
Lactifluus leoninus (Verbeken & E. Horak) Verbeken, p. 451
Lactifluus longipes (Verbeken) Verbeken, p. 452
Lactifluus madagascariensis (Verbeken & Buyck) Buyck, p. 451
Lactifluus neotropicus (Singer) Nuytinck, p. 450
Lactifluus nodosicystidiosus (Verbeken & Buyck) Buyck, p. 449
Lactifluus pelliculatus (Beeli) Buyck, p. 450
Lactifluus phlebophyllus (R. Heim) Buyck, p. 449
Lactifluus pilosus (Verbeken, H.T. Le & Lumyong) Verbeken, p. 451
Lactifluus pruinatus (Verbeken & Buyck) Verbeken, p. 451
Lactifluus pseudotorminosus (R. Heim) Verbeken, p. 452
Lactifluus puberulus (H.A. Wen & J.Z. Ying) Nuytinck, p. 451
Lactifluus roseolus (Verbeken) Verbeken, p. 449
Lactifluus ruvubuensis (Verbeken) Verbeken, p. 452
Lactifluus sesemotani (Beeli) Buyck, p. 451
Lactifluus subvellereus (Peck) Nuytinck, p. 451
Lactifluus urens (Verbeken) Verbeken, p. 452
Lactifluus velutissimus (Verbeken) Verbeken, p. 450
Lactifluus zenkeri (Henn.) Verbeken, p. 450
Lophodermium sinense Y.R. Lin, C.L. Hou & Jiang L. Chen, p. 225
NOMENCLATURAL NOVELTIES & TYPIFICATIONS ... 46 5
Marasmius tyrius B.E. Lechner & Papinutti, p. 252
Melanoleuca exscissa f. diverticulata (G. Moreno & Bon) Fontenla, Para &
Vizzini, p. 374
Melanoleuca exscissa f. iris (Kithner) Fontenla, Para & Vizzini, p. 374
Melanoleuca exscissa f. sarcophylla (Kihner) Fontenla, Para & Vizzini, p. 374
Melanoleuca paedida f. electropoda (Maire & Malencon) Fontenla, Para &
Vizzini, p. 376
Melanoleuca sublanipes Fontenla, Para & Vizzini, p. 373
Microbotryum coronariae (Liro) Denchev & T. Denchey, p. 54
Microcyclospora rumicis Arzanlou & Bakhshi, p. 182
Mycena guldeniana Aronsen & B.A. Perry, p. 190
Mythicomyces corneipes (Fr.) Redhead & A.H. Sm. (validated), p. 456
Paraphysoderma Boussiba, Zarka & T.Y. James, p. 178
Paraphysoderma sedebokerense Boussiba, Zarka & T.Y. James, p. 178
Peziza paludicola (Boud.) Sacc. & Traverso 1911 (lectotypified, epitypified), p. 117
Peziza paludicola var. kilimanjarensis (J. Moravec) Cacialli, Lantieri & Medardi, p. 120
Pleurotus giganteus (Berk.) Karunarathna & K.D. Hyde, p. 62
= Lentinus giganteus Berk. 1847 (epitypified)
Pseudocercospora epidendri Meir. Silva & O.L. Pereira, p. 2
Septobasidium saurauiae S.Z. Chen & L. Guo, p. 283
Spiropes terminaliae S.C. Ren & X.G. Zhang, p. 351
Subulicystidium curvisporum Gorjon, Gresl. & Rajchenb., p. 48
Tephrocybe misera (Fr.) M.M. Moser ex Contu & Vizzini, p. 456
Tephrocybe tesquorum (Fr.) M.M. Moser ex Contu & Vizzini, p. 457
Terriera camelliae (Teng) Y.R. Lin & Jiang L. Chen, p. 227
Terriera coacervata Y.R. Lin & Q. Zheng, p. 318
Terriera illiciicola (S.J. Wang, Y.F. He & Y.R. Lin) Q. Zheng & Y.R. Lin, p. 321
Tothia fuscella (Sacc.) Bat., in Toth 1960 (epitypified), p. 207
Tuber polyspermum L. Fan & C.L. Hou, p. 406
Tuber sinoalbidum L. Fan & J.Z. Cao, p. 408
Urocystis bolboschoeni Denchev, T. Denchev, Spooner & Legon, p. 249
bad taxonomy