MYCOTAXON
THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY & NOMENCLATURE
VOLUME 125 JULY-SEPTEMBER 2013
Rhinocladiella tibetensis sp. nov.
(Wu & al.— Fia. 2, p. 125)
YuE-MING WU, artist
ISSN (PRINT) 0093-4666 _http://dx.doi.org/10.5248/125 | ISSN (ONLINE) 2154-8889
MYXNAE 125: 1-306 (2013)
EDITORIAL ADVISORY BOARD
WEN-YING ZHUANG (2003-2014), Chair
Beijing, China
HENNING KNUDSEN (2008-2013), Past Chair
Copenhagen, Denmark
Scott A. REDHEAD (2010-2015)
Ottawa, Ontario, Canada
SABINE HUHNDORE (2011-2016)
Chicago, Illinois, U.S.A.
PETER BUCHANAN (2011-2017)
Auckland, New Zealand
SEPPO HUHTINEN (2006-2012)
Turku, Finland
Published by
MycoTAaxon, LTD.
P.O. BOX 264, ITHACA, NY 14581-0264, USA
www.mycotaxon.com & www.ingentaconnect.com/content/mtax/mt
© Mycotaxon, LTp, 2013
MYCOTAXON
THE INTERNATIONAL JOURNAL OF FUNGAL TAXONOMY & NOMENCLATURE
VOLUME 125
JULY-SEPTEMBER 2013
EDITOR-IN-CHIEF
LORELEI L. NORVELL
Pacific Northwest Mycology Service
6720 NW Skyline Boulevard
Portland, Oregon 97229-1309 USA
NOMENCLATURE EDITOR
SHAUN R. PENNYCOOK
Manaaki Whenua Landcare Research
Auckland, New Zealand
BooK REVIEW EDITOR
ELSE C. VELLINGA
861 Keeler Avenue
Berkeley CA 94708 U.S.A.
CONSISTING OF XII + 306 PAGES INCLUDING FIGURES
ISSN 0093-4666 (PRINT) http://dx.doi.org/10.5248/125.cvr ISSN 2154-8889 (ONLINE)
© 2013. MycoTAxon, LTD.
Iv ... MYCOTAXON 125
MYCOTAXON
VOLUME ONE HUNDRED TWENTY-FIVE — TABLE OF CONTENTS
COVER SECTION
REVICWETS. 6 ia Son ipo 8 ed 8 Ag Rd ele OS VES SD 8 FS ROE CER ENR OF RNAS vii
Do eGo 17 RRR ie oP Aad Gn AS OVARY WPLe ALR We de aN Oe ae ae ix
SHOIMSSTOM DT OCCU PCS 6 Maoh ony hu. ty vs eg extra ee a wt 'y Yl antag 6 nig ye tan coe x
ECORI TE ILOR wn ae Nena Soa or PSR i hey BO ol ain oe RE dec Ee xi
RESEARCH ARTICLES
Re-appraisal of Scolecopeltidium Harxia Wu & Kevin D. HyDE
Five Leptonia species from New South Wales and Queensland, Australia
DavIip L. LARGENT, SARAH E. BERGEMANN, SANDRA E. ABELL-DAVIS,
KERRI L. KLUTING, & GRIFFIN A. CUMMINGS
Hymenochaetaceae from Mexico 6. A new Fuscoporia species
from the Sonoran desert
TANIA RAYMUNDO, RICARDO VALENZUELA & MARTIN ESQUEDA
Phallus hadriani and P. roseus from Pakistan
G. MorENo, A.N. KHALID, P. ALVARADO & H. KREISEL
Nidula shingbaensis sp. nov., a new bird’s nest fungus from India
KANAD Das & RuI LIN ZHAO
Geosmithia tibetensis sp. nov. and
new Gibellulopsis and Scopulariopsis records from Qinghai-Tibet
YuUE-MING Wu, JUN-JIE XU, HONG-FENG WANG & TIAN-YU ZHANG
New records of crustose lichens from China — 1. QranG REN & SHuxia LI
The lichen genus Graphis in Vietnam
SANTOSH JOSHI, UDENI JAYALAL, SOON-OK OH,
Tuoi THUY NGUYEN, NGUYEN ANH DZUNG & JAE-SEOUN HuR
Setosynnema yunnanense sp. nov. from submerged decaying leaves
YA-Li Bal, JIAN- YING LI,
MIN QIAO, WEN-YUN QIAN, GUANG-ZHU YANG & ZE-FEN YU
Two earth-tongue genera new for Turkey ILGAz AKATA & ABDULLAH Kaya
Two new species of Septobasidium (Septobasidiaceae)
from Yunnan Province in China WEI LI & Lin Guo
Septobasidium hoveniae sp. nov. and S. rhabarbarinum
new to China We! Li, SUZHEN CHEN, LIN GUO & YAOQING YE
Validation and typification of Gyroporus purpurinus
11
a7,
45
ee)
59
65
69
81
87
91
97
NAVEED DAVOODIAN & Roy E. HALLING 103
JULY-SEPTEMBER 2013... V
Golovinomyces clematidis sp. nov. (Erysiphaceae) from China
TIEZHI LIU & JING WEN 107
Four noteworthy hyphomycetes from indoor environments
DE-WE!I Li, GUIHUA ZHAO, CHIN YANG, ARIUNAA JALSRAI & BRIAN KERIN 111
Radulidium xigazense sp. nov., Rhinocladiella tibetensis sp. nov.,
and three new records of Ramichloridium from China
YUE-MInG Wu, JUN-JIE XU, HONG-FENG WANG & TIAN-YU ZHANG 123
A new species of Emericella from Tibet, China
LI-CHUN ZHANG, JUAN CHEN, WEN-HAN LIN & SHUN-XING GUO 131
Jayarambhatia rhizophorae gen. et sp. nov., an asexually
reproducing fungus from Goa, India J. PratiBHaA 139
Sympodioplanus goaensis sp. nov. from Goa, India J. PratipHa 145
Contributions to the family Thyridiaceae.
New data on Sphaeria mutabilis
Jutta CHECA, M. NATIVIDAD BLANCO & GABRIEL MORENO 149
Phyllosticta ephedricola sp. nov. on Ephedra intermedia
YAN WANG, LING JIN, XING-RONG CHEN, LI LIN & HONG-GANG CHEN 165
Scutellospora alterata, a new gigasporalean species from the semi-arid
Caatinga biome in Northeastern Brazil
JULIANA SOUZA DE PONTES, IVAN SANCHEZ-CASTRO, JAVIER PALENZUELA,
LEONOR Costa MAIA, GLADSTONE ALVES DA SILVA & FRITZ OEHL 169
A new Drechslerella species from Hainan, China
JIAN- YING Li, WEN-YUN QIAN, MIN QIAO, YA-LI BAI & ZE-FEN YU 183
New reports of cyperaceous rust fungi from Pakistan
A. IsHAQ, N.S. AFSHAN & A.N. KHALID 189
Scleroderma yunnanense, a new species from South China
CHUNXIA ZHANG, XIAO-E Xu, JING Liu, MINGxIA HE,
WENBING WANG, YUN WANG & KAIPING JI 192
New records of microfungi from Turkey (Bartin Province)
ALI SAvAS BULBUL & ELSAD HUSEYIN 201
Two new species of Repetophragma from the Iberian Peninsula
RAFAEL F, CASTANEDA-RUIZ, MARGARITA HERNANDEZ-RESTREPO,
JOSEPA GENE, MILAGRO GRANADOS & JOSEP GUARRO 209
New records of Rhizocarpon from China
ZUN-TIAN ZHAO, CHAO LI, XIN ZHAO & LU-LU ZHANG 217
Digitella rigidophora and Redbia inflata, two new microfungi from Mexico
RAFAEL E. CASTANEDA-RUIZ, GABRIELA HEREDIA & ROSA M. ARIAS 227
A new coprophilous Gilmaniella species from Malaysia
TEIK-KHIANG GOH, LI-LING LEE & KAH-CHENG TEO 235
vI ... MYCOTAXON 125
Hygrocybe griseobrunnea, a new brown species from China
CHAO-QUN WANG, TAI-Hut LI & BIN SONG 243
Xylaria in southern China - 8. X. bannaensis sp. nov.
and X. brunneovinosa new to the mainland
Hat-x1A MA, LARISSA VASILYEVA & YU LI 251
A new species of Scutellinia from Mexico Laura IzQuiERDO-SaAN AcGusTIiN,
SIGFRIDO SIERRA, IBETH RODRIGUEZ—GUTIERREZ,
SANDRA CASTRO-SANTIUSTE & JOAQUIN CIFUENTES 257
Study on the phylogeny of Nephroma helveticum and allied species
Hat-YING WANG, DAI-FENG JIANG,
YAN-HONG HUANG, PAN-MENG WANG & TAO LI 263
Hydnotrya laojunshanensis sp. nov. from China
Lin Li, YONG-CHANG ZHAO, XIAO-LEI ZHANG,
HonG-YAN Su, SHU-HONG LI & DE-QUN ZHOU 277
Phylogenetic divergence of three morphologically similar truffles:
Tuber sphaerosporum, T. sinosphaerosporum, and
T. pseudosphaerosporum sp. nov. Li FAN & SHUANG-FEN YUE 283
Spatial data for fungal specimens: retrospective georeferencing
and practical recommendations for mycologists
RICARDO BRAGA-NETO, RENATO DE GIOVANNI,
FLAVIA FONSECA PEZZINI, DORA ANN LANGE CANHOS,
ALEXANDRE MARINO, SIDNEI DE SOUZA & LEONOR CosTA Mata 289
MYCOBIOTAS ONLINE 303
Checklist of Russulaceae from Brazil.
MariAna C.A. SA, Juri G. BASEIA & FELIPE WARTCHOW
Checklist of the rust fungi on Poaceae in Pakistan
N.S. AFSHAN & A.N. KHALID
NOMENCLATURE
Nomenclatural novelties proposed in volume 125 305
JULY-SEPTEMBER 2013 ...
REVIEWERS — VOLUME ONE HUNDRED TWENTY-FIVE
The Editors express their appreciation to the following individuals who have,
prior to acceptance for publication, reviewed one or more of the papers
prepared for this volume.
André Aptroot
Juliano M. Baltazar
Hans-Otto Baral
Timothy J. Baroni
J.L. Bezerra
Janusz Blaszkowski
Uwe Braun
Lei Cai
Rafael F. Castafieda Ruiz
Michael A. Castellano
Santiago Chacon
Maria Martha Dios
Martin Esqueda
Genevieve Gates
Zai-Wei Ge
Shouyu Guo
Ying-Lan Guo
Tan Robert Hall
Panu Halme
Shuang-Hui He
Terry W. Henkel
Dian-Ming Hu
Ze-Feng Jia
Klaus Kalb
Bryce Kendrick
Sevda Kirbag
De-Wei Li
Pei-Gui Liu
D. Jean Lodge
Guozhong Li
P. Brandon Matheny
Eric H.C. McKenzie
David W. Minter
Keiichi Motohashi
Abdul Rehman Khan Niazi
Lorelei L. Norvell
Katarina Pastircakova
Shaun R. Pennycook
Stephen W. Peterson
Alan P. Roelfs
Amy Y. Rossman
Leif Ryvarden
Ewald Sieverding
M. Halil Solak
Clement KM Tsui
Aziz Tirkoglu
Larissa Vasilyeva
Annemieke Verbeken
Yun Wang
A.J.S. Whalley
Dursun Yagiz
Eugene Yurchenko
Xiu-Guo Zhang
Wen-Ying Zhuang
VII
vill ... MYCOTAXON 125
PUBLICATION DATE FOR VOLUME ONE HUNDRED TWENTY-FOUR
MYCOTAXON for APRIL-JUNE, VOLUME 124 (x1 + 1-368)
was issued on October 10, 2013
JULY-SEPTEMBER 2013 ...
ERRATA FROM PREVIOUS VOLUMES
VOLUME 124
p. 46, line 20
p- 69, last line
Go C0 UD co DT
. 172, line 28
. 172, line 31
; 172, line 32
. 178, line 3
. 178, line 5
. 179, line 39
p.-
192, line 20
p. 207, line 37
p. 210, line 15
FOR: 41°48’N 36°31VE READ: 37°27 N 30°54E
FOR: incubation period at 16-19°C ascomata developed.
READ: incubation period at 16-19°C.
for: Fre. le read: Fic. 2c
for: Fic. 1d read: Fic. 2d
for: Fic. le read: Fic. 2e
for: Fic. 6a read: Fic. 6b
for: Fic. 6b read: Fic. 6a
FOR: 1993: READ: 1993.
FOR: Cacerese READ: Caceres
FOR: Simbiosis READ: Symbiosis
FOR: (Gorjon & Hallenberg 2012)
READ: (Gorjon & Hallenberg 2013)
IX
X ... MYCOTAXON 125
FOUR STEPS TO SUCCESSFUL MYCOTAXON PUBLICATION IN 2013
Prospective MycotTaxon authors should download instructions PDE, review and
submission forms, and other helpful templates by clicking the ‘file download page’ link
on our INSTRUCTIONS TO AUTHORS page before preparing their manuscript. Below is a
summary of our “4-step’ publication process.
1—PEER REVIEW: Email formatted text and illustration files with a2013 MycoTAxon
Reviewer Comments Form to 2-3 experts for peer review. Authors should (i) ask
peer reviewers to return revisions and comment forms to BOTH authors and Editor-
in-Chief <
[email protected]> and (ii) follow reviewer suggestions before
sending revised files to the Nomenclature Editor for nomenclatural review.
2—NOMENCLATURAL REVIEW: Email text files (wiTH tables & captions but No
artwork) to the Nomenclature Editor <
[email protected]>
for accession and pre-submission review. The Email message MUST include
‘MycotTaxon on the subject line AND all peer reviewer names+Email addresses in
the message. The Nomenclature Editor will assign accession numbers and return
annotated files with a list of needed corrections to the authors and Editor-in-Chief.
3—FINAL SUBMISSION: After consulting experts and revising manuscripts as
needed, send the (i) completed 2013 MycoTaxon submission form; (ii) separate
text files for main text, tables, and legends; and (iii) art files to the Editor-in-Chief
<
[email protected]>. Only text and image files prepared for immediate
publication should be sent at this time. The Editor-in-Chief usually acknowledges
manuscripts and thanks expert reviewers within two weeks, but please wait at
least 14 days before sending a follow-up query (without attachments); this helps
us keep Email traffic to a minimum during Mycotaxon publication deadlines or
temporary closures of the editorial office.
4—FINAL EDITORIAL REVIEW & PRESS PREPARATION: Files not ready for publication
will be rejected or returned to authors for further revision; the Editor-in-Chief gives
tentatvely approved manuscripts a final grammatical and scientific review before
converting all files into publishable format. The PDF proof, bibliographic citation,
and nomenclatural entries are sent to all coauthors for final inspection prior to
publication. After PDF conversion, the Editor-in-Chief corrects ONLY processing
or editorial errors prior to publication but will list corrections of author errors in
the Errata of a subsequent volume for no charge. Authors are expected to arrange
payment of page charges and optional open access fees with the Business Manager
MYCOTAXON LTD— www.mycotaxon.com
The MycoTaxon Webmaster <
[email protected]> posts general and
subscription information, important announcements, and author forms and templates
on the official MycoTaxon site. The server also hosts the regional mycobiota webpage
for free download of distributional annotated species lists.
MYCOTAXON ONLINE— www.ingentaconnect.com/content/mtax/mt
Mycotaxon publishes four volumes a year. Both open access and subscription
articles are offered.
JULY-SEPTEMBER 2013 ... XI
FROM THE EDITOR-IN-CHIEF
THOUGHTS ON AUTHORITIES IN TAXONOMIC PAPERS — MycoTaxon originated
its usage and rules regarding authorities for taxonomic names at a time when
there was no easy way of finding author citations. Our authors were expected
to provide authorities for EVERY taxon (fungal or not) at least once (usually at
first mention). With the advent of the Internet and standardized abbreviations,
however, mycologists now have easy access to INDEX FUNGORUM, MycoBANK,
and other sites that provide this information. I personally have been vexed to
struggle through an introduction containing a sea of authorities for ‘incidental’
names and also crammed with text references, trying to sift the important
information from the non-essential. It is now time to revise our citation
requirements.
Shaun and I suggest that authorities for plant (and other non-fungal) names
be either omitted entirely for incidental taxa or restricted (and cited once ONLY)
to the SPECIMENS EXAMINED sections. When a significant host is to be cited
frequently, then the proper authority should be given (ONCE!) at first mention
(usually in that overworked Introduction, unfortunately).
When it comes to fungi, however, our old rule applies for the nonce. We still
require authorities be cited (ONCE ONLY) for all fungal names — either at first
mention or within a table or appropriate taxonomic section.
MYCOTAXON 125 contains 37 papers by 140 authors (from 20 countries) and
revised by 54 expert reviewers. It also announces two new mycobiotas for its
website.
Within these pages are two new genera with two new species (Digitella
from Mexico, Jayarambhatia from India) plus 31 other species new to science
representing Drechslerella, Emericella, Geosmithia, Golovinomyces, Hydnotrya,
Hygrocybe, Nephroma, Phyllosticta, Radulidium, Rhinocladiella, Scleroderma,
Septobasidium, Setosynnema, Tuber, and Xylaria from China; Fuscoporia,
Redbia, and Scutellinia from Mexico; Gilmaniella from Malaysia; Leptonia
from Australia; Nidula from India; Repetophragma from the Iberian peninsula;
Scutellospora from Brazil; and Sympodioplanus from India.
In addition to range extensions for previously named taxa, we also offer new
combinations in Leptonia, Mattirolia, Micropeltis, Scolecopeltis, and Thyridium
as well as a validation of a Gyroporus from North America, a monograph of
Graphis in Vietnam, and an excellent overview of how to provide the essential
georeference data for all fungal collections.
Warm regards,
Lorelei L. Norvell (Editor-in-Chief)
12 November 2013
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.1
Volume 125, pp. 1-10 July-September 2013
Re-appraisal of Scolecopeltidium
Hatrx1A Wu! & KEVIN D. HypDE??*
‘ International Fungal Research and Development Centre, Key Laboratory of Resource Insect
Cultivation & Utilization State Forestry Administration, The Research Institute of Resource
Insects, Chinese Academy of Forestry Kunming 650224, PR China
? Institute of Excellence in Fungal Research, School of Science, Mae Fah Luang University,
Chiang Rai 57100, Thailand
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — The five new species included in the original circumscription of Scolecopeltidium
are re-examined, redescribed, and illustrated. Scolecopeltidium mirabile and S. hormosporum
are retained in Scolecopeltidium, while S. liciniae is lectotypified and transferred to
Scolecopeltis, and S. costi and S. multiseptatum are transferred to Micropeltis.
Key worps — Dothideomycetes, morphological characters, taxonomy
Introduction
Scolecopeltidium, which was established by Stevens & Manter (1925),
comprises species that lack superficial mycelium and are foliar epiphytes on
leaves. In Scolecopeltidium thyriothecia are relatively large, circular, and blue-
green with a central rounded irregular ostiole and poorly developed basal
peridium. The upper thyrothecial wall consists of an irregular meandering
arrangement of compact hyphae (Wu et al. 2011a). The dense filamentous
hamathecium comprises pseudoparaphyses embedded in mucilage
surrounding the asci, which are inclined towards the center. Asci are bitunicate
or fissitunicate, obclavate, and pedicellate, lacking an ocular chamber, and
containing fasciculate long cylindrical to filiform ascospores (Wu et al. 201 1a).
Stevens & Manter (1925) introduced eleven species in Scolecopeltidium (five
new to science and six new combinations) but did not indicate any type
for the genus. ‘The earliest designation of a generic type was by Clements &
Shear (1931), who selected S. salacense (Racib.) E Stevens & Manter (and also
proposed the superfluous replacement name, Scolecopeltium). Scolecopeltidium
has until recently been listed as a genus of Microthyriaceae, although Lumbsch
& Huhndorf (2010) suggested that the placement in this family is uncertain.
2 ... Wu & Hyde
Batista (1959), who redescribed the genus, added many taxa and brought
the total to 69 species. He retained S. salacense within Scolecopeltidium but
designated S. mirabile as a substitute generic type; however this re-typification
is inadmissible (ICN Art. 10.5; McNeill et al. 2012). Species were distinguished
based on ascoma color and size and ascospore septation. Batista’s (1959)
placement of Scolecopeltidium in Micropeltidaceae was confirmed by Wu et
al. (2011a). There are currently no molecular data for any Scolecopeltidium
species.
Mistakenly following Batista (1959) in treating S. mirabile as the generic
type, Wu et al. (201la) provided a description and plate based on a 1931
Stevens collection. The correct generic type, S. salacense, is described as having
8-spored asci, copious paraphyses, and 6-12-septate ascospores (Raciborski
1900; Stevens & Manter 1925), but we have been unable to locate any authentic
specimen of S. salacense.
We redescribe and illustrate the generic types of Dothideomycetes (Zhang et
al. 2008, 2009, 2012; Wu et al. 2010, 2011a,b) and, where possible, have selected
fresh specimens for epitypification and molecular analysis to provide a natural
classification (e.g., Wu et al. 2011a; Chomnunti et al. 2011). In this paper, we
re-examine the five new species described in Scolecopeltidium by Stevens &
Manter (1925).
Materials & methods
Type specimens of the species were obtained from NY and ILL (for full names of
herbaria see http://sweetgum.nybg.org/ih/index.php). The methods follow those of Wu
et al. (201 1a).
Taxonomy
Micropeltidaceae
Wt et al. (2011a) illustrated Micropeltis applanata Mont. (type species of
Micropeltidaceae) and transferred Byssopeltis and Scolecopeltidium to the
family. Scolecopeltidium, Scolecopeltis, and Micropeltis can be differentiated
morphologically based on the presence or absence of pseudoparaphyses and
shape and septation of ascospores. Studies at the molecular level are needed to
confirm the separation of genera based on these characters.
Key to the genera of the Micropeltidaceae discussed in this paper
1. Ascospores either spindle-shaped to fusiform or filiform to long clavate;
pseudoparaplysesicusually)spbesen tr .1 tre. Fetes aus ars sleet adage atloharag wands ar she 2
1. Ascospores spindle-shaped to fusiform; pseudoparaphyses absent . . Scolecopeltis
2, —~ASCOSpOrey’s5-SEDtate so 5.504 vb ion x wGGoe d eGuee | Sede Feeder eee Scolecopeltidium
ten | USSCOSDORES: 2 a SOP UALS i Fn ls Fe Wil i Nae Ne ch Me che eho Micropeltis
Scolecopeltidium revisited ... 3
Scolecopeltidium F. Stevens & Manter, Bot. Gaz. 79(3): 282 (1925)
TyPE: Scolecopeltidium salacense (Racib.) F. Stevens & Manter, Bot. Gaz. 79(3): 282 (1925)
as “salacensis”. [Designated by Clements & Shear 1931: 304, sub “Scolecopeltium”.] [Type
specimen not seen. ]
FOLIAR EPIPHYTES on leaves, lacking superficial mycelium. THYRIOTHECIA
relatively large, circular, scattered, membranaceous or submembraneous,
superficial, blue-green to dark-green or black, base poorly developed, with a
central rounded irregular ostiole; in section lenticular. UPPER WALL comprising
an irregular meandering arrangement of compact hyphae. PERIDIUM a
single stratum, comprising one to several layers of compact brownish
black pseudoparenchymatous cells. HAMATHECIUM of dense, filamentous,
pseudoparaphyses, embedded in mucilage, surrounding the asci, which are
inclined towards the center. Asci 2—8-spored, bitunicate, fissitunicate, obclavate,
pedicellate, ocular chamber not observed. Ascosporss fasciculate, spindle-
shaped or fusiform to long cylindrical or filiform, tapering towards the base.
ANAMORPHS: Not established for the genus (Hyde et al. 2011).
Notes: We retain S. mirabile and S. hormosporum in Scolecopeltidium.
Scolecopeltidium mirabile F. Stevens & Manter, Bot. Gaz. 79(3): 283 (1925)
This species was described and illustrated in Wu et al. (2011a) based on
a collection of Stevens, on leaves of Diospyros aherni from Philippines on 18
January 1931, NY 2021. Although the host and distribution differ, there are
only minor differences between the original description (specimens from
Kartabo, Guyana) and the 1931 Stevens specimen described in Wu et al.
(201la). Although Wu et al. described the 1931 Stevens specimen’s asci as
8-spored and the ascospores as having 28-38 septa, the original description
cited asci as 2-4-spored and ascospores as having up to 48 septa.
Scolecopeltidium hormosporum F. Stevens & Manter, Bot. Gaz. 79(3): 283
(1925) PLATE 1
FOLIAR EPIPHYTES on the upper surface of leaves, lacking superficial mycelium.
THYRIOTHECIA 1940-2960 um diam x 75-95 um high, relatively large, scattered,
superficial, carbonaceous, rounded from above, blue-green to black, base wall
poorly developed, with a central rounded irregular ostiole; in section lenticular.
UPPER WALL comprising an irregular meandering arrangement of compact
hyphae. PERIpIUM 16.8-22.5 um wide, a single stratum, composed one to several
layers of brown-black and compact pseudoparenchymatous cells. HAMATHECIUM
of dense, 1-2 um wide, filamentous, branched pseudoparaphyses embedded in
mucilage, longer than, and surrounding the asci. Asc1 90-125 x 13.5-33 um
when young, 175-195 x 33.5 x 54.5 um (mean = 159.9 x 43.9 um, n = 15) at
maturity, 3-6-spored, fusiform, pedicel short, with a distinctive but small ocular
chamber. Ascospores 150-160 x 8.5-9.5 um (mean = 156.5 x 9 um, n = 20),
4 ... Wu & Hyde
the host leaf surface. C, D. Squash mounts of ascoma showing strutures of tissues. E, G. Asci. EF
Pseudoparaphyses. H, I. Ascospores with numerous septa. Scale bars: B = 500 um, C, E = 20 um,
D, F-I = 10 um.
filiform to long cylindrical, apex widest (about 9.5 um), end cells slightly elongate
and wide, other cells spherical, hyaline, with 22-28 septa, constricted at septa,
and curved in the ascus, immature spores with only one cell.
MATERIAL EXAMINED: GUYANA (British Guiana), Kartalo, on unknown host, 23 July
1922, EL. Stevens No. 581 (ILL6779, holotype).
Scolecopeltis Speg., Boln. Acad. nac. Cienc. Cordoba 11(4): 574 (1889)
TYPE SPECIES: Scolecopeltis tropicalis Speg., Boln. Acad. nac. Cienc. Cordoba 11(4): 574
[no. 369] (1889)
FOLIAR EPIPHYTES on leaves, lacking superficial mycelium. THYRIOTHECIA,
circular, scattered, membranaceous or submembraneous, superficial, blue-green
to black brown, base poorly developed, with a central rounded ostiole; in section
lenticular. UPPER WALL composed of irregularly meandering and interwoven
compact hyphae. Peridium a single stratum, composed of one to several layers
of compact brownish black pseudoparenchymatous cells. PSEUDOPARAPHYSES
Scolecopeltidium revisited ... 5
absent. Asci (4-) 8-spored, bitunicate, fissitunicate, obclavate, pedicellate,
ocular chamber not observed. Ascospores, overlapping, spindle-shaped to
fusiform, with more than 10 septa.
ANAMORPHS: None reported.
Notes: Scolecopeltis differs from Scolecopeltidium in lacking a hamathecium
of pseudoparaphyses (Stevens & Manter 1925). We transfer Scolecopeltidium
liciniae to Scolecopeltis.
PLATE 2. Scolecopeltis liciniae (lectotype, ILL6780). A, B. Appearance of ascomata on the host
surface. C, D. Squash mount of ascomata. E, F. Section of ascomata. G, H, J. Immature asci.
I, K, L. Ascospores. Scale bars: B = 500 um, C = 200 um, D-J = 10 um, E = 20 um, K, L= 5 um.
6 ... Wu & Hyde
Scolecopeltis liciniae (F. Stevens & Manter) H.X. Wu & K.D. Hyde, comb. nov.
MycoBANK NUMBER: MB801935 PLATE 2
= Scolecopeltidium liciniae F. Stevens & Manter, Bot. Gaz. 79(3): 283 (1925)
Type: Guyana (British Guiana), Rockstone, on leaves of Licinia sp., 17 July 1922, EL.
Stevens No. 479 (Lectotype designated here, ILL6780).
FOLIAR EPIPHYTES on the lower surface of leaves of Licinia sp. (Liliaceae), lacking
superficial mycelium. THYRIOTHECIA 1500-1600 um diameter, scattered,
superficial, blue-green, membranaceous or submembraneous, rounded, within
loosely interwoven hyphae at the margin, dome-like in section, with a rounded
ostiole. PERIDIUM 14.5-16.5 um thick, composed of interwoven hyphae,
lacking at the base. HAMATHECIUM of sparse, paraphyses absent, surrounded
by mucilage and themselves surrounding asci, which form from the tissues at
the circumference and base. Asci 99-139 x 20-27.5 um (mean = 115.5 x 23.3
um, n = 15), 8-spored, cylindro-clavate, with a short pedicel about 1.5 x 1
um, ocular chamber not observed. AscosporEs 65.7-76.8 x 8.1-12 um (mean
= 69.9 x 10.1 um, n = 20), overlapping, spindle-shaped to fusiform, 11-13
septa, rounded towards the apex, tapering towards the base, middle cells wider,
conical, hyaline, slightly constricted at septa.
Notes: Stevens & Manter (1925) cited two collections [syntypes] in the
protologue of S. liciniae: No. 423 [ILL 6781] and No. 479 [ILL 6780], both
conserved in Stevens’ herbarium at ILL. However, ILL 6781 represents a
different species with pseudoparaphyses and 3-celled ascospores. We therefore
designate ILL 6780 (on Licinia sp.) as lectotype.
Micropeltis Mont., Ann. Sci. Nat., Bot., sér. 2, 17: 122 (1842)
TYPE SPECIES: Micropeltis applanata Mont., Annls Sci. Nat., Bot., sér. 2, 17: 122 (1842)
FOLIAR EPIPHYTES on the surface of leaves, superficial mycelium absent or
not observed. THYRIOTHECIA circular, gregarious, superficial, membranous,
bluish or greenish to black, lower peridium poorly developed, easily
removed from the host surface, with a central irregular ostiole; lenticular in
section. UPPER WALL composed of irregularly meandering compact hyphae.
PERipIuM black to light brown, comprising two strata, outer cells black and
compact, inner cells comprising a textura angularis of loose light brown cells.
HAMATHECIUM consisting of asci embedded in mucilage and inclined toward
the central ostiole with sparse or evanescent pseudoparaphyses present. ASscI
6-8-spored, bitunicate, fissitunicate, obclavate to widely fusiform, pedicellate,
ocular chamber not obvious. Ascospores overlapping 2-3-seriate, hyaline,
long clavate to elliptic, trans-septate, smooth-walled.
ANAMORPHS: None reported.
Notes: Micropeltis differs from Scolecopeltidium in having fewer septa in
its ascospores (Stevens & Manter 1925). We transfer Scolecopeltidium costi and
S. multiseptatum to Micropeltis.
Scolecopeltidium revisited ... 7
Micropeltis costi (F. Stevens & Manter) H.X. Wu & K.D. Hyde, comb. nov. PLATE 3
MycoBANK NUMBER: MB801936
= Scolecopeltidium costi F. Stevens & Manter, Bot. Gaz. 79(3): 284 (1925)
FOLIAR EPIPHYTES on the upper surface of leaves, lacking superficial
mycelium. THYRIOTHECIA 830-1120 um diam x 45-51 um high, rounded,
cia
on the host surface.C, D. Squash mount of ascoma. E, FE Section of ascomata. G-I, L. Asci.
J. Ascospores with 4-5 septa.K. Pseudoparaphyses. Scale bars: B = 500 um, C = 60 um,
D,F = 20 um, E = 40 um, G-L = 10 um.
8 ... Wu & Hyde
scattered, membranaceous or submembraneous, superficial, blue-green,
basal peridium lacking, with a central rounded ostiole; dome-like in section.
UPPER WALL comprising an irregular meandering arrangement of hyphae, with
loosely interwoven hyphae at the margin. PERrIpIuM 5-10 um wide, a single
stratum, composed one to several brownish black to light brown layers outside
compact pseudoparenchymatous cells. HAMATHECIUM of dense, filiform 2 um
wide pseudoparaphyses, embedded in mucilage, surrounding the asci inclined
towards the center. Asc1 40-58 x11-22um (mean = 50.7 x15.8 um, n = 15),
8-spored, bitunicate, fissitunicate dehiscence not observed, broadly fusiform,
with a 5 um wide x 6 um long pedicel. AscosporEs 20-28 x 4-5 um (mean =
22.8 x 4.5 um, n = 20), 4-5 overlapping, elliptic or spindle-shaped, hyaline, 4-5
septa, slightly constricted at septa, with middle cells larger and round, smooth-
walled.
MATERIAL EXAMINED: GUYANA (British Guiana), Kartabo, on leaves of Serjania
paucidentata, 23 July 1922, EL. Stevens (NY585, holotype).
Micropeltis multiseptata (F. Stevens & Manter) H.X. Wu & K.D. Hyde, comb. nov.
MycoBANK NUMBER: MB801937 PLATE 4
= Scolecopeltidium multiseptatum F. Stevens & Manter, Bot. Gaz. 79(3): 283 (1925)
FOLIAR EPIPHYTES on the upper surface of leaves, lacking superficial
mycelium. THYRIOTHECIA 1270-1350 um diameter x 76-80.5 um high,
scattered, superficial, blue-green, membranaceous or submembranaceous,
basal peridium lacking, with a central rounded ostiole; dome-like in section.
UPPER WALL comprising an irregular meandering arrangement of hyphae,
with loosely interwoven hyphae at the margin. PERIDIUM 19.5-21.5 um thick,
composed three layers of compact pseudoparenchymatous cells in which the
outer layer is black, the middle of layer is blue-green, and the inner layer is
hyaline. HamATHECIUM of dense filamentous crooked pseudoparaphyses, 1-
1.5 um wide, embedded in mucilage, surrounding the asci. Asci 69-80 x 22-25
um (mean = 73 x 23.7 um; n = 15), 2-4-spored, obclavate to widely fusiform,
with a 3-4 um wide x 4-5 um long pedicel. Ascosporss 27-37 x 8-9.5 um
(mean = 35.5 x 8.5um, n = 20), 2-3-seriate, elliptic or spindle-shaped, slightly
constricted at the septa, hyaline, with 3-4 septa.
MATERIAL EXAMINED: GUYANA (British Guiana), Wismar, on leaves of Philodendron
sp., 24 July 1922, EL. Stevens (NY 1004, isotype).
Acknowledgments
Funds for research were provided by the Grant for Essential Scientific Research
of National Non-profit Institute (no. CAFYBB2007002; no. riricaf2013004M) and
the National Natural Science Foundation of China (no. 31300019). The curators of
herbarium NY and ILL are thanked for providing material on loan for this study. The
Scolecopeltidium revisited ... 9
Pirate 4. Micropeltis multiseptata (isotype, NY 1004). A, B. Appearance of ascomata on the host
surface. C. Squash mount of ascoma. D, E. Section of ascoma. The peridium comprises three layers.
F--H, J. Obclavate asci. I. Pseudoparaphyses. K-N. Ascospores with 4-5 septa. Scale bars: B = 500
um, C = 30 um, D-J = 10 um, K-N = 5 um.
authors also thank Professor Xiaoming Chen and Professor Ying Feng, Dr. Hang Chen
(The Research Institute of Resource Insects, Chinese Academy of Forestry, China), and
Lei Cai (Institute of Microbiology, Chinese Academy of Sciences, Beijing, China) for
10 ... Wu & Hyde
their valuable help. Our deep thanks to Professor Eric McKenzie and Professor Jose Luiz
Bezerra for reviewing the manuscript. The authors earnestly appreciate nomenclature
editor's (Prof. Shaun Pennycook) assistance and thank him for his valuable help! K.D.
Hyde acknowledges a research grant from the Biodiversity Research and Training
Program (BRT R253012) and Training Program Grant (BRTR251181).
Literature cited
Batista AC. 1959. Monografia dos fungos Micropeltaceae. Publicacgées Instituto de Micologia da
Universidade do Recife 56: 1-519.
Chomnunti P, Schoch CL, Aguirre-Hudson B, Ko-Ko TW, Hongsanan §S, Jones EBG, Kodsueb R,
Phookamsak R, Chukeatirote E, Bahkali AH, Hyde KD. 2011. Capnodiaceae. Fungal Diversity
51: 103-134. http://dx.doi.org/10.1007/s13225-011-0145-6
Clements FE, Shear CL. 1931. Genera of fungi. Edn 2. USA, New York; H.W. Wilson Company.
496 p.
Hyde KD, McKenzie EHC, KoKo TW. 2011. Towards incorporating anamorphic fungi in a natural
classification—checklist and notes for 2010. Mycosphere 2: 1-88.
Lumbsch HT, Huhndorf SM. 2010. Myconet volume 14. Part one. Outline of Ascomycota—2009;
Part two. Notes on ascomycete systematics. Nos 4751-5113. Fieldiana, Life and Earth Sciences
1: 1-64. http://dx.doi.org/10.3158/1557.1
McNeill J, Barrie FR, Buck WR, Demoulin Vincent, Greuter W, Hawksworth DL, Herendeen PS,
Knapp S, Marhold K, Prado J, Prudhomme van Reine WE, Smith GE, Wiersema JH, Turland
NJ. 2012. International Code of Nomenclature for algae, fungi, and plants (Melbourne Code).
Koeltz Scientific Books. 240 p. http://www.iapt-taxon.org/nomen/main.php
Raciborski, M. 1900. Parasitische Algen und Pilze Java's. Botanisches Institut, Buitenzorg. 49 p.
Stevens FL, Manter HW. 1925. The Hemisphaeriaceae of British Guiana and Trinidad. Botanical
Gazette 79(3): 265-296. http://dx.doi.org/10.1086/333477
Wu HX, Li YM, Chen H, Hyde KD. 2010. Studies on Microthyriaceae: some excluded genera.
Mycotaxon 113: 147-156. http://dx. doi: 10.5248/113.147
Wu HX, Schoch CL, Boonmee S, Bahkali AH, Chomnunti P, Hyde KD. 2011a. A reappraisal of
Microthyriaceae. Fungal Diversity 51: 189-248. http://dx.doi.org/10.1007/s13225-011-0143-8
Wu HX, Hyde KD, Chen H. 2011b. Studies on Microthyriaceae: placement of Actinomyxa, Asteritea,
Cirsosina, Polystomellina and Stegothyrium. Cryptogamie Mycologie 32: 3-12.
Zhang Y, Fournier J, Pointing SB, Hyde KD. 2008. Are Melanomma pulvis-pyrius and
Trematosphaeria pertusa congeneric? Fungal Diversity 33: 47-60.
Zhang Y, Wang HK, Fournier J, Crous PW, Jeewon R, Pointing SB, Hyde KD. 2009. Towards a
phylogenetic clarification of Lophiostoma/Massarina and morphologically similar genera in the
Pleosporales. Fungal Diversity 38: 225-251.
Zhang Y, Crous PW, Schoch CL, Hyde KD. 2012. Pleosporales. Fungal Diversity 53: 1-221.
http://dx.doi.org/10.1007/s13225-011-0117-x
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.11
Volume 125, pp. 11-35 July-September 2013
Five Leptonia species from New South Wales
and Queensland, Australia
Davip L. LARGENT’ , SARAH E. BERGEMANN?, SANDRA E. ABELL-DAVIS3,
KERRI L. KLUTING’, & GRIFFIN A. CUMMINGS?
"Biological Sciences, Humboldt State University, 1 Harpst St, Arcata CA 95521 USA
"Biology Department, Middle Tennessee State University,
PO Box 60, Murfreesboro TN 37132 USA
*School of Marine and Tropical Biology, Australian Tropical Herbarium and Centre for Tropical
Environmental & Sustainability Science, James Cook University,
PO Box 6811, Cairns QLD 4870 AU
“CORRESPONDENCE TO:
[email protected]
AsBstTRACT — Descriptions and illustrations are provided for five Leptonia species. ‘Three
species are new to science: Leptonia boardinghousensis possesses unusual basidiomes colours,
L. ambigua has subisodiametric basidiospores that atypically have obscure angles at the apex
and a lignicolous habit, and L. omphalinoides is distinguished by its lignicolous omphalinoid
tiny basidiomes. Two species were previously reported: L. poliopus from Europe and
L. umbraphila comb. nov from the Seychelles.
Key worps — Basidiomycota, Entolomataceae, mtSSU, LSU, RPB2
Introduction
Surveys of species in the Entolomataceae Kotl. & Pouzar were conducted
during April-May of 2010-12 in the temperate rainforests of central New
South Wales and February-March 2009-12 from various localities within
the Wet Tropics Bioregion throughout northeastern Queensland. Among
the 918 entolomatoid collections obtained during the surveys, species of
Leptonia (Fr.) P. Kumm. are numerous. Here we describe three new species,
L. boardinghousensis, L. ambigua, and L. omphalinoides and report L. poliopus
and L. umbraphila new for Australia.
The generic concept of Leptonia remains uncertain, because phylogenetic
analyses do not support monophyly for species included in the genus and
the major sub-clades containing Leptonia spp. lack statistical support (Co-
David et al. 2009, Baroni & Matheny 2011). Until resolution of the generic
12 ... Largent & al.
TABLE 1. Collection identifier and GenBank accession numbers of Leptonia species.
GENBANK ACCESSION NUMBERS
SPECIES COLLECTION mtSSU LSU RPB2
L. boardinghousensis Largent 9875 — JQ756410 JQ756425
Largent 9926 JQ756397 JQ756411 JQ756426
Largent 9935 — JQ756412 JQ756427
Largent 10086 JQ756398 JQ756413 JQ756428
L. ambigua Largent 9872 JQ756399 JQ756414 JQ756429
Largent 10130 — JQ756415 JQ756430
L. omphalinoides Largent 9673 JQ756400 JQ756416 JQ756431
Largent 9800 JQ756401 JQ756417 JQ756432
L. poliopus Largent 10209A JQ756402 JQ756418 JQ756433
Largent 10209B JQ756403 JQ756419 JQ756434
Largent 10209C JQ756404 JQ756420 JQ756435
L. umbraphila Largent 9629 JQ756405 _ JQ756436
Largent 9630 JQ756406 JQ756421 JQ756437
Largent 9640 JQ756407 JQ756422 JQ756438
Largent 9766 JQ756408 JQ756423 JQ756439
Largent 9793 JQ756409 JQ756424 JQ756440
and phylogenetic concepts, we follow Largent (1994), who recognizes the
following combination of morphological characters for Leptonia: a habit that
is typically mycenoid, collybioid, omphalinoid, or (rarely) tricholomatoid; a
pileus that is squamulose or tomentulose to tomentose at least on the disc; a
convex, parabolic, broadly convex, or convex-depressed pileus shape; pileipellis
typically composed of erect hyphae at least on the discs of young basidiomes;
inflated pileocystidia averaging >10 um in diameter; lipoid globules and
oleiferous hyphae absent or (if present) not abundant; aborted basidia typically
absent.
Materials & methods
Macromorphological and micromorphological features
Colors of basidiomes were described subjectively and coded according to Kornerup
& Wanscher (1978: 196-225, Diagrams Section), with color plates noted in parentheses.
In descriptions color plates are abbreviated to indicate the page number, column(s),
and row(s) [e.g., 83D-F5-6 = page 8, columns D-F, rows 5-6.] Common color names
are from the charts at the top of each page, with technical color names enclosed by
quotation marks at the bottom of each page in the Color Names subsection [e.g., the
common name for plate 1, column A, row 2 is yellowish white, and the technical name
is ‘milk white’].
Measurements include: the arithmetic means (x) of spore lengths and widths +
one standard deviation in N objects measured; the quotient of spore length by width
(E) indicated as a range variation in N objects measured and the mean of E-values (Q)
Leptonia spp. & comb. nov. (Australia) ... 13
+ standard deviations. The sample size (N) equals the total number of microscopic
structures measured (x) and number of basidiomes studied (y) and follows the format
N = x/y. The following Q values define general basidiospore shape: isodiametric—Q =
1.0-1.15; subisodiametric—Q = 1.16-1.27; heterodiametric—Q >1.27 (Largent 1994).
The techniques and equipment for collecting data in the field, measuring
basidiospores, and obtaining digital photographs of microscopic features follow Largent
et al. (201 1a).
All collections from New South Wales cited in the ‘Additional collections examined’
are deposited in The Plant Pathology Herbarium, Orange Agricultural Institute (DAR);
Queensland collections were split, with duplicates deposited in the Australian Tropical
Herbarium (CNS) and The Queensland Herbarium (BRI). All holotype and isotype
collections are deposited in the herbaria designated using acronyms used in ‘Thiers
(2012).
DNA sequences
DNA extraction and Polymerase Chain Amplification (PCR) protocols for the
mitochondrial small subunit of the ribosomal DNA (mtSSU), variable domains (D1,
D2) of the nuclear large subunit (LSU), and the second largest subunit of the RNA
polymerase gene (RPB2) follow Largent et al. (2011, 2013). For RPB2 amplification
we used primers rpb2-i6f and rpb2-i7r (Co-David et al. 2009). Alternatively, we used
additional forward RPB2 primers (rpb2-EntF1 and rpb2-EntF2; Largent et al. 2013) in
combination with one of three reverse primers: rpb2-EntR1b (5' to 3'- ATG GAT YTC RCA
RTG TGT CCA), rpb2-EntR2 (5’ to 3'— GTG GAT TTC RCA RTG AGT CCA), or rpb2-EntR4
(5' to 3' - TGA ATY TCR CAR TGC GTC CCA). Sequences were generated on an Applied
Biosystems 3130xl Genetic Analyzer at Middle Tennessee State University using the
sequencing and precipitation protocols outlined in Largent et al. (2011a,b). Accessions
for sequences obtained from the three genes are provided in TaBLE 1.
Taxonomy
Leptonia boardinghousensis Largent, sp. nov. PLATEs 1-2
MycoBank MB 802806
Differs from Inocephalus quadratus by its basidiome colors, long rostrate-ventricose
opaque hymenial cystidia, and heterodiametric 6-7(-8)-angled basidiospores.
Type — Australia, New South Wales, Watagans National Park, Boardinghouse Dam
Track within 20 m of 32°59'57"S 151°24'15"E, 12 April 2011, DL Largent 10086
(holotype, DAR).
Erymo.ocy — referring to Boardinghouse Dam Track in Watagans National Park.
PitEus 8-40 mm broad, 3-14 mm high, dull, always opaque (not translucent)
and not hygrophanous; in young basidiomes convex to broadly convex then
broadly parabolic, irregularly campanulate, plano-convex, and eventually
uplifted, rarely obscurely umbonate in expanding and maturing basidiomes; at
first entirely tomentulose or tomentulose-squamulose, in expanding basidioma
remaining tomentulose to tomentulose-squamulose on or near the disc,
squamulose towards the margin and appressed-fibrillose-striate at the margin,
14 ... Largent & al.
eventually in mature forms becoming appressed-fibrillose and then striate and
rimose from the margin to near the disc; entirely orange (6A6) in young and
protected basidiomes, in exposed basidiomes the tomentum, squamules, and
fibrils at first dark brown with a reddish tone (7 or 8F6-7), becoming a bit
lighter (7 or 8E5-7) and eventually fading to light brown (6-7C-D3-6); margin
incurved to more typically decurved then uplifted, eventually wavy to lobed and
split in mature forms; context reddish white to pale red (6-7A-B2-5) becoming
more reddish in a rimose surface, 0.5-1.0 mm thick above the stipe, nearly non-
existent at the margin. ODoR weakly fungal, at times faintly pleasant or fragrant.
TasTE slightly unpleasant or bitter and astringent. LAMELLAE 3-20 mm long,
1-7 mm deep, adnexed, close to subdistant and narrow to moderately broad at
first, then subdistant and sigmoid, ventricose, or broad with maturity, at first
pinkish white (6-7A2) darkening to brownish orange (5-7A3) and then pale
red to pastel red (7A, B or C3-4) with basidiospore maturity; margin typically
smooth and concolorous, in some lighter colored and faintly fimbriate. STIPE
25-72 mm long, 0.75-5.0 mm broad at apex, middle, and base, in some flattened
and longitudinally grooved and then at the apex 5-6 x 2 mm at the apex, 4 x 2
or 5 x 4mm broad in the middle, and 3 x 2.5 or 5 x 4 mm broad at base, equal
to often tapered with the apex smaller or in one with the base smaller, pruinose
at the apex, smooth to the eye but weakly longitudinally striate under 10x, at
first pale orange to pale red (5-7A3-4), remaining so at the apex, but darkening
(5-7A-B3-5) with maturity; hollow, typically sturdy and stiff, rarely fragile
and splitting longitudinally; basal tomentum white, typically at first scarce,
often remaining so with age but at times becoming moderate to abundant in
basidiomes in deep humus, rarely absent and then only in exposed basidiomes
found in shallow or compacted humus along trails. BRUISING REACTIONS stipe
browning when handled.
BASIDIOSPORES in profile view 6-7(-8)-angled, angles somewhat knobby,
subheterodiametric to heterodiametric, in end view 6-angled and isodiametric,
8.1-11.7 x 6.0-8.9 um (x = 9.7 + 0.7 x 7.2 + 0.53 um; E = 1.13-1.62; Q = 1.36
+ 0.10 (heterodiametric); N = 112/4). Basip1a clavate, 4-sterigmate, in some
with fairly large granules, 32.1-43.5 x 6.4-11.2 um (x = 38.6 + 3.9 x 9.6 + 1.6
um; E = 3.5-5.2; Q = 4.1 + 0.60; N = 13/2). CHEILOCysTIDIA versiform, clavate,
obclavate, clavate and acuminate, ventricose-rostrate, or ventricose-rostrate
with the rostrum strangulated and tapered, thin-walled to slightly thick-walled,
colorless, scattered to abundant, 51.3-111.4 x 10.1-32.1 um (E = 3.16-6.30;
Q = 4.2 + 0.77; N = 15/2). PLEUROCYSTIDIA as pseudocystidia, similar in shape
but typically longer than the cheilocystidia, often originating from the outer
portions of the lamellar trama, not associated with the oleiferous hyphae,
opaque but colorless, 81.3-147.6 x 12.5-18.5 um (E = 3.6-7.6; Q = 5.5 + 1.4;
N = 11/2). LAMELLAR TRAMAL HYPHAE subparallel, rather long and broad,
Leptonia spp. & comb. nov. (Australia) ... 15
PLATE 1. Leptonia boardinghousensis {DLL 10086 holotype}. A: Basidiomata habit; B: Lamellar
attachment (note whitish edges on maturing lamellae and pruinose stipe apex); C: Pileus surface,
mature surface tomentulose to tomentulose-squamulose on the disc, appressed fibrillose elsewhere
(left), immature surface, entirely tomentulose (right). Bar (A-C) = 10 mm.
16 ... Largent & al.
without lipoid globules, 49.1-305.2 x 3.7-32.2 um (N = 14/2). PILEIPELLIS a
layer of entangled hyphae, in young basidiomes more or less erect, in older
basidiomes erect to suberect in the center of pileus and semi-erect towards the
margin, and repent at the margin. PILEOcysTIDIA cylindro-clavate to clavate to
broadly clavate, 27.8-180.6 x 6.0-19.8 um (E= 2.0-13.5; Q = 6.6 + 3.8; N= 18/3).
PILEAL TRAMAL HYPHAE entangled, similar in size and shape to the lamellar
trama. STIPITIPELLIS with rare to scattered clusters of hymenial elements at
the apex, a cutis elsewhere. CAULOCYSTIDIA absent. OLEIFEROUS HYPHAE rare,
scattered, or absent in the pileal and lamellar trama. Lrpoip GLOBULEs absent.
BRILLIANT GRANULES absent. PIGMENTATION in the pileipellis cytoplasmic
as well as faintly externally incrusted on the outer hyphal walls. Clamp
CONNECTIONS absent in all tissues.
ECOLOGY & DISTRIBUTION — Rarely solitary, more often scattered,
gregarious, or even caespitose in soil amongst leaf litter, in wet sclerophyll,
warm temperate gallery rainforest; central or northern Hunter District, New
South Wales, April-May.
ADDITIONAL COLLECTIONS EXAMINED — AUSTRALIA. New SoutH WALES, central
Hunter District, Barrington Tops National Park, Williams River Day Use Area, end of Blue
Gum Track, 32°09'03.4"S 151°31'35.1"E, 14 April 2010, DL Largent 9875; 32°09'08'.3"S
151°31'37.0"E, DL Largent 9877; 32°09'03.2"S 151°31'23.6”E, 18 April 2010, DL Largent
9894; 32°09'03.2"S 151°31'23.6"E, 4 May 2011, DL Largent 10193. Williams River Day
Use Area, Track to Pool of Reflections, 32°08'15.8"S 151°30'38.2"E, 22 April 2010, DL
Largent 9935. Myall Lakes National Park, Seal Rock Road, 32°25'08"S 152°28'26"E, 6
May 2011, DL Largent 10203. Watagans National Park, Boardinghouse Dam Track,
32°59'57.7"S 151°24'15.9"E, 13 April 2010, DL Largent 9867; 32°59'57.8"S 151°24'15.4”E,
21 April 2010, DL Largent 9926; 32°59'57.7"S 151°24'15.8"E, 28 April 2010, DL Largent
9958; 32°59'58.2"S 151°24'15.4"E, DL Largent 9959; 32°59'59'.2"S 151°24'16.3"E, DL
Largent 9960; 33°00'00.7"S 151°24'17.3"E, DL Largent 9961; 32°59'57"S 151°24'17"E, 23
April 2011, DL Largent 10144, 10145; 32°59'57"S 151°24'17"E, 1 May 2011, DL Largent
10175.
DISTINCTIVE CHARACTERS — ‘The basidiome color changes of orange then
pinkish to reddish in the stipe, orange then dark brown with a reddish tone in
the pileus, pinkish white in the lamellae, and reddish white to pale red in the
pileal context; an entirely tomentulose pileal surface at first that becomes striate
to the margin with maturity; basidiospores 6-7-angled and averaging <10 um
x <7.5 um; versiform hymenial cystidia; and clampless hyphae.
ComMENTs — In 2010 and 2011, several L. boardinghousensis populations of
10-20 basidiomes each were common throughout the Boardinghouse Dam
PLATE 2. Leptonia boardinghousensis {DLL 9925 A-B, D; DLL 9867 C,E}. A: Basidiospores; B: Faintly
incrusted pigment on hyphae of pileipellis; C: Pileipellis and pileocystidia near pileal margin;
D: Cheilocystidia, pleurocystidia, and oleiferous hyphae in lamellar trama; E: Ventricose-rostrate
pleurocystidia with rostrum strangulated and tapered, basidia with sterigma, basidioles in squash
mount. Bars: A = 5 um; B = 25 um; C = 25 um; D = 40 um; E = 25 um.
17
Leptonia spp. & comb. nov. (Australia) ...
18 ... Largent & al.
Track in Watagans National Park. Collections found in relatively deep humus
and protected by a dense overstory regularly consisted of large basidiomes
with pilei up to 40 mm broad and stipes 35-75 mm long and with orange
colors dominant. Collections in more open areas with less humus consistently
produced smaller pilei (<28 mm broad) and shorter stipes (25-55 mm long)
with brown to reddish brown color predominating.
The pantropical Inocephalus quadratus (Berk. & M.A. Curtis) T.J. Baroni
resembles L. boardinghousensis macroscopically but differs microscopically in
its cuboidal basidiospores and cylindro-clavate to clavate cheilocystidia (Baroni
& Halling 2000, Noordeloos & Hausknecht 2007).
Leptonia ambigua Largent, sp. nov. PLATES 3-4
MycoBank MB 802807
Differs from Leptonia tjallingiorum by smaller basidiomes, the dark greyish violet to
blackish blue pileus, the subisodiametric basidiospores, and the absence of cheilocystidia
and clamp connections in the pileipellis.
Type — Australia, New South Wales, Barrington Tops National Park, end of Blue Gum
Track, within 20 m of 32°09'03.8"S 151°31'30.2"E, 21 April 2011, DL Largent 10130
(holotype, DAR).
EryMo_ocy — derived from the Latin ambiguus (= ambiguous), referring to the obscure
angles at the apex of some basidiospores.
PitEus 8-33 mm broad, 5-10 mm high; opaque and not translucent, not
hygrophanous; typically plane, at times obscurely umbonate, never depressed;
when young convex to parabolic, upon expansion and maturity becoming
broadly convex and eventually plane; at first entirely densely matted fibrillose
to matted tomentulose then remaining matted tomentulose in the center and
becoming appressed squamulose elsewhere, and eventually appressed fibrillose
at or near the margin, not striate; at first entirely dull violet to near dark violet to
between dark greyish violet and blackish blue (18E4 or 19E-F3-4), remaining
so on the disc but the squamules and fibrils fade to greyish lilac (16D2) or
purplish grey (14-15C2), eventually the violaceous color fades completely and
the pileus becomes brown (6-7D-F3-4); context pallid, 1 mm thick above the
stipe, nearly non-existent at the margin; margin decurved then plane. ODOR
indistinct. TAsTE indistinct, mild. LAMELLAE 5-13 mm long, 1-5 mm deep,
adnexed or narrowly adnate at all times, close then subdistant, narrow then
moderately broad, at first violet white (18A2), quickly becoming reddish grey
(7A2), then white to orange white (5-7A1-2), and eventually pale brownish
orange (6C4) with basidiospore maturity; margin smooth and concolorous.
STIPE 22-54 mm long, apex 1-3 mm broad, base 1-4 mm broad, equal to
slightly enlarged towards the base, longitudinally appressed fibrillose except
for the pruinose apex, at first the fibrils dull violet (18E4, 18D3-4) then violet
grey (16D2 or 16B2) and eventually dull red (9B3) or reddish grey (9C2);
Leptonia spp. & comb. nov. (Australia) ... 19
by
F/I A = se
Hey \ (i Ww; ad 4 i
AI
a
PLATE 3. Leptonia ambigua {DLL 10130 holotype}. A: Basidiomata stature, mature (left), young
(right); B: Pileus surface, young (right), maturing (to the left); C: Lamellae and stipe color; young
(right), mature (far left). Bar (A-C) = 10mm.
hollow and somewhat stiff; basal tomentum moderate to scarce, white at first,
then yellowish. BRUISING REACTIONS pileus, lamellae, and stipe none; basal
tomentum at time becoming orangish.
20 ... Largent & al.
BASIDIOSPORES isodiametric to heterodiametric, in profile and dorsiventral
views, 5-angled, all angles usually distinct but at times distinctly angular on
the basal end and obscurely angular or rounded at the apex, isodiametric and
5-6-angled in polar view, 6.2-8.3 x 5.2-7.5 um (x = 7.5 + 0.4 x 6.3 + 0.5 um;
E = 1.04-1.40; Q = 1.19 + 0.09 (subisodiametric); N = 59/2). BAsip1a clavate,
hardly tapered at the base, full of granules just before spore production,
27.1-40.0 x 7.1-11.8 um (x = 33.2 +3.4x 9.3 + 1.2 um; E = 3.11-4.56; Q = 3.59
+ 0.34; N = 18/2); 4-sterigmate with the sterigma up to 8.0 um long. HYMENIAL
CysTIpIA absent. LAMELLAR TRAMAL HYPHAE subparallel, in the center of the
lamella mostly short to moderately long, a few long in the center of the lamellae,
hyphae with rounded ends, 41.4-320.0 x 7.8-22.2 (N = 16/2). PILEIPELLIS
an entangled layer of hyphae composed of + moniliform chains of 3-4 cells,
the chains entangled, more or less erect on the disc, suberect and in clusters
elsewhere with a cutis between the clusters, up to 400 um thick on the disc,
205 um near the disc. PILEOcysTIpDIA present as the terminal cells of a chain of
cells, consistently broad, clavate to cylindro-clavate, 33.7-111.7 x 9.8-21.3 um
(x= 15.0 + 3.2u wide; E = 2.55-6.80; Q = 4.13 + 1.32; N = 16/2). PILEAL TRAMAL
HYPHAE Similar in shape but shorter and broader than the lamellar trama,
57.5-155.4 x 9.8-22.2 um (N = 7/1). STIPITIPELLIS a layer of hyphae similar in
structure to pileipellis everywhere except at the apex where there are clusters of
colorless caulocystidia with a few basidia present. CAULOCYSTIDIA at the apex,
colorless, in clusters, pyriform to broadly clavate to broadly cylindro-clavate
23.9-108.1 x 8.5-20.2 um (E = 1.81-12.73); N = 16/2); elsewhere cylindro-
clavate to clavate, similar in size, shape, and pigmentation as the pileocystidia.
OLEIFEROUS HYPHAE absent. LIPOID GLOBULES absent. BRILLIANT GRANULES
scattered. PIGMENTATION cytoplasmic and intracellular, brownish and insoluble
in 3% KOH in the pileo- and caulocystidia; faintly parietal or incrusting in the
lower portion of the pileipellis. Clamp CONNECTIONS present at the base of the
basidia; absent in all other tissues.
ECOLOGY & DISTRIBUTION — Typically gregarious, rarely scattered but
rarely caespitose, on decomposing logs and in mosses in a subtropical gallery
rainforest, Barrington Tops National Park, New South Wales. In April 2009 and
2010 several different populations were common on decaying logs in various
localities towards the end of the Blue Gum Track in the Williams Day Use
Area. Each population produced approximately 50-100 basidiomes typically in
acrocarpous mosses resembling a species of Dicranum Hedw.
ADDITIONAL COLLECTIONS EXAMINED — AUSTRALIA. NEw SouTH WALES, central
Hunter District, Barrington Tops National Park, Williams River Day Use Area, end
of Blue Gum Track, 32°09'03.2"S 151°31'28.6"E, 8 April 2010, DL Largent 9847;
32°09'10.7"S 151°31'38.3"E, 14 April 2010, DL Largent 9872, 9881; 32°09'04.7"S
151°31'34.1"E, 18 April 2010, DL Largent 9899; 32°09'05.0"S 151°31'30.6"E, 20 April
2010, DL Largent 9914.
Leptonia spp. & comb. nov. (Australia) ... 21
PLATE 4. Leptonia ambigua {DLL 10130 holotype C-E; DLL 9872 A-B}. A: Basidiospores; B: Basidia
and basidioles; C: Pileipellis and terminal pileocystidia with uniform brownish cytoplasmic
pigment in 3% KOH; D: Parietal pigmentation in pileipellis; E: Stipitipellis at stipe apex with
pyriform caulocystidia; F: Stipitipellis at stipe apex with clavate cheilocystidia. Bars: A = 5 um;
B= 10 um; C-D = 15 um; E= 10 um.
22 ... Largent & al.
DISTINCTIVE CHARACTERS — Habitat on decomposing logs covered with
mosses; convex dark greyish violet pileus that becomes brown with maturity;
violet-white lamellae at first; dull violet stipe that becomes grayish violet with
age; subisodiametric basidiospores, distinctly angular except at times obscurely
angular at the apex; two types of caulocystidia at the stipe apex; the broad
tramal hyphae in the lamellae; and no clamp connections in the pileipellis.
ComMENTS — Its basidiome colors and stature, pileipellis type, and brownish
cytoplasmic pigment cause L. ambigua to resemble several lignicolous species
in Leptonia subg. Leptonia.
Entoloma obtusisporum E. Horak from Brazil also has obtusely angular
basidiospores and lacks cheilocystidia but differs from L. ambigua by its white
smooth stipe, lack of parietal pigmentation, and slightly smaller, isodiametric
basidiospores that are 5.5-7.0 um in all dimensions (Horak 1982). Rhodophyllus
dichrooides Romagn. & Gilles from Gabon (Romagnesi & Gilles 1979), the
European L. dichroa (Pers.) P.D. Orton (Noordeloos 1992), and L. euchroa (Pers.)
P. Kumm. from Europe and Australia (Noordeloos 1992, May & Wood 1997)
are differentiated by their heterodiametric angular basidiospores and abundant
clamp connections in the pileipellis. Leptonia tjallingiorum (Noordel.) P.D.
Orton from Europe is differentiated from L. ambigua by larger tricholomatoid
basidiomes, abundant cheilocystidia, heterodiametric basidiospores, abundant
clamp connections, and the absence of blue-black or dark violet colors in the
pileus (Noordeloos 1992, 2004).
Leptonia omphalinoides Largent, sp. nov. PLATES 5-6
MycoBAnk MB 802808
Distinct in the Entolomataceae by the lignicolous omphalinoid small basidiomes, small
quadrate or cuboidal basidiospores, and clampless hyphae.
Type — Australia, northern Queensland, Mossman National Park, lower Track just past
observation platform, within 20m of 16°28'17.6"S 145°19'51.7"E, 18 March 2010, DL
Largent 9800 (holotype, BRI ; isotype, CNS).
EryMoLocy — from the Greek ending “-oides” referring to the omphalinoid basidiome
stature.
PiLEus 6-11 mm broad, 2-4 mm high; opaque, not hygrophanous; convex to
broadly convex, umbilicate; minutely tomentulose to scabrous and punctate
on disc, minutely squamulose with the squamules erect towards the margin,
appressed-fibrillose on the margin, striate to the disc, dull; disc reddish brown
(8F4 to 8F7 ‘mahogany brown’), elsewhere reddish brown but a little lighter
than the disc (8-9E-F6-7), eventually remaining dark brown on the disc
but fading to greyish brown with a reddish tint elsewhere (8E-F3-4; margin
decurved, minutely hairy then crenulate; context dark and less than 0.5 mm
thick above the stipe. Opor indistinct. TasTE indistinct. LAMELLAE up to
Leptonia spp. & comb. noy. (Australia) ... 23
PLaTE 5. Leptonia omphalinoides {DLL9800 holotype A,B; DLL 9373 C}. A: Basidiomata stature;
B: Pileal surface of young, dark basidiome; C: Pileal surface light form mature. Bar (A-C) = 2 mm.
24 ... Largent & al.
12 per basidiome, 4-5 mm long, 1-1.5 mm deep, pallid greyish to off white
when young, subdecurrent to decurrent, narrow, subdistant to distant; margin
smooth and concolorous; lamellulae 1 to 3 between lamellae, in 1-2 tiers,
1 short or 2 short and 1 medium. STIPE 9-17 mm long, <1 mm broad, equal,
glabrous, reddish grey to light dull red (8-9A1-2 or 8-9C2-3), hollow and very
fragile; basal tomentum absent. BRUISING REACTIONS none.
BASIDIOSPORES consistently 4-angled, quadrate and small in all views, rarely
cuboid, angles distinct and at times somewhat elongated and suggestively
prismatic, isodiametric in polar views, subisodiametric to heterodiametric in
profile and basal views, 4.6-8.4 x 3.7-6.7 um (x = 6.1 + 0.9 x 5.2 + 0.7 um; E =
1.00-1.52; Q = 1.19 + 0.12 (subisodiametric); N = 54/2). Basip1A clavate to
subclavate, 21.5-34.8 x 7.2-11.3 um (x = 28.4 + 3.7 x 9.4 + 1.0 um; E = 2.2-4.1;
Q = 3.09 + 0.50; N = 24/2); base 3.1-5.1 um; 4-sterigmate, sterigma 2.4-3.6
um long. CHEILOCYSTIDIA and PLEUROCYSTIDIA abundant, particularly on
the decurrent portion of the lamellae, and morphologically similar, colorless,
versiform (cylindric, acicular, narrowly to broadly rostrate-ventricose),
27.3-49.1 x 4.3-13.0 um (x = 41.0 + 4.9 x 84 + 2.2 um; E = 5.20-10.19;
Q = 5.20 + 1.75; N = 21/2). LAMELLAR TRAMAL HYPHAE relatively small,
37.6-88.1 x 2.4-14.1 um (N= 12/2). PILEIPELLIS 80-119 um thick, badissima-type
with laterally agglutinated, entangled hyphae but without collapsed cylindro-
clavate cells, composed of only 1-3 cells; PrLEocystip14 broadly clavate to
broadly cylindro-clavate, on the disc 14.3-96.3 x 4.0-23.1 um (x = 56.5 + 14.3 x
14.5 + 4.0 um; E = 1.2-6.8; N = 16/2), away from the disc 29.5-135.5 x 6.1-24.5
um (x = 76.7 + 29.5 x 17.2 + 6.1 um; E = 2.5-10.6; N = 11/1). PILEAL TRAMAL
HYPHAE small, not very long, and so thin as to appear non-existent in sections,
50.3-63.7 x 9.5-11.9 um; N = 3/1). STIPITIPELLIS with hymenial elements at
or next to decurrent lamellae, and otherwise a cutis. CAULOCYSTIDIA absent.
STIPE TRAMAL HYPHAE felatively small, 47.7-116.1 x 6.04-15.4 um (N = 9/2).
OLEIFEROUS HYPHAE rare in the trama. LIPOID GLOBULES absent. BRILLIANT
GRANULES abundant in the basidia. PIGMENTATION very dark brown and in
large granules to plaque-like areas in the pileipellis, suggestively parietal in
pileal trama. CLAMP CONNECTIONS absent in all tissues.
ECOLOGY & DISTRIBUTION — Scattered on a single large decaying log, at
the end of Marrdja Walk about 100 yards from the parking lot, Tribulation
Section, Daintree National Park, and on piece of wood at base of a boulder on
a ridge above an observational platform, lower river trail, Mossman National
Park; mid-March.
ADDITIONAL COLLECTIONS EXAMINED — AUSTRALIA. QUEENSLAND, Cook Region,
Daintree National Park, Tribulation Section, 16°08'18.5"S 145°26'26.0"E, 20 March
2009, DL Largent 9673.
DISTINCTIVE CHARACTERS — Small lignicolous omphalinoid basidiomes;
striate pileus; badissima-type pileipellis lacking collapsed cylindro-clavate
Leptonia spp. & comb. nov. (Australia) ... 25
.4 a * :
*
B :
SEE ~ _
_) -
ia
* ad
«
. oo
_ :
- .
:
'
- :
= -
ww _
-. r < a .
f " ‘ _ :
. 8
PLaTE 6. Leptonia omphalinoides {DLL 9800 holotype E; DLL 9673 A - D}. A: Basidiospores;
B: Basidia with globules; C: Obclavate cystidium; D: Basidium, cystidium becoming rostrate-
ventricose, vesiculate cystidium; E: Pileipellis near disc, cylindro-clavate, clavate to broadly
cylindro-clavate pileocystidia with dark brown cytoplasmic pigment in plaque-like areas. Bars:
A = 6 um; B-D = 10 um; E = 20.0 um.
26 ... Largent & al.
pileocystidia; versiform hymenial cystidia; small 4-sterigmate basidia; dark
brown plaque-like pigment in the pileipellis and suggestively parietal in
the pileal trama; clampless hyphae; 4-sided subisodiametric basidiospores
averaging <6.5 um x <5.5 um.
Comments — Eccilia cubensis Murrill from Cuba and Entoloma brunneostriatum
Dennis from Trinidad also have small, omphalinoid basidiomes and small
basidiospores. Eccilia cubensis differs from L. omphalinoides by its octahedral,
larger basidiospores (7-9 um), innately scaly pileus lacking striations, and
slightly granular floccose stipe (Murrill 1911), while Entoloma brunneostriatum
differs in its larger (7-8 x 6-8 um) basidiospores, lack of hymenial cystidia, and
smooth pileus and stipe (Dennis 1953).
Leptonia poliopus (Romagn.) P.D. Orton, Mycologist 5: 134 (1991). PLATES 7-8
= Entoloma poliopus (Romagn.) Noordel., Persoonia 10: 262 (1979).
PILEUS 9-22 mm broad, 1-2 mm high, dull; striate to the disc, suggestively
translucent; depressed, convex then broadly convex; when young entirely
tomentulose, with expansion and maturity remaining tomentulose on the disc
but forming squamules from the disc to the margin, eventually appressed-
fibrillose to nearly glabrous at or near the margin; at first greyish brown (6F3,
negro’) on the disc to a bit lighter brown elsewhere (6F3-4, between ‘negro’
and ‘chocolate brown’), upon expansion retaining the greyish brown (6F3)
color in the disc and in the striations but becoming dark brown (6F6, “burnt
umber’ or ‘vandyke brow) from near the center to the margin as the context
shows through the areas between the squamules and the fibrils, hygrophanous
between the marginal area and the center and thus becoming brownish orange
to orange white (5 or 6C3 to 5-6A-B2-3); margin incurved to decurved then
decurved, plane, and finally uplifted, even; context <1 mm deep, concolorous
with the surface. ODor typically mild and indistinct, at times faintly fragrant.
TasTE typically mild to nearly bitter. LAMELLAE 4-10 mm long, 2-3 mm deep,
broadly adnexed to adnate with a faint decurrent tooth or faintly subdecurrent,
subdistant, moderately broad, pallid or off-white at first (5-6A2); margin in
young and moderately aged basidiomes, smooth to the eye but at 10x minutely
serrulate and thus cystidiate, typically concolorous, sometimes with a faint
greyish line or with a distinct black to brown-black margin on some but not
all lamellae, in mature specimens often appearing smooth when the marginal
cystidia are collapsed. LAMELLULAE typically 3 (2 short, 1 moderately long)
between lamellae, at times up to 7 (4 short, 2 moderately long, 1 long). STIPE
20-47 mm long, 1-2 mm broad at apex, 2-4.0 mm broad at base, subclavate,
+ shiny, glabrous, at first dark violet or bluish grey (18-19F3) quickly becoming
grey or dark brownish grey (5F1 to 6F2) but with a bluish grey tinge, glabrous,
hollow, cartilaginous, relatively fragile; basal tomentum white, scarce to
moderate. BRUISING REACTIONS absent.
Leptonia spp. & comb. nov. (Australia) ... 27
-. .
PLATE 7. Leptonia poliopus {DLL 10209a)}. A: Basidiomata field (1.5); B: Lamellae ; C: Pileal surface.
Bar (A-C) = 10 mm.
BASIDIOSPORES 5-6-angled, angles distinct, apex typically with a single
rounded angle, nearly heterodiametric to typically heterodiametric in profile
and dorsiventral view, 8.5-13.5 x 6.0-9.4 um (x = 10.6 + 1.0 x 7.8 + 0.6 um;
E=1.1-1.8; Q= 1.40 + 0.12; N= 144/4). Basip1a broadly clavate, hardly tapered,
28 ... Largent & al.
with abundant granules prior to spore production, 25.9-44.0 x 7.9-13.1 um
(x = 33.4+ 4.3 x 10.3 + 1.2 um; E = 2.54-4.10; Q = 3.27 + 0.42; N = 48/3);
2 or 4-sterigmate, sterigma up to 6.0 um long. CHEILOCYSTIDIA as terminal
cells of branched hyphae in the hymenophore, abundant and forming a sterile
layer, typically colorless but in 3% KOH with a brownish cytoplasmic pigment
in specimens with marginate edges, broadly clavate to clavate, 27.2-67.1 x
10.7-20.9 um (x= 41.6 + 11.7 x 14.4+2.7 um; E=2.9-5.0; Q=2.9 + 0.8; N= 26/3)
or rarely cylindro-clavate and then 21.3-67.1 x 4.9-10.1 um (x = 41.1 + 10.5 x
7.9 + 1.6 um; E = 2.3-9.2; Q = 5.5 + 2.0; N = 31/4), both clavate and cylindro-
clavate cystidia present in same specimen (DLL 10209a and DLL 10209c) or
cylindro-clavate entirely (DLL 10209b). PLEUROcystTip1A absent. LAMELLAR
TRAMAL HYPHAE subparallel, with rounded to + straight end cells, 76.9-291.1
x 5.7-19.1 um; E 4.6-23.4; N = 12/2). PILEIPELLIS always a palisadoderm in
the pileus disc, an entangled layer of hyphae with inflated terminal cells, at
times with the terminal 2 to 3 cells inflated, 66-125 um deep. PILEOCYSTIDIA
in the disc broadly clavate, rarely nearly napiform, often long clavate, 33.6-99.4
x 14.2-29.9 um (x = 54.8-15.1 x 20.4 + 4.5 um; E = 1.6-6.3; Q = 2.8 + 1.1;
N = 25/2). PILEAL TRAMAL HYPHAE similar to those of the lamellar trama,
91-272 x 4-20 um; N = 6/1. OLEIFEROUS HYPHAE rare in the lamellar trama.
LIPOID GLOBULES absent. BRILLIANT GRANULES absent. PIGMENTATION
plasmatic, brownish in the pileipellis; absent to faintly brownish to brownish in
the cheilocystidia. CLAMP CONNECTIONS absent in all tissues.
ECOLOGY & DISTRIBUTION — Several basidiomes frequently encountered
in leaf humus or in bare soil under ferns or among rocks along the edge of
the trail; basidiomes in one collection scattered, often gregarious. In early May
2011, numerous basidiomes (8-20 per collection) were found in Strickland
State Forest in soil and humus and in protected areas near creeks, tracks, or
roads.
ADDITIONAL COLLECTIONS EXAMINED — AUSTRALIA. NEw SouTH WALES, central
Hunter District, Strickland State Forest, Lower Parking Lot. Within 20 m of 33°22'45"S
151°19'32"E, 7 May 2011, DL Largent10209a, 10209b, 10209c.
DISTINCTIVE CHARACTERS — Greyish brown pileus, striate to the disc; pallid
to off-white lamellae with concolorous or black to brown-black margins; bluish
TABLE 2. Comparison of macromorphology and micromorphology of
Leptonia poliopus collections
BASIDIOSPORE (average)
COLLECTION LAMELLAR MARGIN
LENGTH WIDTH
Largent 10209a Colorless, serrulate 11.0 um 8.0 um
Largent 10209b Black, smooth 10.4 um 7.6 um
Largent 10209c Black, serrulate 10.0 um 7.5 um
Leptonia spp. & comb. nov. (Australia) ... 29
PLATE 8. Leptonia poliopus {DLL 10209b A, C-E; DLL 10209c B}. A: Basidiospores; B: Cheilo-
cystidia; C: Basidia; D: Pileocystidia; E: Palisadoderm on pileal disc. Bars: A= 5 um; B-C = 15 um;
D = 10 um; E = 25 um.
grey to dark violet stipe that quickly becomes grey to brownish grey; 5-6-angled,
heterodiametric basidiospores measuring 8.5-13.5 x 6.0-9.4 um and averaging
>10 um x <8.0 um; clavate to broadly clavate cheilocystidia; clampless hyphae.
ComMMENTS — Three collections of Leptonia poliopus were made in Strickland
State Forest, each differing in the lamellar margin characteristics, type of
cheilocystidia, and average basidiospore size (TABLE 2). As overall sequence
similarity from all three loci was 100%, we conclude that these three collections
represent the same taxon. The composite description above is drawn from the
three collections and matches descriptions of European collections that may
form concolorous or brown- marginate lamellar edges (Noordeloos 1992,
2004).
30 ... Largent & al.
Entoloma asprellopsis G.M. Gates & Noordel. from Tasmania also shows
the same lamellar margin variations but differs from L. poliopus in its blue-
grey lamellae and slightly smaller (9-12 x 6-8 um) basidiospores. Entoloma
griseosquamulosum G.M. Gates & Noordel. differs by its smaller basidiospores,
concolorous lamellar edges, a pileus margin that is opaque or only translucent-
striate at the very edge, and a saliva-inducing taste (Noordeloos & Gates 2012).
Entoloma asprelloides G. Stev. from New Zealand and E. fuscomarginatum
(Cleland) E. Horak (nom. illegit.) and E. fuscum (Cleland) E. Horak from
Australia all have similar-sized basidiospores but differ from L. poliopus
by their concolorous pileus and stipe (Horak 1973, 1980). Additionally,
E. fuscomarginatum (as “rubromarginatum”) and E. fuscum lack cheilocystidia
(Grgurinovic 1997). Other taxa with features similar to L. poliopus are
discussed at the end of the descriptions for E. saponicum, E. asprellopsis, and
E. griseosquamulosum (Noordeloos & Gates 2012),
Leptonia poliopus is not easy to differentiate from other species, in part
because of the large number of morphologically similar species (Horak 2008:
186; Largent 1994: 146-152; Noordeloos 2008: 114; Noordeloos & Gates 2012:
287). Phylogenetic analyses should help to clarify species boundaries in future
studies.
Leptonia umbraphila (Noordel. & Hauskn.) Largent, comb. nov. PLATES 9-10
MycoBank MB 802809
= Entoloma umbraphilum Noordel. & Hauskn., Fungal Diversity 27: 134 (2007).
PiLtEus 8-25 mm broad, 2-4 mm high; opaque and not translucent nor
hygrophanous; broadly convex to convex, umbilicate; tomentulose on the disc,
squarrulose to appressed squamulose towards the margin, appressed fibrillose
on the margin; at first disc very dark brown (7F2) elsewhere a bit lighter (7F4),
then becoming dark brown (6-7F5-6), and eventually fading to medium brown
(6-7E-F5-6), dull, striate nearly to the disc; margin incurved to decurved,
striate, even becoming crenulate with age. TasTE distinctly farinaceous, at
times latent. Opor faintly but distinctly farinaceous. LAMELLAE 4.5-9 mm
long, 1.25-5 mm high, adnate with decurrent tooth to subdecurrent, close
to subdistant then distant in over-mature basidiomes, narrow to moderately
broad, in some becoming broad, white to orange white to pallid (5A2) at
first then more pinkish with basidiospore maturation; margin in places or
entirely roughened to serrulate and distinctly brownish to blackish brown; 3
or 5-7 lamellulae between lamellae (in 2—4 rows, 2-4 short and 1-2 medium
or 1 medium long). Stipe 8-30 mm long, 1.0-4.0 mm broad, equal, glabrous
to faintly appressed fibrillose, a bit lighter than the pileus, medium brown
(6-7E-F4-6), at times pale orange (5B3) at the apex, hollow and stiff but decays
rapidly; basal tomentum scarce. BRUISING REACTIONS absent.
Leptonia spp. & comb. nov. (Australia) ... 31
PiatE 9. Leptonia umbraphila {DLL 9792 A; DLL 9793 B-C}. A: Basidiomata (3); B: Pileal surface
(2.5); C: Marginate lamellar edge (2.5). Bar (A- C) = 10 mm.
BASIDIOSPORES typically cuboid in all views, at times 5-angled in
dorsi-ventral view, angles distinct, mostly isodiametric but some may be
heterodiametric, relatively small, 5.5-8.3 x 5.5-7.9 um (x = 7.3 + 0.50 x 6.7
+ 0.52 um; E = 1.00-1.41; Q = 1.10 + 0.09; N = 92/4). Basrp1a mostly 1-2-
sterigmate, rarely 4-sterigmate, subclavate with the very base tapered, sterigma
2.1-4.8 um; 22.5-40.6 x 6.5-11.0 um (x = 28.6 + 3.8 x 8.5 + 0.9 um; E = 2.8-4.5;
Q = 3.4 + 0.4; N = 40/3); base 1.6-4.5 um. CHEILOCYSTIDIA clavate, scattered
to abundant, in clusters but not forming a sterile layer along the entire lamella,
clavate, 23.3-53.5 x 5.1-10.7 um (x = 37.5 + 9.1 x 8.1 + 1.8 um; E = 2.3-7.9;
Q = 4.8 + 1.3; N = 16/2). PLEUROCYSTIDIA absent. LAMELLAR TRAMAL HYPHAE
relatively slender and thus not broad, 40.8-144.1 x 2.2-22.0 um (N = 26/3).
PILEIPELLIS badissima-type (laterally agglutinated hyphae abundant; slender
cylindro-clavate collapsed on clavate to vesiculate pileocystidia), 80-135 um
32 ... Largent & al.
PLATE 10. Leptonia umbraphila {DLL 9629 A-E; DLL 9792 F}. A: Basidiospores; B: 1-2 sterigmate
basidia; C: Clavate cheilocystidia with brownish cytoplasmic pigment; D: Pileipellis, pileocystidia
and cytoplasmic plaque-like pigment; E: Pileal trama with brilliant granules and parietal pigment
(arrow); F: Pileipellis. Bars: A = 7 um; B = 20um; C = 30 um; D = 20 um; E = um; F = 65 um.
Leptonia spp. & comb. nov. (Australia) ... 33
deep on the disc. PrLeocystrp1A cylindro-clavate to clavate to vesiculate,
22.7-68.6 x 4.8-17.3 um (x = 36.3 + 12.9 x 10.8 + 3.6 um; E = 1.6-9.4;
Q = 4.0 + 2.4; N = 19/2). PILEAL TRAMAL HYPHAE felatively short, subparallel,
32.5-113.1 x 4.4-15.4 um. STIPITIPELLIS a cutis. BASIDIOLE clusters rare,
29.7-44.8 x 8.2-17.0 um (N = 8/1). STIPE TRAMAL HYPHAE subparallel,
31.5-191.7 x 4.4-15.4 um (N = 11/2). OLEIFEROUS HYPHAE scattered in the
stipe trama. LrporD GLOBULES absent. BRILLIANT GRANULES abundant and
small in the basidia and in the pileal tramal hyphae. PIGMENTATION pale brown,
uniformly intracellular in the cheilocystidia; very dark brown, intracellular, and
in pigment-globules in the hyphae of the pileipellis, not soluble in 3% KOH or
in water. CLAMP CONNECTIONS absent in all tissues.
ECOLOGY & DISTRIBUTION — Scattered in bare soft soil in areas protected and
shaded by a dense tree overstory, Mossman National Park; in bare compacted
soil shaded by a single tree (but protected by roots) in middle of Emmagen
Creek Trail, Daintree National Park; late February to late March.
ADDITIONAL COLLECTIONS EXAMINED — AUSTRALIA. QUEENSLAND, Cook Region,
Mossman National Park, 16°28'15.2"S 145°19'48.8"E, 27 February 2009, DL Largent
9629, 9630; 16°28'15.2"S 145°19'48.8"E, 9 March 2009, DL Largent 9640; 16°28'15"S
145°19'49"E, 4 March 2010, DL Largent 9766; 16°28’17.6"S 145°19'51.7"E, 18 March
2010, DL Largent 9792, 9793, 9799. Daintree National Park, Tribulation Section,
16°02'20.1"S 145°27'40.8"E, 22 March 2010, DL Largent 9816.
DISTINCTIVE CHARACTERS —Small broadly convex-depressed dark brown
pileus; weakly decurrent or subdecurrent lamellae; basidiospores cuboid or
5-angled, isodiametric, and averaging <8.1 um x <7.5 um; badissima-type
pileipellis with dark brown, intracellular, pigment globules; basidia small,
typically 2-sterigmate; clavate, cheilocystidia with pale brownish pigment.
ComMENtTs — The collections of L. umbraphila from northern Queensland are
identical to the Seychelles holotype in habitat, all macrofeatures, and nearly all
microfeatures. In the holotype (Noordel. & Hauskn. 2007 as E. umbraphilum),
the basidiospores are a little larger (7-9 x 6.5-8.5 um), the basidia are slightly
smaller (23-31 x 8-11 um), and the cheilocystidia somewhat smaller (20-30
x 8-11 um) than in the northern Queensland collections. We consider these
slight differences to be insignificant.
Rhodophyllus dicubospermus Romagn. & Gilles from Gabon closely
resembles L. umbraphila with its omphalinoid stature, brown pileus and stipe,
bisporic basidia, and cuboid basidiospores but differs in the reddish brown
pileus, brownish white lamellae, concolorous lamellar margin, and slightly
larger (6.5-9 x 6.2-8 um) basidiospores (Romagnesi & Gilles 1979).
Acknowledgments
The Largent family trust provided support for the fieldwork and we are grateful to
Pamela Largent for support and collections. The Australian Tropical Herbarium and
34 ... Largent & al.
the School of Marine and Tropical Biology, James Cook University, provided fieldwork
and logistical support. The DNA sequences generated in this study are based upon work
supported by the National Science Foundation under Grant No. DRI 0922922 awarded
to Sarah Bergemann. Comments by the two reviewers, Drs. Timothy J. Baroni and Terry
W. Henkel, and by the nomenclature editor, Dr. Shaun Pennycook, were also beneficial.
We wish to thank Peter Newling, Pam O’Sullivan, and Skye Moore for their collections
and descriptions.
Literature cited
Baroni TJ, Halling R. 2000. Some Entolomataceae (Agaricales) from Costa Rica. Brittonia 52:
121-135. http://dx.doi.org/10.2307/2666502
Baroni TJ, Matheny B. 2011. A re-evaluation of Gasteroid and Cyphelloid species of Entolomataceae
in eastern North America. Harvard Papers in Botany 16: 293-310.
http://dx.doi.org/10.3100/0.25.016.0205
Co-David D, Langeveld D, Noordeloos ME. 2009. Molecular phylogeny and spore evolution of
Entolomataceae. Persoonia 23: 147-176. http://dx.doi.org/10.3767/003158509X480944
Dennis RWG. 1953. Les Agaricales de l'Ile de la Trinité. Rhodosporae-Ochrosporae. Bulletin de la
Société Mycologique de France 69: 145-198.
Grgurinovic C. 1997. Larger fungi of South Australia. The Botanic Gardens of Adelaide and State
Herbarium and the Flora and Fauna of South Australia Handbooks Committee: Adelaide.
Horak E. 1973. Fungi Agaricini Novaezelandiae I-V. Beihefte Nova Hedwigia 43: 1-200.
Horak E. 1980. Entoloma (Agaricales) in Indomalaya and Australasia. Beihefte zur Nova Hedwigia
65: 12352:
Horak E. 1982. Entoloma in South America II. Sydowia. 35: 75-99.
Horak E. 2008. Agaricales of New Zealand. 1: Pluteaceae (Pluteus, Volvariella) Entolomataceae
(Claudopus, Clitopilus, Entoloma, Pouzarella, Rhodocybe, Richoniella). Fungi of New Zealand
Volume 5. Fungal Diversity Research Series 19: 1-305.
Kornerup A, Wanscher JH. 1978. Methuen handbook of colour, 3rd ed. Richard Clay Ltd:
Chichester, Sussex.
Largent DL. 1994. Entolomatoid fungi of the western United States and Alaska. Mad River Press
Inc: Eureka, California.
Largent DL, Abell-Davis SE, Cummings GE, Ryan KL, Bergemann SE. 201la. Saxicolous
species of Claudopus (Agaricales, Entolomataceae) from Australia. Mycotaxon 116: 253-264.
http://dx.doi.org/10.5248/116.253
Largent DL, Bergemann SE, Cummings GE, Ryan KL, Abell-Davis SE, Moore S. 2011b. Pouzarella
(Agaricales, Entolomataceae) from New South Wales (Barrington Tops National Park) and
northeastern Queensland. Mycotaxon 117: 435-483. http://dx.doi.org/10.5248/117.435
Largent DL, Bergemann SE, Abell-Davis SE, Kluting KL, Cummings GA. 2013. Three new
Inocephalus species with cuboid basidiospores from New South Wales and Queensland,
Australia. Mycotaxon 123: 301-319. http://dx.doi.org/10.5248/123.301.
May TW, Wood AE. 1997. Catalogue and bibliography of Australian macrofungi 1. Basidiomycota.
Fungi of Australia Vol. 2A. Australian Biological Resources Study: Canberra.
Murrill WA. 1911. The Agaricaceae of tropical North America, IV. Mycologia 3: 271-282.
http://dx.doi.org/10.2307/3753496
Noordeloos ME. 1992. Entoloma s.]. Fungi Europaei vol. 5. Ed. Candusso: Alassio, Italy.
Noordeloos ME. 2004. Entoloma s.l. Fungi Europaei vol. 5a. Ed. Candusso: Alassio, Italy,
Leptonia spp. & comb. nov. (Australia) ... 35
Noordeloos ME. 2008. Entoloma in North America 2: the species described by C. H. Peck - type
studies and comments. Osterreichische Zeitschrift fiir Pilzkunde. 17: 87-152.
Noordeloos ME, Gates GM. 2012. The Entolomataceae of Tasmania. Fungal Diversity Research
Series 22: 1-399, http://dx.doi.org/10.1007/978-94-007-4679-4
Noordeloos ME, Hausknecht A. 2007. The genus Entoloma (Basidiomycetes, Agaricales) of the
Mascarenes and Seychelles. Fungal Diversity 27: 111-144.
Romagnesi H, Gilles G. 1979. Les Rhodophylles des foréts cétiéres du Gabon et de la Céte d'Ivoire
avec une introduction générales sur la taxinomie du genre. Beihefte zur Nova Hedwigia 59:
1-649.
Thiers B. 2012. Index Herbariorum: A global directory of public herbaria and associated staff.
New York Botanical Garden's Virtual Herbarium. http://sweetgum.nybg.org/ih/ [accessed
November 2012]
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.37
Volume 125, pp. 37-43 July-September 2013
Hymenochaetaceae from México 6.
A new Fuscoporia species from the Sonoran desert
TANIA RAYMUNDO!, RICARDO VALENZUELA’ & MARTIN ESQUEDA?
‘Escuela Nacional de Ciencias Bioldgicas, I.P.N.
Plan de Ayala y Carpio s/n Col. Santo Tomas, México, D.F. 11340, México
*Centro de Investigacion en Alimentacion y Desarrollo, A.C.
Apartado Postal 1735, Hermosillo, Sonora 83000, México
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Fuscoporia xerophila is described as a new species from México. ‘The collected
specimens were found on dead or living wood in xerophilous scrub in the central plain of
the Sonoran desert, Sonora State, México. This species is characterized by its resupinate
basidiomata with medium size pores (4-5 per mm), its hymenial setae and hyphal setae, and
basidiospores that are are subglobose, hyaline, smooth, and thin-walled. A key to Mexican
species of Fuscoporia is presented.
KEY worps — Agaricomycetes, Hymenochaetales, polyporoid fungi, taxonomy
Introduction
Fuscoporia was described by Murrill (1907) with F ferruginosa as the type
species. Many mycologists (Overholts 1953, Lowe 1966, Ryvarden & Johansen
1980, Gilbertson & Ryvarden 1987, Larsen & Cobb-Poulle 1990, Ryvarden
1991) have regarded this genus as synonymous with Poria Adans. and Phellinus
Quel. At the present time, Fiasson & Niemela (1984), Wagner & Fischer (2001,
2002), Groposo et al. (2007), Baltazar et al. (2009), Baltazar & Gibertoni (2010),
and Raymundo et al. (2013) recognize Fuscoporia as a monophyletic genus
characterized by its annual to perennial and resupinate to pileate basidiomata
with poroid hymenophore, its dimitic hyphal system with encrusted generative
hyphae in the dissepiments and trama, hymenial setae that are always present
and hyphal setae that are either present or absent, and basidiospores that are
hyaline, non-amyloid, acyanophilous, subglobose, ellipsoid, cylindrical to
allantoid, thin-walled, and smooth.
Recently, Raymundo et al. (2013) reported 14 Fuscoporia species from
México: E callimorpha (Lév.) Groposo et al., E chrysea (Lév.) Baltazar &
38 ... Raymundo, Valenzuela & Esqueda
Gibertoni, F contigua (Pers.) G. Cunn., E contiguiformis (Pilat) Raymundo et
al., FE coronadensis (Rizzo et al.) Raymundo et al., E ferrea (Pers.) G. Cunn.,
F. ferruginosa (Schrad.) Murrill, E gilva (Schwein.) T. Wagner & M. Fisch.,
FE. mesophila Raymundo et al., F. nicaraguensis Murrill, F. palmicola (Berk. &
M.A. Curtis) Bondartseva & S. Herrera, F. rhabarbarina (Berk.) Groposo et al.,
E viticola (Schwein.) Murrill, and E wahlbergii (Fr.) T. Wagner & M. Fisch.
In 2009 several Fuscoporia specimens were collected during a survey of
Sonoran desert in Sonora State, México, that did not represent any known
species of Fuscoporia. They are described here as a new taxon.
Materials & methods
The Sonoran desert covers 223,009 km’, of which 29% lies in Arizona and California,
US.A., and 71% in State of Sonora, México (Robles-Gilet al. 2001). It presents a moderate
biological richness with xerophilous scrub and dry or very dry weather. The examined
specimens were collected in Sonora State in August, 2009, and are deposited in the
Herbarium, Instituto Politécnico Nacional, México (ENCB) with an isotype deposited
in the fungal collections of the of the Universidad Estatal de Sonora, México (UES).
Longitudes and latitudes were obtained with GPS eTrex (Garmin). Herbaria acronyms
follow Thiers (2012) and colors are coded according to Kornerup & Wanscher (1978).
Morphological examinations were conducted using protocols outlined by Cifuentes et
al. (1986) and Ryvarden (1991). Anatomical characters were measured from rehydrated
tissues in 5% aqueous KOH and Melzer’s reagent. Line drawings were made to scale
using an optical light microscopy with clear camera and macroscopic photographs were
taken with a Nikon Coolpix 4300. The meanings of some terms are based on Ulloa &
Hanlin (2012).
Taxonomy
Fuscoporia xerophila Raymundo, R. Valenz. & Esqueda, sp. nov. FIGs 1-9
MycoBank MB801799
Differs from Fuscoporia contigua by its smaller pores, its shorter and wider subglobose
basidiospores, and its xeric habitat.
TYPE: México, Sonora, municipality of Guaymas, Francisco Villa “El Tigre’,
28°06'56.3"N 111°01'35.2” W, alt. 140 m, 21.VIII.2009, R. Valenzuela 13772 (Holotype,
ENCB, isotype, UES).
EryMo_oey: Referring to its occurrence in xerophilous scrub with very dry weather.
BASIDIOMATA annual to perennial, resupinate, adnate, becoming widely effused,
reaching 300-600 x 80-150 x 1-3 mm, corky to woody, easily separable of
the substrate, cracked in dry and old specimens. MARGIN sterile, <3 mm wide,
golden brown (5D7), yellowish brown (5F7) to grayish brown (6E3), matted,
fimbriate. HYMENOPHORE poroid, cracked with age or in dry specimens,
grayish brown (6D-E3) to brown (6E4-5), dark brown (6F6) in old specimens;
PORES angular to irregular, (3-)4-5 per mm, 200-240 x 144-176 um (av. 217
Fuscoporia xerophila sp. nov. (Mexico) ... 39
Fics 1-9. Fuscoporia xerophila (1-7,9—holotype, ENCB Valenzuela 13772; 8—ENCB Raymundo
3233): 1. Basidiospores. 2. Hymenial setae. 3. Hyphal setae. 4. Generative hyphae strongly incrusted
with crystals. 5. Hymenial setae. 6-9. Basidiomes. Scale bars: 1-3 = 8 um; 4-5 = 5 um; 6 = 2 mm;
7-9 = 100 mm.
x 160 um); dissepiments thin to thick and lacerated, (48-)80-140(-160) um
thick, (av. 112 um); TUBES <1 mm deep, 1-3 layers, tough to woody, grayish
brown (6E3) to brown (6E5). CONTEXT or subiculum very thin, <1 mm thick,
yellowish brown (5F7), fibrous, tough, azonate.
AO ... Raymundo, Valenzuela & Esqueda
HYPHAL SYSTEM dimitic, GENERATIVE HYPHAE simple-septated, hyaline
to pale yellow in KOH, simple to slightly branched, thin-walled, 2.4-3.2 um
in diam.; SKELETAL HYPHAE yellowish brown to reddish brown, unbranched
or rare branched, thick-walled, 3.2-4.8 um in diam. HYMENOPHORAL TRAMA
composed by interwoven hyphae, generative hyphae hyaline to pale yellow in
KOH, thin-walled, simple to slightly branched, 2.4-3.2 um in diam., hyphae
projecting beyond the hymenia and in the edge of dissepiments strongly
encrusted with crystals; skeletal hyphae yellowish brown to reddish brown in
KOH, unbranched, thick-walled, 3.2-4.8 um in diam. CONTEXTUAL TRAMA
with interwoven hyphae, generative hyphae rare, hyaline to pale yellow in KOH,
simple to scarcely branched, thick-walled, 1.6-2.4 um in diam.; skeletal hyphae
dominant, reddish brown in KOH, unbranched, thick-walled, 2.4-4.8 um in
diam. HYPHAL SETAE 88-180 x 12-20 um, straight, lanceolate to lageniform,
acute, dark brown in KOH, thick-walled, only found in subiculum and margin.
HYMENIAL SETAE 40-52 x 6.4-8 um, ventricose to ventricose-rostrate, acute,
reddish brown to dark brown in KOH, thick-walled. BAasrp1a not observed.
BASIDIOSPORES 5.12-5.46 x 4-4.48 um, subglobose, hyaline in KOH, inamyloid,
thin-walled, smooth.
ECOLOGY & DISTRIBUTION— ‘The species grows on live and dead wood of
Acacia in xerophilous scrub, causing a white rot. It is known only from the type
locality in Sonoran desert in México.
ADDITIONAL SPECIMENS EXAMINED: MEXICO, SONORA, municipality of Guaymas,
Francisco Villa “El Tigre’, 28°06'56.3"N 111°01'35.2"W, alt. 140 m, 21.VIII.2009, T.
Raymundo 3229, 3230, 3232, 3233 (ENCB); R. Valenzuela 13771, 13773 (ENCB).
CoMMENTS— ‘The species is characterized by its resupinate basidiomata with
angular to irregular pores, hyphal setae present in subiculum and margin, and
subglobose basidiospores. Fuscoporia contigua is similar to E xerophila but
has larger pores (1-3 per mm), hyphal setae in the floccose margin, tramal
and hymenial setae in the trama, and longer oblong to subcylindrical (5-7 x
3-3.5 um) basidiospores. Further, F. contigua grows on dead wood in tropical
forests in México and the Neotropics (Ryvarden & Guzman 1993, Ryvarden
2004), on Quercus in China (Dai 1999), and on bamboo in Brazil (Coelho et al.
2009). Other related species are F. ferruginosa and F. nicaraguensis, which have
resupinate basidiomata and hyphal setae in the margin or trama. Further, both
have small circular pores (7-9 per mm) and grow on dead wood of tropical
forests; FE ferruginosa has longer cylindrical (5-7 x 2.4-3.5 um) basidiospores
while E nicaraguensis has smaller globose (2.4—4.4 um in diam.) basidiospores
(Larsen & Cobb-Poulle 1990, Raymundo et al. 2013).
Key to Fuscoporia species in México
1. Hyphal setae present in trama, margin and/or subiculum ....................04. 2
RELY Pia setaesalSelit satatatcithir-sctab- die subod aveniialvatenietad diy felod dts pela dy fee dyin f Wea al 2S 5
Fuscoporia xerophila sp. nov. (Mexico) ... 41
2. Basidiospores globose to subglobose, basidiomata resupinate ................... 3
2. Basidiospores oblong to cylindrical, basidiomata resupinate to pileate ............ 4
3. Pores 7-9 per mm, hymenial setae 24-36 x 6.4—-9.2 «um, subulate, straight
and hyphal setae in the sterile margin 60-136 x 6-12 um, basidiospores
2A AAU CLOW OSE? Ie fs Fear gp lahhel eae set uke! les. F. nicaraguensis
Qo
. Pores 4-5 per mm, hymenial setae 48-52 x 6.4—8 tm, ventricose to
ventricose-rostrate, straight; hyphal setae in the margin or subiculum
88-180 x 12-20 um, straight, lanceolate to lageniform; basidiospores
5.12-5.46 x 4-4.48 um, subglobose .............. 0. eee eee F. xerophila
4. Pores 1-3 per mm, hymenial setae 40-60 x 6-8 tm, subulate, straight,
tramal setae 50-90 x 5-12 um, subulate, straight and hyphal setae in the
floccose margin 80-120 x 6-12 tm, basidiospores 5-7 x 2.4-3.5 um,
Sucre tcaltey CLOG 5 ak ia pe boa eh tee lta Sey F. contigua
4. Pores 7-9 per mm, hymenial setae 30-60 x 6-10 um, subulate, straight and
hyphal setae in the sterile margin 90-150 x 6-10 um, basidiospores
DS 7 DA SSeS LN CV IEA CAS SoS PBS FIBRE lant amet LNCS wet F, ferruginosa
5. Basidiomata resupinate to effused-reflexed ....... 0... eee eee eee eee ee 6
bi. Basicionatapiledtesessllei: 4:4 ost-ady stg drngcbee dense hence ean tres eed aeeni nse s 9
6: Pores-1-3° per mM: oe. tin tents ieee a a ert oid odin 7
Sag td OL coed Ral old Bot UAL Wi i OBIE Ras A SRIR Kaos A vBHR Nuoh AS OBIE Kasten ES Manton ELiGeami LL item Sk nim Staaten kal see i Ao 8
7. Basidiospores oblong to cylindrical, 4-5 x 2-2.5 um, pores angular,
sinuous to labyrinthiform, hymenial setae 32-64 x 6.4—7.2 um,
SU Ube tre Shel Sete he Neil edn ode Led bei ee SO F. palmicola
7. Basidiospores cylindrical to slightly curved, 7-8 x 1.6-2 um,
pores angular, hymenial setae 50-70 x 5-7 um, subulate ...... F. contiguiformis
8. Basidiospores broadly ellipsoid to subglobose, 3.2-4 x 2.4-3 um,
hymenial setae 30-50 x5-8 um, ventricose to subulate ............... EF. chrysea
8. Basidiospores cylindrical, 5.5-7.6 x 2.4-3.2 um, hymenial setae
PIES TRO ETM, SUDUNALE: oa ses hones Nowe hon ni hom eb nea Se hoor kan ol F, ferrea
9. Basidiospores cylindrical to slightly curved, 7-9 x 1.5-2 um,
hymenial setae 25-75 x 5-8 uum, subulate .................... 0008. EF. viticola
9. Basidiospores globose to subcylindrical, never curved and >2 um in diameter .... 10
10. Hymenial setae hooked, some straight, 25-44 x 8-13.2 um, basidiospores
subglobose to ellipsoid, basidiomata applanate, dimidiate to broadly
attached, pores 6-8 per mm, circular to elongate ................ F, wahlbergii
LO: -Fiveie nisl setae Straie it. sec ih Wi A) Sn Oh ete eet the arte te tet Ne eth at Oe 11
11. Basidiomata large, 100-350 x 150-300 x 25-100 mm, applanate, dimidiate
to broadly attached, pores (5-)6-7(-8) per mm, circular, hymenial setae
20-32 x 6.4—9 um, ventricose to subulate, basidiospores 3.2-5.6(-6) x
3.2-4 um, subglobose to ovoid, growing only on conifers ....... F. coronadensis
11. Basidiomata small to medium size, growing only on angiosperms ............ 12
42 ... Raymundo, Valenzuela & Esqueda
12. Pileus surface with a distinctive black crust, glabrous and sulcate, pores
6-9 per mm, hymenial setae 20-30 x 4.8-7.2 um, subulate, basidiospores
SDA Se 2 Batty el SON Gees pasting t nase e ogasene aratages ocatagiee stati F, rhabarbarina
12. Pileus surface without a distinctive black crust .......... 0.0... e eee eee eee 13
13. Basidiomata triquetrous to ungulate, pileus surface velutinate to tomentose,
concentrically sulcate, pores 6-8 per mm, circular, hymenial setae
28-40 x 8.8-16 um, ventricose, basidiospores 4.0 x 3.2-3.8 um,
SUDSIOBOSELO- OV OIG Er. shectiy a pe atig ec euacirs bites Moehee G7 Sawada dad F, mesophila
13. Basidiomata applanate to convex, hymenial setae <10 um broad ............... 14
14, Hymenial setae 16-28 x 6-8.8 um, subulate to ventricose, basidiospores
3.6-4.8 x 2-3 um, oblong to subcylindrical ................... F. callimorpha
14, Hymenial setae 20-40 x 6-10.2 um, ventricose to subulate, basidiospores
4-5 x 2.5-3 um, narrowly ellipsoid to oblong .....................00. F. gilva
Acknowledgments
We wish to express our gratitude to Dr. L. Ryvarden and Me. J.M. Baltazar for
reviewing the manuscript and their useful comments. We also express our gratitude
to SEMARNAT - CONACYT (Grant 2002-C01-0409) for their financial support.
R. Valenzuela and T. Raymundo thank COFAA and IPN for the financial support for
their research in the project SIP-20130034. Silvia Bautista Hernandez (ENCB IPN)
kindly prepared the final version of drawing lines. Aldo Gutierrez (CIAD) kindly
prepared the final version of the pictures and text.
Literature cited
Baltazar JM, Trierveiler-Pereira L, Loguercio-Leite C, Ryvarden L. 2009. Santa Catarina Island
mangroves 3: a new species of Fuscoporia. Mycologia 100:859-863.
http://dx.doi.org/10.3852/08-082
Baltazar JM, Gibertoni TB. 2010. New combinations in Phellinus s.l. and Inonotus s.1. Mycotaxon
111:205-208. http://dx.doi.org/10.5248/111.205
Cifuentes J, Villegas M, Pérez-Ramirez L. 1986. Hongos. 55-64, in A Lot, F Chiang (compiladores).
Manual de Herbario. Consejo Nacional de la Flora de México, A.C., México, D.E.
Coelho G, da Silveira RMB, Guerrero RT, Rajchenberg M. 2009. On poroid Hymenochaetales
growing on bamboos in Southern Brazil and NE Argentina. Fungal Diversity 36:1-8.
Dai YC. 1999. Phellinus sensu lato (Aphyllophorales, Hymenochaetaceae) in East Asia. Acta Botanica
Fennica 166:1-115.
Fiasson JL, Niemala T. 1984. The Hymenochaetales: a revision of the European poroid taxa.
Karstenia 24:14—28.
Gilbertson RL, Ryvarden L. 1987. North American polypores. Megasporoporia-Wrightoporia.
Vol. 2: Fungiflora. Oslo, Norway.
Groposo C, Loguercio-Leite C, Gdes-Neto A. 2007. Fuscoporia (Basidiomycota, Hymenochaetales)
in Southern Brazil. Mycotaxon 101:55-63.
Kornerup A, Wanscher JH. 1978. Methuen handbook of colour. 3"! ed. Eyre Methuen, London.
Larsen MJ, Cobb-Poulle LA. 1990. Phellinus (Hymenochaetaceae). A survey of the world taxa.
Synopsis Fungorum 3:1—-206.
Fuscoporia xerophila sp. nov. (Mexico) ... 43
Lowe JL. 1966. Polyporaceae of North America. The genus Poria. University College of Forestry at
Syracuse University, Tech. Publ. 90. 183 p.
Murrill WA. 1907. Polyporaceae. North American Flora 9: 1-72.
Overholts LD. 1953. The Polyporaceae of the United States, Alaska and Canada. University of
Michigan Press, Ann Arbor, USA.
Raymundo T, Valenzuela R, Bautista-Hernandez S, Esqueda M, Cifuentes J, Pacheco-Mota L.
2013. El género Fuscoporia (Hymenochaetales—Basidiomycota) en México. Revista Mexicana de
Biodiversidad 84 (Suplem.): S50-S69. http://dx.doi.org/10.7550/rmb.31604.
Robles-Gil P, Ezcurra E, Mellink E. 2001. The Gulf of California: a world apart. Agrupacion Sierra
Madre, México.
Ryvarden L. 1991. Genera of polypores. Nomenclature and taxonomy. Synopsis Fungorum 5:
1-636.
Ryvarden L. 2004. Neotropical polypores. Introduction, Ganodermataceae & Hymenochaetaceae.
Synopsis Fungorum 19:1-229.
Ryvarden L, Guzman G. 1993. New and interesting polypores from Mexico. Mycotaxon 47: 1-23.
Ryvarden L, Johansen I. 1980. A preliminary polypore flora of East Africa. Fungiflora, Oslo.
Thiers B. 2012 [continuously updated]. Index herbariorum: a global directory of public
herbaria and associated staff. New York Botanical Garden's Virtual Herbarium.
http://sweetgum.nybg.org/ih/ [accessed February 2012].
Ulloa M, Hanlin RT. 2012. Illustrated dictionary of mycology. 2nd ed. APS Press, St. Paul,
Minnesota, USA.
Wagner T, Fischer M. 2001. Natural groups and a revised system for the European poroid
Hymenochaetales (Basidiomycota) supported by nLSU rDNA sequence data. Mycological
Research 105:773-782. http://dx.doi.org/10.1017/S0953756201004257
Wagner T, Fischer M. 2002. Proceedings towards a natural classification of the worldwide taxa
Phellinus s.1. and Inonotus s.1., and phylogenetic relationships of allied genera. Mycologia
94:998-1016. http://dx.doi.org/10.2307/3761866
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.45
Volume 125, pp. 45-51 July-September 2013
Phallus hadriani and P. roseus from Pakistan
G. MorRENO”™, A.N. KHALID’, P,. ALVARADO’ & H. KREISEL?
' Department of Plant Biology, University of Alcala, 28871, Alcala de Henares, Madrid, Spain
? Department of Botany, University of the Punjab,
Quaid-e-Azam Campus, Lahore, 54590, Pakistan
° Zur Schwedenschanze 4, D-17498, Potthagen, Germany
* CORRESPONDENCE TO:
[email protected].
ABSTRACT — Specimens of Phallus hadriani and P. roseus collected in Pakistan are described
here. Photographs and molecular data are provided for both species.
Key worps — Basidiomycota, Phallales, taxonomy.
Introduction
The genus Phallus Junius ex L. (Phallaceae Corda, Phallales E. Fisch.)
is typified by P impudicus L. Kreisel (1996) has recognized 31 different
species within Phallus sensu lato (incorporating Aporophallus, Dictyophora,
Echinophallus, Endophallus, Itajahya, and several other genera). Calonge (2005)
proposed a provisional key for 25 species, after which several new species have
been described (e.g., Calonge et al. 2005, 2008; Li et al. 2005; Moreno et al.
2009).
Phallus has a cosmopolitan distribution (Kreisel 1996); four species
previously recorded from Pakistan include P celebicus Henn., P. impudicus,
P. rubicundus (Bosc) Fr. (Ahmad 1952), and P. calongei G. Moreno & Khalid
(Moreno et al. 2009). Descriptions for two additional species based on recent
collections from Pakistan are provided below.
Materials & methods
The collections preserved in LAH herbarium were examined and divided, with
separate vouchers being deposited in AH herbarium. Specimens were mounted in
Hoyer’s medium and studied with a Nikon microscope. Spores were measured under
the oil immersion objective.
DNA was extracted and amplified as described in Alvarado et al. (2012). The primers
ITS1F and ITS4 (White et al. 1990, Gardes & Bruns 1993) were used to amplify the
46 ... Moreno & al.
Fic. 1. Phallus hadriani: Mature fruiting bodies with an egg. Bar = 0.5 cm
Phallus spp. new to Pakistan ... 47
internal transcribed spacer region. Sequences were visually inspected for reading errors
in MEGA4.0 (Tamura et al. 2007). Validated sequences were stored in GenBank under
the accession numbers listed below. These sequences were aligned with the closest
matches obtained with BLAST searches through the public databases. ITS sequences
came mainly from Cheong (unpublished). Sequences were first aligned in MEGA 4.0
software using its ClustalW application and then corrected manually. The aligned locus
was loaded in PAUP* 4.0b10 (Swofford 2001) and a maximum parsimony phylogenetic
tree was reconstructed (2000 bootstrap replicates, TBR swapping algorithm, 50 sequence
additions per replicate, MulTrees not in effect). It was also subjected to MrModeltest
2.3 (Nylander 2004) in PAUP* 4.0b10. The best model was then implemented in
MrBayes 3.1 (Ronquist & Huelsenbeck 2003), where a Bayesian analysis was performed
(5.8S-ITS2 data partitioned, 2 simultaneous runs, 6 chains, temperature set to 0.2,
sampling every 100" generation) until convergence parameters were met after about
200,000 generations. Significance thresholds were above 70% for bootstrap (BP) and
99% for posterior probability (PP).
Taxonomy
Phallus hadriani Vent., Mém. Inst. nat. Sci. Arts 1: 517 (1798) Fig. 1
Ecce <50 mm tall x 30 mm diam., subglobose to ovoid, sheathed by a tough,
brown membrane. MATURE FRUITING BODy grayish to violet, <123 mm high,
attached to the substratum by well-developed thick branched rhizomorphs at
the base. RECEPTACULUM with an off white reticulate pileus head and stipe.
Prieus slightly campanulate, having glebal mass, <30 mm tall x 25 mm diam.,
cylindrical, narrowing at the top, hollow. GLEBA olivaceous green wet, sticky,
deliquescent, not very smelly. Stipe off white, spongy, hollow, porous, <80
mm tall x 17-20 mm diam., cylindrical, almost equal, firm, hard. Votva thick,
texture soft, cup-shaped, covering 1/3" of the stipe, globose, grayish to violet
with off white tones, outer surface relatively smooth, not encrusted with soil
particles, lined with grayish to violet gelatinous and sticky material inside, <37
mm tall x 35 mm diam. Spores 3-5 x 1-2 um, ellipsoid, hyaline, smooth.
MATERIAL EXAMINED: PAKISTAN: KuyBEeR PAKHTUN Kuwa, Khanspur, near P.U.
teachers suites, ca. 2250 m a.s.l., solitary, on ground, on mountainous slopes, in
Himalayan moist temperate forest, 22 Aug. 2010, N. Yousaf NYGO1 (LAH 228210; AH
39161, GenBank KF481956).
Phallus roseus Delile, Descr. Egypte, Hist. Nat. 2: 300 (1813) Fics 2-6
= Itajahya rosea (Delile) E. Fisch., Ber. Deutsch. Bot. Ges. 47: 294 (1929)
Ecce off white to pinkish, subglobose, outer surface rough, encrusted with
soil particles, 55 mm tall x 75 mm diam.; longitudinal section showing three
layers forming a semicircle: outer layer 6mm thick, grayish with off white
tones; middle layer <9 mm wide, grayish, smooth, shiny, wet, sticky, inner layer
brownish, roughened by finger-like projections facing the centre; core white,
soft, covered by layers on all sides except at the base. MATURE FRUITING BoDy
48 ... Moreno & al.
a ‘ -
Fics 2-6: Phallus roseus: 2. Eggs of fruiting body. 3. Cross-section of the egg showing three-layered
arrangement. 4-5. Fruiting body development. 6. Mature fruiting body. Bars = 20 mm.
gregarious, <80 mm tall x 17 mm diam at the top and 45 mm at the base,
attached to the ground by well-developed, branched, white, thick rhizomorphs.
RECEPTACULUM bearing pileus and stipe. Piteus globose to subglobose,
21 mm high x 34 mm diam., hollow, having glebal mass with irregular
appendices pinkish. GLEBA grayish, turning blackish with age, unpleasant odor
when collected. Soft, wet, sticky. Stipe off pinkish white to pinkish, hollow,
spongy, porous, hard, entirely enclosed by volva, broader and wider at the base
Phallus spp. new to Pakistan ... 49
(30 mm in diam.) and narrowing upwards (25 mm diam.), some stipe flesh
present at the top of receptaculum as an extension, extended part irregularly
shaped, pinkish, <17 mm high. Votva ovoid, saccate, 45 mm tall x 30-45 mm
diam., prominent, well developed, covering all the stipe almost from all sides,
ends where glebal mass is present, whitish, thick, texture soft, outer surface
rough, slightly having patchy appearance, encrusted with soil particles, smooth,
membranous, gelatinous and shiny from inside, remnants of volva present on
the stipe in form of white patches. SporEs 3-4 x 1.5-2 um, ellipsoid, hyaline,
smooth.
MATERIAL EXAMINED: PAKISTAN: Punjas, Lahore, University of the Punjab, Quaid-
e-Azam campus, Plant nursery, RO II, ca. 217 m a.s.l., gregarious, on ground, under
Dalbergia sissoo Roxb. (Fabaceae), 10 Aug. 2010, N. Yousaf NYGO2 (LAH 108210,
GenBank KF481955; AH 39160).
Discussion
Phallus hadriani, currently included in Phallus sect. Dictyophora (Desv.)
Kreisel, is characterized by its reticulate pileus surface with pinkish or violet
tones. It somewhat resembles P impudicus, a species with a whitish volva that
lacks the purple or pinkish purple tones typical of P hadriani. Kreisel (1996)
GQ981513 Mutinus caninus
1.00/100 r AF324170 Phallus rugulosus
1.00/100 AF324169 Phallus rugulosus
Phallus roseus KF481955
AF324157 Dictyophora indusiata
AF324161 Dictyophora indusiata
1-00/100 ‘o0vr? || AF324160 Dictyophora indusiata
AF324162 Dictyophora phalloidea
4.00/100 r AF324171 Phallus impudicus
1.00/99 AB615481 Uncultured fungus
cane FJ197936 Uncultured fungus
1.00/100 L GQ999338 Uncultured fungus
4.00/100 1 Phallus hadriani KF481956
DQ404385 Phallus hadriani
1.00/100 - JN182874 Dictyophora indusiata
0.99/100 HQ414538 Dictyophora indusiata f. lutea
AF324173 Dictyophora indusiata f. lutea
4.00/99 f AF324167 Dictyophora echinovolvata
-H——
AF324165 Dictyophora echinovolvata 08
Fic. 7: Consensus ITS tree generated in MrBayes 3.1 showing the examined specimens and their
closest relatives in the Phallaceae. Values above nodes represent PAUP maximum parsimony
bootstrap proportions, while those below nodes represent MrBayes posterior probabilities.
50 ... Moreno & al.
cites P hadriani from temperate and Mediterranean Europe, central Asia,
China, Japan, and North America.
Although Fischer (1929) transferred P roseus to Itajahya, Kreisel (1996)
includes the species in Phallus subg. Itajahya (Mller) Kreisel, together with
P. galericulatus (Moller) Kreisel and P glutinolens (Mdéller) Kuntze (emend.
Trierveiler-Pereira et al. 2009). Phallus glutinolens can be separated from both
P. roseus and P. galericulatus based on its pinkish stipe and greenish gleba;
P. galericulatus does not present a greenish gleba. Phallus roseus, a rare species
from desert areas, was recently recorded from the Hadramout valley in Yemen
(Kreisel & Al-Fatimi 2008) and the semi-arid Brazilian region (Ottoni et al.
2010).
We provide the first molecular data for P. roseus, which clearly separate
the species from the impudicus/hadriani group and apparently link it to
P. rugulosus Lloyd. Additionally, molecular data suggest that a cryptic species
could exist within P. impudicus, as shown by the different lineages observed in
the phylogenetic tree. However, the lack of sequences coming from available
fruiting bodies make necessary further sampling efforts to confirm this
hypothesis.
Acknowledgements
We express our gratitude to M.M. Dios and M. Esqueda for reviewing the manuscript
and adding a number of useful comments, to Luis Monje and Angel Pueblas of the
“Gabinete de Dibujo y Fotografia Cientifica” at the Universidad de Alcala de Henares
for help in the digital preparation of the photographs, and to Dr. J. Rejos, curator of the
AH herbarium.
Literature cited
Ahmad S. 1952. Gasteromycetes of West Pakistan. Department of Botany, University of the Punjab,
Lahore.
Alvarado P, Moreno G, Manjon JL. 2012. Comparison between Tuber gennadii and T. oligospermum
lineages reveals the existence of the new species T: cistophilum (Tuberaceae, Pezizales).
Mycologia 104: 894-910. http://dx.doi.org/10.3852/11-254
Calonge FD. 2005. A tentative key to identify the species of Phallus. Bol. Soc. Micol. Madrid 29:
9-18.
Calonge FD, Kreisel H. 2002. Phallus minusculus sp. nova from Tropical Africa. Feddes Repert. 113:
7-8. http://dx.doi.org/10.1002/fedr.200290007
Calonge FD, Kreisel H, Mata M. 2005. Phallus atrovolvatus a new species from Costa Rica. Bol. Soc.
Micol. Madrid 29: 5-8.
Calonge FD, Menezes de Sequeira M, Freitas T, Rocha E, Franquinho L. 2008. Phallus maderensis
sp. nov., found in Madeira, Portugal. Bol. Soc. Micol. Madrid 32: 101-104.
Fischer E. 1929. Eine Phalloidee aus Palestina; Phallus roseus Delile und die Gattung Itajahya Alfr.
Moller. Ber. Deutsch. Bot. Ges. 47: 288-295.
Phallus spp. new to Pakistan ... 51
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes—application
to the identification of mycorrhizae and rusts. Mol. Ecol. 2: 113-118.
http://dx.doi.org/10.1111/j.1365-294X.1993.tb00005.x
Kreisel H. 1996. A preliminary survey of the genus Phallus sensu lato. Czech Mycol. 48: 273-281.
Kreisel H, Al-Fatimi M. 2008. Further basidiomycetes from Yemen. Feddes Repert. 119: 463-483.
http://dx.doi.org/10.1002/fedr.200811175
Li TH, Liu B, Song B, Deng WQ, Zhou TX. 2005. A new species of Phallus from China and
P. formosanus, new to the mainland. Mycotaxon 91: 309-314.
Moreno G, Khalid AN, Alvarado P. 2009. A new species of Phallus from Pakistan. Mycotaxon 108:
457-462. http://dx.doi.org/10.5248/108.457
Nylander JAA. 2004. MrModeltest v2. Evolutionary Biology Centre, Uppsala University, Sweden.
Ottoni T, Silva BS, Fazolino EP, Baseia IG. 2010. Phallus roseus, first record from the neotropics.
Mycotaxon 112: 5-8. http://dx.doi.org/10.5248/112.5
Ronquist F, Huelsenbeck JP. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Swofford DL. 2001. PAUP”: phylogenetic analysis using parsimony (and other methods). Version
4.0b10. Sinauer Associates, Sunderland, Massachusetts.
Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis
(MEGA) software version 4.0. Mol. Biol. Evol. 24: 1596-1599.
http://dx.doi.org/10.1093/molbev/msm092
Trierveiler-Pereira L, Loguercio-Leite C, Calonge FD, Baseia IG. 2009. An emendation of Phallus
glutinolens. Mycol. Progress 8: 377-380. http://dx.doi.org/10.1007/s11557-009-0603-7
White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols: a guide to
methods and applications. New York, USA: Academic Press, Inc.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.53
Volume 125, pp. 53-58 July-September 2013
Nidula shingbaensis sp. nov.,
a new bird's nest fungus from India
KANAD Das! & Rut LIN ZHAO ”
‘Botanical Survey of India, SHRC, Gangtok 737103, Sikkim, India
’ Key Laboratory of Forest Disaster Warning and Control in Yunnan Province,
Southwest Forestry University, Kunming, Yunnan Prov. 650224, PR China
* CORRESPONDENCE TO:
[email protected]
ABSTRACT —A new species of bird’s nest fungi, Nidula shingbaensis, is proposed from the
state of Sikkim. It is characterised by a slightly flared moderate to large peridium, yellowish
interior peridium-wall, numerous brown-coloured peridioles with irregularly wrinkled
surfaces, large broadly ellipsoid to elongate basidiospores, and a six-layered (in cross-
section) peridium. A detailed description is supported by macro- and micromorphological
illustrations, and the relation with similar and related taxa is discussed.
Key worps — Basidiomycota, macrofungi, Agaricaceae, Agaricales, taxonomy
Introduction
Bird’s nest fungi, previously placed in a separate family Nidulariaceae,
were recently moved to the Agaricaceae (Kirk et al. 2008). Currently, they are
represented in India by three genera with 17 species (14 Cyathus spp., Nidula
emodensis, N. candida, and one Crucibulum sp.; Das & Zhao 2012).
Shingba Rhododendron Sanctuary (43 km?) lies in the North district of
Sikkim (a small Indian state in the eastern Himalaya). This subalpine area in the
Yumthang valley and surroundings is covered by over 40 Rhododendron species
but otherwise dominated by trees (Abies densa, Picea spinulosa, Tsuga dumosa,
Larix griffithii, Magnolia globosa, M. campbellii, Acer pectinatum, Betula utilis)
and harbours abundant macrofungi. During a 2011 macrofungal survey, the
senior author came across a striking bird’s nest fungus, which, after thorough
macro- and micromorphological studies and literature surveys, we propose
here as a new species, Nidula shingbaensis. We offer a detailed description and
illustrations, discuss the relationship of the new species with allied Indian and
extralimital taxa, and provide a provisional key to all species of Nidula.
54 ... Das & Zhao
Materials & methods
Macromorphological characters were recorded from the fresh basidiomata in the field
and in the base camp. Field photographs of the fresh basidiomata were taken with the
aid of Nikon D300s. Colour codes and terms (mostly) are as in the Colour identification
chart of British Fungus Flora (Henderson et al. 1969). Immediately after recording the
macromorphological characters, basidiomata were dried with a field drier.
In the laboratory, macromorphological characters were again observed from
the dry samples with the help of stereo zoom dissecting microscope Nikon SMZ
1500 and photographs were taken through the attached dedicated camera. Other
micromorphological structures such as basidiospores, cross-sections of peridium and
peridiole were noted with the aid of light microscope Nikon E 50i and photography
was made with the attached dedicated camera based on the free-hand sections from dry
samples mounted in a mixture of 5 % KOH, 30 % glycerol, phloxine and cotton blue.
Spore measurements are noted based on twenty basidiospores. Spore size measurements
and length/width ratios (Q) are presented as: minimum-—mean-maximum. Herbaria
names are after Holmgren et al. 1990.
Taxonomy
Nidula shingbaensis K. Das & R.L. Zhao, sp. nov. PLATES 1-2
MycoBank: MB 803499
Differs from all other Nidula species by its six-layered peridium.
Type: India. Srkxim: North District, Shingba Rhododendron Sanctuary, 27°43'28.1"N
88°44'53.8"E, alt. 2997 m, 24.VIII.2011, K. Das, KD-11-76 (Holotype, BSHC; GenBank
KC763972. Isotype, SWFC).
EryMo_oey: after Shingba Rhododendron Sanctuary, the type locality
BASIDIOMATA urn- or vase-shaped, 6-9 mm high (<11 mm high with
epiphragm/lid), 5-7 mm wide at mouth, gradually tapering towards base (up
to 4mm wide), sessile. EPIPHRAGM operculate, buff (52), rupturing at maturity.
EXTERIOR of the peridium distinctly matted fibrillose to villose, or wooly,
hairs mostly in tufts (<230 um high), white to buff or clay pink; mouth slightly
flared, margin straight to recurved, fringed, white (1A1), never wooly, never
split into stellate lobes. INTERIOR of the peridium smooth (never plicate), never
shining, saffron (49) to pale yellow (3C) towards mouth, rust or darker towards
base. PERIDIOLES numerous (<40), 0.9-1.3 mm in diam., lenticular, surface
irregularly wrinkled, very sticky, embedded in transparent mucilaginous gel
when moist, cinnamon (10), snuff brown (17) to cigar brown (16); funiculus
absent.
PERIDIUM 650-720 um thick (excluding hair), comprising six layers. Four
outer layers composed of loose hyphal mats, “intricata” textura; each layered
separated by a cord of grouped hyphae; the four (from the outermost) are 210
um, 80 um, <85 um, and <120 um thick; hyphae 3.5-5 um wide, thick-walled
(wall <2 um thick), with clamp connections, hyaline to greenish yellow in KOH.
Nidula shingbaensis sp. nov. (India) ... 55
cs
||
td |
|
|
|
}
}
| |
| |
Wall
ii)
PiaTE 1: Nidula shingbaensis (Holotype KD-11-76). A, E. Basidiomata attached on substrates
showing epiphragm and peridioles; B. Exterior of peridium (from dry sample); C. Peridium
showing flared mouth and peridioles; D. Peridioles with wrinkled surface; F. Longitudinal section
of peridium showing the interior (from dry sample). Scale bars: B, C, F= 1 mm; D=0.5 mm.
Two inner layers of very similar nature, comparatively compact, placed above
the internal (inner most) edge of disintegrated hyphae; the outermost is <90
um and the innermost <190 um thick. Hairs (<70 um wide at base) originating
56 ... Das & Zhao
from hyphal cord, passing through two or three outer layers projected beyond
(emergent) the outer most layer <230 um. PERIDIOLES three layered (cortex,
subcortex and hymenium), covered with tunica (<27 um thick); cortex
<48 um thick, two layered, consisting of an exocortex with hyphal tips (hyphae
<2.2 um wide) projecting in tunica, blue (72) in cotton blue and an endocortex
with branched aseptate slightly to very thick-walled (<4 um thick) grayish
yellow to rust (13) or rusty tawny (14) hyphae (<10 um wide); subcortex thick
(<120 um), yellowish brown to cinnamon in cotton blue, subhyaline towards
hymenium, with very thick-walled (wall <8 um thick) hyphae having narrow
lumen, bluish with cotton blue; hymenium <145 um thick, subhyaline, blue in
cotton blue, containing spore mass and hyphae (<2 um wide). CAPILLITIUM
absent. Basrp1a not found (in mature peridioles). BASIDIOSPORES 6.9-8.3-9.8
x 4.9-5.4-6.1 um, broadly ellipsoid to elongate (Q = 1.25-1.52-1.88), mostly
rounded at both ends or at least at one end, thick-walled (<1 um thick),
subhyaline, contents blue in cotton blue, hyaline to greenish yellow (inamyloid)
in Melzer’s reagent and pink in phloxine.
EcoLocy & DISTRIBUTION — Gregarious to caespitose on small fallen twigs
of Abies densa Griff. in subalpine coniferous or mixed forest. August. Rare.
ADDITIONAL SPECIMEN EXAMINED: INDIA. Sikkim: Nortu District, Shingba
Rhododendron Sanctuary, 27°43'48.6"N 88°44'32.0"E, alt. 3095 m, 25.VHI.2011, K.
Das, KD-11-92 (BSHC).
Notes — Its morphological characters (urn- to vase-shaped basidiomata
containing numerous lenticular brown peridioles, six-layered peridium, mouth
with epiphragm/lid, presence of tunica on the peridioles, two-layered cortex
enclosing basidia and basidiospores, absence of capillitium and presence of
smooth, hyaline, broadly ellipsoid to elongate basidiospores) easily place the
present species amongst bird’s nest fungi. Moreover, the presence of a multi-
layered peridium with epiphragm/lid, absence of funiculus, and presence of
transparent mucilaginous gel surrounding the peridioles confirms its placement
in Nidula (Brodie 1975; Miller & Miller 1988).
Nidula shingbaensis is distinguished by its moderate to large peridium (6-9
x 5-7 mm), yellowish interior peridium-wall, brown-coloured large (0.9-1.3
mm diam.) peridioles with irregularly wrinkled surface, broadly ellipsoid to
elongate large (6.9-9.8 x 4.9-6.1 um) basidiospores, and six-layered peridium
(in cross-section).
Macroscopically the new species is quite similar to three other Nidula
species: N. emodensis (Berk.) Lloyd (Berkeley 1854; Cunningham 1924),
N. candida (Peck) V.S. White (Brodie 1975; Das & Zhao 2012) and N. macrocarpa
Lloyd (Lloyd 1917). However, N. emodensis differs in its smaller (4—6 mm high)
peridia and relatively small (0.5-1 mm diam.) peridioles that are almost black
at maturity (Cunningham 1924). Nidula candida differs by the larger peridium
Nidula shingbaensis sp. nov. (India) ... 57
PLATE 2: Nidula shingbaensis (Holotype KD-11-76). A. Basidiospores; B. Cross-section of peridium
showing six layers; C. Four loose outer layers of peridium; D, F. Cross-section of peridiole showing
tunica, cortex, subcortex and hymenium (blue), E. Transverse-section of peridiole showing tunica
covering two layered cortex and subcortex. Scale bars: A, E = 10 um; B-D, F = 100 um.
(8-13 mm high) with more flared mouth and larger peridioles (1.5-1.8 mm
diam.; Das & Zhao 2012). Similarly, N. macrocarpa (reported from Argentina
and Chile) can be separated from N. shingbaensis by its small (0.5-1 mm diam.)
peridioles and single layered peridium in cross-section (Diehl 2000). Finally,
another species, N. niveotomentosa (Henn.) Lloyd (reported from North
58 ... Das & Zhao
America), differs from N. shingbaensis by its shorter peridium (5-7 mm high)
and smaller peridioles (0.5-1 mm diam.; Miller & Miller 2006).
A provisional key to Nidula species
1. Basidiomata large, often > 10 mm high............. 0... 2
Li Basidiomata stall alwayes< 10 wi Wig bit, eek land cated cst band organs an elanas elapahdia dara 3
2. Peridioles 1.5-3 mm diam.; basidiospores 8-10 x 4-6 um.............. N. candida
2. Peridioles 0.5-1.0 mm diam.; basidiospores 12-16 x 5-6um........ N. macrocarpa
3. Exterior of peridium dingy grey; peridioles almost black at maturity... N. emodensis
3. Exterior of peridium white to yellowish or buff; peridioles reddish brown to grey,
HC Vels DIAC Ait aas Fa tats #2808 AAs Be Ee et ae ee EE ee wet ee 4
4. Peridioles 0.5-1.0 mm diam.; peridium 2-3-layered............ N. niveotomentosa
4. Peridioles 0.9-1.3 mm diam.; peridium 6-layered................. N. shingbaensis
Acknowledgments
The authors are grateful to the Director, Botanical Survey of India, Kolkata (India)
and Department of Forest, Environment and Wild Life Management, Government of
Sikkim for providing all kinds of facilities during this study. They are thankful to Drs.
Annemieke Verbeken (Belgium) and Zai-Wei Ge (China) for kindly reviewing the
manuscript and providing valuable suggestions. Assistance (during macrofungal survey
to Shingba Rhododendron Sanctuary) rendered by S.K. Rai, R.K. Ram, and P. Tamang
(BSI, SHRC, Gangtok) is duly acknowledged. National Natural Science Foundation of
China (Project ID: 31000013) is thanked for providing partial financial support to this
research.
Literature cited
Berkeley MJ. 1854. Decades XLVIL, XLVII. Indian fungi. Hooker’s Journal of Botany 6: 204-212.
Brodie HJ. 1975. The bird’s nest fungi. University of Toronto Press. Toronto and Buffalo.
Cunningham GH. 1924. A revision of the New Zealand Nidulariales, or bird’s-nest fungi.
Transactions of the New Zealand Institute 55: 55-66.
Das K, Zhao R. 2012. Bird’s nest fungi in India: a new record from Sikkim. 61-68, in: A. Biju Kumar
et al. (eds). Biodiversity & Taxonomy. Narendra Publishing House, Delhi, India.
Diehl P. 2000. Anatomy of the peridium in the genus Nidula (Nidulariales, Basidiomycetes). Sydowia
52: 16-29.
Henderson DM, Orton PD, Watling R. 1969. British fungus flora: agarics and boleti: colour
identification chart. Royal Botanic Garden Edinburgh, UK.
Holmgren PK, Holmgren NH, Barnett LC. 1990. Index Herbariorum. Part 1: Herbaria of the world,
8 ed. Regnum Vegetabile 120.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth and Bisby’s Dictionary of the fungi,
10° Edition, CAB International, Wallingford, UK.
Lloyd CG. 1917. Mycological Notes 51. Mycological Writings 5: 731.
Miller OK Jr, Miller HH. 1988. Gasteromycetes—morphological and developmental features with
keys to the orders, families and genera. Mad River Press, Eureka, California, USA.
Miller OK Jr, Miller HH. 2006. North American mushrooms. Falcon Guides, Montana, USA.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.59
Volume 125, pp. 59-64 July-September 2013
Geosmithia tibetensis sp. nov. and new Gibellulopsis
and Scopulariopsis records from Qinghai-Tibet
YUE-MING Wu’”, JUN-JIE XuU?, HONG-FENG WANG‘ & TIAN-YU ZHANG?”
' Department of Plant Pathology, Shandong Agricultural University, Taian, 271018, China
? Key Laboratory of Agricultural Microbiology, Shandong Province, Taian, 271018, China
° College of Life Sciences, Linyi University, Shandong Province, Linyi, 276000, China
* Shandong Agricultural University Fertilizer Science & Technology Company Limited,
Taian, 271000, China
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — A new Geosmithia species and new records of Gibellulopsis nigrescens and
Scopulariopsis canadensis are described and illustrated from the Qinghai-Tibet Plateau
Area, China. Specimens (dried cultures) and living cultures are deposited in the Herbarium
of Shandong Agricultural University, Plant Pathology (HSAUP). Duplicates are kept in the
Herbarium of Institute of Microbiology, Academia Sinica (HMAS).
KEY worps — dematiaceous hyphomycetes, soil fungi, taxonomy
Introduction
During a survey of soil dematiaceous hyphomycetes in China, several
unusual species with phialidic conidia were isolated. One represents a new
species and the others new records for China.
We describe as new Geosmithia tibetensis, which is illustrated from cultures
grown on Czapek yeast extract agar (CYA; Pitt & Hocking 1985). Geosmithia,
established by Pitt (1979), is characterized by asexual penicillate fruiting
structures, typically with entirely rough-walled elements. The conidiogenous
cells are cylindrical phialides. Conidia, which form in long chains, are smooth,
ellipsoidal or subspherical, 0-septate, and hyaline to pale brown. Index
Fungorum (2012) listed 19 taxa, and while Seifert et al. (2011) estimated that
the genus might contain 18 valid species.
Gibellulopsis, established by Batista & Maia (1959), is characterized by
subulate phialides and conidia that are hyaline and ellipsoidal to short-
cylindrical. Chlamydospores are formed abundantly. Seifert et al. (2011) stated
that the genus contains only one valid species. Scopulariopsis, established by
60 ... Wu &al.
Bainier (1907), is characterized by penicillate conidiophores bearing cylindrical
annellides, and conidia are elongate, ovate, or mitriform, hyaline to pale buff in
mass. Although Index Fungorum (2012) listed 102 taxa (many infraspecific),
Seifert et al. (2011) estimated that the genus may contain only 25 valid species.
Fia. 1. Geosmithia tibetensis (ex holotype HSAUP II 2000).
Conidia, conidiophores, and conidiogenous cells. Scale bars = 25 um.
Geosmithia tibetensis sp. nov. (China) ... 61
Geosmithia tibetensis Y.M. Wu & T.Y. Zhang, sp. nov. FIG. 1
MycoBank MB 802833
Differs from Geosmithia fassatiae by its larger conidia and phialidic conidiogenous cells
without a distinct collar around the apical pore and from G. lavendula by its larger and
paler brown conidia and moderately brown conidiophores.
Type: China, Tibet: Jiangzi, from a grassland soil, altitude 4100 m, 11 Sept. 2007, Y.M.
Wu (Holotype HSAUP II ,.2000; isotype HMAS 196275).
EryMoLoey: in reference to the type locality.
CoLonigs on CYA effuse, velvety, pale yellow-brown, Mycelium superficial or
immersed, hyphae branched, septate, smooth, subhyaline to light brown, 2-3 um
wide. CONIDIOPHORES light brown, hyaline towards the apex, macronematous,
mononematous, solitary, erect, septate, conspicuously to finely roughened,
60-80 um long, 3-4 um wide, penicillate, terminally bearing a small number of
elements, typically monoverticillate to biverticillate, verrucose, 6-15 x 3-5 um.
CONIDIOGENOUS CELLS phialides, terminal, verrucose, hyaline, cylindrical,
clavate or obclavate, 8-20 x 3-5 um. Conip1a smooth, ellipsoidal to oblong,
pale brown, often distinctly pointed apex, with a subtruncate base, adhering in
chains, 0-septate, 4.5-6 x 3-4.2 um.
Comments - Morphologically, G. tibetensis resembles G. fassatiae M. Kolatik
et al. (Kolarik et al. 2005) and G. lavendula (Raper & Fennell) Pitt (Pitt 1979),
but G. fassatiae has smaller conidia (3.5-4.5 x 2.5-3 um) and conidiogenous
cells often with a distinct collar around the apical pore, while G. lavendula has
smaller, hyaline conidia (4.0-5.5 x 2.0-2.5 um).
Gibellulopsis nigrescens (Pethybr.) Zare, W. Gams & Summerb.,
Nova Hedwigia 85: 477 (2007) RIG:2
CoLoniges on PDA effuse, dark grey, velvety. Mycelium superficial or
immersed, hyphae branched, septate, smooth, hyaline to pale brown, 2-3
um wide. CONIDIOPHORES smooth, pale brown, hyaline towards the apex,
macronematous, mononematous, solitary or in groups, erect, septate, 180-230
um long, 2.5-3.5 um wide. CONIDIOGENOUS CELLS phialidic, smooth, hyaline,
clavate or subulate, 20-45 x 1.5-2.5 um. Conip1A smooth, ellipsoidal to
ovate, hyaline, often in chains, 0-septate, 4-6 x 1.5-2.5 um. Chlamydospores
abundant.
SPECIMEN EXAMINED: CHINA. TIBET: Xigaze, from a forest soil, altitude 3100 m, 11
Sept. 2007, Y.M. Wu (HSAUP II 1082, HMAS 196276).
Gibellulopsis nigrescens is reported for the first time from China. Compared with
the morphological characters of the species as described by Zare et al. (2007),
both have hyaline conidia that are smooth, ellipsoidal to short-cylindrical, 0-
septate, often in chains, and measure 4-6 x 1.5-2.5 um and both form abundant
62 ... Wu &al.
Fic. 2. Gibellulopsis nigrescens (HSAUP II 1082).
Conidia, chlamydospores, conidiophores, and conidiogenous cells. Scale bars = 25 um.
chlamydospores. We believe they are the same species. This is the only species
known in the genus (Seifert et al. 2011).
Scopulariopsis canadensis F. J. Morton & G. Sm., Mycol. Pap. 86: 55 (1963) Fic. 3
CoLoniges on MA (malt agar) effuse, fuscous-black, velvety. Mycelium
superficial or partly immersed, hyphae branched, septate, smooth, hyaline
Geosmithia tibetensis sp. nov. (China) ... 63
Fra. 3. Scopulariopsis canadensis (HSAUP II 1481).
Conidia, conidiophores, and conidiogenous cells. Scale bar = 25 um.
to pale brown, 1.5-2.5 um wide. Conrp1opHoress bearing annellophores in
groups of 2-5 without metulae, or irregularly branched, pale brown, septate,
smooth, 10-30 x 2.5-3.5 um. CONIDIOGENOUS CELLS phialidic, terminal,
smooth, hyaline, clavate or subulate, 8-15 x 3-6 um. Conrp1a smooth, pale
brown, ovate to oblong, with distinctly truncate base and rounded apex, often
in chains, 0-septate, 6-8.5 x 4-5.5 um.
SPECIMEN EXAMINED: CHINA. TIBET: Xigaze, from a grassland soil, altitude 4550 m, 20
Sept. 2007, Y.M. Wu (HSAUP II 1481, HMAS 196277).
Scopulariopsis canadensis is reported for the first time from China. Compared
with the descriptions by Morton & Smith (1963), both our specimens and
the type have annellophores and pale brown conidia that are smooth, ovate
to oblong, with distinctly truncate bases and rounded apices, often in chains,
0-septate, 6-8.5 x 4-5.5 um. We believe they are the same species. In conidial
shape, this species is most similar to S. candida (Vuillemin 1911), which differs
in producing smaller (5-8 x 4-7 um), and very pale conidia.
64 ... Wu &al.
Acknowledgments
The authors are grateful for pre-submission comments and suggestions provided by
Dr Eric McKenzie, Prof. Y.L. Guo, and Dr. Shaun Pennycook. This project was supported
by the National Science Foundation of China (no. 30970011 & 30499340).
Literature cited
Bainier G. 1907. Mycothéque de l'Ecole de Pharmacie. XIV. Scopulariopsis genre nouveau de
Mucédinées. Bull. Soc. Mycol. Fr. 23: 98-105.
Batista AC, H Da Silva Maia. 1959. Uma nova doenca fungica de peixe ornamental. Anais Soc. Biol.
Pernambuco. 16(1): 154-156.
Index Fungorum. 2012. http://www.indexfungorum.org/Names/Names.asp (accessed 17 Dec.
2012).
Kolatik M, Kubatova A, Cepicka I, Pazoutova S, Sritka P. 2005. A complex of three new white-
spored, sympatric, and host range limited Geosmithia species. Mycol. Res. 109(12): 1323-1336.
http://dx.doi.org/10.1017/S0953756205003965
Morton FJ, Smith G. 1963. The genera Scopulariopsis Bainier, Microascus Zukal, and Doratomyces
Corda. Mycol. Pap. 86: 1-96.
Pitt JI. 1979. Geosmithia gen. nov. for Penicillium lavendulum and related species. Can. J. Bot. 57:
2021-2030.
Pitt JI, Hocking AD. 1985. Interfaces among genera related to Aspergillus and Penicillium. Mycologia
77(5): 810-824.
Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes. CBS
Biodiversity Series. CBS-KNAW Fungal Biodiversity Centre, Utrecht, Netherlands. 997 p.
Vuillemin P. 1911. Difference fondementale entre le genre Monilia et les genres Scopulariopsis,
Acmosporium et Catenularia. Bull. Soc. Mycol. Fr. 27: 137-152.
Zare R, Gams W, Starink-Willemse M, Summerbell RC. 2007. Gibellulopsis, a suitable genus
for Verticillium nigrescens, and Musicillium, a new genus for V. theobromae. Nova Hedwigia
85(3-4): 463-489. http://dx.doi-org/10.1127/0029-5035/2007/0085-0463
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/125.65
Volume 125, pp. 65-67 July-September 2013
New records of crustose lichens from China — 1
QIANG REN* & SHUXIA LI
College of Life Science, Shandong Normal University, Jinan, 250014, China
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — During recent studies on the crustose lichens from northeast China, Cyphelium
lucidum, Varicellaria lactea, and Diploschistes euganeus were revealed as new records for
China or mainland China. Illustrations and brief taxonomic descriptions are provided for
these three newly reported species.
Key worps — lichenized fungi, taxonomy, Greater Khingan Mountains
Introduction
In the course of our investigations on the lichen flora of northeast China,
three new lichen records for China or mainland China were discovered. There
are two mountain ranges in northeast China: the Greater Khingan Mountains
and the Lesser Khingan Mountains. The average precipitation exceeds 500
millimeters annually in the mountains, and the northern half of the mountains
is the coldest part of eastern China, with an extremely severe winter (mean
temperature -28°C). The mountains are covered by forests of larch, birch,
aspen, and pine. Specimens collected from other parts of China were also
studied. Illustrations and brief taxonomic descriptions are provided for the
newly reported taxa.
Materials & methods
All specimens examined are deposited in the Lichen Section of Botanical Herbarium,
Shandong Normal University, Jinan, China (SDNU).
The lichen specimens were examined using an OLyMPus SZ 51 stereomicroscope and
hand-cut sections under an OLyMPus CX 21 compound microscope. Photographs of the
thallus were taken with an OLympus SZX16 camera with DP72. Color reactions (spot
tests) were made using standard methods (Orange et al. 2001). Secondary metabolites
of all specimens were identified using thin layer chromatography (TLC) as described by
Elix et al. (1987) and Orange et al. (2001).
66 ... Ren & Li
The new records
Cyphelium lucidum (Th. Fr.) Th. Fr., Gen. Heterolich. Eur.: 101 (1861) PLATE 1A
This species is characterized by a brilliant greenish yellow, areolate thallus;
prominent, well dispersed, cup-like, black apothecia with sometimes lightly
yellow pruinose discs; always yellow pruinose rim of the apothecia; ascospores 2-
celled, about 10-20 x 7.5-10 um, with a very rough surface; and the production
of vulpinic acid. Cyphelium notarisii (Tul.) Blomb. & Forssell is another species
with yellow-green thallus reported in China (Wu et al. 1997), but C. notarisii
has immersed, epruinose apothecia and submuriform ascospores.
SPECIMEN EXAMINED — CHINA. HEILONGJIANG PROv.: TAHE County, Mengkeshan
Forestry Centre, alt. 555 m, on bark of Larix sp., 14 Aug. 2009, Qiang Ren 2009197
(SDNU).
Varicellaria lactea (L.) Schmitt & Lumbsch, Mycokeys 4: 31 (2012) PLATE 1B
Diagnostic characters are the white-grey thallus with a regularly rimose-
areolate surface; the round white soralia; the production of lecanoric acid;
and the substrate of dry, siliceous or slightly calcareous rock. Apothecia were
not seen in Chinese materials. The species might be confused with Pertusaria
hemisphaerica (Flérke) Erichsen and P. excludens Nyl., but P. hemisphaerica has
a pale blue-grey thallus with paler markedly convex soralia, which is C+ red,
Qe < " 4 el > > » FO OY ry NY as A e eS OF ne’
AR hp Ta? ether oR RI a ROE
PiaTE 1. A, Cyphelium lucidum (Qiang Ren 2009197); B, Varicellaria lactea (Qiang Ren 2012201);
C, Diploschistes euganeus (Daifeng Jiang 20120613). Scale bars: A = 0.5 mm; B= 2mm; C= 1mm.
Cyphelium, Varicellaria, and Diploschistes spp. new for China... 67
and occurs on trees. Pertusaria excludens also occurs on rocks but produces a
C- medulla and soralia.
SPECIMENS EXAMINED — CHINA. INNER MONGOLIA: EERGUNA CITY, Eerguna Nature
Reserve, 51°50.763'N 120°38.860'E, alt. 532 m, on siliceous rocks, 14 Aug. 2012, Qiang
Ren 2012165 (SDNU); Moerdaoga Forest Park, 51°27.415'N 120°45.699’E, alt. 750 m, on
siliceous rock, 10 Aug. 2012, Qiang Ren 2012060 (SDNU); Moerdaoga Forestry Bureau,
Mt. Jiageda, 51°22.698'N 120°49.745’E, alt. 1255 m, on calcareous rock, 15 Aug. 2012,
Qiang Ren 2012201 (SDNU). JINLIN PRov.: Yanji City, Wangqing County, Tianqiaoling
Town, Mt. Tulaopo, alt. 1011 m, on siliceous rock, 1 Dec. 2007, Chao Yuan & Liyan Sun
20073409, 20073419 (SDNU). X1zaNnG: Baxru County, Ranwu Town, Laigu Glacier,
alt. 4200 m, on siliceous rock,,32 Oct. 2007, Guoying Han 20072967 (SDNU).
Diploschistes euganeus (A. Massal.) J. Steiner, Verh. Zool.-Bot. Ges. Wien
69: 96 (1919) PLATE 1C
This species is characterized by the thin whitish gray thallus that is rimose-
areolate; perithecioid, immersed to semi-immersed ascomata; 8-spored asci
with brown, broadly ellipsoid ascospores; absence of lichen metabolites; and
a siliceous rock substrate. Diploschistes euganeus, which was reported from
Taiwan (Aptroot 2011), is new to mainland China. Diploschistes arabiensis
Lumbsch also occurs on siliceous rocks and lacks secondary metabolites but
differs in its whitish thicker thallus, ridged apothecia, predominantly 6-spored
asci, and distribution in Arabia and western North America.
SPECIMEN EXAMINED — CHINA. LIAONING: CHAOYANG CITY, Beipiao County, Mt.
Dahei, alt. 1300 m, on siliceous rock, 14 Aug. 2011, Daifeng Jiang 20120613 (SDNU).
Acknowledgements
This study was financially supported by the National Natural Science Foundation of
China (31100011) and the Program for Scientific research innovation team in colleges
and universities of Shandong Province. The authors thank Drs. André Aptroot (ABL
Herbarium, Soest, The Netherlands) and Shouyu Guo (Institute of Microbiology, CAS)
for presubmission reviews.
Literature cited
Aptroot A. 2011. Checklist of lichens and lichenicolous fungi of Taiwan.
http://www. biologie.uni-hamburg.de/checklists/lichens/asia/taiwan_l.htm
Brodo IM, Sharnoff SD, Sharnoff S. 2001. Lichens of North America. New Haven and London: Yale
University Press.
Elix JA, Johnston J, Parker JL. 1987. A catalogue of standard thin layer chromatographic data and
biosynthetic relationships for lichen substances. Canberra: Australian National University.
Orange A, James PW, White FJ. 2001. Microchemical methods for the identification of lichens.
London: British Lichen Society.
Smith CW, Aptroot A, Coppins BJ, Fletcher A, Gilbert OL, James PW, Wolseley PA (eds). 2009. The
lichens of Great Britain and Ireland. Second edition. London: British Lichen Society.
Wu JN, Kang RC, Abdulla A. 1997. The lichen genera Cyphelium and Pseudevernia and lichen
species Peltula tortuosa first recorded in China from Hanas of Xinjiang. Arid Zone Research.
14(3): 13-15. (in Chinese with English abstract)
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.69
Volume 125, pp. 69-80 July-September 2013
The lichen genus Graphis from Vietnam
SANTOSH JOSHI’, UDENI JAYALAL’, SOON-OK OH’,
THI THuy NGUYEN’*, NGUYEN ANH DZUNG? & JAE-SEOUN HurR"*
'Korean Lichen Research Institute, Sunchon National University, Suncheon-540 950, Korea
Biotechnology Center, Tay Nguyen University, 567 Le Duan, Buon Ma Thuot City, Vietnam
CORRESPONDENCE TO *:
[email protected]
ABSTRACT — ‘The status of Graphis (Ostropales: Graphidaceae) in Vietnam is presented,
based on literature and observation of recently collected specimens. Eleven new records of
the genus are described for the country. All important diagnostic characters of species are
documented and supported by distribution, ecology, and illustrations. A key to the seventeen
Graphis species in Vietnam is also provided.
KEY WoRDs — evergreen forest, National Park, taxonomy, tropical
Introduction
The broad tropical continental biota experienced a long, undisturbed
evolution that resulted into rich composition of old and mature forests (Chazdon
& Whitmore 2002). According to general consensus the tropical old forests
have a vast diversity of corticolous lichenized ascomycetes, particularly those
of Graphidaceae (Aptroot & Sipman 1997; Sipman & Aptroot 2001; Feuerer &
Hawksworth 2007; Archer 2009; Licking et al. 2009, 2011; Rivas Plata et al.
2008, 2010, 2012). Vietnam, being placed in the tropical belt, contains dense
continuous old forests exposed to a high and constant temperature regime
and a prolonged humid climate. The Vietnamese northern and central high
land ecosystems present an array of forest types, from deciduous to mixed
deciduous and evergreen forest cover, mostly restored after the regions were
declared National Parks (Jong et al. 2006). In Vietnam, there has not been
much significant research on Graphidaceae. A more or less exhaustive account
on Vietnam lichen mycota was published by Aptroot & Sparrius (2006) as a
checklist, which accepts ca. 30 species of Graphidaceae (including thelotremoid
taxa) for the country.
70 ... Joshi & al.
Graphis Adans., the largest graphidoid genus, comprises more than 300
species world-wide (Liicking et al. 2009). The genus, which has not thoroughly
studied in Vietnam, is represented by only six species: Graphis caesiella Vain..,
G. dussii Vain., G. leptogramma NyL., G. librata C. Knight, G. proserpens Vain.,
and G. rimulosa (Mont.) Trevis. In order to clarify the Graphis diversity in the
country, a survey was conducted of three National Parks situated in northern
and central highlands (Fic. 14). About 400 specimens were collected from all
three parks, including approximately 50 graphidaceous species representing
Acanthothecis, Diorygma, Fissurina, Graphis, Hemithecium, Platygramme,
Sarcographa, Sarcographina, and Thecaria. Our examination of the Graphis
specimens has revealed eleven species new to Vietnam. Although the recorded
Graphis species in no way encompass the full phytogeographical diversity of
Graphis in Vietnam, they certainly indicate that many more species will be
discovered in the country’s tropical rain forests.
All species reported here share some common characteristics peculiar
to Graphis: lirellate ascomata; carbonized proper exciple; non-amyloid (I-)
hymenium; functionally unitunicate asci with apical wall thickening; simple,
rather lax, apically granulate, + conglutinate, 1-2 um thick paraphyses; hyaline
and amyloid (I+ blue), trans-septate to muriform ascospores with lens-shaped
lumina; and Trentepohlia as photobiont (Archer 2009; Liicking et al. 2009).
Ecologically, Graphis was reported mostly on the trees in secondary old growth
forest and serves as a good indicator of forest health in National Parks in
Vietnam.
The present account briefly describes the 11 Graphis species newly reported
from Vietnam
Materials & methods
Chu Yang Sin, Yok Don, and Tam Dao National Parks of Vietnam were surveyed for
their lichen diversity assessment in April 2012. The collected samples were preserved
in lichen herbarium of Korean Lichen Research Institute, South Korea (KoLRI). The
specimens were segregated up to generic level, and the members of Graphis were
identified morphologically, anatomically and chemically. Morphological and anatomical
characters of thallus and ascomata were observed under SMZ-168 (China) dissecting
and Otympus BX50 (Tokyo, Japan) compound microscopes. The terminology for
lirellae morphology follows Licking et al. (2009). Lugol's solution (I) was used to
check the amyloidity of ascospores. All measurements were taken on thin hand-cut
sections of ascomata mounted in tap water. For color spot reaction tests and thin layer
chromatography (TLC), methodology provided by Orange et al. (2010) was followed.
For TLC, solvent system C (toluene 85%, acetic acid 15%) was used. The key characters
of the species were determined by consulting recent literature on Graphis (Staiger 2002;
Archer 2009; Liicking et al. 2009).
Graphis in Vietnam ... 71
Taxonomy
Graphis caesiocarpa Redinger, Ark. Bot. 27A(3): 23, 1935. PL. 1B
Thallus corticolous, epiperidermal, crustose, continuous, rough, whitish
or creamy grey, 100-150 um thick in cross section; cortex layer indistinct to
absent; algal layer indistinct to 10 um; medulla epi- to endoperidermal, densely
studded with crystals, <140 um; prothallus blackish.
Ascomata lirelliform, immersed; lirellae scattered, 5-10 mm long, black;
labia entire, whitish to creamy pruinose; disc slit-like, concealed (caesiella-
morph); proper exciple completely carbonized, convergent, + round, 50-140
um wide, basally sometimes merged with hypothallus; epihymenium indistinct
to absent; hymenium clear, 100-120 um high; hypothecium hyaline, indistinct
to 20 um high; ascus clavate, 8-spored; ascospores hyaline, fusiform, mostly
transversely 15-20-loculate, 50-70(-80) x 10-11 um.
CHEMISTRY: K+ yellow turning red, PD+ yellow-orange, C-; norstictic acid
detected in TLC.
DISTRIBUTION & ECOLOGY: Neotropics and Eastern Palaeotropics (Lticking
et al. 2009); in Vietnam, it was found growing at 700-800 m with other Graphis
and Diorygma species on tree trunks at medium height.
SPECIMEN EXAMINED: VIETNAM. Dak LAK PROVINCE: Yok Don National Park,
12°51'20.0"N 107°45'58.1"E, alt. ca. 760 m, on tree, 22 April 2012, Hur & Oh
VN120214-1 (KoLRI).
REMARKS: Graphis assimilis Nyl. has a similar distribution and also contains
norstictic acid but differs from G. caesiocarpa in short and sparsely branched
lirellae (lineola-morph). The ascospore size of the examined material, which
exceeds the range cited in Liicking et al. (2009), reaches that of G. marginata
Raddi, which has entirely different lirellae morphology (marginata-morph).
Pending additional collections, the material is provisionally placed in
G. caesiocarpa.
Graphis cervinonigra Zahlbr., Feddes Repert. 31: 210, 1933. BELG
Thallus corticolous, epiperidermal, crustose, continuous, + smooth, +
brownish green to grey-green, 100-150 um thick in cross section; cortex layer
15-20 um; algal layer continuous, 20-40 um; medulla mostly endoperidermal,
80-100 um, with inclusions of crystals; prothallus indistinct to blackish.
Ascomata lirelliform, prominent; lirellae aggregate, 5-7 mm long, black,
+ stellately branched (coarctata-morph); labia entire, epruinose; disc slit-like,
concealed; proper exciple completely carbonized, convergent, + round, 65-75
um wide; epihymenium indistinct to absent; hymenium inspersed, 100-120 um
high; hypothecium hyaline, indistinct to 20 um high; ascus clavate, 8-spored;
ascospores hyaline, fusiform, mostly transversely 9-10-loculate, 20-35 x 6-8
um.
72 ... Joshi & al.
CHEMISTRY: K+ yellow turning red, PD+ yellow-orange, C-; norstictic acid
detected in TLC.
DISTRIBUTION & ECOLOGY: Eastern Palaeotropics (Liicking et al. 2009);
in Vietnam, Graphis cervinonigra was reported at 70-1000 m on tree bark in
evergreen forest. The other lichens growing in surrounding environment were
the members of Diorygma, Letrouitia, and Ocellularia.
SPECIMENS EXAMINED: VIETNAM. VINH PHUC PROVINCE: Tam Dao National Park,
Tay Thien Mt., 21°26'52.2"N 105°38'10.8"E, alt. ca. 936 m, on tree, 26 April 2012, Hur &
Oh VN120372, VN120374 (KoLRI); 21°27'10.8"N 105°38'58.2’E, alt. ca. 77 m, on tree,
25 April 2012, Hur & Oh VN120349 (KoLRI).
REMARKS: The species resembles Graphis centrifuga Rasanen in having branched
lirellae, entire labia, completely carbonized proper exciple, transversely septate
ascospores, norstictic acid in thallus, and a similar geographical distribution.
Graphis centrifuga differs in long, radially branched lirellae and smaller
ascospores. Graphis gonimica Zahlbr. shares similar anatomical and chemical
characters but differs from G. cervinonigra in sparsely to irregularly branched
lirellae (lineola- or deserpens- morph).
Graphis cycasicola A.W. Archer & Elix, Australas. Lichenol. 61: 19, 2007. PL. 1D
Thallus corticolous, epiperidermal, crustose, continuous, smooth, + bulging
(due to bark texture), whitish-grey or green to grey-green, 170-200 um thick in
cross section; cortex layer distinct, 10-15 um; algal layer continuous, 30-50 um;
medulla mostly endoperidermal, studded with crystals; prothallus indistinct to
blackish.
Ascomata lirelliform, emergent; lirellae scattered, simple, straight to
sinus, short to 5 mm long, branched, with thick, complete thalline margin
(subserpentina-morph); labia entire; disc slit-like, concealed; proper exciple
completely carbonized, convergent, <170 um wide; epihymenium <15 um,
greyish, granular; hymenium clear, 120-150 um high; hypothecium hyaline,
indistinct to 20 um high; ascus clavate, 1-spored; ascospores hyaline, ellipsoidal,
muriform, multicelled, 80-110 x 25-40 um.
CHEMISTRY: K+ yellow turning red, PD+ yellow-orange, C-; norstictic acid
detected in TLC.
DISTRIBUTION & ECOLOGY: Eastern Palaeotropics (Licking et al. 2009); in
Vietnam, the species was growing luxuriantly at 700-800 m above chest height
on thick rough tree trunks.
SPECIMEN EXAMINED: VIETNAM. Dak LAK PROVINCE: Yok Don National Park,
12°51'20.0"N 107°45'58.1"E, alt. ca. 760 m, on tree, 22 April 2012, Hur & Oh VN120216
(KoLRI).
REMARKS: Both morphologically as well as chemically, G. cycasicola is similar
to G. subserpentina, which is distinguished by a laterally carbonized proper
exciple.
Graphis in Vietnam ... 73
Graphis epiphloea Zahlbr., Feddes Repert. 31: 210, 1933. PL. 1E
Thallus corticolous, epiperidermal, crustose, continuous, smooth, shiny,
green to greyish-green, 100-300 um thick in cross section; cortex layer
20-25 um; algal layer continuous, 30-50 um; medulla mostly endoperidermal;
prothallus indistinct.
Ascomata lirelliform, + immersed; lirellae aggregate, radially branched, <20
mm long, covered by thick complete thalline margin (subserpentina-morph);
labia entire; disc slit-like, concealed; proper exciple apically carbonized,
convergent, <60-70 um wide; epihymenium <15 um, greyish, granular;
hymenium clear, 150-170 um high; hypothecium hyaline, <40 um high;
ascus clavate, 6—8-spored; ascospores hyaline, fusiform, transversely septate,
15-20-loculate, 90-100(-140) x 18-20 um.
CHEMISTRY: K+ yellow, PD+ yellow-orange, C-; stictic acid detected in
PEG?
DISTRIBUTION & ECOLOGY: Eastern Palaeotropics (Licking et al. 2009); in
Vietnam, the species was collected at ca. 1000 m from a tree trunk above chest
level.
SPECIMEN EXAMINED: VIETNAM. VINH PHUC PROVINCE: Tam Dao National Park,
21°27'21.7"N 105°39'00.8"E, alt. ca. 1092 m, on tree, 25 April 2012, Hur & Oh VN120319
(KoLRI).
REMARKS: Graphis valparaiensis Adaw. & Makhija also produces entire labia,
apically carbonized proper exciple, clear hymenium, transversely septate large
ascospores, and stictic acid but differs from G. epiphloea in sparsely branched
lirellae with lateral thalline margin (lineola-morph). The examined material
was rather poor, and further collection of the material is needed.
Graphis handelii Zahlbr., Symb. Sinic. 3: 44, 1930. PL. 1F
Thallus corticolous, epiperidermal, crustose, continuous, + smooth, green
to grey-green, 100-150 um thick in cross section; cortex layer 10-15 um; algal
layer continuous, 30-40 um; medulla 80-100 um to mostly endoperidermal,
with inclusions of crystals; prothallus indistinct to blackish.
Ascomata lirelliform, prominent; lirellae aggregate, short to 5 mm long,
black, unbranched; labia entire, epruinose; disc exposed, epruinose (handelii-
morph); proper exciple laterally carbonized, convergent, 50-70 um wide;
epihymenium indistinct to absent; hymenium inspersed, <100 um high;
hypothecium indistinct; ascus clavate, 8-spored; ascospores hyaline, fusiform,
transversely septate, 9-10-loculate, 20-30 x 6-7 um.
CHEMISTRY: K+ yellow turning red, PD+ yellow-orange, C-; norstictic acid
detected in TLC.
DISTRIBUTION & ECOLOGY: Pantropical (Licking et al. 2009); in Vietnam,
the species was collected below 100 m from smooth barked trees, where it was
growing with members of the lecanoroid and lecidioid groups.
7A ... Joshi & al.
SPECIMENS EXAMINED: VIETNAM. VINH PHUC PROVINCE: Tam Dao National Park,
Tay Thien Mt., 21°27'53.3"N 105°35'06.6’E, alt. ca. 77 m, on tree, 26 April 2012, Hur &
Oh VN120389, VN120390, VN120392 (KoLRI).
REMARKS: Graphis crebra Vain. and G. aperiens Mill. Arg., which are most
similar to G. handelii, have distinctly white pruinose ascomatal discs (scripta-
morph). Moreover, G. aperiens has a completely carbonized proper exciple.
The examined material could be confused with G. plumierae Vain., which has
pruinose labia with closed ascomatal discs (caesiella-morph) and a different
geographical distribution.
Graphis japonica (Mill. Arg.) A.W. Archer & Liicking, Lichenologist 41: 437, 2009.
PR, 1G
Thallus corticolous, epiperidermal, crustose, continuous, bulging (due to
bark texture), smooth to + verrucose, shiny, grey-green, pale-green or yellowish
green , $170 um thick in cross section; cortex layer 20-30 um; algal layer
continuous, 50-60 um; medulla epi to endoperidermal, <100 um; prothallus
indistinct to blackish.
Ascomata lirelliform, + immersed; lirellae intensely branched, branching
leads the length of lirellae <30 mm, covered by thick complete and bulging
thalline margin (subserpentina-morph); labia entire; disc slit-like, concealed;
proper exciple apically to laterally carbonized, convergent, <20-70 um wide;
epihymenium <10 um, greyish, granular; hymenium clear, 150-170 um high;
hypothecium hyaline, 30-40 um high; ascus clavate, 2-8-spored; ascospores
hyaline, ellipsoidal, muriform, 10-15 x 4-6 loculate, 70-80 x 18-22 um.
CHEMISTRY: K+ yellow, PD+ yellow-orange, C-; stictic acid detected in
‘REG!
DISTRIBUTION & ECOLOGY: Eastern Palaeotropics (Licking et al. 2009); in
Vietnam, the species was collected at 600-800 m, where it was largely spread
over thick tree trunks in an evergreen forest, usually below chest level.
SPECIMENS EXAMINED: VIETNAM. Dak LAK PROVINCE: Chu Yang Sin National Park,
12°28'04.4"N 108°20'39.0"E, alt. ca. 622 m, on tree, 20 April 2012, Hur & Oh VN120062
(KoLRI); 12°27'57.0"N 108°20'34.9"E, alt. ca. 780 m, on tree, 21 April 2012, Hur & Oh
VN120139 (KoLRI).
REMARKS: Graphis japonica is a distinct species with pale-green to grey-green
thallus and a very long branched lirellae, which sometimes appear as grooves
on tree bark. The similar G. streblocarpa (Bél.) Nyl. differs in 1-2-spored asci
and a Neotropical distribution (Liicking et al. 2009).
Graphis renschiana (Mill. Arg.) Stizenb., Ber. Thatigk. St. Gallischen Naturwiss.
Ges. 1889-90: 184. 1891. PL, 1H
Thallus corticolous, epiperidermal, crustose, continuous, + smooth, green
to grey-green, <100 um thick in cross section; cortex layer indistinct to 10 um;
Graphis in Vietnam ... 75
algal layer continuous, 20-30 um; medulla 30 um to mostly endoperidermal,
with inclusions of crystals; prothallus indistinct.
Ascomata lirelliform, immersed to erumpent; lirellae radially to irregularly
branched (deserpens-morph), 10-15 mm long, black; labia entire; disc concealed;
proper exciple laterally carbonized, convergent, 40-50 um wide; epihymenium
indistinct to absent; hymenium clear, <100 um high; hypothecium 20-25 um
high; ascus clavate, 2-8-spored; ascospores hyaline, ellipsoidal, muriform, 7-10
x 5-6-loculate, 18-25 x 6-8 um.
CHEMISTRY: K+ yellow turning red, PD+ yellow-orange, C-; norstictic acid
detected in TLC.
DISTRIBUTION & ECOLOGY: Pantropical (Licking et al. 2009); in Vietnam,
the species was collected at 700-800 m, where it was growing luxuriantly with
other graphidoid taxa above chest level.
SPECIMEN EXAMINED: VIETNAM. Dak LAK PROVINCE: Chu Yang Sin National Park,
12°27'50.0"N 108°20'34.9"E, alt. ca. 780 m, on tree, 21 April 2012, Hur & Oh 120141
(KoLRI).
REMARKS: The over mature ascomata of G. renschiana are slightly striate as in
G. neoelongata Licking, which also contains norstictic acid but differs in also
producing stictic acid and its occurrence limited (thus far) to the Neotropics
(Licking et al. 2009). The other similar species, G. nadurina Aptroot, differs in
prominent, unbranched, very short lirellae with apically thick, complete thalline
margin (cleistomma-morph). The lirellae of the observed specimen do not fully
agree with the description in G. renschiana and so additional collections are
needed to clarify the identification.
Graphis schroederi Zahlbr., Ann. Mycol. 19: 228, 1921. PL. 11
Thallus corticolous, epiperidermal, crustose, continuous, + smooth, green
to grey-green, 200-250 um thick in cross section; cortex layer distinct, <20 um;
algal layer continuous, 30-50 um; medulla mostly endoperidermal, 140-180
um, with inclusions of crystals; prothallus indistinct to blackish.
Ascomata lirelliform, prominent; lirellae aggregate, radially branched,
apically covered by thick thalline margin (subserpentina-morph), 5-10 mm
long, black; labia entire; disc concealed; proper exciple completely carbonized,
convergent, 30-60 um wide, basally merged with hypothallus; epihymenium
indistinct to absent; hymenium clear, <200 um high; hypothecium indistinct;
ascus clavate, 8-spored; ascospores hyaline, fusiform, transversely septate,
14-23-loculate, 70-90(-130) x 14-17 um.
CHEMISTRY: K+ yellow, PD+ yellow-orange, C-; stictic acid detected in
‘TLE.
DISTRIBUTION & ECOLOGY: Palaeotropics (Liicking et al. 2009); in Vietnam,
the species was collected at 900-1000 m from smooth barked trees.
76 ... Joshi & al.
SPECIMEN EXAMINED: VIETNAM. VINH PHUC PROVINCE: Tam Dao National Park,
21°27'13.1"N 105°38'51.2"E, alt. ca. 990 m, on tree, 25 April 2012, Hur & Oh VN120310
(KoLRI).
REMARKS: The sympatric G. subassimilis Mill. Arg. also has entire labia,
completely carbonized proper exciple, clear hymenium, transversely septate
ascospores, and stictic acid but differs from G. schroederi in comparatively
smaller ascospores, lateral thalline margin, and pruinose labia (caesiella-
morph). The other similar species, G. rustica Kremp., differs from G. schroederi
in elongate and irregularly branched lirellae with thick lateral thalline margins
(marginata-morph).
Graphis subserpentina Nyl., Acta Soc. Sci. Fenn. 7: 465, 1863. Pisa
Thallus corticolous, epiperidermal, crustose, continuous, smooth, crystalline,
whitish-green to creamy green or off-white, <150 um thick in cross section;
cortex layer indistinct; algal layer continuous, 100-130 um; medulla mostly
endoperidermal, studded with crystals; prothallus blackish.
Ascomata lirelliform, + erumpent; lirellae aggregate, irregularly branched,
5 to 7 mm, covered by lateral thalline margin (subserpentina-morph); labia
entire; disc slit-like, concealed; proper exciple laterally carbonized, convergent,
<230 um wide in mature ascomata; epihymenium indistinct; hymenium clear,
125-150 um high; hypothecium hyaline, <40 um high; ascus clavate, 1-spored;
ascospores hyaline, ellipsoidal, muriform, multicelled, 80-100 x 20-25 um.
CHEMISTRY: K+ yellow turning red, PD+ yellow-orange, C-; trace of
norstictic acid detected in TLC.
DISTRIBUTION & ECOLOGY: Palaeotropics (Liicking et al. 2009); in Vietnam,
the species was recorded from tree bark at 300-400 m.
SPECIMEN EXAMINED: VIETNAM. Dak LAK PROVINCE: Yok Don National Park,
12°51'20.0"N 107°45'58.1"E, alt. ca. 760 m, on tree, 22 April 2012, Hur & Oh VN120215
(KoLRI).
REMARKS: Graphis subserpentina morphologically resembles G. streblocarpa,
which differs in containing stictic acid. The chemically similar G. insulana
(Mill. Arg.) Licking & Sipman has an inspersed hymenium.
Graphis subvittata Adaw. & Makhija, Mycotaxon 99: 322, 2007. PL. 1K
Thallus corticolous, epiperidermal, crustose, continuous, + smooth (appears
uneven due to bark texture), grey-green to greyish, 140-200 um thick in cross
section; cortex <20 um; algal layer continuous, 20-30 um; medulla 100-150
um, with inclusions of crystals; prothallus blackish.
Ascomata lirelliform, erumpent to prominent; lirellae mostly scattered to
aggregate, irregularly branched, with basal to lacking thalline margin (striatula-
morph), <10 mm long, black; labia striate; disc concealed; proper exciple
peripherally carbonized, convergent, 40-80 um wide; epihymenium indistinct
Graphis in Vietnam ... 77
to absent; hymenium clear, <100 um high; hypothecium distinct, 20-25 um
high; ascus clavate, 8-spored; ascospores hyaline, fusiform, transversely septate,
9-10-loculate, 20-30 x 6-7 um.
CHEMISTRY: K+ yellow turning red, PD+ yellow-orange, C-; norstictic acid
and traces of stictic acid detected in TLC.
DISTRIBUTION & ECOLOGY: Eastern Palaeotropics (Lticking et al. 2009); in Vietnam,
the species was collected from rough bark of trees, where it was spreading luxuriantly at
an altitude between 700-800 m.
SPECIMEN EXAMINED: VIETNAM. Dak LAK PROVINCE: Chu Yang Sin National Park,
12°27'50.0"N 108°20'34.9"E, alt. ca. 780 m, on tree, 21 April 2012, Hur & Oh VN120184
(KoLRI).
REMARKS: Graphis subvittata is most similar in thallus compound and lirellae
morphology to G. nigroglauca Leight., which differs in larger ascospores and
lacking a thalline margin. The examined specimen is comparable to G. schiffneri
Zahlbr. in striated labia and the presence of norstictic acid, but G. schiffneri
has a completely carbonized exciple and tenella-morph lirellae and lacks stictic
acid.
Graphis supracola A.W. Archer, Austral. Syst. Bot. 14: 267, 2001. PL. 11
Thallus corticolous, epiperidermal, crustose, continuous, smooth, greyish-
green, thin, 70-100 um thick in cross section; cortex layer indistinct to absent;
algal layer continuous, 40-60 um; medulla mostly endoperidermal, indistinct,
studded with crystals; prothallus indistinct to blackish.
Ascomata lirelliform, immersed; lirellae scattered, radially branched, 5
to 10 mm long, with thin lateral thalline margin; labia entire, thinly white
pruinose (caesiella-morph)); disc slit-like, concealed; proper exciple completely
carbonized, convergent, <30-80 um wide; epihymenium <15 um, brownish,
granular; hymenium clear, <100 um high; hypothecium hyaline, <20 um high;
ascus clavate, 8-spored; ascospores hyaline, ellipsoidal, transversely septate,
20-30 x 7-8 um.
CHEMISTRY: K-, PD+ yellow-orange, C-; protocetraric acid detected in
LEG:
DISTRIBUTION & ECOLOGY: Pantropical (Licking et al. 2009); in Vietnam,
the species was recorded near a waterfall, where it was growing in small patches
with Letrouitia leprolytoides S.Y. Kondr. & Elix and other crustose species on
thick rough tree bark at 300-400 m.
SPECIMEN EXAMINED: VIETNAM. Dak NONG PROVINCE: Dray Nur Waterfall,
12°33'06.3"N 107°73'19.6"E, alt. ca. 371 m, on tree, 19 April 2012, Hur & Oh VN120008
(KoLRI).
REMARKS: The examined material of G. supracola was rather small, but
identifiable. It agrees well with all diagnostic characters except thallus color,
78 ... Joshi & al.
which Archer (2009) described as pale-fawn. The similar G. distincta Makhija
& Adaw. differs in exposed pruinose ascomatal discs and containing stictic and
constictic acids as an additional compounds.
Key to Graphis species recorded from Vietnam
The six previous records and eleven new records from Vietnam are summarized in this
key. Diagnostic characters of the earlier recorded species are from Liicking et al. (2009).
Hee labia siiiaten RARE At ke Ne Ce, See See AN insole 2
ea “AA ase res t.ho eS ren eS Ro See Se ee a ee Mee ee Mu erttse Merl ge Peril gebt sg -
2. Proper exciple completely carbonized; ascospores 30-80 um long... G. rimulosa
2. Proper exciple apically to peripherally carbonized ......................0000. 3
3. Norstictic and stictic acids present; ascospores 20-30 um long..... G. subvittata
3. | Nochemical substances; ascospores 20-50 um long.............. G. proserpens
A. = Ptoper exciple.conrpletelsncarboni zed «an fy oncy!t x oneculd x oneal t x ouecy! Spee agence: 4 5
4.. Proper exciple apically to laterally carbonized... Aon. eA ee Peg ee tae see nw oe 8
5. | Hymenium inspersed; lirellae long and radially branched; ascospores
ZO- S56 St ce os Sak lax Jadee Ja kge tae Oe ak eae olhtek G. cervinonigra
at bra 00h cs 20LUET G10 Cor | es Rates aR DAR Ra PENS re as SN ER eR RE NAA in HA Reon 6
6. | Ascospores muriform, 80-110 x 25-40 um; norstictic acid present. G. cycasicola
6. Ascospores transversely septate; chemistry variable .....................000. 7
7. Norstictic acid present; ascospores 50-70 x 10-11 um........... G. caesiocarpa
7. Stictic acid present; ascospores 70-90 x 14-17 um............... G. schroederi
8. Proper exciple apically to laterally carbonized; stictic acid present............. 9
8. Proper exciple laterally carbonized, chemistry variable ..................... 10
9. Proper exciple apically or laterally carbonized; ascospores muriform,
TADS OAS NS ONIN, ca thee eto liao chena ae ceed Lo che G. japonica
9. Proper exciple apically carbonized; ascospores transversely septate,
GVO ee LS Oana, peach Sash gtaie ya ig sh eka ens le oP ei eo a G. epiphloea
10. Hymenium inspersed; norstictic acid present; ascospores 20-30 x
(SPE (E Ge OS AAAS Anam ter tS ert CORRE tar tri WR in eR a at art Ren G. handelii
102. AHyimenium Cleat sc: 5.Ac5 bs sooo nah debe Ategh dee ge Mey aun yymeady woees 11
ly. “Ascospores:muriform; norstictic‘acid: present) ..0:h..0 eaeue tha su toes heed 12
LIT, ASCOSPOLES LLAHSVEFSELY SED tALe ss eats etre nwtege.e maine aes? mpihage apiece apinn © ag 13
12. Asci 1-spored; ascospores 80-100 x 20-25 um ............... G. subserpentina
12. Asci 2-8-spored; ascospores 18-25 x 6-8 UM .......... 2202 eee G. renschiana
13. Protocetraric acid; ascospores 20-30 x 7-8 UM........... 2 ee eee G. supracola
13° --stictic- and: hypostictic,-ormorsticticacids present. |. ssivad.nvu dds eisdcp eg ee eee 14
14. Stictic and hypostictic acids present; lirellae narrow, with gently sloping
lateral thalline margin; ascospores 44-65 um long ............ G. leptogramma
14s INGE SCLC ACICAPTESeTIE pie bak es As eS eshai ce a Meal a rie ay bose Pata ered 15
Graphis in Vietnam ... 79
Gulf of Tonkin
THAILAND
CAMBODIA
PLaTE 1. A. Map of Vietnam showing collection sites in northern and central highlands (x = Chu
Yang Sin NP; y = Yok Don NP; z = Tam Dao NP); B. Graphis caesiocarpa; C. G. cervinonigra;
D. G. cycasicola; E. G. epiphloea; E. G. handelii; G. G. japonica; H. G. renschiana; I. G. schroederi;
J. G. subserpentina; K. G. subvittata; L. G. supracola. Scale bars: B-D, F-L = 5 mm; E, G= 10 mm.
15. Lirellae prominent to sessile, with thick lateral thalline margin, very short
ANG DLatiched #COtiCOlOUSM ea mea eee Lake neon tations beat teers G. dussii
15. Lirellae immersed to erumpent; corticolous and saxicolous ................. 16
16. Lirellae elongate and irregularly branched; labia distinctly white
PRUITIOS Gr, oie tata Weare, ri, A eed Perce sal Aca 7a, erg er gal nar G. caesiella
16. Lirellae short and sparsely branched; labia epruinose................ G. librata
80 ... Joshi & al.
Acknowledgments
This work was supported by a grant from the National Research Foundation of
Korea (#2011-0031494) and the Korea National Research Resource Center Program
(NRE, 2012M3A9B8021726). Authors are grateful to Prof. Klaus Kalb and Dr. Ze-
Feng Jia for their valuable comments on the manuscript. Santosh Joshi also thanks Dr
André Aptroot for providing literature on Vietnamese lichens, and Jung Shin Park for
considerable help.
Literature cited
Aptroot A, Sipman HJM. 1997. Diversity of lichenized fungi in the tropics. 93-106, in: KD Hyde
(ed.). Biodiversity of Tropical Microfungi. University Press, Hong Kong.
Aptroot A, Sparrius LB. 2006. Addition to the lichen flora of Vietnam, with an annotated checklist
and bibliography. Bryologist 109(3): 358-371.
http://dx.doi.org/10.1639/0007-2745(2006) 109[358:AT TLFO]2.0.CO;2
Archer AW. 2009. Graphidaceae. 84-194, in: PM McCarthy (ed.). Flora of Australia, Vol. 57.
Canberra & Melbourne: ABRS/CSIRO.
Chazdon RL, Whitmore TC. 2002. Foundation of tropical forest biology. Key papers and
commentaries. University of Chicago press.
Feuerer T, Hawksworth DL. 2007. Biodiversity of lichens, including a world-wide analysis of
checklist data based on Takhtajan’s floristic regions. Biodiversity and Conservation 16: 85-98.
http://dx.doi.org/10.1007/s10531-006-9142-6
Jong WD, Sam DD, Hung TV. 2006. Forest rehabilitation in Vietnam: histories, realities and future.
Bogor, Indonesia: Center for International Forest Research (CIFOR).
Liicking R, Archer AW, Aptroot A. 2009. A world-wide key to the genus Graphis (Ostropales:
Graphidaceae). Lichenologist 41: 363-452. http://dx.doi.org/10.1017/S0024282909008305
Licking R, Seavey F Common RS, Beeching SQ, Breuss O, Buck WR, Crane L, Hodges M,
Hodkinson BP, Lay E, et al. 2011. The lichens of Fakahatchee Strand Preserve State Park,
Florida: Proceedings from the 18th Tuckerman workshop. Bulletin of the Florida Museum of
Natural History 49(4): 127-186.
Orange A, James PW, White FJ. 2010. Microchemical methods for the identification of lichens.
British Lichen Society, London.
Rivas Plata E, Liicking R, Lumbsch HT. 2008. When family matters: an analysis of Thelotremataceae
(lichenized Ascomycota: Ostropales) as bioindicators of ecological continuity in tropical forests.
Biodiversity and Conservation 17: 1319-1351. http://dx.doi.org/10.1007/s10531-007-9289-9
Rivas Plata E, Liicking R, Sipman HJM, Mangold A, Kalb K, Lumbsch HT. 2010. A world-wide
key to the thelotremoid Graphidaceae, excluding the Ocellularia-Myriotrema-Stegobolus clade.
Lichenologist 42: 187-189. http://dx.doi.org/10.1017/S0024282909990491
Rivas Plata E, Licking R, Lumbsch TH. 2012. A new classification of the family Graphidaceae
(Ascomycota: Lecanoromycetes: Ostropales). Fungal Diversity 52: 107-121.
http://dx.doi.org/10.1007/s132225-011-0135-8
Sipman HJM, Aptroot A. 2001. Where are the missing lichens? Mycological Research 105:
1433-1439. http://dx.doi.org/10.1017/S0953756201004932
Staiger B. 2002. Die Flechtenfamilie Graphidaceae. Studien in Richtung einer natiirlicheren
Gliederung. Bibliotheca Lichenologica 85: 1-526.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.81
Volume 125, pp. 81-85 July-September 2013
Setosynnema yunnanense sp. nov.
from submerged decaying leaves
YA-Li BAr"*, JIAN- YING LI**, MIN QIAO’, WEN- YUN QIAN’,
GUANG-ZHU YANG? & ZE-FEN Yu!*
‘Laboratory for Conservation and Utilization of Bio-resources,
Key Laboratory for Microbial Resources of the Ministry of Education,
Yunnan University, Kunming, Yunnan, 650091, P. R. China
?Horticultural Research institute of Yunnan Academy of Agricultural Science
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — Setosynnema yunnanense, a new species isolated from decaying leaves collected
in Xishuangbanna, Yunnan Province, China, is described. It is placed in Setosynnema based
on its chain-like conidia constricted at some septa (resulting in adjacent cells being connected
by a narrow isthmus). It differs from the type species, S. isthmosporum, by its deeper and
more frequent constrictions and its shorter conidia.
Key Worps — tuberculariaceous fungus, systematic, aquatic fungi
Introduction
Setosynnema D.E. Shaw & B. Sutton was erected to accommodate a single
anamorphic fungal species, S. isthmosporum D.E. Shaw & B. Sutton from Papua
New Guinea and Australia, characterized by scattered brown synnematous
conidiomata with whorls of setae near the apex (Shaw & Sutton 1985). The
conidia are holoblastic, filiform, widest at the centre, and with an isthmus at
the central septum tapered towards each end. No additional species have been
described. Subsequently, Nawawi (1985) isolated this species from Malaysia,
Matsushima (1996) from Japan, and Marvanova & Hywel-Jones (2000) from
Thailand. According to K. Seifert (pers. comm.), Synnematophora K.R. Sridhar
& Kaver. (represented by a single species, S. constricta K.R. Sridhar & Kaver.
from India; Sridhar & Kaveriappa 2002) is a synonym of Setosynnema.
China has an enormous diversity of mycota occurring on dead branches
and rotten submerged wood and leaves, and many anamorphic fungi collected
* Ya-Li Bai & Jian-Ying Li contributed equally to this work
82 ... Bai, Li, & al.
in southern China have recently been published (Ma et al. 2010, 2011a,b,
2012a,b; Ren et al. 2011, 2012; Zhang et al. 2009a,b, 2011, 2012). During our
survey of fungi growing on rotten submerged leaves, we isolated an unknown
Setosynnema species, which we describe and illustrate here as a new species. We
also isolated S. isthmosporum from Yunnan Province, a new record for China.
Materials & methods
The culture was isolated from dicotyledonous leaves submerged in a river in Yunnan.
A 2-4 x 4-5 cm rotten leaf was spread on the surface of CMA (20 g cornmeal, 18 g
agar, 40 mg streptomycin, 30 mg ampicillin, 1000 ml distilled water) for ten days; single
conidia were isolated using a sterilized toothpick while viewing with a CX31 microscope
and cultivated on CMA in Petri plates. Morphological observations were made from
CMA after incubation at 28°C for one week; pure cultures and a permanent slide were
deposited in the Herbarium of the Laboratory for Conservation and Utilization of
Bio-resources, Yunnan University, Kunming, Yunnan, P.R. China (YMEF, formerly Key
Laboratory of Industrial Microbiology and Fermentation Technology of Yunnan).
Taxonomy
Setosynnema yunnanense Y.L. Bai & Z.E. Yu, sp. nov. PLATE 1
MycoBank MB 804094
Differs from Setosynnema isthmosporum by its shorter conidia that have fewer septa and
more than one septum constricted to form an intercellular isthmus.
Type: PR China, Yunnan Province, Xishuangbanna city, Tropical Botanical Garden,
Chinese Academy of Science, 21°55'N 101°16’E, elev. 567 m, in a river on submerged
leaves of an unidentified dicotyledonous plant, July 2012, Y.L. Bai (Holotype YMF1.03964
[dried agar culture]; permanent slide, YMF1.039641; ex-type cultures, YMF1.039642).
ETYMOLOGY: yunnanense refers to the province in which the species was found.
Colonies effuse, brown to dark brown, attaining 35 mm diam. after 7 days on
CMA at 28°C. Mycelium partly superficial, partly immersed in substratum,
composed of branched, septate, tuberculate hyphae. Vegetative hyphae
2.5-3.5 um wide, pale brown to brown. Conidiomata are usually massive, stout,
synnematous, solitary or in aggregates of 1-3, brown, made up of parallel closely
packed brown hyphae, with an expanded spore producing head. Setae absent
in pure culture but present on natural substrate. Conidiophores arising close
to one another, and flock together closely, septate, smooth, subhyaline to pale
brown towards base, hyaline towards apex, sometimes 1-3 irregularly branched,
with primary, secondary and tertiary branches, 77-160 um tall, 3.0-5.0 um
wide, apex somewhat truncate to rounded, invariably with two scars marking
position of branches or conidiogenous cells attachment. Conidiogenous cells
terminal, apices somewhat rounded or truncate, with two slightly protuberant
scars, clavate to cylindrical, hyaline, integrated. Conidia produced in a whitish
mass emerging from apex of synnemata, hyaline, sometimes becoming pale
Setosynnema yunnanense sp. nov. (China) ... 83
Kes
J y
'
PLATE 1. Setosynnema yunnanense (holotype YMF1.03964, from pure culture). A. Conidiomata.
B. Branched conidiophores bearing conidia in clusters. C. Conidiogenous cells. D. Deciduous
conidia and conidiogenous cells. E-I. Conidia. Scale bars: A = 50 um; B = 20 um; C-I = 10 um.
whitish brown, acrogenous, filiform, curved, 94-154 um long, 2.0-3.0 um
wide at the widest part near the centre, tapering to 1.0-1.5 tm at each end, but
distal end often narrower. Uniseriate chains of 6-8 cells, with 2-4 (mainly 3) of
the septa between the middle cells constricted to form a narrow isthmus. The
number and position of the constricted septa within the conidium is variable;
there are 3(-4) constricted septa near the middle of each conidium, with 0-2
unconstricted septa at the distal end and 2 unconstricted septa at the proximal
end.
84 ... Bai, Li, & al.
Discussion
Setosynnema yunnanense fits well within Setosynnema based on its
synnematous conidiomata and filiform septate conidia with strong constrictions
at some septa that result in the central cells being connected by narrow isthmi.
However, the conidia of S. yunnanense differ from those of S. isthmosporum,
which has longer conidia ((189-—)200.5-260(-290) um) that are 7-8-septate with
only one septum constricted to an isthmus and with similarly wide proximal
and distal portions.
We did not see any setae in the pure culture of S. yunnanense as noted for
S. isthmosporum, although we did observe setae on the decaying leaves
from which the type species was isolated. In S. isthmosporum, setae were
rarely produced in pure culture (Shaw & Sutton 1985: 30). This variability
in setal production supports the proposed synonymy of Setosynnema and
Synnematophora, for which the presence/absence of setae was proposed as a
major differentiating character (Marvanova 2011:876).
The conidiogenous cell apices vary in different strains of the type species. The
type strain produces 1-3 applanate, denticulate, unthickened condiogenous loci
(Shaw & Sutton 1985). In the Japanese strain, the denticles are not as obvious
and are only slightly visible even under the SEM (Matsushima 1996), while two
conidiogenous loci are easily observed in the strain from Malaysia (Nawawi
1985). The conidiogenous cell apices of S. yunnanense are similar in shape to
those of the type strain of S. isthmosporum.
Acknowledgements
This work was jointly financed by National Basic Research Program of China
(973’Program: 2013CB127506) and National Natural Science Foundation Program
of PR China (31060008, 31160008, 31260007, 31360130), Grants from the Young
Academic and Technical Leader Raising Foundation of Yunnan Province (2010CI020).
China National Tobacco Corporation (grant no. 110201002023) and Yunnan Branch of
China Tobacco Industrial Corporation (grant no. 2010YN17). We are very grateful to
Profs. H.-O. Baral and X.G. Zhang for critically reviewing the manuscript and providing
helpful suggestions to improve this paper, and to Prof. Keith Seifert for providing
valuable literature.
Literature cited
Ma J, Wang Y, O'Neill NR, Zhang XG. 2011a. A revision of the genus Lomaantha, with the
description of a new species. Mycologia 103(2): 407-410. http://dx.doi.org/10.3852/10-176
Ma J, Zhang YD, Ma LG, Ren SC, Castafieda-Ruiz RF, Zhang XG. 2012a. Three new species of
Solicorynespora from Hainan, China. Mycol. Progress 11: 639-645.
http://dx.doi.org/10.1007/s11557-011-0775-9
Ma LG, Ma J, Zhang YD, Zhang XG. 2010. A new species of Spadicoides from Yunnan, China.
Mycotaxon 113: 255-258. http://dx.doi.org/10.5248/113.255
Ma LG, Ma J, Zhang YD, Zhang XG. 2011b. Taxonomic studies of Endophragmiella from southern
China. Mycotaxon 117: 279-285. http://dx.doi.org/10.5248/117.279
Setosynnema yunnanense sp. nov. (China) ... 85
Ma LG, Ma J, Zhang YD, Zhang XG. 2012b. A new species of Corynesporella and two first records
from China. Mycotaxon 119: 83-88. http://dx.doi.org/10.5248/119.83
Matsushima T. 1996. Matsushima Mycological Memoirs. No. 9. Kobe, Japan.
Marvanova L. 2011. Aquatic hyphomycete genera. 874-884, in: K Seifert et al. The genera of
hyphomycetes. CBS Biodiversity Series 9.
Marvanova L, Hywel-Jones NL. 2000. Sigmoidea contorta sp. nov. and two rare hyphomycete
species from streams in Thailand. Cryptogamie Mycologie, 21: 13-26.
Nawawi A. 1985. Some interesting hyphomycetes from water. Mycotaxon 24:217-227.
Ren SC, Ma J, Zhang XG. 2011. A new species and new records of Endophragmiella from China.
Mycotaxon 117: 123-130. http://dx.doi.org/10.5248/117.123
Ren SC, Ma J, Ma LG, Zhang YD, Zhang XG. 2012. Sativumoides and Cladosporiopsis, two new
genera of hyphomycetes from China. Mycol. Progress 11: 443-448.
http://dx.doi.org/10.1007/s11557-011-0759-9
Shaw DE, Sutton BC. 1985. A new aero-aquatic hyphomycete from Papua New Guinea and
Australia. Bot. J. Linn. Soc. 91(1-2): 25-36.
Sridhar KR, Kaveriappa KM. 2002. Synnematophora, a new aquatic hyphomycete from the Western
Ghat forests, India. Indian Journal of Forestry 25: 89-93.
Zhang K, Ma J, Wang Y, Zhang XG. 2009a. Three new species of Piricaudiopsis from southern
China. Mycologia 101(3): 417-422. http://dx.doi.org/10.3852/08-147
Zhang K, Ma LG, Zhang XG. 2009b. New species and records of Shrungabeeja from southern
China. Mycologia 101(4): 573-578. http://dx.doi.org/10.3852/09-006
Zhang YD, Ma J, Wang Y, Ma LG, Castafieda-Ruiz RE, Zhang XG. 2011. New species and record of
Pseudoacrodictys from southern China. Mycol. Progress 10: 261-265.
http://dx.doi.org/10.1007/s11557-010-0696-z
Zhang YD, Ma J, Ma LG, Zhang XG. 2012. Two new species of Taeniolina from southern China.
Mycol. Progress 11: 71-74. http://dx.doi.org/10.1007/s11557-010-0729-7
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.87
Volume 125, pp. 87-90 July-September 2013
Two earth-tongue genera new for Turkey
ILGAZ AKATA' & ABDULLAH KAYA”
‘Ankara University, Science Faculty, Department of Biology, TR 06100, Ankara, Turkey
*Karamanoglu Mehmetbey University, Science Faculty, Department of Biology,
TR 70100 Karaman, Turkey
“CORRESPONDENCE TO:
[email protected]
ABSTRACT — The genera Spathulariopsis (Cudoniaceae) and Trichoglossum (Geoglossaceae)
are recorded from Turkey for the first time, based on the collections of Spathulariopsis
velutipes and Trichoglossum hirsutum. Short descriptions and photographs of the taxa are
provided.
KEY worps — Ascomycota, biodiversity, macrofungi
Introduction
Earth-tongues, including the genera Geoglossum Pers., Leotia Pers.,
Microglossum Gillet, Spathularia Pers., Spathulariopsis Maas Geest., and
Trichoglossum Boud., are among the most widely distributed groups of fungi
in the division Ascomycota. They produce large pileate tongue-shaped fruiting
bodies on various substrates and are common in temperate regions. Despite
their wide distribution, most have been described from North America and
Southwest China (Zhuang 1998, Hustad et al. 2011, Wang et al. 2011).
Spathulariopsis (Cudoniaceae) is a monotypic genus. Also known as velvet-
foot fairy fan, S. velutipes forms a yellowish to brownish yellow laterally
compressed fan- or spatula-like head on a narrow brownish stem, needle-
shaped hyaline occasional septate ascospores, and 8-spored asci.
Trichoglossum (Geoglossaceae) contains 19 species (Kirk et al. 2008),
commonly known as black earth-tongues. Trichoglossum taxa are usually
characterized by club-shaped brownish black fruiting bodies, smooth or
velvety stipes, 7-15-septate smooth dark ascospores, large 4-8-spored asci, and
a positive reaction of the apical ascus pore in Meltzer’s reagent (Arora 1986,
Hansen & Knudsen 2000).
According to the literature on Turkish macrofungi (Solak et al. 2007; Sesli &
Denchev 2008; Akata et al. 2011, 2012; All et al. 2011), only two earth-tongues,
88 ... Akata & Kaya
Leotia lubrica (Scop.) Pers. and Spathularia flavida Pers., have thus far been
registered from Turkey.
Here we report the first Turkish collections of two additional earth-tongue
genera, Spathulariopsis and Trichoglossum.
Materials & methods
Specimens were collected from Uzungél Nature Park in 2011. The samples were
photographed in the field and relevant morphological and ecological characteristics
of the samples were recorded. Macroscopic and microscopic data were obtained using
standard mycological techniques, and the specimens were identified by consulting
Arora (1986), Hansen & Knudsen (2000), Breitenbach & Kranzlin (1984), and Jordan
(2004). The specimens are kept in the herbarium of Ankara University, Ankara, Turkey
(ANK).
Taxonomy
Figure 1. Spathulariopsis velutipes (Akata 4189): a. ascocarps; b. asci; c. ascospores.
Spathulariopsis velutipes (Cooke & Farl. ex Cooke) Maas Geest., Proc. K. Ned.
Akad. Wet., Ser. C, 75: 254. 1972 Fie. 1
Ascocarp 20-60 mm tall, spathulate, with a distinct head and stipe; HEAD
flattened or laterally compressed, pale yellow to brownish yellow or cream
colored and usually wrinkled or fairly smooth; FLESH whitish and insubstantial;
STIPE 10-30 x 5-8 mm, compressed and flattened at apex, cylindrical below,
ochre to reddish-brown and minutely velvety, with a typical orangish basal
mycelium.
Ascr 70-90 x 8-12 um, clavate, multiseriate eight spored, inamyloid;
PARAPHYSES up to 2 um broad, slender, tips spirally curved; AscosporREs 35-40
x 2-2.5 um, needle-shaped, hyaline, smooth, sometimes septate, usually with
several droplets.
SPECIMEN EXAMINED — TURKEY. TRABZON, Caykara, Uzung6l Nature Park, in spruce
(Picea orientalis (L.) Pererm.) forest, 40°37'N 40°18’E, 1420 m, 23.10.2011, Akata 4189
(ANK).
Spathulariopsis and Trichoglossum new for for Turkey ... 89
ComMENTs — Spathulariopsis velutipes could be confused with Spathularia
flavida due to its similar morphology. Spathularia flavida has a paler (whitish)
smooth stipe, while S. velutipes has a minutely fuzzy, brownish stipe, orange
basal mycelium, and shorter spores (Phillips 2005; Kuo 2005).
Trichoglossum hirsutum (Pers.) Boud., Hist. Classific. Discomyc. Europe: 86. 1907,
var. hirsutum Fic. 2
AscocarpP 40-70 mm tall, clavate, fertile head 10-15 x 5-8 mm, spathulate
to clavate, tapering into the slender compressed and grooved stipe; sTIPE 2-3
mm thick, cylindrical. Surface dry, black to brownish black with velvety hairs;
FLESH black and brittle.
Ascrt 170-210 x 20-25 um, cylindrical to clavate, eight spored, spores
parallel in ascus, amyloid; pAaRAPHysES filiform, curved, slightly swollen at
the tips. AscosPoREs 120-140 x 6-7 um, bacilliform, smooth, brown, with 15
septa. SETAE up to 170 um, thick walled, dark brown to black.
SPECIMEN EXAMINED — TURKEY. TRABZON, Caykara, Uzung6l Nature Park, on soil,
near mixed spruce (Picea orientalis) and beech (Fagus orientalis Lipsky) forest, 40°36'N
40°16'E, 1470 m, 27.08.2011, Akata 4077 (ANK).
a. ascocarps; b. asci; c. ascospores; d. paraphyses; e. seta.
90 ... Akata & Kaya
ComMENTs —Trichoglossum representatives differ from other black earth-
tongues primarily by the velvety hair covering their ascocarps. Morphologically
it is difficult to distinguish Trichoglossum taxa from each other. Trichoglossum
hirsutum and T. tetrasporum Sinden & Fitzp. can be distinguished from other
Trichoglossum species only at maturity by their 15-septate bacilliform spores.
Asci of T: hirsutum contain eight spores while those of T! tetrasporum contain
four (Hansen & Knudsen 2000, Breitenbach & Kranzlin 1984).
Acknowledgments
The authors would like to thank Prof. Dr. M. Halil Solak, Assoc. Prof. Dr. Aziz
Turkoglu, Assoc. Prof. Dr. Dursun Yagiz, and Dr. Shaun Pennycook for their helpful
comments and careful review of this article.
Literature cited
Akata I, Halici MG, Uzun Y. 2011. Additional macrofungi records from Trabzon province for the
mycobiota of Turkey. Turkish Journal of Botany 35: 309-314.
Akata I, Kaya A, Uzun Y. 2012. New ascomycete records for Turkish macromycota. Turkish Journal
of Botany 36: 420-424.
Alli H, Isiloglu M, Solak MH. 2011. New ascomycete records for the macrofungi of Turkey. Turkish
Journal of Botany 35: 315-318.
Arora D. 1986. Mushrooms demystified. Berkeley, Ten Speed Press.
Breitenbach J, Kranzlin F. 1984. Fungi of Switzerland, vol. 1. Lucerne, Verlag Mykologia.
Hansen L, Knudsen H. 2000. Nordic macromycetes (ascomycetes), vol. 1. Copenhagen,
Nordsvamp.
Hustad VP, Miller AN, Moingeon JM, Priou JP. 2011. Inclusion of Nothomitra in Geoglossomycetes.
Mycosphere 2: 646-654. http://dx.doi.org/10.5943/mycosphere/2/6/5
Jordan M. 2004. The encyclopedia of fungi of Britain and Europe. Edinburgh, David & Charles
Book Co.
Kirk PF, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the fungi, 10th Ed. Wallingford,
CAB International.
Kuo M. 2005. Spathulariopsis velutipes. MushroomExpert.Com
[http://www.mushroomexpert.com/spathulariopsis_velutipes.html].
Phillips R. 2005. Mushrooms and other fungi of North America. Canada, Firefly Books Ltd.
Sesli E, Denchev CM. 2008. Checklists of the myxomycetes, larger ascomycetes, and larger
basidiomycetes in Turkey. Mycotaxon 106: 65-67; up-dated online version (January 2013):
1-145. http://www.mycotaxon.com/resources/checklists/sesli-v106-checklist.pdf
Solak MH, Isiloglu M, Kalmis E, Alli H. 2007. Macrofungi of Turkey. Checklist. izmir, Universiteliler
Ofset.
Wang Z, Nilsson RH, Lopez-Giraldez F, Zhuang WY, Dai YC, Johnston PR, Townsend JP. 2011.
Tasting soil fungal diversity with earth tongues: phylogenetic test of SATE alignments for
environmental ITS data. PLoS ONE 6(4): e€19039.
http://dx.doi.org/10.1371/journal.pone.0019039
Zhuang WY. 1998. Flora Fungorum Sinicorum, vol. 8, Sclerotiniaceae et Geoglossaceae. Beijing,
Science Press.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.91
Volume 125, pp. 91-96 July-September 2013
Two new species of Septobasidium (Septobasidiaceae) from
Yunnan Province in China
WEI Li’? & LIN Guo’*
'State Key Laboratory of Mycology, Institute of Microbiology,
Chinese Academy of Sciences, Beijing 100101, China
*Graduate University of Chinese Academy of Sciences, Beijing 100049, China
* CORRESPONDENCE TO:
[email protected]
ABSTRACT —Two new species, Septobasidium fissuratum on Castanea sp. associated
with Pseudaulacaspis sp. and Septobasidium heliciae on Helicia nilagirica associated with
Lepidosaphes sp., are described.
Key worps —Pucciniomycetes, Septobasidiales, taxonomy
Two new species of Septobasidium were recently discovered from Yunnan
Province. These specimens, collected by Dr. Shuanghui He, are described
below.
Septobasidium fissuratum Wei Li bis & L. Guo, sp. nov. Figs 1-7
FUNGAL NAME EN 570061
Differs from Septobasidium meridionale by its larger basidia.
Type: China, Yunnan Province, Longchuan, Longba, alt. 1000 m, on Castanea sp.
(Fagaceae), associated with Pseudaulacaspis sp. (Diaspididae), 31.X.2012, S.H. He YN08
(HMAS 244419, holotype).
Erymo.oey: The epithet refers to the fissures of basidiomata.
Basidiomata on branches, 10-14 cm long, 2.5-6 cm wide, pale cinnamon-brown
or cinnamon-brown; margin determinate, surface smooth, with many fissures
at maturity. In section 600-1100 um thick, composed of 3-4 layers. Subiculum
brown, 30-50 um thick. Pillars brown, 100-180 um high, 30-100 um wide,
branched outwards to form a hyphal layer 350-700 um high, then forming
20-40 um thick horizontal layer, from which the fungal hyphae successively
producing hyphal layers at maturity. Hymenium hyaline or brownish, 60-100
92 ... Li& Guo
10 pm
Fic. 1. Septobasidium fissuratum (HMAS 244419, holotype). Basidia.
um thick. Basidia arising directly from the hyphae without a probasidial cell,
cylindrical, straight or slightly curved, 4-celled, 32-45 x 6-9 um, hyaline or
brownish. Basidiospores not seen. Haustoria consisting of irregularly coiled
hyphae.
ComMENTs: Septobasidium fissuratum is similar to S. meridionale C.X. Lu &
L. Guo, but the latter has fewer fissures on the basidiome surface, an
inconspicuous horizontal layer in the section, and smaller basidia, 27-36 x
7-9.5 um (Lu & Guo 2010b).
Septobasidium heliciae Wei Li bis & L. Guo, sp. nov. Figs 8-14
FUNGAL NAME EN 570062
Differs from Septobasidium septobasidioides by its wider pillars and smaller basidia.
Type: China, Yunnan Province, Yingjiang, Tongbiguan Nat. Res., alt. 1250 m, on Helicia
nilagirica (Proteaceae), associated with Lepidosaphes sp. (Diaspididae), 29.X.2012, S.H.
He YNO7 (HMAS 244418, holotype).
ETYMOLOGY: The epithet refers to the substrate plant genus.
Basidiomata on branches, 4-13 cm long, 4-5 cm wide, white or pale cinnamon-
brown; margin determinate, surface smooth. In section 750-1100 um thick.
Fics. 2-7 Septobasidium fissuratum (HMAS 244419, holotype). 2. Basidiomata on branch.
3-4. Sections of basidiomata (arrow shows horizontal layer). 5-6. Basidia (arrows). 7. Haustoria.
Septobasidium spp. nov. (China) ... 93
——
10 um
94 ... Li& Guo
Fic. 8. Septobasidium heliciae (HMAS 244418, holotype). Basidia.
Subiculum brown, 10-20 um thick. Pillars brown, 120-600 um high, 30-120
um wide, branched outwards to form a hymenial layer. From the old hymenium
successively forming new hyphal layer or pillars and hymenium. Hymenium
hyaline or brownish, 80-110 um thick, with irregularly arranged hyphae.
Basidia arising directly from the hyphae without a probasidial cell, cylindrical,
straight or curved, 4-celled, 30-45 x 5-6.5 um, hyaline or brown. Basidiospores
not seen. Haustoria consisting of coiled hyphae.
ComMENTs: Septobasidium heliciae is similar to S. septobasidioides (Henn.)
Hohn. & Litsch., but the latter has basidiomata with lobed wings, slender pillars
(10-25 um wide), and larger basidia (40-55 x 8.4-10 um; Couch 1938).
Including the two new species reported in this paper, 51 Septobasidium species
have now been reported in China (Sawada 1933, Couch 1938, Teng 1963, Tai
1979, Kirschner & Chen 2007, Lu & Guo 2009a,b,c, 2010a,b,c, 2011, Lu et al.
2010, Chen & Guo 201 1a,b,c,d, 2012a,b,c).
Fics. 9-14. Septobasidium heliciae (HMAS 244418, holotype). 9. Basidiomata on branches.
10-11. Sections of basidiomata. 12-13. Basidia. 14. Haustoria.
Septobasidium spp. nov. (China) ... 95
96 ... Li & Guo
Acknowledgements
The authors would like to express their deep thanks to Dr. Eric H.C. McKenzie
(Auckland, New Zealand) for serving as pre-submission reviewer, to Dr. Shuanghui
He (Beijing Forestry University) for serving as pre-submission reviewer and collecting
specimens, to Dr. Shaun Pennycook (Auckland, New Zealand) for nomenclatural review,
to Prof. Zhenyu Li (Institute of Botany, Chinese Academy of Sciences) for identifying
the host plants, to Prof. Sanan Wu (Beijing Forestry University) for identifying the scale
insects, and to Mrs. Xiangfei Zhu for inking in line drawings. This study was supported
by the National Natural Science Foundation of China (No. 30670005).
Literature cited
Chen SZ, Guo L. 2011la. Septobasidium sichuanense sp. nov. (Septobasidiaceae) from China.
Mycotaxon 115: 481-484. http://dx.doi.org/10.5248/115.481
Chen SZ, Guo L. 2011b. Septobasidium atalantiae sp. nov. (Septobasidiaceae) and S. henningsii new
to China. Mycotaxon 117: 291-296. http://dx.doi.org/10.5248/117.291
Chen SZ, Guo L. 201 1c. Septobasidium saurauiae sp. nov. (Septobasidiaceae) and S. pseudopedicellatum
new to China. Mycotaxon 118: 283-288. http://dx.doi.org/10.5248/118.283
Chen SZ, Guo L. 2011d. Septobasidium glycosmidis and S. albiziae spp. nov. (Septobasidiaceae) from
Hainan Province. Mycosystema 30: 861-864.
Chen SZ, Guo L. 2012a. Three new species and three new Chinese records of Septobasidium
(Septobasidiaceae). Mycosystema 31: 651-655.
Chen SZ, Guo L. 2012b. Three new species of Septobasidium (Septobasidiaceae) from Hainan
Province in China. Mycotaxon 120: 269-276. http://dx.doi.org/10.5248/120.269
Chen SZ, Guo L. 2012c. Three new species of Septobasidium (Septobasidiaceae) from southern and
southwestern China. Mycotaxon 121: 375-383. http://dx.doi.org/10.5248/121.375
Couch JN. 1938. The genus Septobasidium. Univ. of North Carolina Press, Chapel Hill. 480 p.
Kirschner R, Chen CJ. 2007. New reports of two hypophyllous Septobasidium species from Taiwan.
Fung. Sci. 22(1,2): 39-46.
Lu CX, Guo L. 2009a. Septobasidium maesae sp. nov. (Septobasidiaceae) from China. Mycotaxon
109: 103-106. http://dx.doi.org/10.5248/109.103
Lu CX, Guo L. 2009b. Two new species of Septobasidium (Septobasidiaceae) from China. Mycotaxon
109: 477-482. http://dx.doi.org/10.5248/109.477
Lu CX, Guo L. 2009c. Septobasidium annulatum sp. nov. (Septobasidiaceae) and Septobasidium
kameii new to China. Mycotaxon 110: 239-245. http://dx.doi.org/10.5248/110.239
Lu CX, Guo L. 2010a. Three new species of Septobasidium (Septobasidiaceae) from Gaoligong
Mountains in China. Mycotaxon 112: 143-151. http://dx.doi.org/10.5248/112.143
Lu CX, Guo L. 2010b. Two new species of Septobasidium (Septobasidiaceae) and S. pallidum new to
China. Mycotaxon 113: 87-93. http://dx.doi.org/10.5248/113.87
Lu CX, Guo L. 2010c. Two new species of Septobasidium (Septobasidiaceae) from Hainan province
in China. Mycotaxon 114: 217-223. http://dx.doi.org/10.5248/114.217
Lu CX, Guo L. 2011. Two new species of Septobasidium (Septobasidiaceae) from Gaoligong
Mountains in China. Mycotaxon 116: 395-400. http://dx.doi.org/10.5248/116.395
Lu CX, Guo L, Wei JG, Li JB. 2010. Two new species of Septobasidium (Septobasidiaceae) from
southern China. Mycotaxon 111: 269-274. http://dx.doi.org/10.5248/111.269
Sawada K. 1933. Descriptive catalogue of the Formosan fungi. Part VI. Rep. Dept. Agric. Govt. Res.
Inst. Formosa 61: 1-99.
Tai FL. 1979. Sylloge Fungorum Sinicorum. Science Press, Beijing. 1527 p.
Teng SC. 1963. Fungi of China. Science Press, Beijing. 808 p.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.97
Volume 125, pp. 97-101 July-September 2013
Septobasidium hoveniae sp. nov. and S. rhabarbarinum
new to China
WEI Li’? , SUZHEN CHEN’ , LIN GuO** & YAOQING YE?
'State Key Laboratory of Mycology, Institute of Microbiology,
Chinese Academy of Sciences, Beijing 100101, China
"University of Chinese Academy of Sciences, Beijing 100049, China
*Huangshan Scenic Area Administration Committee,
Anhui Province, Huangshan 245800, China
* CORRESPONDENCE TO:
[email protected]
ABSTRACT —A new species, Septobasidium hoveniae on Hovenia acerba associated with
Pseudaulacaspis sp., is described. Septobasidium rhabarbarinum on Quercus pannosa is new
to China.
Key worps —Pucciniomycetes, Septobasidiales, Septobasidiaceae, taxonomy
A new species of Septobasidium was discovered in the famous Huangshan Scenic
Area. Owing to the mild and humid climate and plentiful rainfall, Huangshan
Mountain is provided with a great biodiversity. Among Septobasidium
specimens collected by the fourth author a new species was discovered and is
described below:
Septobasidium hoveniae Wei Li bis, S.Z. Chen, L. Guo & Yao Q. Ye, sp. nov. Fries 1-4
FUNGAL NAME FN570057
Differs from Septobasidium henningsii by its thinner hymenium.
Type: China, Anhui Province, Huangshan Scenic Area, Wenquan, alt. 640 m, on
Hovenia acerba Lindl. (Rhamnaceae), associated with Pseudaulacaspis sp. (Diaspididae),
31.V.2012, Y.Q. Ye 5 (HMAS 252321, holotype).
ETYMOLOGY: The epithet refers to the substrate plant genus.
Basidiomata on branches, 10 cm long, 5 cm wide, cinnamon-brown; margin
determinate, surface smooth, cracked at maturity, partly peeling off, emerging
brown pillars. In section 600-1800 um thick. Subiculum brown, 50-70 um
thick. Pillars brown, at first straight, later curved and confluent, and then
98 ... Li & al.
ae AT eereas
10 pm
Fic 1. Septobasidium hoveniae (HMAS 252321, holotype). Basidia.
separable, 200-1500 um high, 20-120 um wide. Hyphal layer brown, 80-150
um high. Hymenium hyaline or brownish, 100-110 um thick. Basidia arising
directly from the hyphae without a probasidial cell, cylindrical, straight or
slightly curved, 4-celled, 35-45 x 7.5-9 um, hyaline. Basidiospores not seen.
Haustoria consisting of hyphae.
COMMENTS: Septobasidium hoveniae is similar to S. henningsii Pat., which
differs by having numerous fissures on the basidiome surface and a thicker and
stratified hymenium, 60-400 um high (Couch 1938).
Septobasidium rhabarbarinum (Mont.) Bres., Annls. Mycol. 14(3/4): 240, 1916.
Fics 5-8
Basidiomata on branches, 2-8 cm long, 1-3 cm wide, cinnamon-brown
or old golden; margin determinate, surface smooth, with numerous cracks at
maturity. In section 320-700 um thick. Subiculum brown, 20-30 um thick.
From subiculum forming brown hyphal layer, broken by channels at base.
Hymenium stratose, brown or brownish, 140-150 um thick. Basidia arising
Fics 2-4. Septobasidium hoveniae (HMAS 252321, holotype). 2. Basidioma on branch; 3. Section
of basidioma; 4. Basidium (arrow). Fics 5-7. Septobasidium rhabarbarinum (HMAS 251990).
5. Basidiomata on branches; 6. Section of basidioma; 7. Basidium (arrow).
Septobasidium hoveniae sp. nov. (China) ... 99
x
"Se 7 7 ' f j t a ‘mn
eth aS
a i! my i
100 ... Li & al.
+
10um |
Fic 8. Septobasidium rhabarbarinum (HMAS 251990). Basidia.
directly from the hyphae without a probasidial cell, cylindrical, curved,
4-celled, 33-38 x 6-7 um, brown. Basidiospores not seen. Haustoria consisting
of irregularly coiled hyphae.
SPECIMENS EXAMINED: CHINA, SICHUAN: Yanyuan, Luguhu, alt. 2700 m, on Quercus
pannosa Hand.-Mazz. (Fagaceae), 14. IX. 2010, Y.F Zhu & L. Guo 342 (HMAS 251990),
Y.F. Zhu & L. Guo 340 (HMAS 263425).
CoMMENTs: Our materials are much like S. rhabarbarinum described by
Couch (1938), except that the basidia are shorter (33-38 x 6-7 um vs. 50-68 x
6.3-7.1 um).
Including the two species reported in this paper, 53 Septobasidium species have
now been reported in China (Sawada 1933, Couch 1938, Teng 1963, Tai 1979,
Kirschner & Chen 2007, Lu & Guo 2009a,b,c, 2010a,b,c, 2011, Lu et al. 2010,
Chen & Guo 2011a,b,c,d, 2012a,b,c, Li & Guo 2013).
Acknowledgements
The authors would like to express their deep thanks to Drs. Eric H.C. McKenzie
(Auckland, New Zealand) and Shuanghui He (Beijing Forestry University) for serving
as pre-submission reviewers, to Dr. Shaun Pennycook (Auckland, New Zealand)
for nomenclatural review, to Mr. Ziyu Cao (Institute of Botany, Chinese Academy of
Sciences) for identifying the host plants, to Prof. Sanan Wu (Beijing Forestry University)
for identifying the scale insect, and to Mrs. Xiangfei Zhu for inking in line drawings.
This study was supported by the National Natural Science Foundation of China (No.
30870016).
Literature cited
Chen SZ, Guo L. 2011la. Septobasidium sichuanense sp. nov. (Septobasidiaceae) from China.
Mycotaxon 115: 481-484. http://dx.doi.org/10.5248/115.481
Septobasidium hoveniae sp. nov. (China) ... 101
Chen SZ, Guo L. 2011b. Septobasidium atalantiae sp. nov. (Septobasidiaceae) and S. henningsii new
to China. Mycotaxon 117: 291-296. http://dx.doi.org/10.5248/117.291
Chen SZ, Guo L. 2011c. Septobasidium saurauiae sp. nov. (Septobasidiaceae) and S. pseudo-
pedicellatum new to China. Mycotaxon 118: 283-288. http://dx.doi.org/10.5248/118.283
Chen SZ, Guo L. 2011d. Septobasidium glycosmidis and S. albiziae spp. nov. (Septobasidiaceae)
from Hainan Province. Mycosystema 30: 861-864.
Chen SZ, Guo L. 2012a. Three new species and three new Chinese records of Septobasidium
(Septobasidiaceae). Mycosystema 31: 651-655.
Chen SZ, Guo L. 2012b. Three new species of Septobasidium (Septobasidiaceae) from Hainan
Province in China. Mycotaxon 120: 269-276. http://dx.doi.org/10.5248/120.269
Chen SZ, Guo L. 2012c. Three new species of Septobasidium (Septobasidiaceae) from southern and
southwestern China. Mycotaxon 121: 375-383. http://dx.doi.org/10.5248/121.375
Couch JN. 1938. The genus Septobasidium. Univ. of North Carolina Press, Chapel Hill. 480 p.
Kirschner R, Chen CJ. 2007. New reports of two hypophyllous Septobasidium species from Taiwan.
Fung. Sci. 22(1,2): 39-46.
Li W, Guo L. 2013. Two new species of Septobasidium (Septobasidiaceae) from Yunnan Province in
China. Mycotaxon 125: 91-96. http://dx.doi.org/10.5248/125.91
Lu CX, Guo L. 2009a. Septobasidium maesae sp. nov. (Septobasidiaceae) from China. Mycotaxon
109: 103-106. http://dx.doi.org/10.5248/109.103
Lu CX, Guo L. 2009b. Two new species of Septobasidium (Septobasidiaceae) from China. Mycotaxon
109: 477-482. http://dx.doi.org/10.5248/109.477
Lu CX, Guo L. 2009c. Septobasidium annulatum sp. nov. (Septobasidiaceae) and Septobasidium
kameii new to China. Mycotaxon 110: 239-245. http://dx.doi.org/10.5248/110.239
Lu CX, Guo L. 2010a. Three new species of Septobasidium (Septobasidiaceae) from Gaoligong
Mountains in China. Mycotaxon 112: 143-151. http://dx.doi.org/10.5248/112.143
Lu CX, Guo L. 2010b. Two new species of Septobasidium (Septobasidiaceae) and S. pallidum new to
China. Mycotaxon 113: 87-93. http://dx.doi.org/10.5248/113.87
Lu CX, Guo L. 2010c. Two new species of Septobasidium (Septobasidiaceae) from Hainan province
in China. Mycotaxon 114: 217-223. http://dx.doi.org/10.5248/114.217
Lu CX, Guo L. 2011. Two new species of Septobasidium (Septobasidiaceae) from Gaoligong
Mountains in China. Mycotaxon 116: 395-400. http://dx.doi.org/10.5248/116.395
Lu CX, Guo L, Wei JG, Li JB. 2010. Two new species of Septobasidium (Septobasidiaceae) from
southern China. Mycotaxon 111: 269-274. http://dx.doi.org/10.5248/111.269
Sawada K. 1933. Descriptive catalogue of the Formosan fungi. Part VI. Rep. Dept. Agric. Govt. Res.
Inst. Formosa 61: 1-99.
Tai FL. 1979. Sylloge Fungorum Sinicorum. Science Press, Beijing. 1527 p.
Teng SC. 1963. Fungi of China. Science Press, Beijing. 808 p.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.103
Volume 125, pp. 103-105 July-September 2013
Validation and typification of Gyroporus purpurinus
NAVEED DAVOODIAN* & Roy E. HALLING
Institute of Systematic Botany, The New York Botanical Garden, Bronx, NY, USA. 10458-5126
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Gyroporus purpurinus is a fairly well known eastern North American bolete
that has never been validly published. It is validated and typified here.
Key worps — Boletales, nomenclature
Introduction
Gyroporus purpurinus is a small bolete in the Sclerodermatineae distributed
throughout the eastern United States and adjacent Mexico and Canada. Though
well depicted on the Internet (Kuo 2003) and in popular field guides (Lincoff
1981, Phillips 1991, Bessette et al. 2000), the taxon has never been validly
published.
As noted by Both (1993), Snell (1936), who first documented the fungus as
“Boletus castaneus f. purpurinus, did not provide a Latin description or designate
a type. This did not constitute valid publication, since a Latin description was
required from 1935 to 2011 (McNeill et al. 2012: Art. 39.1). Singer (1945), who
elevated the form to species level, combined it into Gyroporus, assuming Snell's
“f, nov.’ to be valid. Thus, Singer’s combination was also invalid. Smith & Thiers
(1971) incorrectly implied that a 1915 collection by Kauffman that was sent to
Snell (almost certainly BPI 782366) was the holotype, assuming a collection in
their possession was an isotype (presumably MICH 4998). The University of
Michigan Fungus Collection Database indicates that MICH 4998 is a syntype
(quod.lib-umich.edu/f/funglic/ - accessed April 17", 2013), but this is not
possible because Snell (1936) did not reference any collections. Confusingly,
the box of BPI 782371 is marked with a printed label that reads “rypr” (nt.ars-
grin.gov/fungaldatabases/ - accessed April 17, 2013). It is unclear whether
this was marked by Snell or someone else.
Nevertheless, the taxon constitutes a discrete species. Gyroporus purpurinus
is validated and typified here.
104 ... Davoodian & Halling
Materials & methods
Dried specimens were examined macroscopically with an AO Spencer
stereomicroscope and microscopically with an Olympus BH-2 microscope. Dissections
for microscopic study were prepared on slides with either water or 3% potassium
hydroxide. In the description of spores, Q is the mean length/width quotient. The
description of the taxon was drawn from previous descriptions in relevant literature
(Snell 1936, Singer 1945, Bessette et al. 2000), aspects of which were modified based on
study of specimens cited here. The color terms “reddish-purplish” and “vinaceous red to
burgundy” are taken from Snell (1936) and Bessette et al. (2000), respectively.
Taxonomy
Gyroporus purpurinus Singer ex Davoodian & Halling, sp. nov.
MycoBank 804040
“Boletus castaneus f. purpurinus” Snell, Mycologia 28: 465
(1936), nom. inval. (no Latin description).
“Gyroporus purpurinus” Singer, Farlowia 2: 236 (1945), nom. inval. (no Latin description).
Distinguished from other members of Gyroporus by its distinct reddish-purplish pileus
and stipe surfaces and the relative rarity of clamp connections.
Type: United States, New York, Glens Falls Watershed, near Lake George, 24 Aug 1932,
col. W. H. Snell (holotype, BPI 782371).
PiLEus 1-9 cm, convex to plane with even margin, somewhat velutinate to
subtomentose, sometimes slightly rimose to finely areolate in age, “reddish-
purplish’/“vinaceous red to burgundy”/various intergrading shades of purple
and red. HYMENOPHORE adnexed to free, white then becoming yellow with
maturity, unchanging on injury or exposure; pores 1-4 per mm, tube depth
5-8 mm. STIPE 3-6 cm long, 2.5-10 mm thick, equal or tapering upward,
often hollowing in age, somewhat velutinate, exhibiting colors within the same
range of the pileus, lacking an annular zone. CONTEXT white, unchanging upon
exposure or injury. SPORE PRINT bright yellow.
Spores 8-11(-12) x (4-)4.8-7 um, Q = 1.8, nearly ovoid to ellipsoid,
sometimes appearing subreniform, appearing smooth, hyaline to yellow,
sometimes appearing with a slightly thickened wall, sometimes appearing
with hilar appendage. Bastp1a 21-30 x 8-12.2 um, 4-spored. HYMENOPHORAL
CYSTIDIA versiform, 23-50 x 3.3-8 um. TUBE TRAMA divergent. PILEIPELLIS a
collapsing trichodermium; terminal cells fusoid-ventricose to ampullaceous,
40-120 x 5-20 um; pigmentation at times apparent. STIPITIPELLIS hyphae
oriented in various directions; pigmentation at times apparent. CLAMP
CONNECTIONS infrequent to rare.
DISTRIBUTION: Florida to New England, west to Minnesota and northeast
Mexico. Reported from southeast Canada (mycoportal.org/portal/imagelib/ -
accessed April 17", 2013). PHENOLOGY: July-October. PRESUMED MYCORRHIZAL
SYMBIONTS: Quercus, Pinus.
Gyroporus purpurinus validated (USA) ... 105
OTHER SPECIMENS EXAMINED —- UNITED STATES, MicuiGan, Ann Arbor, 15 Aug
1915, col. C. H. Kauffman (BPI 782366). MASSACHUSETTS, Conway, Pine Hill Road,
30 Aug 1960, col. H. E. Bigelow with M. E. Bigelow (NY 48358). GEorG1A, Athens,
University of Georgia Botanical Garden, 25 Aug 1978, col. H. E. Bigelow given to R. E.
Halling (NY 48357). NORTH CAROLINA, Swain Co., Great Smokey Mountains National
Park, Indian Creek, 1 Aug 1992, col. R. E. Halling (NY 48356).
Comments - For illustrations of microscopic features see Singer (1945) and
Smith & Thiers (1971).
Acknowledgments
We appreciate the insight of Dr. Andrew Minnis regarding nomenclatural points
in this paper. Dr. Timothy Baroni and Dr. Brandon Matheny are thanked for their
helpful reviews of this manuscript. Dr. Shaun Pennycook is thanked for his essential
nomenclatural review of this paper.
Literature cited
Bessette AE, Roody WC, Bessette AR. 2000. North American boletes. Syracuse University Press,
Syracuse.
Both EE. 1993. The boletes of North America: a compendium. Buffalo Museum of Science,
Buffalo.
Kuo M. Gyroporus purpurinus. Retrieved from mushroomexpert.com web site June 7", 2012:
http://www.mushroomexpert.com/gyroporus_purpurinus.html
Lincoff GH. 1981. National Audubon Society field guide to North American mushrooms. Alfred
A. Knopf, New York.
McNeill J, Barrie FR, Buck WR, Demoulin V, Greuter W, Hawksworth DL, Herendeen PS, Knapp
S, Marhold K, Prado J, Prud’ homme van Reine WF, Smith GF, Wiersema JH, Turland NJ. 2012.
International Code of Nomenclature for algae, fungi, and plants (Melbourne Code). Adopted
by the Eighteenth International Botanical Congress, Melbourne, Australia, July 2011. Regnum
Vegetabile 154.
Phillips R. 1991. Mushrooms of North America. Little, Brown and Company, Boston.
Singer R. 1945. The Boletineae of Florida with notes on extralimital species. I]. The Boletaceae
(Gyroporoideae). Farlowia 2: 223-303.
Smith AH, Thiers HD. 1971. The boletes of Michigan. University of Michigan Press, Ann Arbor.
Snell WH. 1936. Notes on boletes V. Mycologia 28: 463-475. http://dx.doi.org/10.2307/3754120
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.107
Volume 125, pp. 107-110 July-September 2013
Golovinomyces clematidis sp. nov. from China
TIEZHI Liu’ & JING WEN
College of Life Sciences, Chifeng University, Chifeng 024000, China
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Golovinomyces clematidis (Erysiphaceae), a new species found on Clematis
aethusifolia (Ranunculaceae) in Inner Mongolia, China, is described, illustrated, and
compared with morphologically similar species of the G. cichoracearum s. lat. complex.
Key worps — Erysiphales, powdery mildews, taxonomy
Introduction
Some interesting specimens of powdery mildew on Clematis aethusifolia
(Ranunculaceae) were collected in Ulanqab City, Inner Mongolia Autonomous
Region, in northern China in 2005 and 2012. This was unusual as the first
ranunculaceous host plant reported to be infected by a species of Golovinomyces
(U. Braun) Heluta (Braun 1987; Chen et al. 1987; Nomura 1997; Shin 2000;
Liu 2010; Braun & Cook 2012). Based on its ellipsoid-ovoid, doliiform to
subcylindrical, non-limoniform conidia as well as relatively short and cylindrical
conidiophores, this fungus should be treated as a new species of Golovinomyces
sect. Golovinomyces (Braun & Cook 2012). It is morphologically close to the
G. cichoracearum (DC.) Heluta s. lat. complex, a widespread powdery mildew
fungus on hosts of Asteraceae (Braun & Cook 2012).
Materials & methods
The fungal materials were mounted in distilled water and examined using standard
light microscopy without staining. For each collection, 100 conidia and related structures
were measured in water. The specimens were deposited in the Mycological Herbarium of
Chifeng University, Inner Mongolia, China (CFSZ), the Mycological Herbarium of the
Institute of Microbiology, Academia Sinica, Beijing, China (HMAS), and the Herbarium
of Martin-Luther- University, Halle (Saale), Germany (HAL).
Taxonomy
Golovinomyces clematidis T.Z. Liu & Jing Wen, sp. nov. FIG. 1
MycoBank MB 805351
108 ... Liu & Wen
Differs from Golovinomyces cichoracearums. str. and G. orontii byits longer conidiophores,
which are consistently straight at the base of foot-cells, and its smaller conidia.
Type: On living leaves of Clematis aethusifolia Turcz. (Ranunculaceae): China, Inner
Mongolia, Ulanqab City, Xinghe County, Datongyao, 24 Aug. 2012, T.Z. Liu, Z.H. Jia &
D.N. Su (Holotype, CFSZ 5940; isotypes, HMAS 244659, HAL 2591 F).
EryMo_oey: derived from the generic name of the host plant.
MycELIA on stems and leaves amphigenous, effuse or forming irregular white
patches, often occupying the whole leaf surface, persistent or subevanescent.
HypuHak 4.5-7.5 um wide, hyaline to yellowish, thin-walled, smooth or rarely
verruculose. APPRESSORIA distinctly nipple-shaped. CONIDIOPHORES erect,
100-200 um long, foot-cells cylindrical, straight or occasionally somewhat
flexuous, 55-100 x 8-12.5 um, followed by 2-3 shorter cells. Conrp1a in chains
(catenescent), ellipsoid-ovoid, doliiform to subcylindrical, relatively small,
20-34 x 10-15 (average 25 x 13) um. CHASMOTHECIA Scattered to gregarious,
dark brown, subglobose, 80-130(-140) (average 105) um diam. PERIDIUM
CELLS irregularly polygonal to daedaleoid, 7.5-25 um diam. APPENDAGES
numerous, about 15-70 or more, usually equatorial and in the lower half of
the chasmothecium, sometimes reaching the upper half, mycelium-like, often
interlaced with mycelia and with each other, mostly unbranched or rarely
irregularly branched one time, flexuous, sometimes tortuous to geniculate,
(0.5-)1-5 times as long as the chasmothecial diam., (50-)100-550 um long,
(2.5-)4-10 um wide, thin-walled, smooth, somewhat rough near the base,
(0—)1-9-septate, brown throughout or in the basal half, paler towards the
apex, hyaline in the upper portion. Asci 8-22, oval, oblong-oval or irregularly
shaped, mostly stalked, sometimes sessile, 40-75 x 20-40 (average 59 x 29.5)
um. ASCOSPORES 2(-3) per ascus, ellipsoid or ovoid, yellowish, (15-)20-25
(-30) x (10-)12.5-15(-17.5) (average 23 x 14) um.
ADDITIONAL SPECIMEN EXAMINED: On living leaves of Clematis aethusifolia: CHINA,
INNER Moneco tia, Ulangab City, Jining District, Laohushan, 16 Oct. 2005, T.Z. Liu
(CFSZ 05392).
ComMENTs: Golovinomyces clematidis is the first Golovinomyces species to
be collected on a host belonging to the Ranunculaceae. Hence, there are no
comparable species on allied hosts. Golovinomyces clematidis is morphologically
similar to species of the G. cichoracearum s. lat. complex including their
chasmothecium size, appendage number and characteristics, and number and
size of asci and ascospores (Braun & Cook 2012). However, species of this
complex are specialized and confined to certain hosts belonging to particular
tribes of the Asteraceae, i.e., they are characterized by a close co-evolution with
their hosts (Matsuda & Takamatsu 2003, Braun & Cook 2012). The plurivorous
G. orontii (Castagne) Heluta is one exception that might have the potential
to cause powdery mildew on Clematis, but it is easily distinguished by the
Golovinomyces clematidis sp. nov. (China) ... 109
Pires
—e
ania
QA
sy : ‘
ie tC ell)
FiGurRE 1. Golovinomyces clematidis (holotype). A. Chasmothecia; B. Appendages; C. Asci and
ascospores; D. Conidiophores and conidia; E. Hyphae and appressoria. Scale bars: A = 100 um;
B-E = 25 um. T.Z. Liu del.
frequently curved base of its conidiophore foot-cells (Liu 2010, Braun & Cook
2012). Golovinomyces cichoracearum s. str. also differs in its curved to sinuous
conidiophore foot-cells that are both shorter and wider ((30—)40-80 x (9-)10-
110 ... Liu & Wen
15(-18) um) as well as much larger conidia (25-42 x 14-23 um). The conidia of
G. clematidis differ significantly from all other species of the G. cichoracearum
complex. One specimen of G. clematidis (CFSZ 05392) has previously been
identified as and confused with Erysiphe aquilegiae var. ranunculi (Grev.) R.Y.
Zheng & G.Q. Chen (Liu 2010).
Acknowledgments
Weare grateful to Dr. Uwe Braun (Martin Luther University, Halle, Germany) and Dr.
Guozhong Li (Dalian Nationalities University, Dalian, China) for their pre-submission
reviews, and to Dr. Shaun R. Pennycook for nomenclatural review and for his valuable
comments and suggestions. This study was supported by the National Natural Science
Foundation of China (No. 31160012).
Literature cited
Braun U. 1987. A monograph of the Erysiphales (powdery mildews). Nova Hedwigia, Beiheft 89:
1-700.
Braun U, Cook RTA, 2012. Taxonomic manual of the Erysiphales (powdery mildews). Utrecht,
CBS-KNAW Fungal Biodiversity Centre.
Chen GQ, Han SJ, Lai YQ, Yu YN, Zheng RY, Zhao ZY. 1987. Flora fungorum sinicorum. Vol. 1
(Erysiphales). Beijing, Science Press. (in Chinese).
Liu TZ. 2010. The Erysiphaceae of Inner Mongolia. Chifeng, Inner Mongolia Science and Technology
Press. (in Chinese).
Matsuda S, Takamatsu S. 2003. Evolution of host-parasite relationship of Golovinomyces
(Ascomycota: Erysiphaceae) inferred from nuclear rDNA sequences. Molecular Phylogenetics
and Evolution 27: 314-327. http://dx.doi.org/10.1016/S1055-7903(02)00401-3
Nomura Y. 1997. Taxonomical study of Erysiphaceae of Japan. Tokyo, Yokendo Ltd. (in Japanese).
Shin HD. 2000. Erysiphaceae of Korea. Suwon, National Institute of Agricultural Science and
Technology.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.111
Volume 125, pp. 111-121 July-September 2013
Four noteworthy hyphomycetes from indoor environments
DE-WEI LI*', GUIHUA ZHAO’, CHIN YANG},
ARIUNAA JALSRAI* & BRIAN KERIN®
' The Connecticut Agricultural Experiment Station, Valley Laboratory,
153 Cook Hill Road, Windsor, CT 06095, USA
? Center of Biotechnology ReD, Jiangsu Polytechnic College of Agriculture and Forestry,
3 Changjiang Road, Jurong, Jiangsu 212400, China
° Prestige EnviroMicrobiology, Inc.,
242 Terrace Boulevard Suite B-1, Voorhees, New Jersey 08043, USA
*EMLab Pe&K Environmental Laboratories,
1936 Olney Avenue, Cherry Hill, NJ 08003, USA
° Pacific EHS, 125 - 3001 Wayburne Drive, Burnaby, BC V5G 4W3, Canada
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Four interesting hyphomycetes (Nalanthamala vermoesenii, Parascedosporium
putredinis, Stachybotrys elegans, Triadelphia australiensis) have been collected from indoor
fungal investigations. Among these fungi, Triadelphia australiensis represents a new record
for Canada and the USA. Parascedosporium putredinis and Stachybotrys elegans are reported
for the first time from indoor environments.
KEY worps — anemophilous, microfungi, mold, residence
Introduction
Fungal diversity inside buildings is poorly understood. Although the list of
fungi from indoor environments compiled from the databases at commercial
laboratories is expanding to include new first records of fungi occurring
indoors, no comprehensive list of indoor fungi exists. Recently, four noteworthy
hyphomycete species found in indoor environments among samples collected
from air and building materials during indoor mold investigations in the USA
and Canada were submitted to our laboratories for analysis. We report on these
indoor fungi here.
Materials & methods
Fungal isolates were grown on malt extract agar (MEA) at 25°C in the dark.
Parascedosporium putredinis was also grown on corn meal agar (CMA), dichloran
112... Li &al.
glycerol agar (DG18), and potato dextrose agar (PDA). If culturing was not successful,
tape lifts or a small scalpel were used to get fungal structures directly from the samples
for microscopic observation. Conidiophores and conidia were mounted in 85% lactic
acid. A staining agent, 0.1% lacto-fuchsin, was used to observe conidiogenous cells and
septation of colorless conidia. All microscopic observations were made under Nomarski
differential interference contrast optics. Photomicrographs were taken with an Olympus
Microfire digital camera (Goleta, CA). Measurements of the fungal structures were
statistically analyzed with Microsoft Office Excel 2010 with 95% confidence interval of
means. The results were presented as ranges and mean + standard deviation. Voucher
specimens or cultures were deposited to China General Microbiological Culture
Collection (CGMCC) and U.S. National Fungus Collections (BPI).
DNA extraction, sequencing, and sequence similarity analysis for Nalanthamala
vermoesenii and Parascedosporium putredinis follow Li et al. (2008).
The partial DNA sequence transcribing the ribosomal spacer region (3’ end of
the 18S ssu), 5’ end of the 28S ribosomal RNA units, and complete sequences for the
5.88 ribosomal RNA and internal transcribed spacers (ITS) 1 and 2) were submitted
through the nucleotide MegaBLAST procedure (Zhang et al. 2000) via the NBCI
web site (www.ncbi.nlm.nih.gov/blast/) using the non-human, non-mouse database.
Sequence similarity searches and comparisons for Nalanthamala vermoesenii and
Parascedosporium putredinis were conducted using MegaBLAST (NCBI).
The partial sequences transcribing the 18S and 28S ribosomal RNA units, and the
complete sequences for the 5.8S ribosomal RNA and internal transcribed spacers (ITS)
1 and 2 have been placed in the GenBank database.
Taxonomy
Nalanthamala vermoesenii (Biourge) Schroers, Mycologia 97: 390 (2005) PLATE 1
= Penicillium vermoesenii Biourge, La Cellule 33: 230 (1923)
= Gliocladium vermoesenii (Biourge) Thom, ‘The Penicillia: 502 (1930)
CoLontes 38-55 mm diam at 25°C after 5 d on MEA in the dark. Colony
surface fine powdery to dusty, salmon to pink; aerial mycelium sparsely
developed. Reverse flesh. ContpIopHoRES dimorphic; penicillate and
acremonium-like. Penicillate conidiophores up to 220 um long, monoverticillate
to quaterverticillate, 22-110 um tall; metulae (6.5-)7.7—-14(-19) x (2-)2.5-3.5
(-4) um (n = 35); phialides cylindrical with a narrowed apex, (8-)10-16(—24)
um long, 1.5-3.5 um wide at base and in the lower third, and 0.5-1.5 um
wide at the tip (n = 35). Acremonium-like conidiophores, unbranched or
occasionally branched; phialides cylindrical or slightly narrowing toward the
tip, 9-25(-40) x (1.5-)1.9-2.7(-3) um, 1-2 um wide at tip (n = 35). CONIDIA
dimorphic: those on penicillate conidiophores 1-celled, ovoid or ellipsoidal,
(3-)3.5-5.5(—7) x (2-)2.1-3.1(—4) um (n = 30), in long, dry, persistent chains, in
masses appearing salmon or pink in color; on acremonium-like conidiophores
ellipsoidal or cylindrical (2—)4.8-10.5(—15) x (1.5-)1.7-2.8(—4) um (n = 30),
1-celled, in liquid drops aggregated at the tip of phialides.
Nalanthamala, Parascedosporium, Stachybotrys & Triadelphia indoors (North America) ... 113
PiaTE 1. Nalanthamala vermoesenii (CGMCC3.15232). a—b. Penicillate conidiophores and conidia;
c. Acremonium-like conidiophore and conidia. Scale bars = 10 um.
TELEOMORPH. Unknown.
MATERIAL EXAMINED: U.S.A. CALIFORNIA, Sacramento, in a residence, April 2005,
anonymous (CGMCC3.15232; GenBank KC894849).
DISTRIBUTION: Australia, Belgium, Congo, Czech Republic, Greece, India,
Japan, New Zealand, Russia, Spain, South Africa, UK, USA, Uzbekistan. Mainly
in warm temperate, Mediterranean, subtropical areas, also on hosts kept in
greenhouses of other geographic areas (Subramanian 1956; Spaulding 1961;
Carpenter et al. 1962; Holevas et al. 2000; Schroers et al. 2005).
SUBSTRATES/HOSTS: air, indoor environment, soil, on various Arecaceae
(causing stem rot, pink rot, necrosis and blight), Citrus medica, Psidium guajava
(Schroers et al. 2005).
Note: Nalanthamala vermoeseniihas been found mainly in indoor environments
on the west coast of North America, especially in California. It has also been
reported indoors and outdoors from Florida and Hawaii (Raabe et al. 1981;
Alfieri. et al. 1984; French 1989) but is not common in other areas of the U.S.A.
It is a pathogen on palms, but it is occasionally found from indoor samples
(Spaulding 1961). The species is often placed in Gliocladium or Penicillium due
to sharing a similar morphology with those genera. Based on its phylogenetic
relationships Schroers et al. (2005) transferred it to Nalanthamala, a genus
erected by Subramanian (1956), typified by N. madreeya Subram., and currently
comprising five species. Nalanthamala vermoesenii is morphologically
similar to N. psidii (Sawada & Kuros.) Schroers & M.J. Wingf. on culture
media. Its salmon to pink colonies on PDA and 1-celled conidia differentiate
114... Li &al.
N. vermoesenii from N. psidii, which has yellow colored colonies and 1-2 celled
conidia (Schroers et al. 2005).
ITS sequence data of N. vermoesenii collected from indoor environments
have a 100% match with the neotype isolate CBS 110893(= 5 MUCL 9504,
Biourge 415, ex-type; GenBank AY554214) and a 95% match with the epitype
isolate of N. psidii BPI 863661 (GenBank AY864836).
Parascedosporium putredinis (Corda) Lackner & de Hoog, IMA Fungus
2(1): 44 (2011) PLATE 2
= Graphium putredinis (Corda) S. Hughes, Can. J. Bot. 36: 770 (1958)
= Parascedosporium tectonae (C. Booth) Gilgado, Gené, Cano &
Guarro, Int. J. Syst. Evol. Microbiol. 57: 2176 (2007)
CoLonlss reaching 34 mm diam on MEA after 14 d at 25°C, velvety, dark
gray and slightly raised at center, buff at edge, granulate due to presence of
numerous synnemata, reverse pale gray at center; 49 mm diam on PDA, light
gray, darker at center, granulate; reaching 53 mm, spreading out in a very thin
layer of mycelium, almost transparent on CMA; no growth on DG18.
CONIDIOPHORES when solitary, simple, undifferentiated, with lateral
conidiogenous cells, occasionally reduced to conidiogenous cells, or irregularly
branched. CONIDIOGENOUS CELLS cylindrical or ampulliform, 10-25 x 2.0-2.5
uum, colorless, smooth, thin-walled, bearing 2-7 cylindrical denticles <1.2 um
long at apical area. Conip1a obovoid or ellipsoidal, smooth, thick-walled, (4.3-)
4.8-6.4 (-6.9) x (3.3-)3.6-4.4(-4.7) (mean = 5.6 + 0.8 x 4.0 + 0.4, n = 25) um.
SYNANAMORPH: synnemata erect, up to 230 um in height; stipe to 20 um in
width, dark grey, fanning out at apices and developing conidia in an opaque
slimy mass. Conidiogenous cells percurrent, cylindrical, annellidic, lateral or
terminal, colorless to subhyaline, smooth-walled, 10-22 x 2.0-2.5 um. Conidia
clavate or subcylindrical, smooth, (5.2-)5.9-7.3 (-7.9) x (2.6-)2.9-3.5(-3.7)
(mean = 6.6 + 0.7 x 3.2 + 0.3, n = 25) um. A small number of conidia developing
directly from undifferentiated hyphae, lateral, subglobose to obovoid, brown,
smooth and thick-walled, usually sessile, 6-7.5 x 5-6 um.
MATERIAL EXAMINED: USA, KENTUCKY, Lexington, from particleboard under a
kitchen sink in a residence, 27 June 2011, Chris Adkins (CGMCC3.15233; GenBank
KC894850).
DISTRIBUTION: Australia, China, Cuba, Czech Republic, Italy, Jamaica, Japan,
Malaysia, Madagascar, New Zealand, Nicaragua, Poland, The Netherlands,
USA.
PLATE 2. Parascedosporium putredinis (CGMCC3.15233). a. Colony growing on MEA for 14 days
at 25°C; b. Synnemata and conidia; c. Annellidic conidiogenous cells and conidia; d. Denticulate
conidiogenous cells and conidia; e. Conidia developed from denticulate conidiogenous cells;
f. Conidia developed from annellidic conidiogenous cells. Scale bars: b = 40 um, c-d = 10 um,
e-f=5 um.
Nalanthamala, Parascedosporium, Stachybotrys & Triadelphia indoors (North America) ... 115
116... Li & al.
SUBSTRATES/HOSTS: Actinidia deliciosa (kiwifruit, leaf lesions),
Carex pseudocyperus(Mutenko, Majewski, Ruszkiewicz-Michalska 2008),
Chrysalidocarpus lutescens, Echium sp., Elaeis sp., Iris pseudacorus, Pandanus
boninensis, Quercus cerris (living wood), Schoenoplectus lacustris, Tectona
grandis (seed), Theobroma cacao, particle board, air, soil (Booth 1964; Liu 1977;
Mercado Sierra et al. 1997; Kobayashi 2007; Multenko et al. 2008; Zhang et al.
2008; Lackner & de Hoog 2011).
Note: Gilgado et al. (2007) erected Parascedosporium as a monotypic genus
for P. tectonae. Lackner & de Hoog (2011) determined that P putredinis was
synonymous, so that the genus remains monotypic.
ITS sequence data of P tectonae collected from indoors in Minnesota
has 100% match with isolates from the ex-type of P tectonae (GenBank
AM749440), CBS 118694 (as P. tectonae; GenBank AM749735), and CMW352
(as Graphium putredinis; GenBank HQ335312.1) (Cruywagen et al. 2010).
Sequence HQ335312.1 (from a C.T. Rogerson collection from a blackened
agaric) is the only previous record of this fungus from the USA (Cruywagen et
al. 2010). The 2011 Adkins collection is the first report of this fungus from an
indoor environment.
Since this species is synanamorphic, developing both Graphium and
Scedosporium anamorphs, care should be taken to avoid identifying this
fungus as two different fungi when both anamorphs are present. This fungus is
hydrophilic according to its growth on artificial media.
Stachybotrys elegans (Pidopl.) W. Gams, Compendium of Soil Fungi: 746 (1980)
PLATE 3
= Stachybotrys aurantia G.L. Barron, Can. J. Bot. 40: 258 (1962)
Cotontgs on MEA reaching 30 mm diam at 21°C in 12 days; pink to salmon
pink with light brown soluble pigment released into medium and conspicuously
funiculose (downy) at center and velutinous at edge; radially sulcate on the
edge; reverse dirty pink to pinkish brown. Conip1oPHores differentiated,
single, determinate, erect, single, straight or flexuous, unbranched or alternately
branched, colorless, smooth or minutely roughened, varying in length, (30-
)42-64(-71) x (3.3-)3.5-4.1(-4.5) um (n = 10), 0-5 septate for unbranched, up
to 285 um in length for alternately branched, tapering toward the apex, slightly
enlarged at the apex and the base, terminally bearing a whorl of 2-7 phialides at
the apex. PHIALIDES determinate, discrete, subclavate, smooth, colorless, (6.7-
)7-8.7(-10.9) x (3.8-)4-4.5(-4.9) um (n = 20), with conspicuous collarettes.
ConipiA unicellular, acrogenous, colorless, smooth, ellipsoidal, (4.8-)6.6-
8.2(-9.2) x (3.5-)3.9-4.7(-5.5) um (n = 30), aggregated in slimy masses.
MATERIAL EXAMINED: USA, NEw JERSEY, in a residence, 10 March 2008, anonymous
(BPI 884211). Additional materials examined are listed in Li (2011).
Nalanthamala, Parascedosporium, Stachybotrys & Triadelphia indoors (North America) ... 117
Pate 3. Stachybotrys elegans (BPI 884211). a. Conidiophore and conidia; b. Branched conidiophore
and conidia; c. Phialides and conidia; d—e. conidium. Scale bars: a-c = 10 um, d-e = 5 um.
DISTRIBUTION: Brazil, Cuba, Canada, China (as Stachybotrys aurantia, Wu
et al. 2009), Egypt, Georgia, India, Kenya, Malawi, Malaysia, Poland, South
Africa, USA, Vietnam.
SUBSTRATES/HOSTs: from soil, plants [Agropyron repens (rhizosphere),
Bambusa sp. (on leaves.), Betula alleghaniensis (roots), Dactylis glomerata, Linum
usitatissimum, Panicum virgatum, Phaseolus vulgaris, Saccharum officinarum,
118 ... Li & al.
Saccharum spontaneum, Trifolium alexandrinum, Trifolium pratense], and an
isopteran insect.
Note: Stachybotrys elegans has been reported from soils and plant debris in
North America (Orpurt 1954; Barron 1962; Morgan-Jones 1977; Ghimire et al.
2010). It is here reported for the first time from an indoor environment. Several
Stachybotrys species (including Memnoniella) have previously been reported
from indoor environments. Predominant indoor species are S. chartarum
and S. echinata (= M. echinata), but S. chlorohalonata, S. microspora, and
S. yunnanensis have also been reported.
Triadelphia australiensis B. Sutton, Sydowia 41: 339 (1989) PLATE 4
[non Triadelphia australiensis Joanne E. Taylor et al., nom. illegit.]
COLONIES on natural substrate thinly diffuse, sparse, dark brown. Mycelium
initially immersed, finally superficial, sparse, of colorless to pale brown,
irregularly branched, smooth, septate hyphae 2-3.5 um wide. CONIDIOGENOUS
CELLS integrated, terminal or lateral, holoblastic, monoblastic, colorless to pale
brown, thin-walled, smooth, globose to ampulliform, more rarely lageniform,
3-5.5 x 3-4 um, each with a single, short, unthickened denticle upon which
a conidium is formed. Conip1A aerogenous, solitary, dry, ellipsoidal, obovoid
to broadly obovoid, smooth, thick-walled, 1-septate near the base, thickened,
sometimes constricted at the septum, (8.2-)9.1-10.9 (-11.7) x (4.9-)5.6-6.8
(-7.3) (mean = 10 + 0.9 x 6.2 + 0.6, n = 30) um, Q = 1.4-1.9 (mean = 1.6); two
cells unequal in size and shape, the apical cell dark brown, thick-walled and the
basal cell pale brown, with a small unthickened scar at the base.
MATERIAL EXAMINED, CANADA, BRITISH COLUMBIA, Nanaimo, from plywood in an
ice rink, 2 November 2011, Gordon Wedman (BPI 884210).
DISTRIBUTION: Australia, Canada, USA.
SUBSTRATES/HOSTS: bark of unknown plant, unknown substrate in a
residence, and plywood in an ice rink.
Note: Triadelphia australiensis represents a new record for Canada and the
USA. It is morphologically very similar to T. uniseptata (Berk. & Broome) P.M.
Kirk (= Polyschema bicellulare Shearer, fide Kirk 1983). The major difference
is that T: australiensis has smaller conidia (8.5-10 x 4.5-6 um; Sutton 1989)
than T! uniseptata (12.5-16 x 6.5-10.5 um; Kirk 1983). Loose conidia with a
similar morphology sometimes found in the air in indoor environments in
North America have often been identified as Endophragmiella, Polyschema,
or Spadicoides due to lack of conidiophores and the similarity with conidia of
E. uniseptata, P. bicellulare, S. cordanoides, and S. hodgkissii.
Several attempts to isolate T. australiensis from bulk and tape samples failed.
The species was found on a tape sample in the USA, but because the sample was
Nalanthamala, Parascedosporium, Stachybotrys & Triadelphia indoors (North America) ... 119
d
c Ne
Prate 4. Triadelphia australiensis (BPI 884210). a—b. Conidia and conidiogenous cells from a tape
sample collected in Canada; c-d. Conidia and conidiogenous cells from a tape sample collected in
USA. (Arrows indicate conidiogenous cells.) Scale bars = 10 um.
consumed during the lab analysis, the excised piece of tape was not retained.
Fortunately, although no fungal structures could be found on the tape remnants,
photomicrographs were successfully taken from the tape.
Acknowledgments
The authors are very grateful to Dr. Bryce Kendrick and Dr. Rafael F. Castafieda
Ruiz for their critical review of the manuscript and to Drs. Louis Magnarelli and James
A. LaMondia for their pre-submission review. The authors are very appreciative to Dr.
Lorelei L. Norvell for her editorial review and Dr. Shaun Pennycook for his nomenclature
review.
120 ... Li & al.
Literature cited
Alfieri SA, Langdon KR, Wehlburg C, Kimbrough JW. 1984. Index of Plant Diseases in Florida.
Florida Department of Agriculture and Consumer Services., Division of Plant Industry Bulletin
11 (Revised). 389 p.
Barron G. 1962. Stachybotrys aurantia sp. nov. from soil. Canadian Journal of Botany 40(2):
257-261. http://dx.doi.org/10.1139/b62-024
Booth C. 1964. Studies on pyrenomycetes. VII. Mycological Papers 94: 1-16.
Carpenter TR, Wilbur WD, Young W. 1962. Mexican palm trees apparently killed by Penicillium
vermoeseni. Plant Disease Reporter 46: 750.
Cruywagen EM, de Beer ZW, Roux J, Wingfield MJ. 2010. Three new Graphium species from
baobab trees in South Africa and Madagascar. Persoonia 25: 61-71.
http://dx.doi.org/10.3767/003158510x550368.
French AM. 1989. California plant disease host index. California Department of Food and
Agriculture, Sacramento, CA.
Ghimire SR, Charlton ND, Bell JD, Krishnamurthy YL, Craven KD. 2010. Biodiversity of fungal
endophyte communities inhabiting switchgrass (Panicum virgatum L.) growing in the native
tallgrass prairie of northern Oklahoma. Fungal Diversity: 1-9.
Gilgado F, Gené J, Cano J, Guarro J. 2007. Reclassification of Graphium tectonae as Parascedosporium
tectonae gen. nov., comb. nov., Pseudallescheria africana as Petriellopsis africana gen. nov.
comb. nov. and Pseudallescheria fimeti as Lophotrichus fimeti comb. nov. International Journal
of Systematic and Evolutionary Microbiology 57(9): 2171-2178.
http://dx.doi.org/10.1099/ijs.0.64958-0
Holevas CD, Chitzanidis A, Pappas AC, Tzamos EC, Elena K, Psallidas PG, Alivizatos AS,
Panagopoulos CG, Kyriakopoulou PE, Bem FP, Lascaris DN, Velissariou DE, Vloutoglou I,
Analytis SC, Paplomatas EJ, Aspromougos JS, Varveri C. 2000. Disease agents of cultivated
plants observed in Greece from 1981 to 1990. Annales de l'Institut Phytopathologique
Benaki 19: 1-96.
Kirk P. 1983. New or interesting microfungi: IX. Dematiaceous hyphomycetes from Esher Common.
Transactions of the British Mycological Society 80(3): 449-467.
http://dx.doi.org/10.1016/S0007-1536(83)80041-2
Kobayashi T. 2007. Index of fungi inhabiting woody plants in Japan. Host, distribution and
literature, Zenkoku-Noson-Kyoiku Kyokai Publishing Co., Ltd.
Lackner M, de Hoog GS. 2011. Parascedosporium and its relatives: phylogeny and ecological
trends. IMA Fungus 2(1): 39-48. http://dx.doi.org/10.5598/limafungus.2011.02.01.07
Li D-W. 2011. Stachybotrys thaxteri sp. nov. and the nomenclatural status of three Stachybotrys
species. Mycotaxon 115(1): 239-250. http://dx.doi-org/10.5248/115.239
Li D-W, Cowles RS, Vossbrinck CR. 2008. Metarhiziopsis microspora gen. et sp. nov. associated with
the elongate hemlock scale. Mycologia 100(3): 460-466. http://dx.doi.org/10.3852/07-078R1
Liu PSW. 1977. A supplement to a host list of plant diseases in Sabah. Malaysia Phytopathol. Pap.
21: 1-49.
Mercado Sierra A, Figueras MJ, Gene J. 1997. New or rare hyphomycetes from Cuba VIII. Species
of Lylea, Phaeoisaria, Arxiella, Graphium, Periconia and Ramichloridium. Mycotaxon 63:
369-375.
Morgan-Jones G. 1977. Fungi of Alabama. VI. Dematiaceous hyphomycetes. Journal of Alabama
Academy of Science 48 26-41.
Mutenko W, Majewski T, Ruszkiewicz-Michalska M. 2008. A preliminary checklist of micromycetes
in Poland. W. Szafer Institute of Botany, Polish Academy of Sciences, Krakéw . 752 p.
Nalanthamala, Parascedosporium, Stachybotrys & Triadelphia indoors (North America) ... 121
Orpurt P. 1954. Studies on the soil microfungi of Wisconsin prairies. Ph.D., University of
Wisconsin.
Raabe RD, Conners IL, Martinez AP. 1981. Checklist of plant diseases in Hawaii. College of Tropical
Agriculture and Human Resources, University of Hawaii, Information Text Series No. 22.
Schroers H-J, Geldenhuis MM, Wingfield MJ, Schoeman MH, Yen Y-F, Shen W-C, Wingfield
BD. 2005. Classification of the guava wilt fungus Myxosporium psidii, the palm pathogen
Gliocladium vermoesenii and the persimmon wilt fungus Acremonium diospyriin Nalanthamala.
Mycologia 97(2): 375-395. http://dx.doi.org/10.3852/mycologia.97.2.375.
Spaulding P. 1961. Foreign diseases of forest trees of the world. USDA, Agriculture Handbook
197p;
Subramanian CV. 1956. Hyphomycetes - II. Journal of the Indian Botanical Society 35(4):
446-494.
Sutton BC. 1989. Notes on Deuteromycetes. II. Sydowia 41: 330-343.
Wu T-M, Geng Y-H, Zhang T-Y. 2009. Soil dematiaceous hyphomycetes from Dahingganling
Mountain Range, Inner Mongolia, China II. Mycosystema 28(5): 656-659.
Zhang Y-L, Zhang T-Y, Wang H-F. 2008. Dematiaceous hyphomycetes from soil in tropical
primordial rain forest of Jianfengling, Hainan Province of China I. Mycosystema 27(1): 29-38.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.123
Volume 125, pp. 123-130 July-September 2013
Radulidium xigazense sp. nov., Rhinocladiella tibetensis sp. nov.,
and three new records of Ramichloridium from China
YUE-MING Wu’”, JUN-JIE XuU?, HONG-FENG WANG‘ & TIAN-YU ZHANG?”
' Department of Plant Pathology, Shandong Agricultural University,
Taian, 271018, China
’ Key Laboratory of Agricultural Microbiology,
Shandong Province, Taian, 271018, China
* College of Life Sciences, Linyi University,
Shandong Province, Linyi, 276005, China
* Shandong Agricultural University Fertilizer Science & Technology Company Limited,
Taian, 271000, China
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — Two new species, Radulidium xigazense and Rhinocladiella tibetensis, are
described and illustrated from the Qinghai-Tibet Plateau Area, China. Ramichloridium
apiculatum, R. brasilianum, and R. musae represent new records for China. Specimens
(dried cultures) and living cultures are deposited in the Herbarium of Shandong Agricultural
University, Plant Pathology (HSAUP), and the Herbarium of Institute of Microbiology,
Academia Sinica (HMAS).
Key worps — dematiaceous hyphomycetes, soil fungi, taxonomy
Introduction
During a survey of soil dematiaceous hyphomycetes in China, we found two
undescribed species and three new records. ‘The species, all of which produce
aseptate conidia on a sympodially proliferating rachis, are described and
illustrated from cultures grown on malt extract agar (MEA) (Arzanlou et al.
2007).
Radulidium, established by Arzanlou et al. (2007), is characterized by
conidiophores reduced to polyblastic conidiogenous cells that are widest at the
base and have straight cylindrical to acicular rachis with crowded pale brown
prominent blunt denticles and conidia that are solitary, 0-septate, subhyaline,
smooth or verrucose, obovoidal to fusiform, base subtruncate and with a
slightly prominent, conspicuously pigmented hilum. Seifert et al. (2011) cite
two taxa for the genus.
124 ... Wu &al.
Fic. 1. Radulidium xigazense (ex holotype HSAUP II ,,0964).
Conidia, conidiophores, and conidiogenous cells. Scale bar = 25 um.
Radulidium xigazense Y.M. Wu & T.Y. Zhang, sp. nov. FIG. 1
MycoBank MB 802277
Differs from Radulidium subulatum by its conidia containing several oil droplets and
from R. epichloes by its smaller conidia.
Type: China, Tibet: Xigaze, altitude 3900 m, from a forest soil, 18 Sept. 2007, Y.M. Wu
(Holotype HSAUP II 0964; isotype HMAS 196270).
EryMo_oey: in reference to the type locality.
Cotonies on MEA effuse, velvety, olivaceous brown. Mycelium mostly
immersed, hyphae branched, septate, smooth, subhyaline, 1-2.5 um wide.
CONIDIOPHORES pale brown to subhyaline, mononematous, widest at the base
and tapering towards the apex, cylindrical to acicular, generally straight rachis,
with crowded, prominent, blunt denticles, smooth, 20-40 um long, 2 -4 um
wide. CONIDIA solitary, subhyaline, smooth, 0-septate, clavate to fusiform,
base subtruncate and with a slightly prominent hilum, containing several oil
droplets, 5-7 x 1.5-2 um.
Comments: Morphologically, Radulidium xigazense resembles R. subulatum
(de Hoog) Arzanlou et al. and R. epichloes (Ellis & Dearn.) Arzanlou et al., but
R. epichloes produces larger (5-11 x 2-3 um) verruculose conidia, while R.
subulatum conidia contain no oil droplets (Arzanlou et al. 2007).
Rhinocladiella, established by Nannfeldt (Melin & Nannfeldt 1934), is
characterized by conidiophores that are usually branched, brown, and paler
towards the apex, intercalary or terminal conidiogenous cells that are cylindrical
to acicular, subdenticulate rachis, non-pigmented, and conidia that are solitary,
Radulidium & Rhinocladiella spp. nov. (China) ... 125
Q-septate, hyaline to subhyaline, smooth, and subglobose to ovoid or long-
ellipsoid. Seifert et al. (2011) lists 11 taxa for the genus.
Fra. 2. Rhinocladiella tibetensis (ex holotype HSAUP II 0991).
Conidia, conidiophores, and conidiogenous cells. Scale bar = 25 um.
Rhinocladiella tibetensis Y.M. Wu & T.Y. Zhang, sp. nov. FIG. 2
MycoBank MB 802278
Differs from the Rhinocladiella state of Dictyotrichiella mansonii by its slightly curved
conidia and longer conidiophores, and from R. pedrosoi by its narrower and slightly
curved conidia.
126 ... Wu &al.
Type: China, Tibet: Jiangzi, altitude 4000 m, from an everglade soil, 10 Sept. 2007, Y.M.
Wu (Holotype HSAUP II 0991; isotype HMAS 196271).
EryMoLoey: in reference to the type locality.
Cotoniges on MEA effuse, felted, olivaceous to blackish brown. Mycelium
superficial or immersed, hyphae branched, septate, smooth, pale brown, 2-3
um wide. CONIDIOPHORES brown, paler towards the apex, macronematous,
mononematous, solitary or in groups, erect, septate, smooth, 50-140 um long
and 3-4 um wide. CONIDIOGENOUS CELLS hyaline, terminal or intercalary, 5-
25 um long and 2-4 um wide, slightly wider at the middle than the basal part.
Conipi hyaline, smooth, 0-septate, clavate, slightly curved, 3-5 x 1-2 um.
ComMENTs: Morphologically, Rhinocladiella tibetensis resembles the
Rhinocladiella state of Dictyotrichiella mansonii Schol-Schwarz and R. pedrosoi
(Brumpt) Schol-Schwarz, but D. mansonii has longer conidiophores and
uncurved conidia, and R. pedrosoi has wider (3-5 x 2-3 um) uncurved conidia
(Schol-Schwarz 1968).
Ramichloridium, validated by de Hoog (1977), is characterized by straight
unbranched brown conidiophores, conidiogenous cells that are integrated,
terminal, polyblastic, smooth, golden-brown, subhyaline to pale brown,
straight or flexuose, with conspicuous conidiogenous loci or slightly prominent
denticles, and conidia that are solitary, 0-1-septate, subhyaline to pale brown,
smooth to coarsely verrucose, obovate, obconical to fusiform, and with a
prominent hilum. Seifert et al. (2011) lists 21 taxa for the genus.
Ramichloridium apiculatum (J.H. Mill., Giddens & A.A. Foster) de Hoog, Stud.
Mycol. 15: 69. 1977. FIG. 3
Cotonies on MEA effuse, velvety, olivaceous green. Mycelium superficial or
immersed, hyphae branched, septate, smooth, pale to mid brown, 2-3 um wide.
CONIDIOPHORES straight, unbranched, smooth or slightly rough, dark brown,
up to 100 um long. CONIDIOGENOUS CELLS integrated, terminal, golden-brown,
straight, cylindrical, with conspicuous conidiogenous loci, 25-40 x 2-3.5 um.
Conipia solitary, pale brown, finely verrucose, 0-septate, obovate to obconical,
5-7 x 3-4 um, hilum conspicuous.
SPECIMEN EXAMINED: CHINA. TIBET: Xigaze, altitude 3900 m, from a forest soil, 9 Sept.
2007, Y.M. Wu (HSAUP II, 1427, HMAS 196272).
Ramichloridium apiculatum is reported for the first time from China. Our
specimens share the obovate to obconical 0-septate finely verrucose pale
brown conidia with a conspicuous hilum and that measure 5-7 x 3-4 um as
described by de Hoog (1977). The species is most similar in conidial shape to
R. cerophilum (Tubaki) de Hoog, which differs in its smooth conidia with 1-3
short secondary conidia (de Hoog 1977).
Radulidium & Rhinocladiella spp. nov. (China) ... 127
——
op)
<
HA
od
in sh
oP)
nor
ic ~p
Fic. 3. Ramichloridium apiculatum (HSAUP II 1427).
Conidia, conidiophores, and conidiogenous cells. Scale bars = 25 um.
Ramichloridium brasilianum Arzanlou & Crous, Stud. Mycol. 58: 72.2007. Fic. 4
Cotonigs on MEA effuse, velvety to hairy, dark olivaceous-grey. Mycelium
superficial or immersed, hyphae branched, septate, smooth or slightly rough,
olivaceous-brown, 1.5-2 um wide. CONIDIOPHORES straight, unbranched,
smooth or slightly rough, dark brown, up to 70 um long. ConIDIOGENOUS
CELLS integrated, terminal, subhyaline, straight, cylindrical, with conspicuous
conidiogenous loci, 15-30 x 2-3.5 um. Conrp1A solitary, pale brown, finely
verrucose, 0-septate, obovoid to fusiform, 4-6 x 2-2.5 um, hilum conspicuous.
SPECIMEN EXAMINED: CHINA. T1BeT: Nagri, altitude 4700 m, from a mountain soil, 18
Sept. 2007, Y.M. Wu (HSAUP II 1388, HMAS 196273).
128 ... Wu &al.
Fic. 4. Ramichloridium brasilianum (HSAUP II 1388).
Conidia, conidiophores, and conidiogenous cells. Scale bars = 25 um.
Ramichloridium brasilianum is also reported for the first time from China.
Our specimens share the pale brown conidia that are obovoid to fusiform,
finely verrucose, 0-septate, hilum conspicuous, and measure 4-6 x 2-2.5 um
as described by Arzanlou et al. (2007). The species is most similar in conidial
shape to R. biverticillatum Arzanlou & Crous, which differs in its smooth and
smaller (3-4 x 1.5-2.5 um) conidia (Arzanlou et al. 2007).
Radulidium & Rhinocladiella spp. nov. (China) ... 129
Ramichloridium musae (Stahel ex M.B. Ellis) de Hoog, Stud. Mycol. 15: 62.1977. Fic. 5
Cotonizs on MEA effuse, velvety to hairy, olivaceous-grey. Mycelium
superficial or immersed, hyphae branched, septate, smooth, olivaceous- brown,
1-2 um wide. CONIDIOPHORES straight, unbranched, smooth or slightly rough,
brown, up to 160 um long. CONIDIOGENOUS CELLS integrated, terminal,
subhyaline, straight, cylindrical, with conspicuous conidiogenous loci, 20-30 x
Fic. 5. Ramichloridium musae (HSAUP II ,,0576).
Conidia, conidiophores, and conidiogenous cells. Scale bars = 25 um.
130 ... Wu &al.
2-2.5 um. Conrp1A solitary, pale brown, finely verrucose, 0-septate, obovate to
obconical, 7-9 x 2-3 um, hilum conspicuous.
SPECIMEN EXAMINED: CHINA. T1BeT: Shannan, altitude 3500 m, from a grassland soil,
10 Jun. 2007, Y.M. Wu (HSAUP II 90976, HMAS 196274).
Ramichloridium musae is reported for the first time from China. Our specimens
share the pale brown conidia that are obovate to obconical, finely verrucose,
0-septate, hilum conspicuous, and measure 7-9 x 2-3 um as described by de
Hoog (1977). The species is most similar in conidial shape to R. cerophilum,
which is distinguished by smooth and smaller conidia (6-7 x 2-3 um; de Hoog
1977).
Acknowledgments
The authors are grateful for pre-submission comments and suggestions provided
by Dr. Eric McKenzie and Prof. Y.L. Guo. This project was supported by the National
Science Foundation of China (no. 30970011 & 30499340).
Literature cited
Arzanlou M, Groenewald JZ, Gams W, Braun U, Shin H-D, Crous PW. 2007. Phylogenetic and
morphotaxonomic revision of Ramichloridium and allied genera. Studies in Mycology 58:
57-93. http://dx.doi.org/10.3114/sim.2007.58.03
de Hoog GS. 1977. Rhinocladiella and allied genera. Studies in Mycology 15: 1-140.
Melin JBE, Nannfeldt JA. 1934. Researches into the blueing of ground wood-pulp. Svenska
Skogsvardsforeningens Tidskrift 32(3-4): 397-616.
Schol-Schwarz MB. 1968. Rhinocladiella, its synonym Fonsecaea and its relation to Phialophora.
Antonie van Leeuwenhoek 34: 119-152. http://dx.doi.org/10.1007/BF02046424
Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes. CBS
Biodiversity Series 9. 997 p._http://dx.doi.org/10.3767/003158511X617435
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.131
Volume 125, pp. 131-138 July-September 2013
A new species of Emericella from Tibet, China
LI-CHUN ZHANG” **’, JUAN CHEN”, WEN-HAN LIN! & SHUN-XING GUO?®"
' The State Key Laboratory of Natural and Biomimetic Drugs, Peking University,
Beijing 100193, People’s Republic of China.
? Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences &
Peking Union Medical College, Beijing, 100193, People’s Republic of China
ABSTRACT — Emericella miraensis sp. nov. is described and illustrated. It was isolated
from the alpine plant Polygonum macrophyllum var. stenophyllum from Tibet, China,
and is characterized by ascospores with star-shaped equatorial crests. The new species is
distinguished from other Emericella species with stellate ascospores (e.g., E. variecolor,
E. astellata) by its violet ascospores and verrucose spore ornamentation. ITS and 6-tubulin
sequence analyses also support E. miraensis as a new species.
Key worps —Aspergillus, endophytic fungi, phylogeny, taxonomy
Introduction
Berkeley (1857) established Emericella, a teleomorph genus associated
with Aspergillus, for the type species E. variecolor Berk. & Broome (Geiser
2009, Peterson 2012). To date, 36 species have been described and recorded
worldwide (Kirk et al. 2008). Emericella species are usually isolated from soil
(Samson & Mouchacca 1974, Horie et al. 1989, 1990, 1996, 1998, 2000; Stchigel
& Guarro 1997) but sometimes also from stored foods, herbal drugs, and
grains or occasionally from hypersaline water (Zalar et al. 2008) or living plants
(Berbee 2001, Thongkantha et al. 2008, Zhang et al. 2011).
During a survey of endophytic fungi associated with Polygonum
macrophyllum var. stenophyllum (Meisn.) A.J. Liin Tibet, China, an unidentified
endophytic fungus was isolated from the roots of the alpine medicinal plant.
Our morphological and molecular data confirm the fungus as a new Emericella
species.
Materials & methods
Plant samples of P. macrophyllum var. stenophyllum were collected at 4850 m altitude
from the mountain steppe of Mira Hill at Nyingchi County, in Tibet, China, in June
132 ... Zhang & al.
2010. Plant samples and their rhizosphere soils were collected and kept in plastic bags
together for transporting to the laboratory.
For fungal isolation, three pieces of healthy roots of individual plants were randomly
selected and removed from each of the five PR. macrophyllum var. stenophyllum plants,
rinsed under tap water to remove soil and litter, and washed in sterile de-ionized water.
Each root was cut into 20 mm long segments, and the surfaces were sterilized in 75%
ethanol for 1 min, 3% NaClO for 3 min, and 75% ethanol for 30 s, and then rinsed in
sterilized water three times. These root segments were cut into approximately 1 mm long
portions and inoculated on potato dextrose agar (PDA) in 90 mm diam. Petri dishes.
The cultures were kept in a dark incubator at 25°C to obtain their anamorphic stages.
The fungal mycelium was sub-cultured in Czapek yeast extract agar (CYA), PDA, and
malt extract agar (MEA) for morphological observations.
The fungal isolates were identified morphologically from colony characters (e.g.,
colour, growth rate, hyphae, and margin characters) and micro-characters (conidia
and ascospores) on CYA and PDA medium. Strains were incubated at 25°C for 14 d,
after which colonies and mycelia were observed using a light microscope (ZEIss Axio
ImagerA1) and scanning electronic microscope (SEM; JSM-6510LV, Japan). Cultures
have been conserved in the Chinese General Microbiological Culture Collection Center,
Institute of Microbiology, Chinese Academy of Sciences, Beijing, China (CGMCC).
DNA was extracted from the examined strain using the E.Z.N.A.™ Fungal DNA
Mini Kit (OmEGABIOTEK, Norcross, USA) according to the manufacturer’s protocol.
The internal transcribed spacer (ITS) region was amplified with primer pair ITS1/ITS4
(White et al. 1990) and the $-tubulin gene with primer pair T1/T22 (O'Donnell &
Cigelnik 1997) according to Zhang et al. (2012). PCR products were examined in 1%
agarose gels (mixed with goldview) by electrophoresis visualized under UV light. After
purification with mini-columns (Sangon, China), purified DNA was directly sequenced
in the ABI Prism 377 DNA sequencer (Applied Biosystems, USA).
Similar sequences were retrieved from GenBank using the NCBI BLast program
(Altschul et al. 1997), most previously published in Peterson (2008) and Zalar et al.
(2008). Aspergillus karnatakaensis was chosen as outgroup based on Peterson's (2008)
analyses. Sequences were aligned with Clustal X 1.81. Neighbor joining (NJ) trees were
constructed with the Kimura two-parameter model (Kimura 1980) and maximum
parsimony (MP) trees with the close-neighbor-interchange (CNI) search method on
random trees on MEGa version 5.0 (Tamura et al. 2011).
Results
Taxonomy
Emericella miraensis L.C. Zhang, Juan Chen & S.X. Guo, sp. nov. Fic. 1
MycoBAnk MB 800444
Differs from Emericella stella-maris and E. variecolor by its violet ascospores with
verrucose convex walls.
Type: China, Tibet, Nyingchi County, Mira Hill, 29°53'N 92°50’E, 4850 m, from roots
of Polygonum macrophyllum var. stenophyllum, June 2010, Li-Chun Zhang (Holotype,
CGMCC3.14984; GenBank, JQ268604, KC342577).
Emericella miraensis sp. nov. (China) ... 133
a ) i
Li) |e ot J
SEI 30K WO10iim,. SS40Q 9 %15,000 1pm _——
y ¥ 16 Nov 2011
FiGurRE 1. Emericella miraensis (holotype). Morphological characters. a. Colonies on PDA after
2 week at 25°C; b. Colonies on CYA after 2 week at 25°C; c, d. Hiille cells; e. Asci in different
developmental stages views; f. Hiille cells, asci and ascospores; g. Stellate ascospores; h, i. Scanning
electron micrograph of ascospores showing the side views and verrucose ornamentation on the
convex surface; j, Scanning electron micrograph of conidia; k, 1. Conidiophores; m. Conidia. Bars:
c, e-g, m = 10 um; d, 1 = 20 um; h = 2 um; i, j = 1 um; k= 100 um.
ETYMOLOGY — miraensis refers to the type locality, Mira Hill.
CoLonliegs on PDA spreading broadly, attaining 7.2-7.8 cm diam. in 14 days at
25°C. Aerial mycelium khaki, marginal mycelium white, irregular, and small
amounts exudates droplets and granular produced in center after two weeks,
reverse pale yellowish white, and then becoming gray purple-brown. Ascomata
134 ... Zhang & al.
abundantly produced, gray green, subglobose, with numerous, globose to ovoid
shaped Hiille cells, 15-20 mm diam.
Asci 8-spored, globose, 10 x 20 um, firstly pink-purple, becoming violet in
mature. AscosporEs violet, with 6-7 tm denotative crests stellate in surface
view, 6.0-10.0 um (including stellate tentacles); spore bodies subglobose,
verrucose on the surface, 4.0-5.0 um diam., convex-lens form, with two stellate,
broad equatorial crests in side view; undissected part of crests < 1 um, every
angle of stellate crests regularly ornamented with three longitudinal striations,
transverse striation arranged irregularly between two longitudinal striations.
ANAMORPHIC STAGE: CONIDIAL HEADS grayish olive, radiate to short
columnar. CONIDIOPHORES abundant, columnar, straightforward, stipes
smooth, brownish and nonseptate, generally 275-345 um long x 8.5-13.0 um
wide, dark colour near the conidia; vesicles abundant, radiate, subclavate to
flask-shaped, hyaline to pale brownish green, 2.0-3.5 um wide x 9.0-17.0 um
long, covered in the upper half by metulae, which are hyaline to pale brown,
15.5-18.5 x 9.0-10.0 um; phialides flask-shaped, hyaline, 10-16.5 x 3.5-5.5
um.
Conip1A globose to subglobose, verrucose, appearing grayish green in
mass, diameter 1.5-4.0 um, strawberry appearance in SEM. Colonies on MEA
spreading broadly, attaining a diameter of 5.3-5.7 cm in 14 days at 25°C;
appearance same as on PDA, but ascomata arranged in concentric circles,
particularly on colony margins, grayish green, edge mycelium white. Colonies
on CYA spreading slowly, attaining 4.0-4.5 cm diam. after 14 d at 25°C,
bright yellow, white edge, consisting of a thin mycelial felt, slightly granular
in colony center due to formation of Hille cells (thick-walled refractive cells
like chlamydospores) and conidia abundant, reverse yellowish brown, edge
mycelium white.
Phylogenetic analysis
The sequences for our new taxon have been deposited in GenBank.
The ITS data set consisted of 28 sequences and 550 characters, of which 98
are parsimony informative sites. MP analysis produced 97 trees (TL = 139,
CI = 0.813, RI = 0.834), of which one is shown in Fic. 2. NJ analysis (not shown)
created similar topology to MP analysis. All Emericella sequences analyzed were
divided into two large clades and four subclades. Emericella miraensis formed
a well-supported clade (Clade II; BP = 100%) with other related species, such
as E. stella-maris, E. astellata, E. variecolor, E. qingixianii, E. appendiculata, and
E. filifera. These taxa all have star-shaped ascospores, but are distinguished
from one another by color or ascospore ornamentation (TABLE 1).
The §-tubulin data set contained 19 sequences and 420 characters, of
which 84 were parsimony informative sites. MP analysis produced 9 trees
EU448266 E. discophora
EF652468 A. karnatakaensis
Emericella miraensis sp. nov. (China) ... 135
AB248989 Emericella cleistominuta
AB248999 E. dentata
JN676111 E. nidulans
HQ285568 Emericella sp.
AB249010 E. foveolata
AB248970 E. montenegroi
| AB243116 E. miyajii
sre "48248962 E. acristata
AB248975 E. corrugata
1400) EF652484 E. quadrilineata
EF652470 Aspergillus striatus
100)
Cladel
52 EF652482 A. recurvatus
100 EF652434 E. rugulosa
EF652483 E. fruticulosa
sub2 EU482442 E. pluriseminata
100 52 EF652428 A.caespitosus
100! AB248982 E. undulata
sub3 i997 EF652435 Emericella sp.
EU448268 E. olivicola
Cladelll toor~ EF652431 E. variecolor
100 EF652447 E. astellata
sub4 | £U448276 E. filifera
ie JQ268604 E. miraensis
AB248997 E. appendiculata
O
EU448270 E. stella-maris
AB249008 E. qingixianii
FIGURE 2. One of the MP trees obtained based on phylogenetic analysis of ITS sequence data of
Emericella/Aspergillus. Numbers above branches are bootstrap values = 50%.
(TL = 172, CI = 0.784, RI = 0.804; one tree is shown in Fic. 3). MP analysis of
6-tubulin produced topologies very similar to those obtained by ITS analysis.
All Emericella sequences analyzed were divided into three large clades, with
E. miraensis forming a well-supported clade (BP = 100%) with three other
species (E. stella-maris, E. astellata, E. variecolor).
Discussion
The Emericella miraensis specimens were isolated from the roots of an
alpine plant. Microscopic examination showed ascomata embedded in
masses of Hiille cells and violet ascospores with two stellate equatorial crests.
In addition, their anamorphic Aspergillus stage also was observed on CYA,
136 ... Zhang & al.
no. | EF 428367 Emericeiia steta-maris
33 EF428366 £. steflamaris
nt EF652255 £. variecalor
| hoo — EF652296 . variecafor
KC342577 E. miraensis
oo| EF 428369 &. venezuelensis
AYS39998 E. venezuelensis
bos 100 EF428368 £. asteleta
100 ~ EF652271 £. astelete
4B524360 £. gingkiani
100 4 46248345 £ appendicusata
100° EF 428371 £. filifera
EF652259 Emericella sp.
EF652252 Aspergifus caespilosus
100 EF428363 £. undulata
100° 46248324 £. unduata
EF428375 £. pluriseminata
100 A6524359 £. pauseminaia
EF652292 A. karnatakaensis
66
FIGURE 3. One of the MP trees obtained based on phylogenetic analysis of B-tubulin sequence data
from Emericella/Aspergillus. Numbers above branches are bootstrap values = 50%.
PDA, and MEA. These are some typical morphological features associated
with Emericella (Malloch & Cain 1972). Emericella miraensis differs from
the closely related E. stella-maris and E. variecolor in having ascospores with
tuberculate or verrucose convex walls and of a different color (TABLE 1). In
previous studies, the six Emericella species having ascospores ornamented in
a star-shape pattern included E. variecolor (Berkeley 1857), E. astellata (Horie
1980), E. pluriseminata (Stchigel & Guarro 1997), E. venezuelensis (Frisvad &
Samson 2004), E. stella-maris, and E. olivicola (Zalar et al. 2008). Emericella
pluriseminata did not produce aspergilla on any media (Frisvad & Samson 2004,
Zalar et al. 2008), while E. miraensis forms conidiophores and conidia on three
conventional media: CYA, PDA, and MEA. Although E. miraensis resembles
E. variecolor in ascospore colour, its ascospores are obviously verrucose as
seen in SEM, while E. variecolor ascospores have smooth convex walls. The
phylogenetic trees (Fics 2-3) indicate a close relationship between E. miraensis
and E. stella-maris, which differs in its orange-red ascospore color. Emericella
miraensis also can easily be distinguished from E. venezuelensis, which has violet
brown ascospores with triangular flaps on their convex sides. In addition, the
nonseptate conidiophores of E. miraensis distinguish it from E. stella-maris and
E. astellata, whose conidiophores are always septate. Ascospore morphology is
the most important diagnostic character for Emericella species (Horie 1980).
Emericella miraensis sp. nov. (China) ... 137
TABLE 1. Ascospore characters of Emericella miraensis and related species.
ASCOSPORES
SPECIES a aja:h ate-aarecn aPbiatqsocn said wold g wia:s cia:G atnle ajeie afa'e afte nie a aie ian a ale oa aifio aie ayein eje'mraveiacetajnate a siein tia g 0'6 0 016'chai6 apne sib-a'die-aisiaiGie niath aieia-sivis'a ale Q a's ala bays cles, cie'b alee sine algia:matmaibie’a Pain geia.na'eleuiie wa
ASCOSPORE SHAPE COLOR SURFACE ORNAMENTATION
E. variecolor stellate violet smooth
E. stella-maris stellate orange-red smooth
E. astellata stellate reddish purple- smooth
reddish brown
E. gingixianii lenticular violet-brown smooth
E. appendiculata lenticular violet-brown capitate appendages
E. filifera subglobose brownish red capitate appendages
E. venezuelensis stellate violet brown triangular flaps
E. miraensis stellate violet verrucose
Most Emericella species are more adapted to dry warm climates than to humid
cold environments (Samson & Mouchacca 1974, Zalar et al. 2008). However
the host of E. miraensis, P. macrophyllum var. stenophyllum, is an alpine plant
that occurs in mountain steppes up to 4850 m, with annual precipitation of
443.6 mm (Luo et al. 2003).
Acknowledgments
This research was financially supported by the National Natural Sciences Foundation
of China (No. 30830117, 31170016). The authors thank Mr. Wen Jie for help with scanning
electron microscopy, Dr. Pei-Gui Liu and Dr. Stephen W. Peterson for pre-submission
review and advice, and Editor-in-Chief Dr. Lorelei L. Norvell and Nomenclature Editor
Dr. Shaun R. Pennycook (Mycotaxon) for helpful manuscript suggestions.
Literature cited
Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped
BLAST and PSI-BLAST: a new generation of protein data base search programs. Nucleic Acids
Res. 25: 3389-3402. http://dx.doi.org/10.1093/nar/25.17.3389
Berbee ML. 2001. The phylogeny of plant and animal pathogens in the Ascomycota. Physiol. Mol.
Plant Pathol. 59: 165-187. http://dx.doi.org/10.1006/pmpp.2001.0355
Berkeley MJ. 1857. Introduction to cryptogamic botany. London: Bailliere. 604 p.
Frisvad JC, Samson RA. 2004. Emericella venezuelensis, a new species with stellate ascospores
producing sterigmatocystin and aflatoxin B1. Syst. Appl. Microbiol. 27: 672-680.
http://dx.doi.org/10.1078/0723202042369910
Geiser DM. 2009. Sexual structures in Aspergillus: morphology, importance and genomics. Med.
Mycol. 47: 21-26. http://dx.doi.org/10.1080/13693780802139859
Horie Y. 1980. Ascospore ornamentation and its application to the taxonomic re-evaluation in
Emericella. Trans. Mycol. Soc. Japan 21: 483-493.
Horie Y, Miyaji M, Nishimura K,, Udagawa S. 1989. Emericella falconensis, a new species from
Venezuelan soil. Trans. Mycol. Soc. Japan 30: 257-263.
Horie Y, Udagawa S, Abdullah SK, Al-Bader SM. 1990. Emericella similis, a new species from Iraqi
soil. Trans. Mycol. Soc. Japan 31: 425-430
Horie Y, Fukiharu T, Nishimura K, Taguchi H, Wang DL, Li R. 1996. New and interesting species
of Emericella from Chinese soil. Mycoscience 37: 323-329.
http://dx.doi.org/10.1007/BF02461304
138 ... Zhang & al.
Horie Y, Li D, Fukiharu T, Li R, Abliz P, Nishimura K, Wang DL. 1998. Emericella appendiculata, a
new species from Chinese soil. Mycoscience 39: 161-165.
http://dx.doi.org/10.1007/BF02464054
Horie Y, Abliz P, Hui Y, Fukiharu T, Nishimura K, Li DL, Li R. 2000. Emericella qingixianii, a new
species from desert soil in China. Mycoscience 41: 183-187.
http://dx.doi.org/10.1007/BF02464329
Kimura M. 1980. A simple method for estimating evolutionary rate of base substitutions through
comparative studies of nucleotide sequences. J. Mol. Evol. 16: 111-120.
http://dx.doi.org/10.1007/BF01731581
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the Fungi,
10" edn. CAB International, U.K.
Luo J, Bianba D, Zheng WL. 2003. A study on spermatophytic flora of Mila Mountains in Tibet.
Journal of Nanjing Forestry University (Natural Sciences Edition) 27(6): 18-22.
Malloch D, Cain RE. 1972. New species and combinations of cleistothecial ascomycetes. Can. J. Bot.
50: 61-72. http://dx.doi.org/10.1139/b72-011
O'Donnell K, Cigelnik E. 1997. Two divergent intragenomic rDNA ITS2 types within a monophyletic
lineage of the fungus Fusarium are nonorthologous. Mol. Phylo. Evol. 7(1): 103-116.
http://dx.doi.org/10.1006/mpev.1996.0376
Peterson SW. 2008. Phylogenetic analysis of Aspergillus species using DNA sequences from four
loci. Mycologia. 100(2): 205-226. http://dx.doi.org/10.3852/mycologia.100.2.205
Peterson SW. 2012. Aspergillus and Penicillium identification using DNA sequences: barcode or
MLST? Appl. Microbiol. Biotechnol. 95(2): 339-344.
http://dx.doi.org/10.1007/s00253-012-4165-2
Samson RA, Mouchacca J. 1974. Some interesting species of Emericella and Aspergillus from
Egyptian desert soil. Ant. Leeuwenhoek 40: 121-131. http://dx.doi.org/10.1007/BF00394559
Stchigel AM, Guarro J. 1997. A new species of Emericella from Indian soil. Mycologia 89: 937-941.
http://dx.doi.org/10.2307/3761114
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGAS5: Molecular
evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum
parsimony methods. Mol. Biol. Evol. 28: 2731-2739.
http://dx.doi.org/10.1093/molbev/msr121
Thongkantha S, Lumyong S, McKenzie EHC, Hyde KD. 2008. Fungal saprobes and pathogens
occurring on tissues of Dracaena lourieri and Pandanus spp. in Thailand. Fungal Divers. 30:
149-169.
White TJ, Bruns TD, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal
ribosomal RNA genes for phylogenetics. Academic, New York, pp 315-322.
Zalar P, Frisvad JC, Gunde-Cimerman N, Varga J, Samson RA. 2008. Four new species of Emericella
from the Mediterranean region of Europe. Mycologia 100(5): 779-795.
http://dx.doi.org/10.3852/08-078
Zhang GJ, Sun SW, Zhu TJ, Lin ZJ, Gu JY, Li DH, Gu QQ. 2011. Antiviral isoindolone derivatives from
an endophytic fungus Emericella sp. associated with Aegiceras corniculatum. Phytochemistry
72: 1436-1442. http://dx.doi.org/10.1016/j.phytochem.2011.04.014
Zhang LC, Chen J, Li YL, Gao C, Guo SX. 2012. Mycena sp., a mycorrhizal fungus of the orchid
Dendrobium officinale. Mycol. Progress 11(2): 395-401.
http://dx.doi.org/10.1007/s11557-011-0754-1
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.139
Volume 125, pp. 139-144 July-September 2013
Jayarambhatia rhizophorae gen. et sp. nov.,
an asexually reproducing fungus from Goa, India
J. PRATIBHA
Department of Botany, Goa University, Goa-403 206, India
CORRESPONDENCE TO:
[email protected]
ABSTRACT — A new hyphomycete genus, Jayarambhatia, is proposed, characterized by
mononematous branched septate pale brown smooth conidiophores with terminal hyaline
phialidic conidiogenous cells with long slender necks and minute collarettes. Numerous
smooth aseptate narrowly obclavate filiform conidia double over and pack densely together
to form ovate mucous heads on the tips of the conidiogenous cells. The type species was
collected from decomposing litter of Rhizophora mucronata in an intertidal mangrove area
in Goa, India.
KEY woRDs — systematics, taxonomy
Introduction
Unique organisms inhabit mangroves in the intertidal saline zones. This
highly productive ecosystem supports many marine organisms including fish
(Thatoi & Biswal 2008). Fungi inhabiting this ecosystem are called manglicolous
fungi, and they degrade mangrove litter and other detritus (Nambiar &
Raveendran 2009). The entire coast of Goa with its backwaters and seven major
rivers is lined with diverse mangrove vegetation.
During a survey of manglicolous fungi of Goa, a unique asexually
reproducing fungus was encountered on decomposing twigs and a viviparous
seedling of Rhizophora mucronata Lam. (Rhizophoraceae). The fungus
produced mononematous branched septate pale brown smooth conidiophores
terminating in phialidic conidiogenous cells with long slender necks and
smooth filiform conidia that double over and pack closely together to form
mucous heads at the tips of the conidiogenous cells. These unique features
warrant accommodation of the fungus in a new genus. The monotypic genus
is compared with four closely related genera (Atrosetaphiale, Kmetiopsis,
Natarajania, Phaeohiratsukaea) and Dictyochaeta lilliputiana, D. minutissima,
and D. uncinata, and its sole species is described and illustrated.
140 ... Pratibha
Materials & methods
Freshly gathered mangrove litter from intertidal area was brought to the laboratory
in polythene bags, incubated for 2-3 days and examined under a stereomicroscope. The
fungus was carefully picked up with a sterile needle and mounted in either lactophenol
or lactophenol cotton blue mountant. The slides were observed under a light microscope.
The holotype is conserved in the herbarium of the Indian Agricultural Research Institute,
New Delhi, India (HCIO).
Taxonomy
Jayarambhatia Pratibha, gen. nov.
MycoBank MB803753
Differs from Atrosetaphiale, Kmetiopsis, Natarajania, Phaeohiratsukaea, and
Dictyochaeta by solitary branched conidiophores lacking setae, terminal monophialidic
conidiogenous cells with elongated slender necks terminating in minute collarettes with
filiform conidia that are doubled over and packed closely together in mucous heads.
TYPE SPECIES: Jayarambhatia rhizophorae Pratibha
Erymovoey: In honor of Prof. D. Jayarama Bhat, Department of Botany, Goa University,
Goa, India.
COLONIES effuse, white, velvety. MycEeLtum partly immersed in the substrate.
CONIDIOPHORES mononematous, macronematous, erect, straight, solitary,
sometimes branched, smooth, brown. CONIDIOGENOUS CELLS monophialidic,
terminal, integrated, cylindrical, terminating with a narrow, elongated, slender
neck. CONIDIAL HEAD ovate, mucous, within which numerous conidia are
doubled over and densely packed. Conrp14 smooth, hyaline, aseptate, filiform,
narrowly obclavate, straight to flexuous when mounted in water.
Jayarambhatia rhizophorae Pratibha, sp. nov. FIGs 1, 2
MycoBank MB803754
Differs from species of Atrosetaphiale, Kmetiopsis, Natarajania, Phaeohiratsukaea, and
Dictyochaeta by monophialidic terminal conidiogenous cells with elongated slender
necks terminating with a minute collarette, and filiform conidia irregularly doubled over
within a mucous head.
Type: India, Goa, Chorao, on decomposing litter of Rhizophora mucronata, 8 January
2013, coll. J. Pratibha (Holotype, HCIO 51502).
ErymMo_ocy: Referring to the host genus.
COLONIES effuse, white, velvety. Mycelium light brown, smooth, septate, 2-3
uum wide, partly immersed in the substrate. CONIDIOPHORES mononematous,
macronematous, erect, straight to flexuous, solitary, septate, rarely branched
at the base, smooth, pale brown, 75-150 x 4.5-7 um. CONIDIOGENOUS CELLS
monophialidic, terminal, integrated, cylindrical, smooth, 15-20 x 5-6 um, with
an elongated, narrow, slender neck terminating in a small collarette. CONIDIAL
HEAD ovate, mucous, 15-20 um long, within which numerous conidia are
Jayarambhatia rhizophorae gen. et sp. nov. (India) ... 141
Fic.1. Jayarambhatia rhizophorae (holotype, HCIO 51502):
Conidiophores, conidiogenous cells, and conidia. Scale bars = 10 um.
doubled over and densely packed. Conrp1A smooth, hyaline, aseptate, filiform,
narrowly obclavate, straight to flexuous, 30-50 x 1 um when mounted in water.
142 ... Pratibha
Fic. 2. Jayarambhatia rhizophorae (holotype, HCIO 51502): a-f. Conidiophores; g. Conidio-
genous cells; h. Mucous conidial head; i-l. Conidia. Scale bars = 10 um
Jayarambhatia rhizophorae gen. et sp. nov. (India) ... 143
Discussion
Jayarambhatia is morphologically similar to anamorphic genera such as
Atrosetaphiale Matsush., Kmetiopsis Bat. & Peres, Natarajania Pratibha & Bhat,
Phaeohiratsukaea Udagawa & Iwatsu, and three species of Dictyochaeta —
D. lilliputiana R.E. Castafieda, D. minutissima A. Hern.-Gut. & J. Mena, and
D. uncinata R.F. Castafieda & W.B. Kendr. (TABLE 1). Atrosetaphiale, Kmetiopsis,
and the three Dictyochaeta spp. are similar to Jayarambhatia in producing a
mucous head of filiform or acerose conidia on monophialidic conidiogenous
cells (Batista & Peres 1960, Hernandez-Gutiérrez & Mena Portales 1996,
Batista & Peres 1960, Castafieda 1986, Castafieda et al. 1998, Matsushima
1995). Natarajania and Phaeohiratsukaea produce phialidic conidiogenous
cells with an elongated, slender neck with a collarette (Pratibha & Bhat 2005,
Udagawa & Iwatsu 1990). None of these fungi have filiform conidia doubled
over within mucous heads. Atrosetaphiale produces discrete, ampuliform,
numerous conidiogenous cells. In Dictyochaeta lilliputiana conidiophores
are ampulliform and conidiogenous cells are without neck and conspicuous
TABLE 1. Comparison between Jayarambhatia and related genera and species
GENERA : HABITAT : CONIDIOPHORES : CONIDIOGENOUS : CONIDIA
i __CELLS
Atrosetaphiale : Terrestrial : Mononematous, : Monophialidic, Filif limy. |
: litter : solitary, unbranched : discrete, numerous, : at a Mee ee
; exuous, hyaline
i : ampuliform
seaman fecal aMonbnenacnes a Reacaklaiee neon Mie
lilliputiana litter solitary, without neck curved, hyaline
unbranched, and conspicuous
aseptate, collarette
ampuliform
pense Fee EC EApECT re eT ae Masnick = Meee es
minutissima litter : solitary, branched 1-3 percurrent : fusiform, slightly
proliferations curved, hyaline
to sub-hyaline
eae eau” Mononenaistes ft Monophiaidie tanto aiaetong
uncinata litter solitary, : with conspicuous i flexuous, hyaline
unbranched, setose. narrow collarette
“aneaeinnaes Sta Ee teseardy = SearenGcalen Meneses 1) eaurenes
litter pseudostroma without neck falcate, hyaline,
and collarette ends pointed
Seagal ae ise Monbacmansus Pe Nbsonmaliaie Wake Sonica ho
litter fasciculate, long, cylindrical ellipsoidal,
verrucose neck and collarette dark brown
towards apex
Se ay eae eo Mead er eee
litter i fasciculate, polyphialidic, ellipsoidal, brown
branched with short neck with germ slit
and collarette
Giguimblida” oT Maase Man Mongahilitig sith Filfoas, shi lone =
litter solitary, branched slender neck and flexuous, hyaline,
minute collarette
tightly doubled
over, forming
mucous head
144 ... Pratibha
collarette. Dictyochaeta minutissima produces monophialidic conidiogenous
cells with 1-3 percurrent proliferations and acerose to fusiform conidia. In
Dictyochaeta uncinata conidiophores are unbranched, it produces setae, and
the conidiogenous cells have a conspicuous narrow collarette. In Kmetiopsis
the conidiophores are sporodochial with a pseudostroma and the conidia are
acerose. In Natarajania the conidiophores are unbranched and verrucose at the
upper part and the conidia are ellipsoidal and dark brown. In Phaeohiratsukaea
the conidiophoresare percurrent, conidiogenous cells are mono- to polyphialidic
and the conidia are ellipsoidal, brown with a germ slit and formed in chains.
The combination of diagnostic characters found in Jayarambhatia is not shown
by any other genus of phialidic fungi. Moreover, all of the fungi discussed above
were isolated from terrestrial litter, whereas Jayarambhatia was isolated from
mangrove litter from intertidal region.
Acknowledgments
Thanks are due to the University Grants Commission, New Delhi, for a postdoctoral
research grant support. I am indebted to Dr. R.F. Castafieda-Ruiz (Instituto de
Investigaciones Fundamentales en Agricultura Tropical Alejandro de Humboldt
(INIFAT), Cuba) and Dr. Eric McKenzie (Landcare Research, New Zealand) for kindly
reviewing the manuscript for Mycotaxon. I take this opportunity to thank my guide and
Head of Department of Botany, Goa University, Prof. M. K. Janarthanam for supporting
this work.
Literature cited
Batista AC, Peres GEP. 1960. Kmetiopsis - um novo género de fungos Tuberculariaceae. Instituto
de Micologia da Universidade do Recife 245: 1-9.
Castaneda RF. 1986. Fungi Cubense (La Habana) 1: 1-20.
Castaneda RF, Kendrick B, Guarro J, Mayayo E. 1998. New species of Dictyochaeta and Helicoma
from rain-forests in Cuba. Mycological Research 102: 58-62.
http://dx.doi.org/10.1016/S0953-7562(08)60835-7
Hernandez-Gutiérrez A, Mena Portales J. 1996. Dictyochaeta minutissima sp. nov. on Coccothrinax
miraguama from Cuba. Mycological Research 100: 687-688.
http://dx.doi.org/10.1016/S0953-7562(96)80199-7
Matsushima T. 1995. Matsushima mycological memoirs no. 8. Matsushima Fungus Collection,
Kobe. 54 p.
Nambiar GR, Raveendran K. 2009. Manglicolous marine fungi on Avicennia and Rhizophora along
Kerala Coast (India). Middle East Journal of Scientific Research 4(1): 48-51.
Pratibha J, Bhat DJ. 2005. Natarajania indica gen. et sp. nov., a dematiaceous hyphomycete from the
Western Ghats, India. Kavaka 33: 129-133.
Thatoi HN, Biswal AK. 2008. Mangroves of Odisha coast: floral diversity and conservation status.
Special habitats and threatened plants of India. ENVIS Bulletin: Wildlife and Protected Areas
11: 201-207.
Udagawa SI, Iwatsu T. 1990. Phaeohiratsukaea expansa, a new genus and species of hyphomycetes.
Reports of the Tottori Mycological Institute 28: 151-157.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.145
Volume 125, pp. 145-148 July-September 2013
Sympodioplanus goaensis sp. nov. from Goa, India
J. PRATIBHA
Department of Botany, Goa University, Goa 403206, India
CORRESPONDENCE TO:
[email protected]
ABSTRACT — A new species, Sympodioplanus goaensis, occurring on decaying unidentified
twigs collected from Goa, India, is described and illustrated. The fungus is characterized by
numerous conidiogenous cells that are polyblastic, sympodial, integrated, and terminal as
well as intercalary and by naviculiform 1-2-septate conidia
KEY worps — taxonomy, litter fungi
Introduction
During a biodiversity survey of litter-degrading microfungi from forests of
Western Ghats in Goa, an undescribed anamorphic fungus with morphological
characteristics of Sympodioplanus R.C. Sinclair & Boshoff was found on fallen
decomposing twigs of an unidentified plant. The fungus is described, illustrated,
and compared with other Sympodioplanus spp.
Materials & methods
Freshly gathered litter samples from Sonal forests of Goa were taken to the laboratory
in polythene bags, incubated for 2-3 days, and examined under a stereomicroscope.
Fungal fruiting bodies were carefully picked up with a sterile needle, mounted in
lactophenol, and observed under a light microscope. Several fungi were observed,
one of them an undescribed species of Sympodioplanus, which is described here. The
holotype is conserved in the herbarium of the Indian Agricultural Research Institute,
New Delhi, India (HCIO).
Taxonomy
Sympodioplanus goaensis Pratibha, sp. nov. (Fics 1, 2)
MycoBank MB804078
Differs from Sympodioplanus capensis by its larger conidia with fewer septa and from
S. yunnanensis by its smaller conidia with fewer septa.
TyPE: India, Goa, Sattari, Sonal, tropical forests of Western Ghats, on decomposing litter
of unidentified tree, 26 January 2013, coll. J. Pratibha (Holotype HCIO 51503).
Erymotoey: In reference to the biodiversity rich Goa State.
146 ... Pratibha
Fic. 1. Sympodioplanus goaensis (holotype HCIO 51503):
Conidiophores, conidiogenous cells, and conidia. Scale bar = 20 um.
COLONIES on natural substrate effuse, hairy, dark brown. MyceELium partly
superficial, partly immersed in the host tissue, composed of light brown,
smooth, branched, thin-walled, 1.5-3 um wide hyphae. CoNIDIOPHORES
macronematous, mononematous, erect, straight to flexuous, smooth, thick-
Sympodioplanus goaensis sp. nov. (India) ... 147
Fic. 2. Sympodioplanus goaensis (holotype HCIO 51503): a-g. Conidiophores, conidiogenous
cells, and conidia; h-i. Conidia. Scale bars = 20 um.
148 ... Pratibha
walled, dark brown, paler towards the apex, unbranched, 160-285 x 4-6.5 um.
CONIDIOGENOUS CELLS polyblastic, terminal as well as intercalary, sympodial,
thick-walled, 8-10 x 2-3 um, bearing flat scars. Conip1A solitary, dry, light
brown, thin-walled, smooth, naviculiform, rounded at the apex, truncate at the
base; basal cells light brown, apical cell subhyaline, 1-2-septate, 22-36 x 8-12
um.
Discussion
The genus Sympodioplanus is typified by S. capensis R.C. Sinclair & Boshoff,
which was collected from dead, decorticated wood in South Africa (Sinclair et
al. 1997). The genus is mainly characterised by conidiophores with sympodial
proliferation with numerous conidiogenous loci and naviculiform, euseptate
conidia. Yang et al. (2012) added a second species, S. yunnanensis G.Z. Yang &
Z.F. Yu from China on submerged leaves of an unidentified dicotyledonous plant.
These two articles comprise the total published knowledge of Sympodioplanus.
Sympodioplanus goaensis differs from S. capensis and S. yunnanensis by length
of the conidiophores and septation and size of the conidia (TABLE 1). All three
species have polyblastic sympodial conidiogenous cells.
TABLE 1: Comparison of Sympodioplanus species
SPECIES CONIDIOPHORES CONIDIA
S. capensis Macronematous, moderately Naviculiform, 3(-5)-septate,
geniculate, <65 um long 13-16 x 2.5-4 um
S. goaensis Macronematous, straight, Naviculiform, 1-2-septate,
160-285 um long 22-36 x 8-12 um
S. yunnanensis Macronematous, straight, Spindle shaped, 4-7-septate,
70-205 um long 38-56 x 6-10.8 pm
Acknowledgments
Thanks to the University Grants Commission, New Delhi, for post doctoral research
grant support. I am indebted to Dr. Eric McKenzie, Landcare Research, New Zealand,
and Dr. Xiu-Guo Zhang, Department of Plant Pathology, Shandong Agricultural
University, China for kindly reviewing the manuscript for Mycotaxon. I take this
opportunity to thank my guide and Head of Department of Botany, Goa University
Prof. M. K. Janarthanam, for supporting this work.
Literature cited
Sinclair RC, Boshoff S, Eicher A. 1997. Sympodioplanus, a new anamorph genus from South Africa.
Mycotaxon 64: 365-374.
Yang GZ, Lu KP, Yang Y, Ma LB, Qiao M, Zhang KQ, Yu ZE 2012. Sympodioplanus yunnanensis,
a new aquatic species from submerged decaying leaves. Mycotaxon 120: 287-290.
http://dx.doi.org/10.5248/120.287
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.149
Volume 125, pp. 149-164 July-September 2013
Contributions to the family Thyridiaceae.
New data on Sphaeria mutabilis
JULIA CHECA, M. NATIVIDAD BLANCO & GABRIEL MORENO
Dpto. de Ciencias de la Vida, Facultad de Biologia, Universidad de Alcala,
Alcala de Henares, Madrid 28871 Spain
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Type specimens of the genera Balzania, Mattirolia, Thyridium, and
Thyronectroidea were studied. We accept Mattirolia (five species) and Thyridium (four species)
in the Thyridiaceae and regard Balzania and Thyronectroidea as synonyms of Mattirolia. The
occurrence of Mattirolia roseovirens in Spain represents only the second collection since its
original description. Four new combinations are proposed: Mattirolia mutabilis, M. ohiensis,
M. platensis, and Thyridium lasiacidis. Lectotypes are designated for M. mutabilis and
M. ohiensis. A key is provided to species in the Thyridiaceae.
Key worps — Ascomycota, Lasiella mutabilis, systematics, taxonomy
Introduction
The yellowish color that appears in the fruiting bodies of some Pyrenomycetes
sensu lato has raised confusion among mycologists throughout history,
e.g., Quélet (1875), Saccardo (1883), Winter (1884-87), and Munk (1957).
Although the coloration suggests the order Hypocreales, detailed microscopic
studies indicate that species with yellow ascomata can be very different and
phylogenetically distant.
While studying samples on logs and dead branches of Genista scorpius (L.)
DC. (Fabaceae), a number of fungi with yellow ascomata were collected that
do not belong in the Hypocreales. This scrub tree is common in the green oak
forest of Tamajon (Guadalajara, Spain) growing on basic ground limestone.
These samples were identified as Mattirolia roseovirens representing the family
Thyridiaceae (Sordariomycetidae), although macroscopically they resembled
Pseudotrichia mutabilis in the Pleosporomycetidae.
The study of these samples led us to revise species in Thyridiaceae for
comparison with other species having yellow ascomata. The Thyridiaceae
150 ... Checa, Blanco & Moreno
previously studied by Yue & Eriksson (1987), Eriksson & Yue (1989), Barr
(1990), and Eriksson & Hawksworth (1991), currently consist of five genera
and 22 species (Kirk et al. 2008), although Lumbsch & Huhndorf (2010) have
accepted only four genera. Most of the studied species have been collected only
once and are represented only by type specimens, which are generally old and
currently of uncertain taxonomic position. In this paper, we provide an account
of two genera with nine species accepted in the Thyridiaceae.
Materials & methods
Mattirolia roseovirens was collected on Genista scorpius during surveys carried
out in the spring of 1996 and 2008 at Tamajoén (Guadalajara, Spain). Specimens are
deposited in AH and compared with other M. roseovirens specimens, including the type
material from BPI, FH, and S. These collections were compared with other species of the
Thyridiaceae from the herbaria B, K, LPS, NY, UME, including type specimens of Balzania
platensis, Sinosphaeria lasiacidis, Teichospora ohiensis, Thyronectria chrysogramma, and
Thyridium flavum. Fries’ specimen of Sphaeria mutabilis and Quélet’s specimen of
Lasiella mutabilis are from UPS.
Collections were examined with a binocular microscope after mounting in 5% KOH.
Spore measurements were made under a 100x oil immersion objective. Micrographs
were taken with a Nikon (Eclipse 80i) microscope and a digital camera Nikon (DS-
5M).
Taxonomy
Taxonomy of the Thyridiaceae
Yue & Eriksson (1987) established the family Thyridiaceae for Sinosphaeria
and Thyridium. Sinosphaeria bambusicola, found on bamboo in China, is
characterized by yellowish stromata with immersed ascomata that react with
KOH to produce a reddish color and by the presence of irregularly brown
dictyospores with thick darkened septa. Thyridium differs in producing KOH
negative stromata in which the immersed ascomata have convergent ostioles
and uniformly brown dictyospores.
Eriksson & Yue (1989) recognized Thyridium with Bivonella and Sinosphaeria
as synonyms. They compared T’ chrysomallum (= Bivonella chrysomalla,
= Sinosphaeria bambusicola) with T. flavum (Petch 1917), which has a yellow
subcortical, KOH negative stroma, ostioles not uniformly convergent, and dark
brown dictyospores. This resulted in a broadly defined genus that accommodated
varying stromatal structures and ascospore characters.
Samuels & Rogerson (1989) described Sinosphaeria lasiacidis on Lasiacis
ligulata Hitchc. & Chase (Poaceae) from French Guiana. They stated that
their species differed from S. bambusicola mainly by the smaller ascospores
[(9-)9.8-11.6(-12.6) x (4.5-)5-5.8(-6.3) um versus (12.5-)14-16.5(-17.5) x
(6-)6.5-7.5 um for S. bambusicola (= T. chrysomalla)].
Re-classification in the Thyridiaceae ... 151
Barr (1990) did not consider Bivonella to be a synonym of Thyridium because
the type species of Bivonella (= Sinosphaeria) has periphysoids, which she could
not find in T! vestitum. She accepted Thyridiaceae for these two genera and
added Valsaria Ces. & De Not. and Valsonectria Speg., both with uniseptate
ascospores. Valsaria currently falls within the Diaporthales and Valsonectria in
the Hypocreales (Kirk et al. 2008).
Rossman et al. (1999) separated Balzania, Mattirolia and Thyronectroidea
from the Hypocreales based on the paraphyses and included them in the
Thyridiaceae. They also transferred Calyptronectria ohiensis to Thyridium as
T. ohiense.
Genera included in Thyridiaceae
After studying numerous type specimens we accept the Thyridiaceae with
two genera, Mattirolia (with five species) and Thyridium (with four species).
A key to these genera and species is provided below.
Mattirolia Berl. & Bres., Annuario Soc. Alpin. Trident. 14: 351 (1889)
TYPE SPECIES: Mattirolia roseovirens Berl. & Bres.
= Thyronectroidea Seaver, Mycologia 1: 206 (1909)
TYPE SPECIES: Thyronectroidea chrysogramma (Ellis & Everh.) Seaver
[= Mattirolia chrysogramma].
= Balzania Speg., Anales Mus. Nac. Buenos Aires 6: 286 (1898)
TyPE SPECIES: Balzania platensis Speg. [= Mattirolia platensis].
STROMA variable, usually present, erumpent, covered with loosely interwoven
yellowish or brownish hyphae, KOH negative. PERITHECIA globose, semi-
immersed or isolated in the stroma. PARAPHYSES abundant. AscI unitunicate,
cylindrical or clavate, non amyloid. Ascospores smooth, muriform, hyaline to
greenish yellow when mature.
Mattirolia roseovirens Berl. & Bres., Annuario Soc. Alpin. Trident. 14: 351
(1889) FIGs. 1-11
Type: ITALY. Trento, Muralta, on branches of Cytisus laburnum, 14 April 1888, leg. G.
Bresadola (type F115389 in S); FH 258826 (Patouillard sheet number 6749, probably an
isotype).
STROMA subcortical, pulvinate, 0.5-6 mm diam. PERITHECIA aggregated,
immersed in the stroma or more rarely isolated, globose, 400-450 um diam.,
black, surrounded by a yellowish tomentum, 30-50 um thick, formed by
hyphae 4-5 um diam. PERIDIUM pseudoparenchymatous, orange, composed
of isodiametric cells, 5-15 um diam. PARAPHYSES 5 um diam, regularly septate,
sometimes with free ends. Ascr unitunicate, cylindric, 100-120 x 12-15
um, with 8 uniseriate ascospores. ASCOSPORES greenish-brown, ellipsoid to
oblong, 18-21 x 9-11 um, with 3-5(-7) non-constricted, transverse septa and
152 ... Checa, Blanco & Moreno
Fics. 1-11. Mattirolia roseovirens (AH 39966): 1. Surface of stroma and perithecium. 2. Peridial
cells and hyphae of the tomentum. 3. Asci and ascospores. 4. Paraphyses. 5. Ascospores.
M. roseovirens (FH 258826): 6-7. Stromata. 8-9. Ascospores. M. roseovirens (S 115389 type):
10. Stroma. 11. Ascus with ascospores. Scale bars: 1 = 0.5 mm; 2, 4, 5, 8, 9, 11 = 10 um; 3 = 50 um;
6, 7,10 =1 mm.
Re-classification in the Thyridiaceae ... 153
1 longitudinal septum that includes the end cells, smooth and surrounded by a
gelatinous sheath sometimes located only around ends.
ADDITIONAL SPECIMENS EXAMINED, ITALY. VENETO, Patavii, 1889, leg. P.A. Saccardo,
det. Berlese (BPI 553005 ex Herb. Saccardo [labelled as ex type, but specimen data do not
correspond to type]); TRENTINO, Trento, in ramis corticalis Cytisi laburni, II-1890 (S ex
Herb. Bresadola F115390, ex Herb. Mycolog. Lars Romell. F115391, F115392). SPAIN.
GUADALAJARA, Tamajon, Enebrales’s hermitage, on branches of Genista scorpius, 18-
V-1996, leg. H.O. Baral (AH 39966); 25-IV-2008, leg. J. Checa & M.N. Blanco (AH
39959, AH 39960, AH 39961, AH 39962, AH 39963); 22-V-2008 (AH 39233, AH 39964,
AH 39965, AH 39967).
REMARKS— ‘This species is known from two related hosts in the Fabaceae,
Cytisus laburnum and Genista scorpius.
Mattirolia chrysogramma (Ellis & Everh.) Sacc., Syll. Fung. 9: 993 (1891)
Fics 12-16
= Thyronectria chrysogramma Ellis & Everh., Proc. Acad.
Nat. Sci. Philadelphia 42: 245 (1890)
= Thyronectroidea chrysogramma (Ellis & Everh.) Seaver, Mycologia 1: 206 (1909)
= Nectria chrysogramma (Ellis & Everh.) Rossman, Mem.
New York Bot. Gard. 49: 259 (1989)
SPECIMENS EXAMINED, USA, Kansas, Manhattan, on bark of Ulmus americana, March
1889, Kellerman & Swingle 1421 (NY 00927545, holotype); NEw York, Potsdam, on
elm limbs, Ellis 286 (NY 00927565, paratype).
REMARKS— This is the type species of Thyronectroidea. The holotype specimen
is depauperate, but the paratype includes numerous mature ascomata (Rossman
et al. 1999). The appearance of this species is similar to Mattirolia
roseovirens, and the ascospores have a greenish color. We recognize this species
as M. chrysogramma and consider Thyronectroidea a synonym of Mattirolia, as
suggested by Rossman et al. (1999).
Mattirolia mutabilis (Sacc.) Checa, M.N. Blanco & G. Moreno, comb. nov.
MycoBank MB 805470 FIGS 17-25
= Pleosphaeria mutabilis Sacc., Syll. Fung. 2: 306 (1883)
= Strickeria mutabilis (Sacc.) G. Winter, Rabenh. Krypt.-FL, ed. 2, 1(2): 288 (1885)
MISAPPLIED NAME: “Lasiella mutabilis” sensu Quélet, Mém.
Soc. Emul. Montbéliard, 2e série, 5: 517 (1875)
INVALID NAME: “Teichospora cfr. mutabilis” Munk, Dansk Bot. Ark. 17(1): 394 (1957)
Type: FRANCE. Jura, La Bouloie, Saule marceau (Salix), leg. Lucien Quélet 406223
(Lectotype designated here, UPS F-126406, as Sphaeria mutabilis).
STROMA sometimes present. PERITHECIA subglobose to globose, 400-700 um
diam., superficial, scattered or aggregated, covered with a yellowish or yellow-
brownish tomentum. Ascr 80-90 x 10-15 um, unitunicate, cylindrical-clavate,
with 8 uniseriate ascospores or biseriate toward apex. PARAPHYSES 3-5 um diam,
154 ... Checa, Blanco & Moreno
co
~— «se
oe 4
, y : ‘;
‘ a:
Fe a
me. o"% 3
- "
Ko ae 4
% t
x
ae
7 ” 74 a
eet a
DN aie ‘
<) i.
y
Socal. I
To
,
Fics. 12-25. Mattirolia chrysogramma (Ellis 286, NY 00927565 paratype): 12. Stromata. 13. Detail
of stroma. 14. Ascospores. 15-16. Detail of ascospores. M. mutabilis (UPS 406223 (F-126406)
lectotype): 17-18. Perithecia. 19. Peridial cells. 20-22. Asci with ascospores. 23-24. Detail of
ascospores. M. mutabilis: 25. Quélet’s original drawing. Scale bars: 12, 17 = 1 mm; 13, 18 = 0.5 mm;
14-16, 19-24 = 10 um.
Re-classification in the Thyridiaceae ... 155
abundant, hyaline, filiform, septate, cylindrical, with obtuse apex. ASCOSPORES
19-22 x 8-12 um, ellipsoid with rounded ends, muriform, 5-7 transverse septa
and 1-2 longitudinal, pale septa, hyaline to pale yellow-greenish.
REMARKS— Mattirolia mutabilis is characterized by unitunicate asci and hyaline
to yellow-greenish muriform ascospores as well as isolated or grouped perithecia
without a typical stroma; the perithecia are covered by a yellowish tomentum
unlike in Pseudotrichia mutabilis (TABLE 1). Quélet (1875) recombined
Sphaeria mutabilis as Lasiella mutabilis, but his interpretation and specimen
do not match the original sense of Persoon’s S. mutabilis, and this has caused
later authors to misinterpret this name. Some authors have misinterpreted
Queélet’s publication of Lasiella mutabilis as creating a valid sp. nov. based on
his description. However, this view is a nomenclatural error, because Queélet
explicitly published Lasiella mutabilis as a valid and legitimate comb. nov. based
on Persoon’s Sphaeria mutabilis; he was therefore taxonomically misapplying
this name when he attached it to his description of a different new species.
Quélet’s species acquired a valid name only when Saccardo (1883) renamed
it as Pleosphaeria mutabilis, which is the correct basionym for all subsequent
combinations. Pleosphaeria mutabilis is placed in the genus Mattirolia rather
than Lasiella, now considered to be a synonym of Lasiosphaeria Ces. & De Not.,
because the ascospores of the latter are subcylindrical to sigmoid and have
only transverse septa (Hilber & Hilber 1983; Miller & Huhndorf 2004; Munk
1957).
Mattirolia ohiensis (Ellis & Everh.) Checa, M.N. Blanco & G. Moreno, comb. nov.
MycoBank MB 805467 Fics 26-28
= Teichospora ohiensis Ellis & Everh., Proc. Acad. Nat. Sci. Philadelphia 46: 329 (1894)
= Strickeria ohiensis (Ellis & Everh.) Kuntze, Rev. Gen. Pl.
3(3): 534 (1898), as “Strickera ohioensis”
= Calyptronectria ohiensis (Ellis & Everh.) M.E. Barr, Mycotaxon 18: 155 (1983)
= Thyridium ohiense (Ellis & Everh.) Rossman & Samuels, Stud. Mycol. 42: 176 (1999)
Type, USA. Ohio, Preston, on hard dry wood, leg. A.P. Morgan 1012 (Lectotype
designated here, NY Ellis collection, 00927519; isolectotype, NY 00927520).
REMARKS— Barr (1983) placed this species in Calyptronectria and suggested
that it could be related to Thyronectria but lacked a stroma. Calyptronectria
is now placed in the Melanommataceae (Kirk et al. 2008). Based on our
examination of the type specimen, this species belongs in Mattirolia.
Mattirolia platensis (Speg.) Checa, M.N. Blanco & G. Moreno, comb. nov.
MycoBank MB 805468 FIGS 29-32
= Balzania platensis Speg., Anales Mus. Nac. Buenos Aires 6: 286 (1898)
= Mattirolia nivea Speg., Anales Mus. Nac. Buenos Aires 6: 292 (1899)
= Leucocrea nivea (Speg.) Sacc. & P. Syd., Natiirl. Pflanzenfam. 1(1**): 540 (1900)
156 ... Checa, Blanco & Moreno
Fics. 26-32. Mattirolia ohiensis (NY 927519, type): 26. Perithecia. 27-28. Detail of ascospores.
M. platensis (LPS 1645, holotype): 29. Stromata. 30. Detail of stroma. 30. Ascospores. 31-32. Asci
and ascospores. Scale bars: 26 = 0.5 mm; 27, 28 = 10 um; 29 = 5 mm; 30 = 1 mm: 31, 32 = 20 um.
SPECIMEN EXAMINED, ARGENTINA. La Plata, on bark of dead trunks of Ailanthus
glandulosa, Aug 1891, C. Spegazzini (LPS 1645, holotype).
REMARKS—Although this specimen is in poor condition, we were able to observe
it macro- and microscopically. The asci are unitunicate and the ascospores are
muriform, hyaline to yellowish; thus we include it in Mattirolia.
The holotype specimen of Mattirolia nivea (LPS-1704) was examined and
considered a synonym of B. platensis by Rossman et al. (1999).
Thyridium Nitschke, Pyrenomycetes Germanici 1: 110 (1867)
TYPE SPECIES: Thyridium vestitum (Fr.) Fuckel
= Bivonella (Sacc.) Sacc., Syll. Fung. 9: 989 (1891)
TYPE SPECIES: Bivonella lycopersici (Pass.) Sacc.
= Sinosphaeria J.Z. Yue & O.E. Erikss., Syst. Ascom. 6: 231 (1987)
TYPE SPECIES: Sinosphaeria bambusicola J.Z. Yue & O.E. Erikss.
STROMATA present, immersed or erumpent, formed by interwoven yellowish,
brownish or black hyphae and cells of the substrate, KOH positive (fuchsia) or
KOH negative. PERITHECIA globose with short or long necks with convergent or
separate ostioles, immersed. Asci cylindrical, inamyloid. AscosporEs muriform,
very pale brown to dark brown, or with thickened and pigmented septa.
Re-classification in the Thyridiaceae ... 157
REMARKS— Eriksson & Yue (1989) emended Thyridium to incorporate
Bivonella and Sinosphaeria as synonyms.
Thyridium vestitum (Fr.) Fuckel, Jb. nassau. Ver. Naturk. 23-24: 195 (1870)
Fics 33-35
= Fenestella ulmicola Ellis & Everh., Proc. Acad. Nat. Sci. Philadelphia 45: 143 (1893)
SPECIMENS EXAMINED, AUSTRIA, BOHEMIA, on Sambucus racemosa, 1873 (de Thimen
859, NY). CANADA, ONTARIO, London, on dead limbs of Ulmus americana, VIII-1892
(Holotype of Fenestella ulmicola-NY 00928688); on Ribes lacustre, 30-I-1894 (NY).
GERMANY, on Ribes rubrum, VIII-1882, (NY); Saxony, Konigstein, on Sambucus
racemosa, X1-1882, leg. W. Krieger (de Thiimen, 2254, NY); BERLIN, on Frangula alnus,
V-1887, leg. Sydow 2249, Mycotheca Marchica n. 1362 (NY); RHINELAND-PALATINATE,
Oestrich (Nassau), on Betula alba and Robinia pseudoacacia, 1894, leg Fuckel (Herbier
Barbey-Boissier, NY). HUNGARY, on Colutea arborescens, V1-1875, leg. Lojka (NY).
ITALIA, VENETO, TREVISO, Vitorio, on Ribes grossularia, IX-1897, (D. Saccardo 107,
NY). POLAND, MazowlEckIE, Warszawa-Goclawek, on Elaeagnus angustifolia, 25-IX-
1960, leg. J. Kochman (J. Kochman Mycotheca Polonica in NY). U.S.A. Iowa, on Carya
sp. (NY); MassacuusettTs, Baptist Hill, Conway, on old branch of Berberis sp., 23-
XII-1979, coll. and det. M.E. Barr, 6652 (Herbarium of the University of Massachusetts
in NY); on young dead branches of Forsythia sp., 15-IV-1961, coll. & det. M.E. Barr,
2872 (Herbarium of the University of Massachusetts in NY); Sunderland, on branches of
Betula sp., 25-VIUI-1963, coll. and det. M.E. Barr 4126 (NY). Missouri, on dead sprouts
of Platanus occidentalis, 27-X-1897, leg. C.N. Demetrio (NY).
REMARKS— Macroscopically this species is variable and occurs frequently on
diverse substrates. A complete description with illustrations of macro- and
microscopic characteristics appears in Barr (1983).
Thyridium chrysomallum (Berk. & Broome) O.E. Erikss. & J.Z. Yue,
Syst. Ascom. 8: 12 (1989) Fics 36-37
= Melanospora chrysomalla Berk. & Broome, J. Linn. Soc. Bot. 14: 130 (1873)
= Bivonella chrysomalla (Berk. & Broome) Sacc., Syll.
Fung. 9: 990 (1891), as “chrysomella”
= Sinosphaeria bambusicola J.Z. Yue & O.E. Erikss. Syst. Ascom. 6: 231 (1987)
SPECIMENS EXAMINED, NEW ZEALAND, Bay OF PLENTY, Te Puke, D.S.I.R. Research
Orchard, on canes of Actinidia deliciosa, 15-VII-1981, coll. G.J. Samuels (81-209) & S.R.
Pennycook, det. M.E. Barr [as Thyridium vestitum on Actinidia chinensis] (Herbarium
of the University of Massachusetts in NY). SRI LANKA, Peradeniya, on palm stems,
November 1868, coll. G-H.K. Thwaites 1071 (K(M) 36218, ex herb. M.J. Berkeley,
holotype of Melanospora chrysomalla). VENEZUELA, ARAGUA, on Colonia Tovar-La
Victoria road, ca 7 km from Colonia Tovar, on unidentified bamboo, 14-VII-1971, leg.
K.P. Dumont, J.H. Haines & G.J. Samuels (NY, Dumont-VE 2192).
REMARKS— Macroscopically this species is similar to Mattirolia roseovirens
and also has ascospores with very thick septa but their color is pale brown and
not greenish. The stroma reacts positively with KOH taking on a fuchsia color.
158 ... Checa, Blanco & Moreno
Fics. 33-41. Thyridium vestitum: 33. Stroma (Thiimen, 2249 in NY). 34-35. Asci and ascospores
(M.E. Barr 2872 in NY). T. chrysomallum (NY, Dumont-VE 2192): 36. Stroma. 37. Ascospores.
T. flavum (isotype K(M) 160957): 38-39. Stromata. 40-41. Asci and ascospores. Scale bars: 33 = 1
mm; 34, 35, 37, 40, 41 = 10 um; 36, 38, 39 = 0.5 mm.
Re-classification in the Thyridiaceae ... 159
The sequences of Thyridium chrysomallum (as Sinosphaeria bambusicola)
in Genbank have been shown to be erroneous and have been removed (Miller,
pers. comm.), thus the taxonomic position of this species is not known.
Thyridium flavum Petch, Ann. Roy. Bot. Gard. Peradeniya 6(3): 226 (1917)
Fics. 38-41
SPECIMEN EXAMINED, SRI LANKA, Peradeniya, on twigs of Hevea brasiliensis, February
1917, coll. Petch 4968 (isotype, K(M) 160957).
REMARKS— ‘The KOH- perithecia in the isotype specimen are blackish
(lacking a yellowish color), short-necked, and grouped in rows under the bark
of a Hevea brasiliensis branch. Under the microscope we observed cylindrical,
unitunicate asci and dark brown ellipsoid ascospores, 16-20 x 8-10 um,
with 3(-5) transverse septa and 1 longitudinal septum, which correspond to
the description by Petch (1917). We also observed many ascospores on the
bark of the substrate giving the false appearance of conidia or formation of
proliferate asci, a feature not noted by the author nor found in other species of
Thyridiaceae.
Thyridium lasiacidis (Samuels & Rogerson) Checa, M.N. Blanco &
G. Moreno, comb. nov. Figs 42-45
MycoBANK MB 805474
= Sinosphaeria lasiacidis Samuels & Rogerson, Stud. Mycol. 31: 147 (1989)
SPECIMENS EXAMINED, FRENCH GUIANA, Saiil, 200 m, on dead culms of Lasiacis
ligulata, 3-11-1986, leg. GJ. Samuels 3784A (Holotype, NY); I-1986, leg. G.J. Samuels
3773 (UME 33336).
STROMA present, KOH positive. Asci clavate to broadly cylindrical. AscosPoREs
very pale brown with 3 transverse septa and 1 longitudinal septum in median
cells that are not conspicuously darkened.
REMARKS— Because Sinosphaeria is considered a synonym of Thyridium, this
species is transferred to Thyridium. It is similar to T: chrysomallum but has
smaller spores (10-12 x 5-6 um).
Key to species of Thyridiaceae
1. Stroma usually present, erumpent, with a loosely interwoven yellowish or brownish
tomentum, KOH negative; perithecia globose without convergent ostioles;
ascospores muriform, hyaline to greenish yellow when mature (Mattirolia) ....2
1. Stroma always present, immersed or erumpent, with interwoven yellowish,
brownish or black tomentum and cells of the substrate, KOH negative or
positive; perithecia globose with short or long necks, sometimes convergent
ostioles; ascospores muriform, very pale brown to dark brown, or with wall
thickened and pigmented only at the septa (Thyridium) ..................04. 6
160 ... Checa, Blanco & Moreno
Fics. 42-51 Thyridium lasiacidis (NSF BSR 8500236 holotype in NY): 42. Detail of the stroma.
43. Perithecium. 44. Asci and ascospores. 45. Detail of ascospores. Pseudotrichia mutabilis:
46. Persoon’s original drawing of Sphaeria mutabilis (tab. 7, fig. 6a, 6d, 6e). P. mutabilis
(B 700014106): 47-48. Pseudothecia. 49. Ascus. 50-51. Detail of asci and ascospores. Scale bars:
42, 43 = 50 um; 44, 45, 49-51 = 10 um; 47 = 1 mm; 48 = 0.5 mm.
2. Perithecia solitary, surrounded with brownish tomentum; ascospores 3-4
transverse septa and | irregularly longitudinal septum ............. M. ohiensis
2. Perithecia semi-immersed in a stroma or solitary, with yellowish tomentum....... 3
3,.Ascospores with 3'transverse. septa «2... ai. Siw sees wee: eh eo M. platensis
3, ASCOSPOLeswil hea transverse septa. pee ee peel Wr cle wR ew 4
4. Ascospores with 3-5(-7) transverse septa..............-e eee ee eee M. roseovirens
4, AScOSpores. with mMOrethaird LrAnsversersep td ..cecul taunt. sage gas ell wear) y buer ga Pe)
5 Ascosporeswith 5-7 transverse Sepia, errs... Ps os eG er M. mutabilis
5. Ascospores with 7-9(-11) transverse septa.................0.. M. chrysogramma
Re-classification in the Thyridiaceae ... 161
6. Stroma variable in size and sometimes in valsoid configuration, KOH negative;
ASCOSPOTE!S AITITEOLIMLY EO WIN wan ei Gres oA cm Mie dy 5 Wa rs Ua sap all Nn ioral ey al 7
6. Stroma not in valsoid configuration KOH positive; ascospores with 3 transverse
septa and | longitudinal septum, thickened, not uniformly brown ............ 8
7. Ascospores with 3-5(-8) transverse septa......... 0... cece cece ee ee eee T. vestitum
7. Ascospores with fewer [3(-5)] transverse septa........... 2... cece ee eee T. flavum
Bi Ascospores LOS E2 5 SG) (005 es shog drt chen dein g hea tegen de pcbee draceea dig eid T. lasiacidis
8. Ascospores (12.5—)14-16.5(-17.5) x (6-)6.5-7.5 UM .........000. T. chrysomallum
Nomenclatural problem with Sphaeria mutabilis
In his description and illustration of Sphaeria mutabilis, Persoon (1798,
1801) provided few microscopic characters. His drawings, which are too small
to illustrate detailed morphology, do not include ascospores. In addition, he
did not provide ascospore measurements or identify the substrate. Fries (1823),
who studied Persoon’s specimen, observed that the specimens grew “ad ligna
durisima quercina, ad terram prostata’. Later, Barr (1990) studied Fries’ material
and gave a macro- and microscopic description of this species (see TABLE 1).
Our observations of Fries’ material agree with those of Barr (1990). This species
is now regarded as Pseudotrichia mutabilis in the Pleosporales.
Quélet (1875) transferred Sphaeria mutabilis to Lasiella, but misapplied
this name to a specimen growing on woody debris of willows and oak (now
recognized as Mattirolia mutabilis). The distinction between Persoon’s and
Queélet’s taxa was quickly recognised by Saccardo (1883: Lasiosphaeria mutabilis
[p. 196] versus Pleosphaeria mutabilis |p. 306]) and by Winter (1884-87:
Herpotrichia mutabilis [p. 209] versus Strickeria mutabilis [p. 288]).
Pseudotrichia mutabilis (Pers.) Wehm., Fungi of Maritime Provinces: 35 (1950)
Fics 46-51
= Sphaeria mutabilis Pers., Icon. descr. Fung. 1: 24 (1798)
= Lasiosphaeria mutabilis (Pers.) Fuckel, Jahrb. Nassauischen
Vereins Naturk. 25-26: 302 (1871)
= Lasiella mutabilis (Pers.) Quél. [non sensu Quélet], Mém.
Soc. Emul. Montbéliard, 2e série, 5: 517 (1875)
= Herpotrichia mutabilis (Pers.) G. Winter, Rabenh. Krypt.-Fl., Ed. 2, 1(2): 209 (1885)
= Enchnosphaeria mutabilis (Pers.) Hohn., Sitzungsber. K. Akad.
Wiss., Math.-Naturwiss. K1., Abt. 1, 126: 346 (1917)
= Khekia mutabilis (Pers.) Petr., Ann. Mycol. 38: 203 (1940)
SPECIMENS EXAMINED, GERMANY: LOTHRINGEN, [now = FRANCE: LORRAINE,
MosELLE], Forbach, Schénecker wald, 26-IX-1913, leg. Dr. A. Ludwig, (B 700014106
as Herpotrichia mutabilis). SWEDEN: SMALAND, Femsjo, Herb. E. Fries (UPS F-07198,
133504); GASTRIKLAND, Gavle, Lovudden, on the bank of the R. Gavlean, Alnus (2),
ramus dejectus, 7-I-1973, leg. J. Ax. Nannfeldt n° 22906 (UPS F-126407, 406224 as
162 ... Checa, Blanco & Moreno
Herpotrichia mutabilis); in ramis dejectis, 17-VII-1950, leg. J. Ax. Nannfeldt n° 11084,
(UPS F-126408, 406225 as Lasiosphaeria, rev. G. Carroll 1963 as “Lophiostoma mutabilis”.
USA: ALABAMA, Cort. Cerasi Caroliniani, Jeg. Beaumont ex. Herb. M.A. Curtis (UPS
F-04319, 57500, Herb. E. Fries).
REMARKS— Although Persoon (1798) did not describe the hamathecium, asci,
and ascospores verbally in his protologue, he did include them in his drawing.
We provide a description of those features in TABLE 1.
TABLE 1. A morphological comparison of Pseudotrichia mutabilis
and Mattirolia mutabilis.
iP. MUTABILIS* i M. murasizis**
UPS (F-01798) 133504 : UPS (F-126406) 406223
Scattered or aggregated; Scattered or aggregated;
eaves : (Stroma not observed); : (Stroma not observed);
Tomentum brown-yellowish; : Tomentum yellow to yellow-greenish;
Ostiole papillate : Ostiole subpapillate and blackish
Bitunicate, i Unitunicate,
ASCI : clavate, i Cylindrical-clavate,
: (90-)120-155 x 12-20 um : 80-90 x 10-15 pm.
HAMATHECIUM Trabecular pseudoparaphyses Paraphyses
! 26-39 x (6-)7-9 um, ellipsoid-fusiform 19-22 x 8-12 um, ellipsoid
Tou cisabanits 1-3 tranverse septa ; 5-7 transverse septa
0 longitudinal septa : 1-2 longitudinal septa
Hyaline to light brown. i Hyaline to lightly yellow-greenish
* Description from Barr (1990) based on material collected by Fries from Sweden.
** Data from this paper.
Barr (1984) provided a comprehensive description and illustration of
Pseudotrichia mutabilis, although she did not study the type specimen.
Conclusions
After examining the type species of Balzania, Mattirolia, Thyridium, and
Thyronectroidea, we accept only Mattirolia (with Balzania and Thyronectroidea
in synonymy) and Thyridium within the Thyridiaceae. We can define Mattirolia
by a stroma that is generally present, KOH negative, cylindrical to clavate asci,
and muriform ascospores that become yellow-green when mature. Thyridium is
characterized by the presence of stromata, KOH variable, cylindrical or clavate
asci, and very pale brown to dark brown muriform ascospores that lack green
tones.
Based on our examination of the type specimens, Thyridium ohiense does
not belong in Thyridium due to the absence of stroma and the presence of
hyaline or yellowish spores. Its macro- and microscopic characteristics place it
instead in Mattirolia.
Re-classification in the Thyridiaceae ... 163
Balzania, a monotypic genus described more than 100 years ago by Spegazzini
(1898) for Balzania platensis, which has been collected only once, must be
included within Mattirolia, as Rossman et al. (1999) suggested. Thyronectroidea
is also a monotypic genus, which we consider synonymous with Mattirolia.
The type species, T’ chrysogramma, appears macroscopically similar to
M. roseovirens, and the ascospores are hyaline to faintly greenish when mature.
As these two species are congeneric, we use the name M. chrysogramma.
Because of Quélet’s (1875) misapplication of the name, Lasiella mutabilis has
been misinterpreted by different authors. The earliest valid name for Quélet’s
species was Pleosphaeria mutabilis, here recombined as Mattirolia mutabilis in
the Thyridiaceae; Pseudotrichia mutabilis, based on Persoon’s Sphaeria mutabilis,
belongs in the order Pleosporales.
Acknowledgments
We wish to express our gratitude to Luis Monje and Angel Pueblas of the Department
of Drawing and Scientific Photography at the Alcala University for their help in the
digital preparation of the photographs. And we are grateful to Javier Rejos, curator of
the AH herbarium, for his assistance with the specimens examined in the present study.
And especially we are grateful to the curators of the herbaria B, BPI, FH, K, LPS, NY, S,
and UME for sending us various materials for this study. We are very thankful to Shaun
Pennycook and Scott Redhead for their help in resolving nomenclatural and taxonomic
problems that have arisen. We express our gratitude to Amy Rossman and Larissa
Vasilyeva for reviewing the manuscript and adding a number of useful comments.
Finally we would like to thank David Mitchell and Laura Yebes for their help in the
translation and facilitating the comprehension of the text.
Literature cited
Barr ME. 1983. Muriform ascospores in class Ascomycetes. Mycotaxon 18: 149-157.
Barr ME. 1984. Herpotrichia and its segregates. Mycotaxon 20: 1-38.
Barr ME. 1990. Prodromus to nonlichenized, pyrenomycetous members of class Hymeno-
ascomycetes. Mycotaxon 39: 43-184.
Eriksson OE, Hawksworth DL. 1991. Notes on ascomycete systematics. Nos. 1128-1251. Systema
Ascomycetum 10: 27-67.
Eriksson OE, Yue JZ. 1989. An amended description and disposition of the genus Thyridium.
Systema Ascomycetum 8: 9-16.
Fries EM 1823. Systema Mycologicum 2(2). Lund. pp. 275-620.
Hilber O, Hilber R. 1983. Neue und seltene Arten der Gattung Lasiosphaeria. Ces. & de Not.
Sydowia 36: 105-117.
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s Dictionary of the Fungi.
10th edition. CABI Europe. UK.771 pp.
Lumbsch HT, Huhndorf SN. 2010. Myconet 14. Part One. Outline of Ascomycota - 2009. Part Two.
Note on ascomycete systematics. Nos. 4751-5113. Fieldiana: Life and Earth Sciences 1. 64 p.
Miller AN, Huhndorf S. 2004. A natural classification of Lasiosphaeria based on nuclear LSU rDNA
sequences. Mycol. Res. 108(1): 26-34. http://dx.doi.org/10.1017/S0953756203008864
164 ... Checa, Blanco & Moreno
Miller AN, Huhndorf S. 2005. Multi-gene phylogenies indicate ascomal wall morphology is a
better predictor of phylogenetic relationships then ascospore morphology in the Sordariales
(Ascomycota, Fungi). Molecular Phylogenetics and Evolution 35: 60-75.
Munk A. 1957. Danish pyrenomycetes: a preliminary flora. Dansk Bot. Ark. 17(1). 491 p.
Persoon CH. 1798. Icones et descriptiones fungorum minus cognitorum 1: 1-26. Leipzig; Breitkopf-
Haertel.
Persoon CH. 1801. Synopsis methodica fungorum. Germany, Gottingen; Henricus Dieterich.
Petch T. 1917. Additions to Ceylon fungi. Ann. Roy. Bot. Gard. Peradeniya 6: 195-256.
Quélet L. 1875. Les champignons de Jura et des Vosges. Mém. Soc. Emul. Montbéliard. 2? serie,
5: 429-556.
Rossman AY, Samuels GJ, Rogerson, C, Lowen R. 1999. Genera of Bionectriaceae, Hypocreaceae
and Nectriaceae (Hypocreales, Ascomycetes). Stud. Mycol. 42: 1-248.
Saccardo PA. 1883. Sylloge pyrenomycetum, vol. II. Sylloge Fungorum 2. Padova. 815 p.
Samuels GJ, Rogerson CT. 1989. Endocreas lasiacidis and Sinosphaeria lasiacidis, new tropical
Ascomycetes. Stud. Mycol. 31: 145-149.
Spegazzini C. 1898. Fungi Argentini novi vel critici. Anales Mus. Nac. Buenos Aires 6: 81-288.
Tang AMC, Jeewon R, Hyde KD. 2009. A re-evaluation of the evolutionary relationships within
the Xylariaceae based on ribosomal and protein-coding gene sequences. Fungal Diversity 34:
127-155.
Winter G. 1884-87 [“1887”]. Ascomyceten: Gymnnoasceen und Pyrenomyceten. Rabenh. Krypt.-
EL, Ed. 2, 1(2). 928 p.
Yue JZ, Eriksson OE. 1987. Sinosphaeria bambusicola gen. et sp. nov., (Thyridiaceae fam. nov.). Syst.
Ascomycetum 6: 229-236.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.165
Volume 125, pp. 165-167 July-September 2013
Phyllosticta ephedricola sp. nov. on Ephedra intermedia
YAN WANG’, LING JIN’*, XIU-RONG CHEN’, LI LIN’ & HONG-GANG CHEN"
‘Gansu College of Traditional Chinese Medicine, Lanzhou 730000, China
? College of Pratacultural Science, Gansu Agricultural University, Key Laboratory of
Grassland Ecosystem (Gansu Agricultural University), Ministry of Education
Sino-U.S. Center for Grazingland Ecosystem Sustainability, Lanzhou 730070, China
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — ‘The new anamorphic species Phyllosticta ephedricola on Ephedra intermedia in
China is described, illustrated, and differentiated from P ephedrae.
KEY worps — coelomycete, pathogen, taxonomy
Introduction
A species of Phyllosticta on necrotic stem spots of Ephedra intermedia was
collected in 2011 from Hami, Xinjiang Province, China. Severe infections
caused by this pathogenic fungus usually result in death of ground parts of
the plants. Two characteristics, the shape of the conidiogenous cells and the
cylindrical to clavate apically appendaged conidia, indicate that the fungus is a
species of Phyllosticta. As no authentic Phyllosticta species has previously been
described from Ephedra (Aa & Vanev 2002), we propose it as a new species.
Materials & methods
The fungal specimens were cut by hand using a razor blade to make thin sections of
conidiomata for microscope observation. They were examined under a light microscope
after they were mounted in water and lactophenol cotton blue on slides. Measurements
for the new species were determined using the means of 50 spores and at least 20
pycnidia. The examined specimens were deposited in Lanzhou University Herbarium
(LZU), Lanzhou, Gansu Province, China.
Taxonomy
Phyllosticta ephedricola L. Jin & Yan Wang, sp. nov. PLATE 1
MycoBank MB 803189
Differs from all other Phyllosticta species by its ephedraceous host.
Type: China, Xinjiang Province, Hami city, on stems of Ephedra intermedia Schrenk &
C.A. Mey. (Ephedraceae), 22 July 2011, L. Jin (Holotype, LZU 11001214).
166 ... Wang & al.
PiaTE 1. Phyllosticta ephedricola (holotype). A: Dark-brown stromata on stem of Ephedra
intermedia. B: Ostioles. C: Section through a stroma showing an immersed eustromatic conidioma
with inner surface covered by a layer of conidiogenous cells bearing conidia. D: Conidiogenous
cell bearing an appendage-bearing conidium. E-F: Typical appendage-bearing guttulate conidia.
Scale bars: A = 1 mm; B-C = 100 um; D-F = 25 um.
EryMo_oey: Epithet refers to the host genus.
Occurring on stems. Mycelium immersed in the host tissue, septate, branched,
hyaline to pale brown. Pycnidia immersed, or semi-immersed, separate or
aggregated, globose to subglobose, 227.6 x 231.0 um diam., brown to dark
brown. Ostioles single, central, circular, 31.3 x 35.3 um diam., with darker and
thicker walls around the pore. Wall 20-32 um diam., composed of 3-4 layers
of small, rounded or irregular, pale brown to dark brown thick-walled cells
and an inner textura prismatica with thin-walled paler cells. Conidiogenous
cells hyaline, cylindrical, discrete, determinate, smooth, forming one apical
conidium, 8.8 x 2.5 um diam., originated from the internal layer of conidiomatal
wall, sometimes hardly differentiated from the flat inner wall-cells. Conidia
one-celled, ellipsoidal or obovoidal, seldom cylindrical, sometimes pyriform
with a truncate base, broadly rounded apically and inconspicuously indented,
9.4-15.8 x 5.4-12.8 um, surrounded by a slime layer, containing one large,
bright guttule, 9.1-14.5 x 7.2-11.5 um, almost fill the whole conidium.
Apical appendage 12.5-34.4 x 1.9-3.3 um, hyaline, single, subulate or filiform
gelatinous, filiform, cellular, with subacute apex. The spermatial synanamorph
and the Guignardia teleomorph have not been observed.
Discussion
The genus Phyllosticta Pers. (with type P. convallariae Pers.; Donk 1964)
was introduced by Persoon in 1818. The modern generic circumscription
is restricted to species with large unicellular guttulate conidia with a slime
Phyllosticta ephedricola sp. nov. (China) ... 167
layer and apical extracellular appendage and teleomorphs (where known) in
Guignardia Viala & Ravaz (Aa 1973; Nag Raj 1993; Aa & Vanev 2002). Aa &
Vanev (2002) accepted 141 species in Phyllosticta sensu stricto, while Kirk et al.
(2008) estimated that there were only 92 species; recently another nine species
have been described (Motohashi et al. 2008; Wikee et al. 2011).
Only one other Phyllosticta species has been described from Ephedra:
P. ephedrae Trotter on E. altissima Desf. (Trotter 1916: 21). However, Aa &
Vanev (2002: 200), who did not accept P ephedrae as an authentic Phyllosticta,
suggested that its small eguttulate conidia without appendages indicated that
it was an Asteromella species (possibly the spermatial state of one of the five
Mycosphaerella species described from Ephedra). Since Ephedra is a botanically
isolated gymnospermous genus in a monogeneric family and order, we consider
that the host specificity of P ephedricola differentiates it from all other accepted
Phyllosticta species.
Acknowledgements
The authors are grateful to Keiichi Motohashi (Tokyo University of Agriculture,
Japan) and Katarina Pastircakova (Slovak Academy of Sciences, Slovakia) for critical
comments, corrections, and pre-submission reviews. This study has been supported
by Basic Work of Science and Technology-Commonly Used Rare and Endangered
Medicinal Plant Resources Investigation, project SB2007FY020, Gansu Herbal Medicine
Industry Research Foundation, project GYC11-01 and Gansu Nature Science Fund,
project 1212RJZA092.
Literature cited
Aa HA van der. 1973. Studies in Phyllosticta I. Studies in Mycology 5: 1-110.
Aa HA van der, Vanev S. 2002. A revision of the species described in Phyllosticta. Centraalbureau
voor Schimmelcultures: Utrecht, The Netherlands.
Donk MA. 1968. Report of the committee for Fungi and Lichens 1964-1969. Taxon 17: 578-581.
http://dx.doi.org/10.2307/1216075
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth and Bisby’s dictionary of the fungi,
10th edn. CAB International, Wallingford.
Motohashi K, Araki I, Nakashima C. 2008. Four new species of Phyllosticta, one new species of
Pseudocercospora, and one new combination in Passalora from Japan. Mycoscience 49(2):
138-146. http://dx.doi.org/10.1007/s10267-007-0395-z
Nag Raj TR. 1993. Coelomycetous anamorphs with appendage-bearing conidia. University of
Waterloo: Waterloo, Canada.
Trotter A. 1916. Caratteri ecologici e prospetto della flora micologica della Libia. Nuovo Giornale
Botanico Italiano 23: 5-33.
Wang XH, Chen GQ, Huang F, Lou JZ, Hyde KD, Li HY. 2012. Phyllosticta species associated with
citrus diseases in China. Fungal Diversity 52: 209-224.
http://dx.doi.org/10.1007/s13225-011-0140-y
Wikee S, Udayanga D, Crous PW, Chukeatirote E, McKenzie EHC, Bahkali AH, Dai DQ, Hyde KD.
2011. Phyllosticta—an overview of current status of species recognition. Fungal Diversity 51:
43-61. http://dx.doi.org/10.1007/s13225-011-0146-5
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.169
Volume 125, pp. 169-181 July-September 2013
Scutellospora alterata, a new gigasporalean species from the
semi-arid Caatinga biome in Northeastern Brazil
JULIANA SOUZA DE PONTES’, IVAN SANCHEZ-CASTRO’,
JAVIER PALENZUELA?, LEONOR CosTA MAIA’,
GLADSTONE ALVES DA SILVA’ & FRITZ OEHL'**
"Departamento de Micologia, CCB, Universidade Federal de Pernambuco,
Av. da engenharia s/n, Cidade Universitaria, 50740-600, Recife, PE, Brazil
*Departamento de Microbiologia, Campus de Fuentenueva, Universidad de Granada,
E-18071 Granada, Spain
*Departamento de Microbiologia del Suelo y Sistemas Simbi6ticos,
Estacion Experimental del Zaidin, CSIC, Profesor Albareda 1, E-18008 Granada, Spain
‘Federal Research Institute Agroscope Reckenholz-Tdanikon ART, Organic Farming Systems,
Reckenholzstrasse 191, CH-8046 Ziirich, Switzerland
“CORRESPONDENCE TO:
[email protected]
ABSTRACT — A new species of Gigasporales (Glomeromycota) was isolated from soils of the
semi-arid Caatinga biome in NE Brazil. It produced spores in the rhizospheres of Sorghum
sudanense, Zea mays, Panicum maximum, and Helianthus annuus in pot cultures. Spores are
triple-walled, roughened, yellow-white to light yellow, and 150-255 um in diameter. The
single germination shield is hyaline, oval to ovoid, and bi-lobed and has the two germ tube
initiations (GTIs) typical for Scutellospora species. The shields can change shape under light
pressure on the cover slide, causing several ‘false’ lobes to appear that do not bear cGTis but
inflate from the shield periphery. Molecular analyses of the partial LSU rDNA gene place
the fungus in a clade next to Scutellospora calospora, S. dipurpurescens, and S. spinosissima.
Further investigations on germ shield morphology showed that several false lobes also
form in other Scutellospora species in lactic acid based mountants under pressure on the
cover slide. In Racocetraceae more than two ‘true’ lobes form during spore formation, each
potentially bearing one GTI.
Key worps — Glomeromycetes, Scutellosporaceae, Orbispora, molecular phylogeny, arbuscular
mycorrhiza
Introduction
During the last decades a high species richness of arbuscular mycorrhizal
fungi (AMF) has been detected in the Gigasporales (e.g., Nicolson &
Gerdemann 1968, Gerdemann & Trappe 1974, Ferrer & Herrera 1981, Morton
170 ... Pontes & al.
1995, Souza et al. 2005, Silva et al. 2006, Tchabi et al. 2009a). Many species
have been described within this fungal group (e.g., Koske & Halvorson 1990,
Blaszkowski 1991, Lin & Yen 2011), especially from tropical South America
(e.g., Spain et al. 1989, Walker et al. 1998, Cuenca & Herrera-Peraza 2008, Silva
et al. 2008, Goto et al. 2012, Mello et al. 2012). The morphological diversity in
the Gigasporales concerns above all spore sizes and color (Silva et al. 2008, Goto
et al. 2011), outer spore wall ornamentation (Goto et al. 2009, 2010, Tchabi et
al. 2009b), number of walls (Oehl et al. 2008, Oehl et al. 2011a), germination
shield complexity and color, and specific germination characteristics (Oehl et
al. 2010, Oehl et al. 2011a,c,d, Goto et al. 2012). Within the Gigasporales, major
fungal groups have been identified as a result of detailed morphological and
molecular phylogenetic analyses. These analyses so far support five families and
ten genera (Silva et al. 2013).
A new species of the Gigasporales producing spores with an evanescent
papillate surface roughening has been isolated from tropical soils of the semi-
arid ‘Caatinga biome in NE Brazil. The fungus forms triple-walled spores
with hyaline to subhyaline bi-lobed germination shields, clearly suggesting
placement in Scutellospora (Scutellosporaceae) according to Oehl et al. (201 1c).
However, we observed an atypically highly variable germination shield
morphology, especially when we applied pressure on the cover slides in lactic
acid based mountants. The aim of this study was to a) describe this unique
species, b) study thoroughly its variable shield morphology, and c) analyze its
ribosomal gene. Shields in other Scutellospora species were reviewed, and their
morphological variation is also discussed.
Materials & methods
Study site, soil sampling and chemical soil analyses
The study site was located at 833 m asl at the Research Station of the Instituto de
Pesquisas Agronémicas (IPA) in Araripina (7°29'S 40°36’'W), Pernambuco State, NE
Brazil, in natural vegetation in the semi-arid ‘Caatinga biome. The mean annual rainfall
is 742 mm, temperature is 23°C, and humidity is 52%. According to Albuquerque (2008),
the native Caatinga vegetation at the site is hyperxerophilic with Bauhinia cheilantha
(Bong.) Steud., Croton sonderianus Mull. Arg., Spondias tuberosa Arruda, and Mimosa
malacocentra (Mart.) Benth. dominating.
Field soil samples (0-20 cm depth) were taken in October 2010 and analyzed for
selected chemical soil characteristics as described in Goto et al. (2009). Mean soil pH
(H,O) was 4.7, organic carbon 17.1 g.kg™, and available P was 63 mg.kg”.
AMF bait cultures
Soil from Araripina was placed in four 1 L pots under greenhouse conditions at the
Department of Mycology, Universidade Federal de Pernambuco (Recife) as described
in Mello et al. (2012) with the objective to cultivate and reproduce the native AMF
communities. Corn (Zea mays L.), Sorghum sudanense (Piper) Stapf, Panicum maximum
Scutellospora alterata sp. nov. (Brazil) ... 171
Jacq., and Helianthus annuus L. were planted as host plant mixtures in the same pots
during three months. For propagation, field samples of the five field soil replicates
were combined into one homogenous AMF inoculum. The new fungus sporulated
abundantly in two pots co-occurring with AMF species like Acaulospora sieverdingii,
A. spinosa, Ambispora appendicula, Dentiscutata cerradensis, and Gigaspora gigantea.
Despite several attempts, single species cultures of the new fungal species could not
be established. Voucher specimens were deposited in the herbaria of Eidgendssische
Technische Hochschule, Ziirich, Switzerland (ZT), and Universidade Federal de
Pernambuco, Recife, Brazil (URM).
Morphological analyses
About 200 spores were extracted from the field soils and bait cultures by wet sieving
and sucrose centrifugation (Sieverding 1991). The spores were mounted in polyvinyl-
alcohol-lactic acid-glycerin (PVLG), in PVLG + Melzer’s reagent, and in water, and
microscopically examined. The terminology of Oehl et al. (2008, 2011a) for spore
morphology and germination of gigasporalean species is followed.
Molecular analyses
PCR reactions were performed on DNA extracted from five surface-sterilized spores
(Mosse 1962) isolated from the bait cultures and crushed with a sterile disposable
micropestle in an Eppendorf tube with 23 uL of milli-Q water.
A two-step PCR was conducted to amplify the ribosomal fragment consisting of
partial SSU, ITS1, 5.88, ITS2 and partial LSU rDNA using the primers SSUmAf/LSUmAr
and SSUmCf/LSUmBr consecutively according to Kriger et al. (2009). PCR reactions
were carried out in an automated thermal cycler (Gene Amp PCR System 2400, Perkin-
Elmer, Foster City, California) with a pureTaq Ready-To-Go PCR Beads (Amersham
Biosciences Europe GmbH, Germany) following manufacturer's instructions with 0.4
uM concentration of each primer. PCR products were analyzed by electrophoresis in
1.2% agarose gels, stained with Gel Red™ (Biotium Inc., Hayward, CA, U.S.A.) and
viewed by UV illumination. The expected amplicons were purified using the Illustra
GFX PCR DNA and Gel Band Purification Kit (Amersham Biosciences, Piscataway,
NJ), cloned into the pCR2.1 vector (Invitrogen, Carlsbad, California), and transformed
into one shot TOP10 chemically competent Escherichia coli cells (Invitrogen, Carlsbad,
California). After plasmid isolation from transformed cells, cloned DNA fragments were
sequenced with vector primers (White et al. 1990) in both directions by Taq polymerase
cycle sequencing on an automated DNA sequencer (Perkin-Elmer ABI Prism 373).
Querying the National Center for Biotechnology Information databases with the
BLASTn program, we verified that the sequences obtained from the new fungus were
affiliated with the Gigasporales (Glomeromycota). The AMF sequences (partial LSU
rRNA) obtained were aligned with other glomeromycotan sequences from GenBank
using the program ClustalX (Larkin et al. 2007) and edited with the BioEdit program
(Hall 1999) to obtain a final alignment. The sequences were deposited at GenBank under
the accession numbers HF935017, HF935020-HF935022, and HF935024.
Maximum parsimony (MP) and neighbor joining (NJ) analyses with 1000 bootstrap
replications were performed using the Phylogenetic Analysis Using Parsimony (PAUP)
program version 4 (Swofford 2003). Bayesian (two runs over 1 x 10° generations with a
172 ... Pontes & al.
burnin value of 2500) and maximum likelihood (1000 bootstrap) analyses were executed,
respectively, in MrBayes 3.1.2 (Ronquist & Huelsenbeck 2003) and PhyML (Guindon &
Gascuel 2003), launched from Topali 2.5. The model of nucleotide substitution (GTR
+ G) was estimated using Topali 2.5 (Milne et al. 2004). Two sequences from Pacispora
scintillans (FM876831, FM876832) were used as outgroup.
Results
Taxonomic analyses
Scutellospora alterata Oehl, J.S. Pontes, Palenz., Sanchez-Castro &
G.A. Silva, sp. nov. Fics 1-18
MycoBank MB 803603
Differs from all other Scutellospora spp. by the evanescent papillate surface roughening
on the spores.
Type: Brazil, Pernambuco, Araripina, isolated from pot cultures on plants inoculated
with soils from natural Caatinga, 94-9401 (holotype, ZT Myc 35647); 94-9402-9410
(isotypes, ZT Myc 35648); 94-9411-9413 (isotypes, URM 83532-URM 83534).
EryMo_oey: alterata (altered), referring to the variable germ shield shape, depending
on the pressure applied on cover slides.
GLOMEROSPORES are singly formed in soils terminally on single, bulbous
suspensor cells (= ‘sporogenous’ cells). Glomerospores are yellowish white to
bright yellow, globose, subglobose to oval or ellipsoid (155-255 x 150-225
um), and have three walls (an outer, a middle, and an inner wall; ow, Mw, and
Iw) and a bi-lobed, hyaline to subhyaline germination shield.
OUTER WALL is 4.0-5.5 um thick in water, expanding to 7.0-11.0 um in
crushed spores in lactic acid-based mounts when pressure is applied on the
cover slide; ow composed of three layers (OWL1-OWL3): the outermost (OWL1)
hyaline to subhyaline to light yellow, evanescent to semi-persistent, ~1.0-1.4
um thick with a papillate surface roughening to which larger debris is often
attached, especially while this wall layer is degrading. However, this debris can
easily be removed from the spore surface by sonification or slight movements of
the spore under the cover slides in liquid or fresh mountants. OwL2 yellowish
white to bright yellow, 2.2-3.0 um thick in H,O, expanding to 5.2-8.5 um in
lactic acid-based mountants when pressed. OwL3 concolorous with OWL2 or
slightly lighter in color, thin, flexible (0.5-1.1 tm thick), and usually difficult
to observe as adhering closely to owL2. OWL2 and ow13 stain dark yellow in
Melzer’s reagent. The straight pore channel at the spore base (about 2.8-4.8 um
broad) might be closed by a plug, but often appears to be open.
MIDDLE WALL composed of two hyaline flexible to semi-flexible layers
(MWL1, MWL2) that are often difficult to separate. In crushed spores they might
show several folds in close vicinity to ow. Mwt1 and Mwtz are each about
0.6-1.2 um thick and may slightly expand in PVLG based mountants.
Scutellospora alterata sp. nov. (Brazil) ... 173
a + or,
rs “ot See .
Fey a "s “ ‘.
: “ ; s eA —_ :
50 yum . Ls 50 um
Fics 1-8. Scutellospora alterata, spore morphology: 1-4. Whitish yellow to light yellow spores
formed on sporogenous cells (sc), with three walls (OW, MW, IW) and a single germination shield
(gs) on the IW surface. Spore surfaces with papillate roughened (rough) surface often capturing
large amounts of debris that can easily be removed through sonification or moving the spores
slightly under the cover slides in the first hours after mounting in PVLG. The gs can usually be
positioned in planar view through such movements, but often deforms when the oval to ovoid
shield shapes (Fic. 3) become irregular and variable (Fic. 4) through pressure. 5-6. OW triple-
layered (OWL1-3), MW bi-layered (MWL1-2), and IW triple-layered (IWL1-3). OW staining dark
yellow, and IWL2 purple to deep purple in Melzer’s reagent. 7-8. Papillate roughened spore surface
in PVLG and in Melzer’s.
INNER WALL triple-layered (IWL1- IWL3), bearing a germination shield on
the outer surface. Iw11 hyaline, flexible, 0.4-1.0 um thin, sometimes difficult
to observe; IwL2 united to finely laminate, 1.4-2.0(-2.7) um thick; Innermost
174 ... Pontes & al.
ee | 10 i
yn “\ /~
: ay gp gp
/ Sa 4 } \
7 . f P : }
Fics 9-17. Scutellospora alterata, variable germination shield morphology. Germ shield is bi-lobed,
often oval to ovoid to violin-shaped, bearing a central ‘germ pore’ (gp) and a ‘fork’ of two parallel
folds (f) separating the lobes. A slight pressure on the spore may cause a few to several ‘false’ lobes
anywhere on the shield periphery. Apparently lobe terminals sometimes do not stop growing close
to the central fork and germ pore, but continue recurving laterally (Fics 16-17). However, these
processes may also be caused by shield deformation after pressure applied on the spores.
IWL3 flexible, thin (0.4-0.8 um thick), and often separable from IwL2 when
pressure applied on the cover slide and then forming several minute folds. Only
IWL2 stains purple to dark purple in Melzer’s reagent.
SPOROGENOUS CELL globose to elongate, concolorous with or slightly
lighter than the spore, 32-50 x 25-41 um, with 2 wall layers generally visible
Scutellospora alterata sp. nov. (Brazil) ... 175
(continuous with spore OwWL1 and OWL2); OWL1 0.6-1.3 um thick, evanescent to
semi-persistent, roughened as the upper surface of the spore outer wall; owL2
1.2-2.5 um thick. Sporogenous hypha bi-layered, 10-26 um diam tapering to
5-10 um within 30-120 um from the sporogenous cell; hyphal wall concolorous
with or darker yellow than spore ow, 1.2-2.2 um tapering to 0.5-1.5 um. A few
(2-5) septa originating from the inner layer might be visible in the hypha.
GERMINATION SHIELD hyaline to subhyaline to (rarely) light yellow, bi-lobed,
oval to ovoid (80-100 x 62-80 um) in uncrushed spores, under pressure
becoming irregular (80-130 x 65-125 um) in crushed or uncrushed spores.
Shield has one initial germ pore (GP) at the shield center (in planar view),
with two lobes surrounding the two folds of the Gp center (= ‘fork’). One germ
tube initiation (GTIs, 2.2-4.0 um diam, often difficult to show in photographs)
generally positioned towards the end of each lobe. Shield wall thin (0.8-1.6
TS, SN
ay
Xe
f
Fics 18-22. Deformed bi-lobed germination shields, either on intact or slightly crushed spores
or shields completely separated from the spores. 18. Scutellospora alterata. 19-20. S. calospora
germination with germ tube (gt) arising from germ tube initiation (gti). 21-22. S. spinosissima
showing many folds on the shield but no clearly visible gti.
176 ... Pontes & al.
um), highly flexible, with the shield periphery regularly deforming under light
pressure on the cover slide, sometimes even in uncrushed spores, when at any
position additional ‘false’ lobes may arise that are regular to highly irregular in
shape but always lacking GTIs.
DISTRIBUTION: Known only from the semi-arid Caatinga biome, in the
Municipality of Araripina, in Pernambuco State (NE Brazil).
Spore development
The major stages of spore development could be deduced from clearly
identified spores of S. alterata found in the bait cultures. First the outer spore
wall differentiates one evanescent to semi-persistent outer layer (OWL1), a
laminate layer (OWL2), and the adherent thin inner layer (OWL3). The bi-
layered middle wall (mw), and later the three-layered inner wall (Iw), develop
de novo without visible connection with the outer wall. Finally, the germination
shield develops on the outer surface of the inner wall as in other Scutellospora
species (e.g. Fics 19-22).
Molecular analyses
Phylogenetic analyses of the partial LSU rDNA gene place the fungus within
Scutellospora ina clade next to S. calospora, S. dipurpurescens, and S. spinosissima
(Fic. 23). For the ITS region, the species closest to S. alterata were S. calospora
(92% identity, BLASTn analysis) and S. spinosissima (90%). The LSU rDNA
sequences were closest to S. calospora and S. dipurpurescens (both 96% identity).
Environmental ITS sequences with closest match to S. alterata were found in
roots of Lobelia dortmanna L. (JN581980, 94% identity; Kohut et al. 2012). The
S. alterata LSU region was most similar to environmental sequences amplified
in roots of Phellodendron amurense Rupr. (Heilongjiang, China—EU252109,
96%) and (Miscanthus sinensis Andersson (Hokkaido, Japan—AB561124, 96%)
and to some sequences obtained from a grassland ecosystem soil (DQ400293,
99%; DQ400277, 97%; Hempel et al. 2007).
Discussion
Scutellospora alterata has two surprising diagnostic features: a) the presence
of an evanescent, papillate surface roughening on the spores instead of asmooth
surface or persistent surface ornamentation and b) a simple germination shield
that may erroneously be interpreted as complex due to the emergence of several
‘false’ lobes, especially after pressure on the spore. The new fungus can easily be
distinguished from all known Scutellospora species, since S. arenicola (Koske &
Halvorson 1990), S. aurigloba (Hall 1977, as Gigaspora aurigloba), S. calospora
(Nicolson & Gerdemann 1968, as Endogone calospora), S. dipurpurescens
(Morton & Koske 1988), and S. tricalypta (Ferrer & Herrera 1981, as Gigaspora
Pacispora scintillans FM876831
P. scintillans FM876832
0.1
Scutellospora alterata sp. nov. (Brazil) ... 177
100L. ©. pernambucana JQ340918
1001 O. pernambucana JQ340917
7 pol O: pernambucana JF965445
100_¢ Scutellospora spinosissima FR750150
4.99 Scutellospora sp. HE794050
p! S. dipurpurescens FJ461868
é S. calospora EU346867
100, S. alterata HF935024
tootr S- alterata HF935017
; S. alterata HF935022
Cetraspora pellucida AY639323
C. pellucida AY639261
C. gilmorei FN547618
C. gilmorei FN547603
C. nodosa FM876833
C. helvetica HM565944
C. helvetica HM565946
Racocetra verrucosa AY900508
R. persica FJ461880
R. castanea Y12076
R. weresubiae FR750134
R. weresubiae FR750135
R. gregaria AJ510232
R. tropicana GU385898
Dentiscutata nigra AY900497
D. nigra AY900494
Quatunica erythropus AM040355
Q. erythropus AM040353
Fuscutata heterogama FJ461875
F. heterogama FJ461872
F. aurea JN971067
F. aurea JN971066
Gigaspora albida FJ461861
G. rosea Y12075
G. margarita AF396783
G. decipiens FJ461862
Orbispora pernambucana HQ871519
kbs Wee pernambucana JF965446
100 ' S. spinosissima FR750149
S. calospora EU252109
100). 'S. alterata HF935021
S. alterata HF935020
C. gilmorei FN547606
C. nodosa FM876836
C. helvetica HM565945
R. fulgida FJ461870
R. verrucosa AY900507
R. coralloidea FJ461866
R. alborosea JN689226
D. nigra AY900495
Q. erythropus AM040357
F. heterogama FJ461876
F. aurea JN971068
G. rosea AM040350
G. gigantea AY900506
68 G. gigantea AY900504
is 1007 _& Margarita AF396782
4.00| 1007 /ntraornatospora intraornata JN971074
. qooLr /. intraornata JN971075
54 .00 !. intraornata JN971073
59 Paradentiscutata maritima JN971081
0.57 | 94 P. maritima JN971079
99 P. maritima JN971080
4 ae P. bahiana JN971070
P. bahiana JN971069
P. bahiana JN971071
Fic. 23. Gigasporales. LSU rDNA-based phylogenetic tree rooted by Pacispora scintillans. Sequences
are labeled with database accession numbers. Support values (from top) are from neighbor-joining
(NJ), maximum parsimony (MP), maximum likelihood (ML) and Bayesian analyses. Scutellospora
alterata sequences are in bold. Only bootstrap values =50% are shown. (Consistency Index = 0.53;
Retention Index = 0.82).
178 ... Pontes & al.
tricalypta) all have smooth spore surfaces, and S. crenulata (Herrera-Peraza
et al. 2001), S. dipapillosa (Koske & Walker 1985, as Gigaspora dipapillosa),
and S. spinosissima (Walker et al. 1998, Silva et al. 2013) have either double
ornamentations or permanent spines on the spore surfaces (Oehl et al. 2008,
2011e).
Roughened spore surfaces occur quite commonly in glomoid species (e.g.,
Viscospora viscosa; Oehl et al. 2011b) but have rarely been found in other
glomeromycotan groups, e.g., in Ambispora granatensis (Palenzuela et al.
2011). In the Gigasporales, Dentiscutata cerradensis is known to have papillae
on the spore surface (Spain & Miranda 1996) that become invisible in lactic
acid-based mountants, whereas the S. alterata papillae generally remain visible
on spores immersed in lactic acid-based mountants.
Scutellospora species are characterized by hyaline shields that possess only two
‘true’ lobes, each generally bearing one Gti when mature. The observation that
additional, so-called ‘false’ lobes may arise on germination shield peripheries
through pressure on the spore surface is interesting, because the phenomenon
has not been reported previously. Certainly, such a feature has never been so
obvious and the extent and variability of the shield alterations might be unique
for S. alterata. Nonetheless, this distortion can also be recognized to a lesser
extent in type specimens of S. dipurpurescens (OSC), and we also found such
characteristics in a S. calospora isolate from Germany (Fics 19-20) and in
S. spinosissima (Fics 21-22), which Walker et al. (1998) and Oehl et al. (2008)
at first erroneously interpreted as containing more lobes. Indeed, especially in
S. spinosissima, multiple folds and ‘false’ lobes can sometimes be seen beneath
cover slides when shields are exposed to pressure or lateral movements in
liquid lactic acid mountants. Shield morphology has not yet been analyzed
sufficiently in the Scutellosporaceae (including Orbispora), and we feel that such
investigations should be carried out soon.
Acknowledgments
The authors thank Janusz Blaszkowski (West Pomeranian University of Technology,
Szczecin, Poland) and Ewald Sieverding (University of Hohenheim, Stuttgart,
Germany) for presubmission critical review. The authors also acknowledge the valuable
comments and revisions of several other experts on the manuscript and appreciate the
corrections by Shaun Pennycook, Nomenclatural Editor, and suggestions by Lorelei L.
Norvell, Editor-in-Chief. This study has been supported by the Conselho Nacional de
Desenvolvimento Cientifico e Tecnolégico (CNPq) that provided research grants (INCT
~ Herbario Virtual 572883/2008-4, Programa de Biodiversidade do Semi-arido (PPBio)
558317/2009-0, Protax 562330/2010-0, Sisbiota 563342/2010-2, CT-Agro 559248/2009-
1) to Leonor C. Maia and G.A. Silva, and by CNPq, FACEPE and UFPE which provided
grants to F. Oehl as ‘visiting professor’.
Scutellospora alterata sp. nov. (Brazil) ... 179
Literature cited
Albuquerque PP. 2008. Diversidade de Glomeromycetes e atividade microbiana em solos sob
vegetacao nativa do Semi-arido de Pernambuco. Tese de Doutorado, Universidade Federal de
Pernambuco, Recife, PE. 113 p.
Blaszkowski J. 1991. Polish Glomales VUI. Scutellospora nodosa, a new species with knobby spores.
Mycologia 83: 537-542. http://dx.doi.org/10.2307/3760369
Cuenca G, Herrera-Peraza R. 2008. Scutellospora striata sp. nov., a newly described glomeromycotan
fungus from La Gran Sabana, Venezuela. Mycotaxon 105: 79-87.
Ferrer RL, Herrera RA. 1981 [“1980”] El género Gigaspora Gerdemann et Trappe (Endogonaceae)
en Cuba. Rev. Jardin. Bot. Nacional Habana 1: 43-66.
Gerdemann JW, Trappe JM. 1974. The Endogonaceae in the Pacific Northwest. Mycologia Memoir
No. 5. 76 pp.
Goto BT, Maia LC, Silva GA, Oehl F. 2009. Racocetra intraornata, a new species in the Glomeromycetes
with a unique spore wall structure. Mycotaxon 109: 483-491.
http://dx.doi.org/10.5248/109.483
Goto BT, Silva GA, Maia LC, Oehl E 2010. Dentiscutata colliculosa, a new species in the
Glomeromycetes from Northeastern Brazil with colliculate spore ornamentation. Nova Hedwigia
90: 383-393. http://dx.doi.org/10.1127/0029-5035/2010/0090-0383
Goto BT, Silva GA, Maia LC, Souza RG, Coyne D, Tchabi A, Lawouin L, Hountondji F Oehl F. 2011.
Racocetra tropicana, a new species in the Glomeromycetes from tropical areas. Nova Hedwigia
92: 69-82. http://dx.doi.org/10.1127/0029-5035/2011/0092-0069
Goto BT, Silva GA, Magna DAA, Silva DKA, Souza RG, Ferreira ACA, Jobim K, Mello CMA, Vieira
HEE, Maia LC, Oehl F. 2012. Intraornatosporaceae (Gigasporales), a new family with two new
genera and two new species. Mycotaxon 119: 117-132. http://dx.doi.org/10.5248/119.117
Guindon S, Gascuel O. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies
by maximum likelihood. Systematic Biol. 52: 696-704.
http://dx.doi.org/10.1080/10635150390235520
Hall IR. 1977. Species and mycorrhizal infections of New Zealand Endogonaceae. Trans. Br. Mycol.
Soc. 68: 341-356. http://dx.doi.org/10.1016/S0007-1536(77)80186-1
Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program
for Windows 95/98/NTT. Nucl. Acids Symp. Ser. 41: 95-98.
Hempel S, Renker C, Buscot E 2007. Differences in the species composition of arbuscular
mycorrhizal fungi in spore, root and soil communities in a grassland ecosystem. Environ.
Microbiol. 9: 1930-1938. http://dx.doi.org/10.1111/j.1462-2920.2007.01309.x
Herrera-Peraza RA; Cuenca G, Walker C. 2001. Scutellospora crenulata, a new species of Glomales
from La Gran Sabana, Venezuela. Can. J. Bot. 79(6): 674-678.
http://dx.doi.org/10.1139/cjb-79-6-674
Kohut P, Sykorova Z, Ctvrtlikova M, Rydlova J, Suda J, Vohnik M, Sudova R. 2012. Surprising
spectra of root-associated fungi in submerged aquatic plants. FEMS Microbiol. Ecol. 80:
216-235. http://dx.doi.org/10.1111/j.1574-6941.2011.01291.x
Koske RE, Halvorson WL. 1990 [“1989”]. Scutellospora arenicola and Glomus trimurales: Two new
species in the Endogonaceae. Mycologia 81: 927-933. http://dx.doi.org/10.2307/3760112
Koske RE, Walker C. 1985. Species of Gigaspora (Endogonaceae) with roughened walls. Mycologia
77: 702-720. http://dx.doi.org/10.2307/3793280
Kriger M, Stockinger H, SchiiSler A. 2009. DNA-based species-level detection of arbuscular
mycorrhizal fungi: one PCR primer set for all AME. New Phytol. 183: 212-223.
http://dx.doi.org/10.1111/j.1469-8137.2009.02835.x
180 ... Pontes & al.
Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F,
Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. Clustal W and
Clustal X version 2.0. Bioinformatics 23: 2947-2948.
http://dx.doi.org/10.1093/bioinformatics/btm404
Lin T-C, Yen C-H. 2011. Racocetra undulata, a new species in the Glomeromycetes from Taiwan
Mycotaxon116: 401-406. http://dx.doi.org/10.5248/116.401
Mello CMA, Silva GA, Vieira HEE, Silva IR, Maia LC, Oehl F. 2012. Fuscutata aurea, a new species in
the Glomeromycetes from cassava and maize fields in the Atlantic rainforest zone of Northeastern
Brazil. Nova Hedwigia 95: 267-273. http://dx.doi.org/10.1127/0029-5035/2012/0037
Milne I, Wright F, Rowe G, Marshal DF, Husmeier D, McGuire G. 2004. TOPALi: Software for
Automatic Identification of Recombinant Sequences within DNA Multiple Alignments.
Bioinformatics 20: 1806-1807. http://dx.doi.org/10.1093/bioinformatics/bth155
Morton JB. 1995. Taxonomic and phylogenetic divergence among five Scutellospora species based
on comparative developmental sequences. Mycologia 87: 127-137.
http://dx.doi.org/10.2307/3760955
Morton JB, Koske RE. 1988. Scutellospora dipurpurescens, a new species in the Endogonaceae from
West Virginia. Mycologia 80: 520-524. http://dx.doi.org/10.2307/3807854
Mosse B. 1962. Establishment of vesicular-arbuscular mycorrhiza under aseptic conditions. J. Gen.
Microbiol. 27: 509-520. http://dx.doi.org/10.1099/00221287-27-3-509
Nicolson TH, Gerdemann JW. 1968. Mycorrhizal Endogone species. Mycologia 60: 313-325.
http://dx.doi.org/10.2307/3757161
Oehl F, de Souza FA, Sieverding E. 2008. Revision of Scutellospora and description of five new genera
and three new families in the arbuscular mycorrhiza-forming Glomeromycetes. Mycotaxon 106:
311-360.
Oehl F, Jansa J, Souza FA, Silva GA. 2010. Cetraspora helvetica, a new ornamented species in the
Glomeromycetes from Swiss agricultural fields. Mycotaxon 114: 71-84.
http://dx.doi.org/10.5248/114.71
Oehl F, Sieverding E, Palenzuela J, Ineichen K, Silva GA. 2011a. Advances in Glomeromycota
taxonomy and classification. IMA Fungus 2: 191-199.
http://dx.doi.org/10.5598/imafungus.2011.02.02.10
Oehl F, Silva GA, Goto BT, Sieverding E. 2011b. Glomeromycota: three new genera, and glomoid
species reorganized. Mycotaxon 116: 75-120. http://dx.doi.org/10.5248/116.75
Oehl FE, Silva DKA, Maia LC, Ferreira NM, da Silva GA. 2011c. Orbispora gen. nov., ancestral
in the Scutellosporaceae of the Glomeromycetes. Mycotaxon 116: 161-169. http://dx.doi.
org/10.5248/116.161
Oehl F, Silva GA, Goto BT, Maia LC, Sieverding E. 2011d. Glomeromycota: two new classes and a
new order. Mycotaxon 116: 365-379. http://dx.doi.org/10.5248/116.365
Oehl F, Silva GA, Goto BT, Sieverding E. 2011e. New recombinations in Glomeromycota. Mycotaxon
117: 429-434, http://dx.doi.org/10.5248/117.429
Palenzuela J, Barea JM, Ferrol N, Oehl F. 2011. Ambispora granatensis, a new arbuscular mycorrhizal
fungus, associated with Asparagus officinalis in Andalucia (Spain). Mycologia 103: 333-340.
http://dx.doi.org/10.3852/09-146
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models. Bioinformatics 19(12): 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Sieverding E. 1991. Vesicular-arbuscular mycorrhiza management in tropical agrosystems.
Deutsche Gesellschaft fiir Technische Zusammenarbeit (GTZ) GmbH, Eschborn, Germany.
Silva GA, Lumini E, Maia LC, Bonfante P, Bianciotto V. 2006. Phylogenetic analysis of Glomeromycota
Scutellospora alterata sp. nov. (Brazil) ... 181
by partial LSU rDNA sequences. Mycorrhiza 16: 183-189.
http://dx.doi.org/10.1007/s00572-005-0030-9
Silva DKA, Freitas NO, G Cuenca, Maia LC, Oehl EF. 2008. Scutellospora pernambucana, a new
fungal species in the Glomeromycetes with a characteristic germination orb. Mycotaxon 106:
361-370.
Silva GA, Maia L, Oehl F. 2013 [“2012”]. Phylogenetic systematics of the Gigasporales. Mycotaxon
122: 207-220. http://dx.doi.org/10.5248/122.207
Souza FA, Declerck S, Smit E, Kowalchuk GA. 2005. Morphological, ontogenetic and molecular
characterization of Scutellospora reticulata (Glomeromycota). Mycol. Res. 109: 697-706.
http://dx.doi.org/10.1017/S0953756205002546
Spain JL, Miranda JC. 1996. Scutellospora cerradensis: an ornamented species in the Gigasporaceae
(Glomales) from the Cerrado region of Brazil. Mycotaxon 60: 129-136.
Spain JL, Sieverding E, Toro S. 1989. Scutellospora biornata, a new species in the Endogonaceae
from the Llanos Orientales of Colombia. Mycotaxon 35: 219-227.
Swofford DL. 2003. PAUP*. Phylogenetic Analysis Using Parsimony (* and Other Methods),
Version 4. Sinauer Associates, Sunderland, Massachusetts.
Tchabi A, Burger S, Coyne D, Hountondji F, Lawouin L, Wiemken A, Oehl F. 2009a. Promiscuous
arbuscular mycorrhizal symbiosis of yam (Dioscorea spp.), a key staple crop in West Africa.
Mycorrhiza 19: 375-392. http://dx.doi.org/10.1007/s00572-009-0241-6
Tchabi A, Hountondji FE, Lawouin L, Coyne D, Oehl F. 2009b. Racocetra beninensis from sub-
Saharan savannas: a new species in the Glomeromycetes with ornamented spores. Mycotaxon
110: 199-209. http://dx.doi.org/10.5248/110.199
Walker C, Cuenca G, Sanchez F. 1998. Scutellospora spinosissima sp. nov. a newly described
Glomalean fungus from acidic, low nutrient plant communities in Venezuela. Ann. Bot. 82:
721-725. http://dx.doi.org/10.1006/anbo.1998.0728
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols: a guide to
methods and applications. Academic Press, San Diego, California.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.183
Volume 125, pp. 183-188 July-September 2013
A new Drechslerella species from Hainan, China
JIAN- YING LI*, WEN-YUN QIAN*, MIN Qt1A0o, YA-LI BAI & ZE-FEN Yu*
Laboratory for Conservation and Utilization of Bio-resources,
Key Laboratory for Microbial Resources of the Ministry of Education,
Yunnan University, Kunming, Yunnan, 650091, P. R. China
*CORRESPONDENCE TO:
[email protected]
Asstract — Drechslerella hainanensis sp. nov., isolated from soil sampled from Wuzhi
Mountain, Hainan Province, China, is described. The new species, placed in Drechslerella
because it forms constricting rings in the presence of nematodes, is characterized by
unbranched conidiophores and 0-2-septate subcylindric-ellipsoidal macroconidia. The
morphological and phylogenetic differences between D. hainanensis and similar species are
discussed.
Key worps — ITS, nematode trapping fungi, orbiliaceous, phylogenetic placement
Introduction
Scholler et al. provided evidence by detailed molecular analyses to propose
new generic concepts for orbiliaceous nematode-trapping fungi based on the
shape of trapping device (Hagedorn & Scholler 1999, Scholler et al. 1999). Li
et al. (2005) also redefined the systematic classification of nematode-trapping
fungi based on phylogenies inferred from sequence analyses of 28S rDNA,
5.88 rDNA, and $-tubulin genes and confirmed that it is credible to classify
nematode-trapping fungi based on the shapes of their trapping devices.
According to the present systematics of nematode-trapping fungi, Drechslerella
Subram. is characterized by three-celled constricting ring traps.
In our survey of nematode-trapping fungi from Hainan Province, a new
species was isolated from soil, which we referred to Drechslerella based on its
formation of three-celled constricting ring traps. In this paper, we describe and
illustrate the new species and discuss its phylogenetic placement determined by
ITS sequence analyses.
*Jian- Ying Li & Wen-Yun Qian contributed equally to this work
184 ... Li, Qian, & al.
60 D. brochopaga U72609
D. brochopaga AY773456
100/- p, brochopaga U51950
99 D. brochopaga FJ380936
87 D. brochopaga HQ711928
D. brochopaga HQ711929
16 D. brochopaga EF445987
63 100 D. anchonia AY965753
D. dactyloides AY773463
8 D. hainanensis KC952010
D. yunnanensis FJ185262
D. polybrocha U51953
A. constringens U51967
D. coelobrocha AY773463
400 D. doedycoides EF4459921
D. stenobrocha AY773460
Arthrobotrys conoides JN9113091
ann |
0.05
PLATE 1. Phylogenetic tree of Drechslerella hainanensis and nine other Drechslerella species,
including Arthrobotrys constringens (= D. effusa), using the neighbor joining method based on
ITS region sequence data. Arthrobotrys conoides was used as outgroup. Bootstrap values <50% are
not shown.
Materials & methods
Collection of samples, isolation and characterization
Soil samples (30 g) were collected from the forest in Wuzhi Mountain, Hainan
Province, China. Each sample was placed in zip-locked plastic bags and labeled.
Drechslerella hainanensis sp. nov. (China) ... 185
Samples of 0.5-1g soil were sprinkled onto CMA (20 g cornmeal, 18 g agar, 40 mg
streptomycin, 30 mg ampicillin, 1000 ml distilled water) inoculated with sterile Paragrellus
redivius (free-living nematode) and incubated at 25°C, following methods described by
Duddington (1955) and Wyborn et al. (1969). After one month, samples were examined
using a dissecting microscope. Single spores were isolated with a sterilized toothpick
and were cultivated on CMA at 25°C, maintained on the same medium as agar slants
and stored at 4°C. Morphological observations were made from CMA after incubation
at 28°C for one week.
Specimens and cultures were conserved in the Herbarium of the Laboratory for
Conservation and Utilization of Bio-resources (YMF), Yunnan University, Kunming,
Yunnan, P.R. China.
DNA extraction, PCR and sequencing
Total DNA was isolated from fresh mycelium as described by Turner et al. (1997).
Primer pairs ITS4 and ITS5 (White et al. 1990) were used to amplify the complete
ITS. PCR amplification parameters followed Yu et al. (2007). The PCR products were
purified with a commercial Kit (Bioteke Biotechnology Co., Ltd., China) and sequenced
on both strands with the same primers that were used for amplification with the aid
of a LI-COR 4000L automatic sequencing system, using cycle sequencing with the
ThermoSequenase-kit as described by Kindermann et al. (1998).
Phylogenetic analysis
Using the new ITS sequence from our culture and the 15 available GenBank ITS
sequences from nine other Drechslerella species, we performed cladistic analyses with
MEGA version 4.1 using the neighbor-joining method. The neighbor-joining tree was
constructed with Kimura 2-parameter model, including transitions and transversions
with pairwise gap deletion.
Results
A neighbor-joining tree (PLATE 1) was generated from ITS sequences from
D. hainanensis and nine other Drechslerella species. Arthrobotrys conoides
Drechsler, a fungus trapping by means of adhesive three-dimensional networks,
was selected as outgroup. The phylogenetic tree shows that D. hainanensis
clusters as a species separate from D. doedycoides (Drechsler) M. Scholler et al.,
D. effusa (Jarow.) M. Scholler et al., and D. polybrocha (Drechsler) M. Scholler
et al.
Taxonomy
Drechslerella hainanensis Jian Y. Li & Z.F. Yu, sp. nov. PLATE 2
MycoBank MB 804093
Differs from Drechslerella effusa by its production of only a single macroconidium at the
conidiophore apex.
Type: PR China, Hainan Province, Wuzhi Mountain, Atuoling Provincial Park, 18°48'N
109°34'E, elev. 514 m, isolated from forest soil, Dec. 2010, Y. L. Bai (Holotype, YMF
1.03963; ex-type culture, YMF 1.036931).
186 ... Li, Qian, & al.
EryMo toy: hainanensis refers to the province in which the species was found.
Mycelium slow-growing, colonies hyaline to white, reaching <25 mm diam.
after 10 days on CMA at 25°C. Vegetative hyphae hyaline, septate, 1.2-4.9 um
wide. Aerial mycelium sparse, hyaline, septate, branched. Macroconidiophores
hyaline, septate, erect, unbranched, 98-109 x 3.5-5.0 um, each tip bearing one
conidium. Macroconidia hyaline, straight, subcylindric-ellipsoidal, 32.5-43 um
long, 17.0-25 um at the broadest part, (0—)1-2 septate (0 in 18.3%; 1 in 40.2%;
2 in 41.5%; n = 80). Microconidia frequently observed. Microconidiophores
hyaline, septate, erect, unbranched, 40-80 x 2.2-3.3 um, sometimes narrower
near apex, apices with 2-4 4.5-6.0 long denticles, each bearing one conidium.
Microconidia hyaline, straight, elongate ellipsoid-clavate, rounded at the
apex, 18.2-22.8 x 4.2-5.3 um, (0—)1 septate. Trapping nematodes by means of
spontaneously formed, stalked, three-celled constricting rings with triangular
inner thickenings at the septa. At non-constricted points, outer diameter =
22-35.5 um, inner diameter = 9.0-15.5 um.
Discussion
Drechslerella heterospora (Drechsler) M. Scholler et al., D. stenobrocha
(Drechsler) M. Scholler et al., and D. effusa resemble D. hainanensis in their
cylindric-ellipsoid shaped macroconidia. Drechslerella heterospora differs from
D. hainensis by its distinctly narrower microconidia and D. stenobrocha differs
from D. hainensis by its distinctly narrower macroconidia. Drechslerella effusa
fits quite well with D. hainanensis in macroconidial size and number of septa
but differs in producing up to 12 or more macroconidia near the conidiophore
apex, whereas the macroconidia of D. hainanensis always grow singly at the
tip. Unlike D. hainanensis, D. doedycoides macroconidia are broadly ellipsoid-
fusoid with narrowed ends and 2(-3)-septate, while those of D. polybrocha
have only one sub-basal septum.
Our ITS rDNA phylogenetic tree supports D. hainanensis as separate from
D. doedycoides, Arthrobotrys constringens (= D. effusa), D. polybrocha, and
D. stenobrocha. We included a sequence from the type of Arthrobotrys
constringens Dowsett et al. because no sequence was available from the D. effusa
type; Oorschot (1985) treated these two species as synonymous, although they
differ somewhat in microconidial size. Although D. hainanensis is very close to
the clade formed by D. brochopaga (Drechsler) M. Scholler et al., D. anchonia
(Drechsler) M. Scholler et al., and D. dactyloides (Drechsler) M. Scholler et al.,
in these three species the conidiophore apex bears more than one conidium,
thus forming a radiating capitate arrangement, and their conidial shape and
septation also differ from those in D. hainanensis.
Drechslerella hainanensis sp. nov. (China) ... 187
i
”
a
PiatE 2. Drechslerella hainanensis (Holotype, YMF 1.03963): A. Macroconidia; B, C. Macro-
conidiophore; D. Microconidia; E. Microconidiophores and microconidia; F. Macroconidiophore
and macroconidia; G. Constricting rings. Scale bars: A~D = 10 um; E, F = 50 um; G = 20 um.
188 ... Li, Qian, & al.
Acknowledgements
This work was jointly financed by National Basic Research Program of China
(973’Program: 2013CB127503) and National Natural Science Foundation Program of
PR China (31060008, 31160008, 31260007, 31360130), Grants from the Young Academic
and Technical Leader Raising Foundation of Yunnan Province (2010CI020). China
National Tobacco Corporation (grant no. 110201002023) and Yunnan Branch of China
Tobacco Industrial Corporation (grant no. 2010YN17). We are very grateful to Dr. D. M.
Hu and Prof. H.-O. Baral for critically reviewing the manuscript and providing precious
suggestions on this paper.
Literature cited
Duddington CL. 1955. Notes on the technique of handing predacious fungi. Transactions of the
British Mycological Society 38: 97-103. http://dx.doi.org/10.1016/S0007-1536(55)80021-6
Hagedorn G, Scholler M. 1999. A reevaluation of predatory orbiliaceous fungi. I. Phylogenetic
analysis using rDNA sequence data. Sydowia 51: 27-48.
Kindermann J, El-Ayouti Y, Samuels GJ, Kubicek CP. 1998. Phylogeny of the genus Trichoderma
based on sequence analysis of the internal transcribed spacer region 1 of the rDNA clade.
Fungal Genetic Biology 24: 298-309. http://dx.doi.org/10.1006/fgbi. 1998.1049
Li Y, Hyde KD, Jeewon R, Cai L, Vijaykrishna D, Zhang KQ. 2005. Phylogenetics and evolution
of nematode-trapping fungi (Orbiliales) estimated from nuclear and protein coding genes.
Mycologia, 97(5): 1034-1046. http://dx.doi.org/10.3852/mycologia. 97.5.1034
Oorschot CAN (1985) Taxonomy of the Dactylaria complex V. A review of Arthrobotrys and
allied genera. Studies in Mycology 26: 61-96.
Scholler M, Hagedorn, Rubner A. 1999. A reevaluation of predatory orbiliaceous fungi. II. A new
generic concept. Sydowia 50(1): 89-93.
Turner D, Kovacs W, Kuhls K, Lieckfeldt E, Peter B, Arisan-Atac I, Strauss J, Samuels GJ,
Borner T, Kubicek CP. 1997. Biogeography and phenotypic variation in Trichoderma sect.
Longibrachiatum and associated Hypocrea species. Mycological Research 101: 449-459.
http://dx.doi.org/10.1017/S0953756296002845
Wyborn CHE, Priest D, Duddington CL. 1969. Selective technique for the determination
of nematophagous fungi in soil. Soil Biology & Biochemistry 1: 101-102.
http:/dx.doi.org/10.1016/0038-0717(69)90039-X
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR Protocols: a guide to
methods and applications. Academic Press, San Diego, CA.
Yu ZF, Zhang Y, Qiao M, Zhang KQ. 2007. Orbilia dorsalia sp. nov., the teleomorph of Dactylella
dorsalia sp. nov. Cryptogamie, Mycologie 28: 289-294.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.189
Volume 125, pp. 189-192 July-September 2013
New reports of cyperaceous rust fungi from Pakistan
A. IsHAQ’*, N.S. AFSHAN? & A.N. KHALID’
™Department of Botany & *Centre for Undergraduate Studies,
University of the Punjab, Quaid-e-Azam Campus, Lahore, 54590, Pakistan
*CORRESPONDENCE TO:
[email protected]
ABSTRACT —Puccinia minuta is reported as new record, and the telial stage of P. caricis is
reported for the first time from Pakistan.
KEY worps — Cyperaceae, sedges, Uredinales
Introduction
This paper is a continuation of the exploration of rust fungi on Poaceae
and Cyperaceae from Pakistan. Previously, about 21 rust species have been
reported on 15 hosts of Cyperaceae from Pakistan (Ahmad et al. 1997; Afshan
& Khalid 2008; 2009; Afshan et al. 2009; Saba & Khalid 2011). In the present
investigation, rusted specimens of Cyperaceae were collected from different
localities in Pakistan. Among these, one rust is a new record for the country,
and the telial stage of another is reported for the first time in Pakistan.
Materials & methods
Rust infected plants were collected along with their inflorescences. These collections
as well as herbarium specimens from were studied morphologically and free hand
sections and scrape mounts were taken from infected plant materials. The plants
were photographed and infected portions were observed under a stereomicroscope.
Twenty spores of each spore state were examined under a microscope (Nikon YS 100);
paraphyses and spores were measured through a Zeiss Eyepiece Screw micrometer.
Sections, paraphyses, and spores were photographed using a Digiporo-Labomed.
Illustrations of spores and paraphyses were made under a camera lucida (Ernst Leitz
Wetzlar Germany).
Species recorded
Puccinia minuta Dietel, Cornell Univ. Sci. Bull. 3(1): 19 (1897) Fic. 1
Spermogonia and aecia not found. Uredinia adaxial, naked, light brown in
color, 0.2-0.3 mm long. Urediniospores globose to subglobose, light brown to
190 ... Ishaq, Afshan & Khalid
Fic. 1: Puccinia minuta.
A. Urediniospores showing germ pores (arrow); B. Teliospores.
Scale bars: A = 14um; B = 12 um.
hyaline, 23-29 x 24-30(-38) um; wall 2-4 um thick, echinulate; germ pores up
to 4, equatorial. Telia amphigenous, subepidermal, brown, 0.1-0.4 x 0.1-0.3
mm. Teliospores amphigenous, oblong, brown to chestnut brown, 2-celled,
(9-)14-24(-27) x (26-)42-56 um, rounded above, narrowed below, apex 5-9
um thick; wall 2-5 um thick; pedicel long, hyaline, 5-9 x 30-66(-92) um.
MATERIAL EXAMINED: PAKISTAN, KHYBER-PAKHTUNKHAWAH (KPK), Ghora gali, alt.
1950 ma.s.l., on Carex sp., stages II + III, April 2011, AM #7 (LAH 1135).
ComMENTs: Puccinia bolleyana Sacc., P. caricina DC., P. caricis-kouriyamensis
Morim., P. caricis-pocilliformis Morim., P. dioicae Magnus, P. extensicola var.
linosyridis-caricis (E. Fisch.) Zwetko, P. pakistani S. Ahmad, P. subepidermalis
Afshan et al., and P urticata FE. Kern have previously been reported on Carex
spp. from Pakistan (Ahmad 1960, 1969; Ono 1992; Ono & Kakishima 1992;
Afshan & Khalid 2009; Afshan et al. 2011; Saba & Khalid 2011). Puccinia
minuta is a new record for the country.
Puccinia minuta new to Pakistan ... 191
Fic. 2: Puccinia caricis.
A. Urediniospores showing germ pores (arrow); B. Teliospores.
Scale bars: A = 10 um; B = 13 um.
Puccinia caricis Rebent., Prodr. Fl. Neomarch.: 356 (1804) Fia. 2
Spermogonia and aecia not found. Uredinia amphigenous, light brown,
scattered, covered by epidermis, oblong, 0.1-0.2 x 0.07-0.1 mm. Urediniospores
globose to subglobose, 14-19 x 18-23 um; wall 2-3 um thick, echinulate; germ
pores up to 8, scattered. Telia hypophyllous, naked, black, 0.1-0.2 mm. Telia
hypophyllous, naked, black, 0.1-0.2 mm. TELIosporss clavate or oblong to
clavate, chestnut-brown to hyaline, 16-26 x 47-68 um; apex conical, 8-10
um thick; 1.5-2 um thick from sides; pedicels hyaline, persistent, up to 50 um
long.
192 ... Ishaq, Afshan & Khalid
MATERIAL EXAMINED: PAKISTAN, KHYBER-PAKHTUNKHAWAH (KPK), Ghora gali, alt.
1950 ma.s.l., on Carex sp., stage III, April, 2011, AM # 61 (LAH 1136).
ComMENTs: The aecial stage of Puccinia caricis was previously reported from
Patriata in Pakistan on leaves of Urtica dioica L. (Ahmad 1956a,b). The telial
stage is reported here for the first time from the country.
Acknowledgements
We sincerely thank Dr. Abdul Rehman Niazi (Department of Botany, University of
the Punjab, Lahore, Pakistan) and Dr. Alan P. Roelfs for their valuable suggestions for
improving the manuscript and acting as presubmission reviewers.
Literature cited
Afshan NS, Khalid AN. 2008. New rust fungi on noxious weeds from Pakistan. Pak. J. Phytopathol.
20(1): 82-87.
Afshan NS, Khalid AN. 2009. New records of Puccinia and Pucciniastrum from Pakistan.
Mycotaxon 108: 137-146. http://dx.doi.org/10.5248/108.137
Afshan NS, Khalid AN, Iqbal SH, Niazi AR, Sultan A. 2009. Puccinia subepidermalis sp. nov. and
new records of rust fungi from Fairy Meadows, Northern Pakistan. Mycotaxon 110: 173-182.
http://dx.doi.org/10.5248/110.173
Afshan NS, Khalid AN, Niazi AR, Iqbal SH. 2011. New records of Uredinales from Fairy Meadows,
Pakistan. Mycotaxon 115: 203-213. http://dx.doi.org/10.5248/115.203
Ahmad S. 1956a. Uredinales of Pakistan. Biologia 2: 29-101.
Ahmad S. 1956b. Fungi of Pakistan. Biological Society of Pakistan, Lahore Monograph 1: 1-126.
Ahmad S. 1960. Further contribution to the fungi of Pakistan. Biologia 6: 117-136.
Ahmad S. 1969. Fungi of Pakistan. Biological Society of Pakistan, Lahore, Monograph 5, Suppl. 1.
110 p.
Ahmad S, Iqbal SH, Khalid AN.1997. Fungi of Pakistan. Sultan Ahmad Mycological society of
Pakistan, Department of Botany, University of the Punjab, Lahore, Pakistan.
Ono Y. 1992. Uredinales collected in the Kaghan Valley, Pakistan. Cryptogamic flora of Pakistan
1: 217-240.
Ono Y, Kakishima M. 1992. Uredinales collected in the Swat Valley, Pakistan. Cryptogamic flora of
Pakistan 1: 197-216.
Saba M, Khalid AN. 2011. New records of rust fungi on sedges (Cyperaceae) from Pakistan.
Mycotaxon 117: 115-122. http://dx.doi.org/10.5248/117.115
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.193
Volume 125, pp. 193-200 July-September 2013
Scleroderma yunnanense, a new species from South China
CHUNXIA ZHANG *, XIAO-E Xu ’, JING Liu’, MInGxia HE’,
WENBING WANG ', YUN WANG *? & KAIPING JI *
"Yunnan Institute for Tropical Crop Research,
99 Xuanwei Road, Jinghong 666100, Yunnan, China.
? The New Zealand Institute for Plant & Food Research Ltd.,
Private Bag 4704 Christchurch 8140, New Zealand
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Scleroderma yunnanense sp. nov. is described from Yunnan, China. Previously
misidentified as Scleroderma citrinum, the new species is diagnosed by its echinulate-spiny
spores and thick peridium. Molecular analysis supports erection of this new species. Perhaps
unique for the genus, S. yunnanense is edible and considered a delicacy in Yunnan.
Key worps — earth ball, gasteromycete, taxonomy
Introduction
Scleroderma (Sclerodermataceae, Boletales) has about 25 recognized species
(Guzman 1970; Sims et al. 1995; Kirk et al. 2008), of which 10 are found in China
(Liu 2005). The genus is widespread from the tropical to boreal regions and
common in forests, parks, and farmland. Most mushroom books and scientific
papers state that Scleroderma species are suspected, undesirable, inedible,
or poisonous (Arora 1986; Bresinsky & Besl 1990; Mao 1998; Pacioni 1981;
Stevenson & Benjamin 1962). Bresinsky & Besl (1990) state that consumption
of raw Scleroderma cepa Pers. leads to severe abdominal pain, stomach cramp,
and paralysis, while in New Zealand ingestion of an unknown Scleroderma
species cooked in a casserole resulted in anaphylactic shock (I.R. Hall, pers.
comm.). In stark contrast, the authors have found an edible Scleroderma species
that is extensively collected and sold at local mushroom markets in Yunnan,
China, without any reports of adverse affects on humans. The authors, who
have eaten this mushroom on a number of occasions, have found it to be not
just edible but choice and delicious. This species is commonly found growing
in the tropical and warm-subtropical parts of Yunnan Province. Previously this
mushroom was recorded from China as S. citrinum Pers. (Wang et al. 2004).
194 ... Zhang & al.
However, after re-examining recent collections both morphologically and
molecularly we determined that this species has been incorrectly identified and
warrants separation as a new species.
Materials & methods
The macroscopic and microscopic characters were described based on fresh and
dried specimens collected from several locations in Yunnan, China. Sections were made
with a freezing microtome (Jinhua Yidi Medical Equipment Factory, Zhejiang, China)
and mounted in water and then lactophenol solution. Dry specimens were mounted
in 5% KOH solution and examined under a Nikon E400 microscope. Spore samples
were vacuum-dried, sputter-coated with gold, and examined with a FEI QUANTA200
Environmental Scanning Electron Microscope at Yunnan University.
The holotype and other examined specimens are deposited in KUN-HKAS, Kunming,
Yunnan, China, except for one specimen held in the Herbarium of the Research Institute
TABLE 1. Phlebopus and Scleroderma collections included in the molecular analysis.
SPECIES VOUCHER ORIGIN GENBANK *
P. portentosus H-01-3-1 China GQ253574
S. areolatum JMP0080 USA EU819438
RT00036 USA EU819518
F: PGK193 USA GQ166910
S. aurantium Strain 8-5 China HM237174
S. bovista K80S09 New Zealand GQ267487
K(M)105588 England EU784409
RT00034 USA EU819517
S. cepa JMP0081 USA EU819439
S. citrinum F:PRL5772 USA GQ166907
K(M)17485 England EU784413
CITSCLI1 USA FM213344
K(M)53906 England EU784414
— USA FJ824090
S. polyrhizum Strain 11-3 China HM237173
S. sinnamariense SINSCL9 Thailand FM213364
SINSCL8 Thailand FM213363
SINSCL6 (SCLD1) Thailand FM213361
SINSCL7 Thailand FM213362
SINSCL2 (SCLP3) Thailand FM213357
S. verrucosum K(M)30670 England EU784415
S. yunnanense KUN-HKAS 79633A China JQ639040
KUN-HKAS 79633B China JQ639041
KUN-HKAS 79633C China JQ639042
KUN-HKAS 79633D China JQ639043
KUN-HKAS 79664A China JQ639044
KUN-HKAS 79664B China JQ639045
KUN-HKAS 79665 China JQ639046
IFRD 414-012 China FJ687275
*New sequences are presented in bold font.
Scleroderma yunnanense sp. nov. (China) ... 195
of Resource Insects of Chinese Academy of Forestry (IFRD), Kunming, Yunnan,
China.
Tissue samples were excised from the inner part of fresh basidiomata to avoid
contamination. DNA was extracted from each sample with the E.Z.N.A. fungi DNA
miniprep kit (Omega Biotech, GA, and USA). The ITS region was amplified with
TRANSTAQ™ DNA Polymerase High Fidelity (TransGen Biotech, China). Primer pairs
ITS4/ITS5 were used to amplify the ITS region of the ribosomal RNA gene (White et al.
1990). PCR parameters were as follows: initial denaturation for 5 min at 95 °C followed
by 30 cycles at 95 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min, and final extension at 72
°C for 10 min. PCR products were electrophoresed on 1.2% agarose gels with 1x TBE
buffer. After purification with a Gel Extraction & PCR Purification Combo Kit (BioTeke,
China), the PCR products were ligated into a pMD-18T vector (TakaRa, Japan) for DNA
sequencing. Both strands were sequenced using the vector specific primers T7 and M13F
(BGI Company). Sequences of seven samples were submitted to GenBank (TaBLE 1).
Closely related sequences revealed by BLASTN were obtained from the GenBank DNA
database (http://www.ncbi.nlm.nih.gov/entrez/). A total of 29 sequences were used for
phylogenetic analyses (TABLE 1).
A multiple sequence alignment was performed using the ClustalX programme
(Thompson et al. 1998). Phylogenies were constructed using the MEGA 4.0 software
package (Kumar et al. 2008). Neighbor-Joining (NJ) trees were constructed using the
Kimura-2-parameter distance model and Gamma distribution parameter 0.55. Tree
robustness was assessed with a 1000-pseudoreplicate Bootstrap analysis (Felsenstein
1985). Branches supported by >50% of bootstrap replicates are indicated on the tree.
Phlebopus portentosus (GQ253574) was used as the outgroup.
Taxonomy
Scleroderma yunnanense Y. Wang, sp. nov. Figs. 1-12
MycoBank MB 805073
Differs from Scleroderma cepa by having clamp-connections and from S. sinnamariense
in its thicker peridium with a hyaline inner surface and its non-reticulate basidiospore
ornamentation of dense narrow pyramidal warts.
Type: China, Yunnan Province, Pure, 22°20’N 110°59’E, under Pinus kesiya var.
langbianensis, 15 Sept. 2011: K.P. Ji $1101 (Holotype, KUN-HKAS 79633; GenBank
JQ639040-JQ639043).
ETYMOLOGY: yunnanense refers to the type locality.
BASIDIOMATA subglobose to globose, 2.5-5.0(-7.0) cm in diameter, with
scales, dirty whitish to yellowish, the base attached to the substrate via a tuft
of mycelium and rhizomorphs, sometimes aggregated into a pseudostipe, <2
cm long, conspicuously covered with well-developed rhizomorphs composed
of hyaline hyphae, usually 2.0-3.0(-5) um in diam., with emanating right
branching hyphae and numerous clamp-connections and with some hyphae
with adherent crystalline structure. PERIDIUM 2-7 mm thick, two-layered,
the outer layer <500 um thick, composed of thin and thick yellowish hyphae
196 ... Zhang & al.
towards the peridial surface, 1.5-2.0(-5) um in diam.; the inner layer <6500
um thick, composed of hyaline interwoven hyphae, 5.0-7.5 um diam., clamp-
connections rare. Kou on the surface of peridium light reddish and no reaction
on peridial cross-section. GLEBA when young firm, white to whitish, and with
numerous white capillitia, becoming grayish to purplish then purplish brown
and finally powdery, composed of hyaline hyphae, 1.5-2.0 um in diam., with a
few dark, thick hyphae <3 um in diam. BAsip1osporEs globose to subglobose,
(7.0-) 8.4 x 8.0(-9.5) um including ornamentation, covered with dense narrow
pyramidal warts, 1-1.2 um long and 0.4-0.6(—8) um thick at the base. ODoR
mushroomy; TASTE sweet.
PHYLOGENETIC ANALYSIS — ITS-rDNA sequence analysis groups all
S. yunnanense collections together with high (99%) bootstrap value and
separate from the S. citrinum collections, which also group together with high
(97%) bootstrap value (Fic. 13).
ECOLOGY & DISTRIBUTION — Sub-hypogeous, solitary or in small groups
under Pinus kesiya var. langbianensis and Betula alnoides and forming
ectomycorrhizae with one or both of these hosts, alt. 880-1300 m, fruiting from
June to October in Yunnan, China. Known only from sub-tropical and tropical
regions of Yunnan, China.
ADDITIONAL SPECIMENS EXAMINED: CHINA, YUNNAN PROVINCE, Pure — 22°20’N
110°59°E, under Pinus kesiya var. langbianensis, 15 Sept. 2011: K.P. Ji $1102 (KUN-
HKAS 79664; GenBank JQ639044, JQ639045); under Betula alnoides, 15 Sept. 2011: K.P.
Ji $1103 (KUN-HKAS 79665; GenBank JQ639046); Puwen — 22°30’N 101°03’E, under
Pinus kesiya var. langbianensis, 24.Sep.2011: Ji $1104 (KUN-HKAS 79666), Ji S1105
(KUN-HKAS 79667), Ji $1106 (KUN-HKAS 79668); Yiliang — 24°92’N 103°14’E,
12.Sep.2007: T. Ma, YLOO7 (IFRD 414-012, as “Scleroderma citrinum,” GenBank
FJ687275); Wuiding — 25°55’N 102°36’E, 12.Aug.1998: X.H. Wang 742, KUN-HKAS
35824, as “Scleroderma citrinum”).
ComMENTS —'The discovery of an edible Scleroderma species in a genus long
considered toxic (or at least highly suspect) underlines the difficulties in
generalizing on the edibility or toxicity of mushrooms. In the Yunnan area
where S. yunnanense is widely consumed, there is presumably sufficient general
knowledge to prevent the eating of inedible or toxic lookalikes. However, the
Fics 1-8. Scleroderma yunnanense. 1: Sectioned fruiting body, showing scales and gleba. 2: Fruiting
body, showing dense rhizomorphs in the soil. 3: Fruiting body with rhizomorphs, sectioned to show
the pseudostipe. 4: Rhizomorphs on the fruiting body surface. 5: Rhizomorphs and emanating
hyphae, showing right-angled hyphal branching (arrow) and clamp-connections. 6: Rhizomorphs
and emanating hyphae, showing crystalline structure on the hyphae (arrow). 7: Outer peridial layer
with vertically arranged hyphae. 8: Inner peridial layer of interwoven hyphae. Scale bars: 1, 3 =
1.5 cm; 2, 4 = 1 cm; 5 = 40 um; 6 = 25 um; 7, 8 = 50 um.
Scleroderma yunnanense sp. nov. (China) ... 197
7 dete ~~
(eS 7 m5
——
:
\
“9
198 ... Zhang & al.
9/27/2011 |mode| HV mag O|} WD T spot 4
4:55:17 PM| SE |30.00 kV} 25 000 x|10.0 mm| 2.0 label
Fics 9-12. Scleroderma yunnanense. 9: Basidiomata showing various stages of maturity. 10: Gleba
sporogenous tissue, showing thick hyphae (arrow). 11: Basidiospore (SEM). 12: Basidiospores.
Scale bars: 9 = 2 cm; 10 = 2.5 um; 11 = 4 um; 12 = 10 um.
likely publicity surrounding the edibility of S. yunnanense might now persuade
some people to try eating potential lookalikes outside of the natural range of
this species. Fortunately, the misidentification of S. yunnanense as S. citrinum
Pers. (a toxic species) should be lessened based on the accurate morphological
information that we present.
Morphologically Scleroderma yunnanense is similar to S. cepa Pers. in
having spiny spores and thick peridium. However, it differs in having clamp-
connections (Fic. 8). The ITS-rDNA sequence analysis shows that S. yunnanense
is closely related to S. sinnamariense Mont. (Fic. 13). However, S. sinnamariense
has a thinner (<1 mm) peridium, a bright sulfur yellow inner peridial surface,
and partially reticulate spores, all of which clearly differ in S. yunnanense.
Acknowledgements
We are grateful to Michael Castellano, Ian R. Hall, and Simon Bulman for reviewing
the paper and providing valuable comments; to The Laboratory for Conservation
and Utilization of Bio-resources of Yunnan University, China for helping with DNA
sequencing and to The Advanced Analysis and Measurement Center of Yunnan
Scleroderma yunnanense sp. nov. (China) ... 199
Scleroderma yunnanense
JQ639041
Scleroderma yunnanense
JQ639042
Scleroderma yunnanense
JQ639046
99 cleroderma yunnanense
JQ639045
cleroderma yunnanense
JQ639040
cleroderma yunnanense
JQ639044
Scleroderma yunnanense
56
Ars ea nae yunnanense
FJ687275
Scleroderma sinnamariense
FM213363
Scleroderma sinnamariense
84 100 FM213357
Scleroderma sinnamariense
FM213362
Scleroderma sinnamariense
Fe rad ond sinnamariense
FM213361 ,
100 Scleroderma polyrhizum
68 HM 237173
‘Scleroderma aurantium
HM237174
Scleroderma bovista
97 EU819517
Scleroderma bovista
GQ267487
Scleroderma bovista
EU784409
Scleroderma cepa
EU819439
63 Scleroderma citrinum
FJ824090
Scleroderma citrinum
97 EU784414
Scleroderma citrinum
FM213344
Scleroderma citrinum
EU784413
Scleroderma citrinum
GQ166907
Scleroderma verrucosum
2 EU784415
‘Scleroderma areolatum
99 EU819438
‘Scleroderma areolatum
EU819518
Scleroderma areolatum
Soe portentosus
GQ253574
96
Fic. 13. ITS-based neighbor-joining phylogenetic tree of Scleroderma species. Sequences are labeled
with their GenBank accession numbers (see TABLE 1). Bootstrap support values (1000 replications)
>50% are shown on the nodes.
University, China for SEM. Thanks also to the National Natural Science Foundation
of China (No. 31060271, 30470011, and 30770007), Yunnan Province Appliance Basic
Research Foundation (No.2008CD193) and The Research Achievement Transformation
Foundation of China (No. 2011GB2F300004). This study was partially financed by
International Cooperation Yunnan Program of Innovation to Strong Provinces by
Science & Technology (No.2009AC013), the Joint Founds of the National Science
Foundation of China and Yunnan Province Government (No.U0836604), and Key
Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany, Chinese
Academy of Sciences (No. 0806361121), as well as the Knowledge Innovation Program
of the Chinese Academy of Sciences (No. KSCX2-YW-G-025).
200 ... Zhang & al.
Literature cited
Arora D. 1986. Mushrooms demystified. Ten Speed Press, Berkeley, U.S.A.
Bresinsky A, Besl H. 1990. A colour atlas of poisonous fungi. London, Wolfe.
Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution
39: 783=791,
Guzman G. 1970. Monografis del genero Scleroderma Pers. emend. Fr. Darwiniana 16: 233-407.
Jeanmougin F, Thompson JD, Gouy M, Higgins DG, Gibson TJ. 1998. Multiple sequence alignment
with Clustal X. Trends Biochem. Sci. 23: 403-405.
Kirk PM, Cannon PF, Minter DW, JC & Stalpers JA. Dictionary of the Fungi. 2008. 10th Edition.
Wallingford, UK: CAB International.
Kumar S, Nei M, Dudley J, Tamura K. 2008. MEGA: a biologist-centric software for evolutionary
analysis of DNA and protein sequences. Brief Bioinform. 9: 299-306.
Li JZ. 2003. Studies of Scleroderma from China. J. Nat. Sci. Hunan Univ. 26(4): 60-64.
Liu B. 2005. Sclerodermatales, Tulostomatales, Phallales et Podaxales. Flora Fungorum sinicorum
Vol. 23. Science Press, Beijing, China. (In Chinese)
Mao XL. 1998. Economic fungi of China. Science Press, Beijing, China. (In Chinese)
Pacioni G. 1985. Simon & Schuster’s guide to mushrooms. Simon & Schuster, Inc. Artes Graficas
Toledo, S.A. Spain.
Persoon CH. 1801. Synopsis methodica fungorum. Géttingen, Henricus Dieterich.
Sims KP, Watling R. Jefferies P. 1995. Revised key to the genus Scleroderma. Mycotaxon 56:
403-420.
Stevenson JA, Benjamin CR. 1962 [“1961”]. Scleroderma poisoning. Mycologia 53: 438-439.
http://dx.doi.org/10.2307/3756589
Wang XH, Liu PG, Yu FQ. 2004. Color atlas of wild commercial mushrooms in Yunnan. Yunnan
Science and Technology Press, Kunming, China. (In Chinese)
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols: a guide to
methods and applications. Academic, San Diego.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.201
Volume 125, pp. 201-208 July-September 2013
New records of microfungi from Turkey (Bartin Province)
ALI SAvAs BULBUL’ & ELSAD HUSEYIN?
‘Department of Molecular Biology and Genetics, Science Faculty, Bartin University,
Bartin,74100, Turkey
?Department of Biology, Arts and Sciences Faculty, Ahi Evran University,
Kirsehir,40100 Turkey
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — Cheiromyces stellatus, Coniothyrium ruscicola, Metasphaeria errabunda,
Mycosphaerella winteri, Nectria viridescens, Neosetophoma samararum, Oletheriostrigula
papulosa and Physalospora eriostega are recorded for the first time for the Turkish mycobiota,
and are described and illustrated based on Turkish specimens. These represent the first
records from Turkey of the genera Cheiromyces, Neosetophoma, and Oletheriostrigula.
Key worps — Ascomycota, fungal diversity, anamorph, teleomorph
Introduction
Bartin province (41°53’ N 32°45’ E), located on the northwest coast of
the Black Sea region, is characterized by its temperate marine (“Black Sea”
climate with hot summers and cool winters (Akman 1990). Around Bartin
(Karabuk-Zonguldak, Bartin) the Euro-Siberian vegetation type is common
and dominant but mixed with a considerable number of Mediterranean species.
Mediterranean maquis communities, composed of such species as Carpinus
betulus L., Fagus orientalis Lipsky, and Castanea sativa Miller, occur near the
Bartin river, although they are generally spread throughout the coastal region.
The vegetation and humid climate create favourable conditions for development
of fungi.
Although the Bartin forest ecosystem vegetation has been sufficiently
examined, but the microfungi of this region are little known. During a recent
field study, we collected more than one hundred plant specimens showing
symptoms of microfungal infection. Among these specimens, 45 species from
35 genera of Ascomycota and Basidiomycota were identified. Three ascomycete
genera and eight species represent new records for the mycobiota of Turkey.
The eight microfungi are described here.
202 ... Bilbiil & Hiiseyin
Materials & methods
Fungal specimens were collected in September 2012 during a special research field
trip in Peliken forest ecosystems of Bartin Province. The specimens were cut by hand
into sections using a razor blade and microscopically examined using Leica DM-E
compound microscope. The fungi were identified using the relevant literature (Saccardo
1882; Saccardo & Saccardo 1905; Grove 1935; Tomilin 1979; Dennis 1981; Byzova &
Vasyagina 1981; Sutton 1985, 2004; Huhndorf & Harris 1996; Melnik 2000; Gruyter
et al. 2010). Host plants were identified using the “Flora of Turkey and East Aegean
Islands” (Davis 1965-85). Species names follow Index Fungorum (2013), and author
names follow Kirk et al. (2008). All specimens are deposited in the Herbarium of Bartin
University, Bartin, Turkey (HBU); collection numbers of Elsad Huseyin are prefixed
with EH. Genera new for Turkey are marked with an asterisk (*).
Results
Coniothyrium ruscicola D. Sacc., Mycoth. Ital.: no. 1694. 1913. FIG. 1
Conidiomata black, scattered, immersed, opening by a rounded, simple,
distinct ostiole 10-15 um in diam., globose, 100-120 um diam. Conidia
unicellular, yellowish-green, biguttulate, straight or slightly curved, narrowly
ellipsoid or cylindrical with rounded ends, 5-9 x 2.5-3(-3.5) um.
Causing roundish, ellipsoidal, brownish, spots on cladodes, 1-5 mm in
diam., with a reddish brown border.
MATERIAL EXAMINED: TURKEY, BaARTIN PROVINCE, Peliken area, 80 m a. s. 1, on
living cladodes of Ruscus hypoglossum L., 16.1X.2012. E. Hiiseyin EH-B 19 (HBU).
Notes: Conidia of the Turkish material are similar in size to those described by
Grove (1935, as Phyllosticta ruscicola: 7-8 x 3.5 um).
Mycosphaerella winteri (Pass.) Tomilin, Nov. Sist. Niz. Rast. 5: 168. 1968. FIG. 2
Ascomata epiphyllous, scattered, immersed or partly erumpent, dark brown
or almost black, sphaerical, 60-90 um diam., with an ostiole 15-20 um diam.
Asci 8-spored, fasciculate, straight or slightly curved, sessile or short-stalked,
clavate or almost cylindrical, 35-45 x 8-10(-11) um. Ascospores distichous,
straight or slightly curved, hyaline, uniseptate, clavate or almost fusiform,
12-15:% 2.5=3.5'am.
On leaves, causing rounded to irregular leaf spots, 4-13(-15) mm diam.,
confluent, dark brown, with pale brown center.
MATERIAL EXAMINED: TURKEY, BARTIN PROVINCE, Peliken area, 80 m a.s.l., on living
leaves of Rubus sanctus Schreb., 16.1X.2012, A.S. Bulbiil & E. Hiiseyin EH-B 22 (HBU).
Notes: Ascomata and asci of the Turkish material are similar in size to those
presented by Tomilin (1979: ascomata 80-100 um diam., asci 35-40 x 8-10
um).
New ascomycete records for Turkey ... 203
Fics. 1-2. (1) Coniothyrium ruscicola: conidia. (2) Mycosphaerella winteri: a. ascomata; b. asci;
c. ascospore.
Metasphaeria errabunda Feltgen, Vorstud Pilzfl. Luxemb., Nachtr. 3: 235. 1903. Fic. 3
Ascomata scattered or grouped, black, globose-depressed, subimmersed
or superficial, 85-160 um diam. Asci 8-spored, fasciculate, short-stalked,
paraphysate, clavate-fusiform, 77-95 x 10-12(-15) um. Ascospores distichous,
hyaline, 3-septate, constricted at the middle septum, 4-guttulate, slightly
curved, fusiform, 20-25 x 4-6 um.
MATERIAL EXAMINED: TURKEY, BaRrTIN PROVINCE, Peliken area, 70 m a. s. 1, on
thin dead branches of Ilex aquifolium L., 16.1X.2012, A.S. Biilbiil & E. Hiiseyin EH-B
29 (HBU).
Notes: The Turkish asci are longer than described by Saccardo & Saccardo
(1905: asci 55-75 x 10-12 um), but the ascomata and ascospores are similar
(Saccardo & Saccardo 1905: ascomata 70-150 um diam.; ascospores 16-22 x
3-5 um).
*Oletheriostrigula papulosa (Durieu & Mont.) Huhndorf & R.C. Harris,
Brittonia 48: 551. 1996. FIG. 4
Ascomata amphigenous, numerous, immersed, black, subglobose, 130-150
um diam. Asci 8-spored, paraphysate, short clavate, 65-85 x 10-12(-12.5)
204 ... Bilbiil & Hiiseyin
Fics. 3-5. (3) Metasphaeria errabunda: ascus with ascospores. (4) Oletheriostrigula papulosa:
a. asci; b. ascospore. (5) Neosetophoma samararum: conidia.
um. Ascospores hyaline or pale, distichous, 3-septate, 4-guttulate, straight or
slightly curved, ellipsoid-fusiform, 18-20 x 5-5.5 um.
MATERIAL EXAMINED: TURKEY, BARTIN PROVINCE, Peliken area, 66 m a. s. 1., on
living leaves of Rhododendron ponticum L., 16.1X.2012, A.S. Bilbiil & E. Hiiseyin EH-B
14 (HBU).
Note: Asci in Bulgarian material of O. papulosa (Hiiseyin et al. 2011: 65-85 x
13-15 um) are wider than those in the Turkish material.
*Neosetophoma samararum (Desm.) Gruyter, Avescamp & Verkley,
Mycologia 102: 1075. 2010. FIG. 5
Conidiomata immersed, erumpent, black, globose, 250-280 um diam.
Conidiophores hyaline, filiform, (18-)20-25 x 1 um. Conidia biguttulate,
unicellular, hyaline, cylindrical with rounded ends, 6-7.5 x 2-2.5 um.
MATERIAL EXAMINED: TURKEY, BARTIN PROVINCE, Peliken area, 70 m a.s.l., on
the wing of fruit of Acer campestre L., 16.[X.2012, A.S. Biilbiil & E. Hiiseyin EH-B 27
(HBU).
Notes: Conidia of N. samararum have been reported at 7 x 2.5 um (Grove
1935; Gruyter et al. 2010), slightly wider than found in the Turkish material.
New ascomycete records for Turkey... 205
Fics. 6-8. (6) Cheiromyces stellatus: a. fragment of sporodochium; b. conidia. (7) Nectria
viridescens: a. ascomata; b. asci with ascospores. (8) Physalospora eriostega: a. vertical section of
ascomata; b. asci; c. ascospores.
*Cheiromyces stellatus Berk. & M.A. Curtis, Grevillea 3: 97. 1875. FIG. 6
Sporodochia scattered, single, superficial, flattened, circular or ellipsoidal,
golden-brown, <210 um diam. Conidiophores absent. Conidiogenous
cells discrete, doliiform, pale brown, 4-5 x 3.5-4 um. Conidia palmiform,
consisting of truncated bottom basal cell, 4—4.5 um wide, and (3-)5-12(-14)
pale brown, vertical, slightly divergent or closely contiguous, more or less
straight, cylindrical arms. Arms of the conidia 4-12(-14)-distoseptate with
strongly reduced cell cavities, not constricted or only slightly constricted at
septa, unbranched, straight, more or less of equal length, (22—)25-30(-56) x
4-5 um. Apical cell of each arm almost hyaline and slightly longer and wider
than the other cells of the arm.
MATERIAL EXAMINED: TURKEY, BARTIN PROVINCE, Peliken area, 70 m a.s.l., on
dead thin branches of Ilex aquifolium, 16.1X.2012, A.S. Bulbiil & E. Hiiseyin EH-B 28
(HBU).
Notes: Arms of conidia in C. stellatus are given by Mel'nik (2000) as 23-40 x
4-7 um, slightly wider than measured for the Turkish material.
Nectria viridescens C. Booth, Mycol. Pap. 73: 89. 1959. FIG. 7
Stromata <0.2 cm diam., densely, fleshy, reddish brown, erumpent from the
bark. Perithecia bright-orange-red, with papillate ostiole, densely crowded,
rounded, 170-210 um diam. Asci 8-spored, surrounded by filiform paraphyses,
cylindrical, 60-75 x 5-6 um. Ascospores uniseriate, hyaline, uniseptate, not
constricted, ellipsoidal, 6-7.5(-10) x 2.5-3 um.
MATERIAL EXAMINED: TURKEY, BARTIN PROVINCE, Peliken area, 66 m a.s.l., on dead
branches of C. betulus, 16.1X.2012, A.S. Bulbul & E. Hiiseyin EH-B 3 (HBU).
Notes: The Turkish perithecial sizes fall within ranges previously reported
for N. viridescens: 200-250 x 150-200 um (Booth 1959), 125-200 um diam
206 ... Biilbiil & Hiiseyin
(Dennis 1981), and 270-350 x 250-350 um (Byzova & Vasyagina 1981). Asci
and ascospores in the Turkish material are smaller than reported elsewhere
(Booth 1959: asci 68-76 x 6-9 um; Dennis 1981: ascospores 7.5-10 x 4-5
um).
Physalospora eriostega (Cooke & Ellis) Sacc., Syll. Fung. 1: 443. 1882. Fia. 8
Ascomata numerous, scattered, immersed, with only stomata erumpent,
subepidermal, black, depressed-globose, 220-350 um diam. Asci 8-spored,
paraphysate, thick, short-stalked, broadly clavate, 80-100 x 15-20 um.
Ascospores distichous, hyaline, unicellular, broadly lanceolate, ellipsoidal,
25=392% 9125p.
MATERIAL EXAMINED: TURKEY, BARTIN PROVINCE, Peliken area, 80 m a.s.l., on dead
branches of Laurus nobilis L., 16.1X.2012, A.S. Bilbiil & E. Hiiseyin EH-B 32 (HBU).
Notes: The ascospores of P. eriostega on L. nobilis from Bartin province are
smaller than those reported on L. sassafras L. by Saccardo (1882: 35 x 12 um).
Discussion
The above eight species represent new records for Turkey and have not been
included in previous publications on Turkish microfungi (Bremer & Petrak
1947; Bremer et al. 1948, 1952a,b; Petrak 1953, 1957; Karel 1958; Lohwag 1963;
Gobelez 1963, 1964; Oner & Ekmekci 1974; Tamer & Oner 1978; Baydar 1982;
Oner et al. 1984; Tamer et al. 1989, 1990; Giiven & Tamer 1993; Altan and
Tamer 1996; Hiiseyinov & Selcuk 1999; Hiiseyin & Selcuk 2001; Hiiseyin et al.
2003, 2009; Melnik et al. 2004; Erdogdu & Hiiseyin 2008; Stoykov & Denchev
2007; Gdcmen et al. 2011). Cheiromyces Berk. & M.A. Curtis, Neosetophoma
Gruyter et al., and Oletheriostrigula Huhndorf & R.C. Harris represent new
generic records for Turkey.
Acknowledgement
We thank Dr. Eugene Yurchenko (Pinsk, Belarus) and Dr. Sevda Kirbag (Elazig,
Turkey) for serving as presubmission reviewers. Especially we are grateful to Dr. Shaun
Pennycook (Auckland, New Zealand) for detailed linguistic help and nomenclatural
review of the manuscript.
Literature cited
Akman Y. 1990. iklim ve Biyoiklim. Ankara: Palme Yayin Dagitim.
Altan Y & Tamer AU. 1996. The parasitic fungi occurring on some endemic plants in Turkey and
their damaging effects. Plant life in South-West and Central Asia. Ege University Press, Izmir,
Turkey. 1: 398-401
Baydar S. 1982. The fungi species of Ascomycetes collected from Trabzon and Rize Provinces.
Atatiirk University Faculty of Science Journal 1(1): 250-285.
Booth C. 1959. Studies of Pyrenomycetes. IV. Nectria. 1. Mycol Pap 73.
New ascomycete records for Turkey ... 207
Bremer H, Ismen H, Karel G & Ozkan M. 1948. Beitrage zur Kenntnis der parasitischen Pilze der
Tiirkei. III. Revue de la Faculté des Sciences de I‘Université d‘Istanbul, Ser. B 13(1): 1-53.
Bremer H, Karel G, Bryikoglu K, Goksel N & Petrak F. 1952a. Beitrage zur Kenntnis der parasitischen
Pilze der Tiirkei. VI. Revue de la Faculté des Sciences de ‘Université d‘ Istanbul, Ser. B 17(3):
259-276.
Bremer H, Karel G, Bryikoglu K, Goksel N & Petrak F. 1952b. Beitrage zur Kenntnis der parasitischen
Pilze der Tiirkei. VII. Revue de la Faculté des Sciences de [‘Université d‘ Istanbul, Ser. B 17(4):
277-288.
Bremer H & Petrak F. 1947. Neue Kleinpilze aus der Tirkei. Sydowia 1(1-3): 248-263.
Byzova ZM, Vasyagina MP. 1981. Flora sporovykh rastenii Kazakhstana. Protoascomycetes-
Euascomycetes. Vol. XII. Alma-Ata: Nauka KazSSR.
Davis PH (ed.). 1965-85. Flora of Turkey and East Aegean Islands. 9 vols. Edinburgh: Edinburgh
University Press.
Dennis RWG. 1981. British Ascomycetes. Vaduz: Strauss & Cramer GmbH.
Erdogdu M & Hiiseyin E. 2008. Microfungi of Kurtbogazi dam (Ankara) and its environment. The
Herb Journal of Systematic Botany 14(1): 131-150.
Gébelez M. 1963. La Mycoflore de Turquie. I. Mycopathologia et Mycologia Applicata 19(4):
296-314. http://dx.doi.org/10.1007/BF02052305
Gébelez M. 1964. La Mycoflore de Turquie. II. Mycopathologia et Mycologia Applicata 23(1):
47-67. http://dx.doi.org/10.1007/BF02049185
Gécmen E, Vural M, Hiiseyin E & Selcuk E 2011. Some seed plants in ecosystems of Kurtdiizii
Ridges (Bitlis) and their microfungi. Artvin Coruh University Faculty of Forestry Journal 12(1):
68-71.
Grove WB. 1935. British stem-and leaf fungi. Coelomycetes, Vol. 1. Cambridge: University Press.
Gruyter J de, Joyce HC, Woudenberg MM, Avescamp GJM, Verkley JZ, Crous GPW. 2010.
Systematic reappraisal of species in Phoma section Paraphoma, Pyrenochaeta and Pleurophoma.
Mycologia 102: 1066-1081. http://dx.doi.org/10.3852/09-240
Giiven K & Tamer AU. 1993.Some parasitic fungi determined in plants living in Eskisehir. Journal
of Science Faculty of Ege University, Ser. B 15(2): 25-32.
Huhndorf SM, Harris RC. 1996. Oletheriostrigula, a new genus for Massarina papulosa. Brittonia
48: 551-555. http://dx.doi.org/10.2307/2807875
Hiiseyin E, Bilbil AS & Akgil H. 2009.Some notes on micromycetes from Turkey. Pak. J. Bot.
40(1): 453-459.
Hiiseyin E & Selcuk F. 2001. New and poorly known genera of microfungi for Turkey. Turk. J. Bot.
25(6): 437-438.
Hiiseyin E, Selcuk FE, Gaffaroglu M. 2003. Some materials on mitosporic fungi from Turkey. I.
Hyphomycetes. [Kai kurie duomenys apie Turkijos mitosporinius grybus. I. Hyphomycetes].
Botanica Lithuanica 9(2): 151-160.
Hiiseyin E, Selcuk F, Bilbiil AS. 2011. New records of microfungal genera from Mt. Strandzha in
Bulgaria (south-eastern Europe). II. Mycologia Balcanica 8: 157-160.
Hiiseyinov E & Selcuk F. 1999. New records of phytopathogenic microfungi for Turkey. Plant
Disease Research 14(2): 175-176.
Index Fungorum. 2013. http://www.indexfungorum.org/Names/Names.asp. Accessed 15
September 2013.
Karel GA. 1958. A preliminary list of plant diseases in Turkey. Ankara: Ayyildiz Matbaas1.
Kirk PM, Cannon PF, Minter DW, Stalpers JA (eds). 2008. Authors of fungal names. Wallingford:
CAB Bioscience.
208 ... Bilbiil & Hiiseyin
Lohwag K. 1962/1963. Mykologische Notizen aus dem Belgrader Wald bei Istanbul in Turkei.
Sydowia 16: 199-204.
Mel'nik VA. 2000. Definitorium fungorum Rossiae. Classis Hyphomycetes. Fasc 1. Fam. Dematiaceae.
St. Petersburg: Nauka.
Mel'nik VA, Hiiseyin E & Selcuk EF. 2004. Contribution to the studying of micromycetes in several
Black Sea Provinces of Turkey. Nov. Sist. Niz. Rast. 37: 133-148.
Oner M, Dizbay V, Ucar F & Karaboz I. 1984. Some parasitic fungi of southwestern Anatolia and
Konya Province. Doga Bilim Dergisi 8(3): 401-404.
Oner M & Ekmekci S. 1974. Contribution to the parasitic fungi occurring on the natural flora of
northern part of Turkey. Plant Journal 1(2): 232-238.
Petrak F. 1953. Neue Beitrage zur Pilzflora der Tiirkei. Sydowia 7(1-4: 14-44.
Petrak FE. 1957.Beitrage zur Tirkishen Pilzflora. Sydowia 10(1-6): 101-111.
Saccardo PA. 1882. Sylloge fungorum omnium hucusque cognitorum. Vol. 1. Patavii.
Saccardo PA, Saccardo D. 1905. Sylloge fungorum omnium hucusque cognitorum. Vol. 17.
Patavii.
Stoykov DY & Denchev CM. 2007. New records of non-lichenized ascomycetes from Mt. Strandzha
in Turkey (south-eastern Europe). Mycologia Balcanica 4: 157-159.
Sutton BC. 1985. Notes on some deuteromycete genera with cheiroid or digitate brown conidia.
Proc. Indian Acad. Sci. (Plant Sci.) 94: 229-244.
Sutton BC. 2004. The Coelomycetes. Fungi imperfecti with pycnidia, acervuli and stromata. CABI
Publishing.
Tamer AU, Altan Y & Giicin F. 1989.Some parasitic fungi determined on the flora of Giilveren
Village (Erzurum-Senkaya). Journal of Anadolu University Arts and Sciences Faculty 1(2):
45-55.
Tamer AU, Altan Y & Giicin F 1990. Some parasitic fungi determined in flora of east Anatolian
region. Turk. J. Bot. 14(2): 83-86.
Tamer AU. & Oner M. 1978. The parasitic fungi of Aydin Province. Mycopathologia 64(2): 87-90.
http://dx.doi.org/10.1007/BF00440966
Tomilin BA. 1979. Opredelitel’ gribov roda Mycosphaerella Johans. Leningrad: Nauka.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.209
Volume 125, pp. 209-215 July-September 2013
Two new species of Repetophragma from the Iberian Peninsula
RAFAEL FE. CASTANEDA-RuIz', MARGARITA HERNANDEZ-RESTREPO’,
JOSEPA GENE”*, MILAGRO GRANADOS? & JOSEP GUARRO?
"Instituto de Investigaciones Fundamentales en Agricultura Tropical Alejandro de Humboldt’ (INIFAT),
Académico Titular de la “Academia de Ciencias de Cuba’,
Calle 1 Esq. 2, Santiago de Las Vegas, C. Habana, Cuba, C.P.
*Unitat de Micologia, Facultat de Medicina Ciéncies de la Salut, Universitat Rovira i Virgili,
43201 Reus, Spain
°Centro de Investigaciones en Proteccién de Cultivos (CIPROC), Universidad de Costa Rica
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — Repetophragma fragile and R. ibericum, two new microfungi collected on plant
debris, are described and illustrated. Repetophragma fragile is distinguished by variable,
subnavicular, obovoid to subrhomboidal, collapsing, 0-1-septate, pale brown conidia often
with faint bands or irregular spots on the surface. Repetophragma ibericum is characterized
by turbinate to globose, mostly 2-septate, guttulate conidia, with brown central cell and paler
brown end cells.
KEY worDs —asexual fungi, systematics, litter
Repetophragma Subram. was erected to accommodate Sporidesmium species
with euseptate conidia produced on monoblastic, integrated, indeterminate
conidiogenous cells with several percurrent extensions (Subramanian
1992). Castafteda-Ruiz et al. (2011) provided an illustrated update and key
to Repetophragma species, adding another species and making twelve new
combinations. During two field expeditions in Spain (to Burgos, 2010) and
Portugal (to Minho province, 2011), more than 300 samples of dead plant
material colonized by anamorphic fungi were collected. Plant debris was
treated according to Castafieda-Ruiz (2005) and examined periodically
under the stereomicroscope for a 2-month period. Semi-permanent and
permanent microscope slides of fungi growing on the natural substrate were
mounted in lactic acid 85% and polyvinyl alcohol and examined under the
light microscope. Photomicrographs were obtained with a Zeiss AXIO Imager
M1 light microscope (Géttingen, Germany). Among these 300 samples two
210 ... Castafieda-Ruiz & al.
undescribed Repetophragma species were collected, which are herein described
and illustrated.
Taxonomy
Repetophragma fragile R.F. Castafieda, Hern.-Rest., Gené & Guarro, sp. nov.
MycoBank MB802412 FIGS 1, 2
Differs from Repetophragma biseptatum by having variable, fragile, very often collapsed,
0-1-septate, pale brown conidia, sometimes with faint bands or irregular spots on the
surface.
TYPE: Spain, Burgos, Salas de los Infantes, Rio Pedroso, 42°04'N 3°18'W, on submerged
decaying wood of unidentified plant, 10 November 2010, coll. M. Hernandez-Restrepo
& J. Gené C10/126 (Holotype, CBS H-20750; Isotype, FMR 11581).
Erymo oey: Latin, fragile, referred to the delicate, very often collapsed conidia.
CoLoniEs on the natural substrate effuse, hairy, brown. Mycelium superficial
and immersed, composed of septate, branched, brown, smooth hyphae 1-2.5
um diam. CONIDIOPHORES distinct, single, erect, straight or slightly geniculate
toward the apex, 6—12-septate, with 4—8 annellations near the apex, 87-190
x 5-10 um, smooth, brown at the base and pale brown toward the apex.
CONIDIOGENOUS CELLS monoblastic, terminal, integrated, 5-20 x 5-8 um,
indeterminate, annellidic with numerous cyathiform enteroblastic percurrent
extensions. Conidial secession schizolytic. Conip1a solitary, variable,
subnavicular, obovoid, mucronate to somewhat acute, long subrhomboidal,
fragile, very often collapsed, 0—1-septate, pale brown, but sometimes with faint
bands or irregular spots, slightly obscure or brown pigmented on the surface,
25-42 x 10-17 um, truncate, 5—7.5 um wide at the base, smooth-walled, dry.
Teleomorph unknown.
Repetophragma fragile superficially resembles R. biseptatum (M.B. Ellis)
Subram. (Subramanian 1992, Castafieda-Ruiz et al. 2011), but R. biseptatum
produces navicular, 3-septate, smooth-walled conidia with brown to dark
brown upper cells and subhyaline basal cell, 17-23 x 7-8 um and cannot be
confused with R. fragile.
Repetophragma ibericum R.F. Castafieda, Hern.-Rest., Gené & Guarro, sp. nov.
MycoBank MB802415 FIGS 3, 4
Differs from Repetophragma quadriloculare by its globose to subturbinate, mostly 2-
septate conidia, with dark brown or brown central cell and pale brown end cells.
TYPE: Portugal, Minho province, “Lagoas de Bertiandos’, 41°46'N 8°38'W, on bark of
Eucalyptus globulus Labill, 9 November 2011, R.F. Castafieda, M. Hernandez- Restrepo,
J. Gené & J. Mariné-Gené C11/55 (Holotype, HAL 2452 F; Isotype, FMR 12183).
EtyMoL_oGy: Latin, ibericum, in reference to Iberian Peninsula.
Repetophragma spp. nov. (Iberian Peninsula) ... 211
Fic. 1. Repetophragma fragile (ex holotype CBS H-20750):
a. Conidia. b, d. Conidiogenous cells and conidia. c. Conidiogenous cells. Bars = 10 tm.
212 ... Castafieda-Ruiz & al.
Fic. 2. Repetophragma fragile (ex holotype CBS H-20750):
a. Conidia. b. Conidiogenous cells. Bars = 10 um.
Repetophragma spp. nov. (Iberian Peninsula) ... 213
| i
Fic. 3. Repetophragma ibericum (ex holotype HAL 2452F):
a. Conidia. b. Conidiogenous cells. c-d. Conidiophores, conidiogenous cells, and conidia.
Bars = 10 um.
CoLonliegs on the natural substrate effuse, hairy, black. Mycelium superficial
and immersed, composed of septate, branched, brown, smooth hyphae, 3—4 um
diam. CONIDIOPHORES distinct, single or sometimes fasciculate, unbranched,
erect, straight or slightly geniculate toward the apex, 4—7-septate, with up to 7
annellations near the apex, 100-130 x 4.5—7 um, dark brown at the base and
pale brown above. CONIDIOGENOUS CELLS monoblastic, terminal, integrated,
indeterminate, annellidic with numerous cyathiform to infundibuliform
enteroblastic percurrent extensions. Conidial secession schizolytic. CONIDIA
solitary, turbinate to globose, with broad obconical to somewhat cuneate,
truncate basal cell, (1-)2(-3)-septate, dark brown at the septa, with brown to
dark brown central cell and pale brown end cells, 14-18 x 6-8 um, smooth-
walled, dry. Teleomorph unknown.
Repetophragma ibericum is somewhat similar to R. quadriloculare (Matsush.)
R.E Castafieda et al. (Castafieda-Ruiz et al. 2011), but the latter has larger,
obovoid to subglobose, 3-septate, smooth-walled conidia with dark brown
central and basal cells, and a pale brown apical cell, 16-21 x 8-13 um, from
214 ... Castafieda-Ruiz & al.
am Oe
Fic. 4. Repetophragma ibericum (ex holotype HAL 2452F):
a. Conidia. b. Conidiogenous cells. Bars = 10 um.
cultures on corn meal agar (conidia larger, 20—24 x 11-14 um on the natural
substrate, according to Matsushima 1993), so the two species can be easily
separated.
Repetophragma spp. nov. (Iberian Peninsula) ... 215
Acknowledgments
The authors express their sincere gratitude to Dr De-Wei Li and Prof. Bryce Kendrick
for their critical peer review of the manuscript. The authors are deeply indebted to the
Spanish Ministry of “Economia y Competitividad’, grant CGL 2011-27185 and the
Cuban Ministry of Agriculture for facilities. We also thank Mirtha Caraballo and Beatriz
Ramos for technical assistance. We acknowledge the facilities provided by Dr. P.M.
Kirk and Drs. V. Robert, G. Stegehuis and A. Decock through the IndexFungorum and
Mycobank websites. Dr. Lorelei L. Norvell’s editorial review and Dr. Shaun Pennycook’s
nomenclature review are greatly appreciated.
Literature cited
Castanieda-Ruiz RF. 2005. Metodologia en el estudio de los hongos anamorfos. 182-183, in: Anais
do V Congresso Latino Americano de Micologia. Brasilia.
Castafieda-Ruiz RF, Heredia G, Arias RM, McKenzie EHC, Hyde KD, Stadler M, Saikawa M, Gené
J, Guarro J, Iturriaga T, Minter DW, Crous PW. 2011. A new species and re-disposed taxa in
Repetophragma. Mycosphere 2: 273-289.
Matsushima T. 1993. Matsushima mycological memoirs 7. Kobe published by the author, 75 p.
Subramanian CV. 1992. A reassessment of Sporidesmium (hyphomycetes) and some related taxa.
Proc. Indian Nat. Sci. Acad. Part B, 58: 179-190.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/125.217
Volume 125, pp. 217-226 July-September 2013
New records of Rhizocarpon from China
ZUN-TIAN ZHAO, CHAO LI, XIN ZHAO & LuU-LU ZHANG*
College of Life Science, Shandong Normal University, Jinan, 250014, P. R. China
*CORRESPONDENCE TO:
[email protected]
ABSTRACT - Four new lichen records are reported from China — Rhizocarpon grande,
R. infernulum, R. petraeum, and R. rubescens. Detailed taxonomic descriptions with photos
and comments are provided.
Key worps - Rhizocarpaceae, Asia, taxonomy
Introduction
De Candolle originally established Rhizocarpon (Rhizocarpaceae) in 1805
(Kirk et al. 2008). The lichen genus, which is predominately distributed in
temperate, alpine and polar regions, includes about 200 species worldwide
(Feuerer & Timdal 2004; Ihlen 2004; Kirk et al. 2008). The genus is distinguished
by its rock dwelling crustose thallus with black lecideine apothecia, branched
and anastomosed paraphyses, Rhizocarpon-type asci, and 1-septate to muriform
ascospores with a swollen perispore (halonate).
Traditionally Rhizocarpon is divided into taxa with a yellow thallus containing
rhizocarpic acid (subgenus Rhizocarpon) and taxa with white, gray, or brown
thalli lacking rhizocarpic acid (subgenus Phaeothallus) (Thomson 1967).
In China, 28 Rhizocarpon species have been reported (Wei 1991; Abbas & Wu
1998; Aptroot 2002; Aptroot & Sparrius 2003). During our study of Rhizocarpon
in China, four additional species were found in subgenus Phaeothallus:
R. grande, R. infernulum, R. petraeum, and R. rubescens.
Materials & methods
The examined specimens are preserved in SDNU (Lichen Section of Botanical
Herbarium, Shandong Normal University). Their morphological and anatomical
characters were examined under a stereomicroscope (COIC XTL7045B2) and a polarizing
microscope (OLyMPus CX41). Lichen substances were identified using standardized thin
layer chromatography techniques (TLC) with solvent system C (Orange et al. 2001).
Photographs were taken under OLympus SZX16 and BX61 with DP72.
218 ... Zhao & al.
Taxonomy
Rhizocarpon grande (Flérke ex Flot.) Arnold, Flora 54: 149 (1871) Figs 1, 2
Thallus saxicolous, crustose, verrucose-areolate to bullate-verrucose, 0.15-
0.2 mm thick, pale gray to gray-brown, epruinose; hypothallus prominent,
black; cortex and medulla with obvious crystals; algal layer even. Apothecia
lecideine, black, between the areolae, angular or rounded, 0.4-0.6 mm in
diam; margin thin to disappearing; disc flat to convex; exciple brown, with
crystals; epihymenium olivaceous brown, with crystals, usually K+ purple red;
hymenium hyaline to pale brown in upper part, 110-135 um tall; paraphysis
Figure. 1 Rhizocarpon grande (Fu 20124496, SDNU). A: Thallus; B: Apothecia; C: Crystals in
thallus section. Scale bars: A = 1 mm; B = 500 um; C = 50 um.
New Rhizocarpon records (China) ... 219
rm ia. 3 «i 20 um ,
FiGurE. 2 Rhizocarpon grande (Fu 20124496, SDNU). A: Apothecium section; B: Crystals in
apothecium section; C: K reaction; D: Ascus; E: Ascospore. Scale bars: A~C = 50 um; D = 20 um;
E=10um.
capitate, branched and anastomosing; hypothecium brown. Asci Rhizocarpon-
type, 8-spored. Ascospores dark brown, muriform, ellipsoid, 25-40 x 10-16
um.
CHEMISTRY — Secondary metabolites: gyrophoric acid and stictic acid.
SPECIMEN EXAMINED — CHINA. INNER MONGOLIA, Arxan city, Mt. Jiguan, alt. 1500
m, on rock, 29 Aug. 2011, H.D. Fu 20124496 (SDNU).
ComMENTs — Rhizocarpon grande resembles R. eupetraeum in having a
verrucose thallus, but R. eupetraeum contains norstictic acid, lacks gyrophoric
acid, and has a K- epihymenium. Rhizocarpon grande is also similar to
R. geminatum, which can be differentiated by its 2-spored asci, larger ascospores
(35-60 x 18-30 um; Thomson 1997), and absence of gyrophoric acid.
DISTRIBUTION — Rhizocarpon grande has been reported from North
America, Europe, Asia, and Antarctica (Thomson 1997, Galloway 2007,
Golubkov & Matwiejuk 2009). New to China.
Rhizocarpon infernulum (Nyl.) Lynge, Rhodora 36:158 (1934) Fics 3, 4
Thallus saxicolous, crustose, rimose to cracked areolate, brown, 0.05-0.085
mm thick, epruinose; prothallus black, well developed; cortex without crystals,
220 ... Zhao & al.
ee”
nae Sere
fo, $i
250
a Taal
Figure. 3 Rhizocarpon infernulum (Zhang 20103078, SDNU). A: Thallus; B: Apothecium;
C: Crystals in thallus section. Scale bars: A = 1 mm; B = 250 um; C = 50 um.
medulla with obvious crystals; algal layer even. Apothecia lecideine, black, innate,
0.3-0.7 mm in diam; disc flat; margin persistent, thin; exciple well developed,
carbonaceous, without crystals; epihymenium usually with aeruginous blue to
blue-black pigment, without crystals, N+ purple red; hymenium hyaline, 70-90
um tall; paraphysis branched and anastomosing, scarcely swelling at apex, with
sharply delimited, brown cap, although this is often masked by a blue-green
epithecial pigment; hypothecium brown. Asci Rhizocarpon-type, 8-spored.
Ascospores hyaline, 1-septate, ellipsoid, 15-18 x 7-8.5 um.
CHEMISTRY —No substances were detected by TLC.
New Rhizocarpon records (China) ... 221
Figure. 4 Rhizocarpon infernulum (Zhang 20103078, SDNU). A: Apothecium section; B: Crystals
in apothecium section; C: N reaction; D: Ascus; E: Ascospores. Scale bars: A-C = 50 um; D = 20 um;
E=10um.
SPECIMENS EXAMINED — CHINA. Gu1zHoU, Leishan county, Mt. Leigong, alt. 2700 m,
on rock, 9 Nov. 2009, L.L. Zhang 20103078 (SDNU); alt. 2100 m, on rock, 1 Apr. 2011,
X.R. Kou 20111813 (SDNU); alt. 1800 m, on rock, 2 Apr. 2011, Y.L. Cheng 20112591A
(SDNU).
CoMMENTS — Rhizocarpon infernulum is morphologically close to R. hochstetteri,
which can be separated by the thicker thallus (0.1-0.35 mm thick) and larger
ascospores (21-25 x 10-12 um) (Fryday 2002). Rhizocarpon infernulum is also
similar to R. cinereovirens, which can be distinguished by its less well-developed
exciple with a hyaline interior and the usual presence of norstictic acid or stictic
acid.
DISTRIBUTION — Rhizocarpon infernulum has been reported from Europe,
Asia, and North America (Fryday 2002, Fletcher et al. 2009). New to China.
Rhizocarpon petraeum (Wulfen) A. Massal., Ric. Auton. Lich.
Crost. 102 (1852) Fics 5, 6
Thallus saxicolous (usually on siliceous rock), crustose, continuous to
rimose, areolate in part, often flat and polygonal, 0.14-0.2 mm thick, pruinose,
when eroded, thallus surface gray to brown; when eroded, thallus surface gray
222 ... Zhao & al.
»
a
thallus section. Scale bars: A = 2 mm; B = 500 um; C = 50 um.
to brown; prothallus distinct, black; cortex and medulla with obvious crystals;
algal layer even. Apothecia lecideine, innate, irregularly arranged, 0.4-1 mm
diam; disc flat, black, epruinose; margin distinct, persistent; exciple dark brown
to dark blue-green at the rim, inner part colourless to brown, with crystals, N+
purple; epihymenium olivaceous, with obvious crystals; hymenium hyaline,
150-200 um tall; paraphysis branched and anastomosing; hypothecium brown.
Asci Rhizocarpon-type, 8-spored. Ascospores: hyaline, becoming dark when
over-mature, narrowly ellipsoid to ellipsoid, eumuriform, 23-50 x 12-16 um,
with 12-21 cells in optical view.
New Rhizocarpon records (China) ... 223
FiGuRE. 6 Rhizocarpon petraeum (Li 20126494A, SDNU). A: Apothecium section; B: Crystals in
apothecium section; C: N reaction; D: Ascus; E: Ascospores. Scale bars: A-C = 50 um; D = 20 um;
E=10um.
CHEMISTRY — Secondary metabolites: stictic acid.
SPECIMENS EXAMINED — CHINA. XINJIANG, Urumgi, Nanshan-Xiaoquzi, alt. 2700 m,
on rock, 28 Aug. 2011, L. Li 20126494A (SDNU); 28 Aug. 2011, Z.L. Huang 20125928
(SDNU).
ComMENTs — Rhizocarpon petraeum is morphologically close to R. umbili-
catum, which can be distinguished by its smaller ascospores (22-27.5 x 11-15
um) with 6-8 cells in optical view and usual growth on calcareous rock (Ihlen
2004). When the thallus is not distinctly covered with pruina, R. petraeum is
also similar to R. lavatum and R. reductum, but R. lavatum lacks secondary
metabolites, and R. reductum produces ascospores containing fewer cells (8-13
cells in optical view; Ihlen 2004).
DISTRIBUTION — Rhizocarpon petraeum has been reported from Europe,
North America, Australia, and Asia (Ihlen 2004, Fletcher et al. 2009, Golubkov
& Matwiejuk 2009). New to China.
Rhizocarpon rubescens Th. Fr., Lich. Scand. 1: 631 (1874) Fics 7, 8
Thallus saxicolous, crustose, areolate, areoles convex, rounded, containing
small granules, gray to gray-brown, 0.15-0.2 mm thick, epruinose; prothallus
224 ... Zhao & al.
Figure. 7 Rhizocarpon rubescens (Shi 061473, SDNU). A: Thallus; B: Apothecium; C: Crystals in
thallus section. Scale bars: A = 1 mm; B = 500 um; C = 50 um.
distinct, black; cortex and medulla with crystals; algal layer even. Apothecia
lecideine, innate, irregularly arranged or sometimes arranged in a circular
pattern, 0.5-1mm diam; disc flat, black; margin distinct when young; exciple
dark brown, with obvious crystals, K+ purple; epihymenium dark green, with
crystals; hymenium hyaline, often with a Macrocarpa-green tinge, 130-150 um
tall; paraphysis branched and anastomosing; hypothecium dark brown. Asci
Rhizocarpon-type, 8-spored. Ascospores hyaline, ellipsoid, eumuriform, 25-38
x1 2= Fy me
New Rhizocarpon records (China) ... 225
Figure. 8 Rhizocarpon rubescens (Shi 061473, SDNU). A: Apothecium section; B: Crystals in
apothecium section; C: K reaction; D: Ascus; E: Ascospore. Scale bars: A-C = 50 um; D = 20 um;
E=10um.
CHEMISTRY — Secondary metabolites: norstictic acid.
SPECIMENS EXAMINED — CHINA. Gansu, Wenxian county, Qiujiaba, alt. 2250 m, on
rock, 3 Aug. 2006, X.L. Shi 061473 (SDNU), 061475 (SDNU); YUNNAN, Lijiang city, Mt.
Laojun, alt. 3800 m, on rock, 5 Nov. 2009, H.Y. Wang 20100308A (SDNU).
COMMENTS — Rhizocarpon rubescens resembles R. suomiense in having hyaline,
muriform ascospores and norstictic acid, but R. suomiense has 2-spored asci
and strongly muriform ascospores (31-54 cells in optical view; Ihlen 2004).
Rhizocarpon rubescens is morphologically close to R. reductum, but R. reductum
contains stictic acid and has a K+ blue epithecium and K+ yellow exciple.
DISTRIBUTION — Rhizocarpon rubescens has been reported from Europe
and North America (Fryday 2000, Ihlen 2004). New to China.
Acknowledgements
The project was financially supported by Program for Scientific Research Innovation
Team in Colleges and Universities of Shandong Province, and the National Natural
Science Foundation of China (31070010, 31170187). The authors thank Dr. A. Aptroot
(ABL Herbarium, Soest, The Netherlands) and Prof. Shou-yu Guo (Institute of
Microbiology, Chinese Academy of Sciences) for presubmission reviews.
226 ... Zhao & al.
Literature cited
Abbas A, Wu JN. 1998. Lichens of Xinjiang. Sci-Tech & Hygiene Publishing House of Xinjiang (K),
Urumdi. 178 p.
Aptroot A. 2002. Corticolous and saxicolous lichens from Xishuangbanna, southern Yunnan,
China. http://www.nhm.uio.no/botanisk/lav/ Yunnan
Aptroot A, Sparrius LB. 2003. New microlichens from Taiwan. Fungal Diversity 14: 1-50.
Feuerer T, Timdal E. 2004. Rhizocarpon. 456-466, in: TH Nash II et al. (eds). Lichen flora of the
greater Sonoran Desert region. Vol. 2. Tempe: Lichens Unlimited, Arizona State University.
Fletcher A, Gilbert OL, Clayden S, Fryday AM. 2009. Rhizocarpon. 792-808, in: CW Smith et al.
(eds). The lichens of Great Britain and Ireland. London: British Lichen Society.
Fryday A. 2000. On Rhizocarpon obscuratum (Ach.) Massal., with notes on some related species in
the British Isles. Lichenologist 32: 207-224. http://dx.doi.org/10.1006/lich.2000.0269
Fryday A. 2002. A revision of the species of the Rhizocarpon hochstetteri group occurring in the
British Isles. Lichenologist 34: 451-477. http://dx.doi.org/10.1006/lich.2002.0416
Galloway DJ. 2007. Flora of New Zealand. Lichens. Revised second edition, Vol. 2. Pannaria -
*Zwackiomyces. Manaaki Whenua Press, Lincoln. New Zealand.
Golubkov VV, Matwiejuk A. 2009. Some new records of Rhizocarpon from north-eastern Poland
and north-western Belarus. Acta Mycologica 44(2): 201-210.
Thlen PG. 2004. Taxonomy of the non-yellow species of Rhizocarpon (Rhizocarpaceae, lichenized
Ascomycota) in the Nordic countries, with hyaline and muriform ascospores. Mycological
Research 108: 533-570. http://dx.doi.org/10.1017/S0953756204009803
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the fungi, 10th edition. Cromwell
Press, Townbridge, UK. 771 p.
Orange A, James PW, White FJ. 2001. Microchemical methods for the identification of lichens. 2nd
edition. London: British Lichen Society.
Thomson JW. 1967. Notes on Rhizocarpon in the arctic. Nova Hedwigia 14: 421-481.
Thomson JW. 1997. American arctic lichens 2. Microlichens. University of Wisconsin Press,
Madison. 675 p.
Wei JC. 1991. An enumeration of lichens in China. International Academic Publishers, Beijing.
313 p.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.227
Volume 125, pp. 227-233 July-September 2013
Digitella rigidophora and Redbia inflata,
two new microfungi from Mexico
RAFAEL FE. CASTANEDA-Ruiz', GABRIELA HEREDIA? & ROSA M. ARIAS”
"Instituto de Investigaciones Fundamentales en Agricultura Tropical Alejandro de Humboldt,
Académico Titular de la “Academia de Ciencias de Cuba’,
Calle 1 Esquina 2 Santiago de Las Vegas, La Habana, C.P. 17200, Cuba
?Instituto de Ecologia A.C., Carretera antigua a Coatepec 351,
Congregacion El Haya, 91070 Xalapa, Veracruz, México
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Two microfungi collected from plant debris in cloud forests during a survey
of the fungi associated with leaf litter in Veracruz are described and illustrated. Digitella
rigidophora gen. et sp. nov. is distinguished by polytretic conidiogenous cells having a
successive sympodial but rectilinear or geniculated proliferation and with discoid to papillate-
perforate thickened conidiogenous loci and digitate solitary dark brown to brown conidia.
Redbia inflata sp. nov. is characterized by alternate, curved to coiled, slightly echinulate
branches that possess a distinct ampulla at the ends and by coarsely verruculose, subhyaline,
0-1-septate conidia.
KEY worps —anamorphic fungi, taxonomy, tropical fungi
Introduction
Tropical mountain cloud forests are among the most diverse biomes in
the world. In Mexico, although this kind of forest covers less than 1% of the
land surface, it contains 10-12% of the flowering plant species in the country
(Rzedowsky 1996). Because of the climatological conditions, all kinds of fungi
grow in a wide variety of habitats provided by these forests. Unfortunately, such
forests are severely threatened in Mexico. Given that very few mycological studies
focused on microfungi have been made in this diverse ecosystem, it is urgent to
explore the few areas where there are still remnants of forest. Continuing with
a long-term study of anamorphic fungi from tropical mountain cloud forests
of central Veracruz State, we sampled fungi in several forest fragments and
found two interesting fungi colonizing the rachis of a palm tree and leaves of an
unidentified member of the Lauraceae. They are described and discussed here.
228 ... Castafieda, Heredia & Arias
Material & methods
During a foray to study tropical forest mycobiota, 110 samples of plant litter
were collected near the San Martin Tuxtla Volcano (1070 m alt., 18°32'06"N
95°08'25.46.2"W) and Santa Marta, Soteapan (1375 m alt., 18°20'54"N 94°53'23"W).
Individual plant samples were placed in paper or plastic bags taken to the laboratory
and treated according to the techniques described by Castafeda Ruiz (2005). Mounts
were prepared in polyvinyl alcohol-glycerol (8 g in 100 ml of water, plus 5 ml of glycerol)
and measurements made at a magnification of x1000. Photographs were obtained using
a Nikon microscope with differential interference contrast (Eclipse E600) and a JEOL
(JSM-S600LV) scanning electron microscope (SEM) using the techniques described by
Figueras & Guarro (1988).
Taxonomy
Digitella RF. Castafieda, Heredia & R.M. Arias, gen. nov.
MycoBank 800394
Differs from Dendryphion by successive enteroblastic percurrent proliferations after each
holoblastic sympodial proliferation of the conidiogenous cells, by discoid to papillate-
perforated strongly melanized conidiogenous loci, and solitary digitate brown to dark
brown conidia, and differs from Ceratosporella by tretic conidiogenous cells.
TYPE SPECIES: Digitella rigidophora R.E. Castafieda et al.
Erymo_oey: Latin, Digitella, referring to the finger-like conidial branches.
Anamorphic fungi. CoLontrgs on the natural substratum effuse, hairy, dark
brown or black. Mycelium partly superficial and immersed. CONIDIOPHORES
distinct, single, unbranched, septate, dark brown or black, smooth or verrucose.
CONIDIOGENOUS CELLS polytretic, integrated, terminal at first with a single
terminal conidiogenous locus, then indeterminate, with successive sympodial
rectilinear proliferations followed by enteroblastic percurrent proliferation,
being the same process repeated several times, producing terminal and
intercalary conidiogenous loci. Conidiogenous loci evident, convex, discoid,
perforated, thick and black. Conidial secession schizolytic. Conrp1< solitary,
acropleurogenous, digitate, euseptate, brown to dark brown, each with a
subconical to somewhat campanulate, conspicuously cicatrized, strongly
melanized, subtruncate basal cell.
Digitella rigidophora R.F. Castafieda, Heredia & R.M. Arias, sp. nov.
MycoBANnkK 800395 FIG. 1A-G
Differs from Dendryphion spp. by successive enteroblastic percurrent proliferations
after each holoblastic sympodial proliferation of the conidiogenous cells and solitary
digitate brown to dark brown smooth conidia; differs from Ceratosporella spp. by tretic
conidiogenous cells.
Type: Mexico, Veracruz, San Martin Tuxtla Volcano, on rachis of unidentified palm
tree, 5 January 2011, G. Heredia (Holotype: XAL CB1692).
ErymMo_oey: Latin, rigidophora, referring to straight, rigid conidiophores.
Digitella gen. & sp. nov. and Redbia sp. nov. (Mexico) ... 229
i
2
o
x1, 668
Fic. 1. Digitella rigidophora (ex holotype XAL CB1692). a. Conidia. b. Conidiogenous cells
and conidia. c. Conidiogenous locus with a pore (shown by arrow). d. Conidiogenous cells with
several enteroblastic percurrent proliferations (shown by arrows). e. Conidiogenous cells and
conidiogenous loci (SEM). f. Conidiophore (SEM). g. Conidia (SEM). Dendryphion digitatum
(ex XAL CB1236). h. Conidiogenous cells and conidia. Bars = 10 um, except where otherwise
indicated.
Anamorphic fungus. CoLonizs on the natural substratum effuse, hairy, dark
brown or black. Mycelium partly superficial and immersed. CONIDIOPHORES
macronematous, mononematous, single, septate, 120-245 x 8-14 um,
230 ... Castafieda, Heredia & Arias
dark brown or black at the base, brown to pale brown at the apex, smooth.
CONIDIOGENOUS CELLS polytretic, integrated, 8-11 x 8-12 um, brown or
pale brown, terminal at first with a single terminal conidiogenous locus, then
indeterminate, with successive sympodial rectilinear proliferation, sometimes
delimited by one septum and followed by enteroblastic percurrent proliferation,
being the same process repeated several times, producing terminal and
intercalary conidiogenous loci. Conidiogenous loci evident, convex, discoid,
papillate-perforated, 5-7 um diam., thick and black. Conidial secession
schizolytic. Conrp1a solitary, acropleurogenous, digitate, euseptate, constricted
at septate when mature, brown to dark brown, 49-78 x 23-26 um, composed
of two branches, 43-75 um long and a subconical to somewhat campanulate,
conspicuously cicatrized, strongly melanized, subtruncate basal cell, 8-10 um
wide. Teleomorph unknown.
ComMENts — ‘The pattern of ontogeny in Digitella can be classified using the
scheme for conidial development in Kirk et al. (2008). Conidial initiation is
tretic, delimitation by 1 septum, secession schizolytic, maturation by diffuse
wall-building, percurrent enteroblastic conidiogenous cell extension, followed
by further conidial initiation by replacement of apical wall-building; strongly
melanized, each successive conidium seceding before the next percurrent
elongation of the conidiogenous cell, but sometimes also holoblastic, sympodial
proliferation occurring, with two or more conidia produced. The combination
of sympodial and enteroblastic percurrent proliferations with discoid, convex,
thick, darkened conidiogenous loci in Digitella separates it from Dendryphion
Wallr. (Bhat & Sutton 1985, Ellis 1971, 1976, Hughes 1978, Siboe et al. 1999),
where dark cicatrized loci are produced after sympodial proliferations of the
discrete, polytretic conidiogenous cells disposed in geniculate branches of the
conidiophores (e.g., Dendryphion digitatum Subram., Fic. 1h). Dendryphion
conidia are solitary or very often short catenulate and only digitate or cheiroid
in few species. Ceratosporella Hohn. species also have digitate to cheiroid
conidia similar to Digitella, but the conidium ontogeny in Ceratosporella is
holoblastic and only enteroblastic percurrent proliferations occur during the
conidiogenous events.
Redbia inflata Heredia, R.M. Arias & R.F. Castafieda, sp. nov. Fic. 2
MycoBank MB800396
Differs from Redbia elegans by curved to sub-coiled branches; swollen to botryose
conidiogenous cells and 0-1-septate, oblong to cylindrical conidia, which sometimes
bear secondary conidia at the apex.
Type: Mexico, Veracruz, Soteapan, Reserva de la Biosfera de la Sierra Santa Marta, on
decaying leaf of an unidentified species of the Lauraceae, 5 August 2011, G. Heredia
(Holotype: XAL CB1691).
Digitella gen. & sp. nov. and Redbia sp. nov. (Mexico) ... 231
Fic. 2. Redbia inflata (ex holotype XAL CB1691). a. Conidia. b. Catenulate conidia. c. Conidio-
genous cells and conidia. d, e. Branches. f. Conidiophores. Bars a, c = 10 um; d, e = 40 um;
f= 100 um.
232 ... Castafieda, Heredia & Arias
Erymo oey: Latin, inflata, referred to the vesicular swellings at the tips of branches.
CoLoniges on the natural substratum, effuse, hairy, brown. Mycelium
superficial and immersed. Hyphae septate, branched, 1-2 um diam., smooth,
pale brown to brown. CONIDIOPHORES macronematous, mononematous,
erect, straight, cylindrical 14-19-septate, smooth at the base, verruculose to
verrucose towards the apex and branch tips, 480-600 x 12-17 um, alternately
branched, with branches whip-like, curved, slightly coiled, brown at the base
and subhyaline 94-200 um long, echinulate, with an ampulla or a botryose to
inflated apex 5-7 um wide. CONIDIOGENOUS CELLS polyblastic, denticulate,
terminal, integrated and discrete, subhyaline, 6-20 x 5-8 um, indeterminate,
with several sympodial proliferations bearing conspicuous denticles. Conidial
secession schizolytic. Conrp1A solitary or sometimes short catenulate, oblong
to somewhat cylindrical, coarsely verruculose to verrucose, obtuse or rounded
at the apex, truncate at the base, 0-1-septate, 12-16 x 2.5-3.5 um, subhyaline,
dry. Teleomorph unknown.
ComMENtTs — Deighton & Pirozynski (1972) established Redbia based on a
mycophilous fungus, R. pucciniicola (the type species), found on telia of Puccinia
holosericea Cooke. Redbia is distinguished by conidiophore branches, brown
below and paler towards the apex and branches, with sympodial proliferating,
denticulate conidiogenous cells. Three additional species were described:
R. elegans Piroz. & Hodges (Pirozynski & Hodges 1973), R. laxa R.E. Castafieda
(Castaneda 1985), and R. trichomambusta R.W. Barreto (Barreto1994). Redbia
inflata is superficially similar to R. elegans in conidial ornamentation, but
R. elegans is easily differentiated by its narrow ellipsoid to fusiform, 3-septate,
15-35 x 4-5 um conidia.
Key to Redbia species
1 Conidiophores simple, conidia obovate, 0-3-septate,
8-21 x 1-6 um, smooth, pale brown .................006- R. trichomambusta
GONIGiOpaGres:OrAMe eC Met allt Nace it mare mst ecarng nace eae nae ore tee oR es a 2
PREC OMICIASMMGOU Bil ORT El A OA OS Od BA BO ee 2 3
Gomidiagverrucu lose: haps... Mati Natl Is RI UE IR LD OT 4
3 (2) Conidia fusiform, 1-3-septate, hyaline,
=e) eS 2495 [PE Ree ne EER ER eee pele eet, R. pucciniicola
Conidia obovoid to clavate, 1-septate, sometimes
unequal, hyaline or subhyaline, 7.5-10.5 x 3-3.5 um ..............06. R. laxa
4(2) Conidia narrowly ellipsoid or fusiform, pale
straw-colour, 3-septate, 15-35 X 4-5 um .... eee ee eee eee R. elegans
Conidia oblong to somewhat cylindrical, subhyaline,
W=Taseptate sO —l xg? FSP g nin leet estes Sey elt KIN Nae Mag Og R. inflata
Digitella gen. & sp. nov. and Redbia sp. nov. (Mexico) ... 233
Acknowledgments
The authors wish to thank Dr. David W. Minter (CABI, UK) and Dr. De-Wei Li
(The Connecticut Agricultural Experiment Station, USA), for critical review of the
manuscript. This study was supported by the National Commission for the Knowledge
and Use of Biodiversity, Mexico (CONABIO/IE004 project) and the Instituto de
Ecologia A.C., Mexico. We acknowledge the facility provided by the Cuban Ministry of
Agriculture. We acknowledge the facilities provided by Dr. P.M. Kirk and Drs. V. Robert,
G. Stegehuis and A. Decock through the IndexFungorum and Mycobank websites.
Dr. Lorelei L. Norvell’s editorial review and Dr. Shaun Pennycook’s nomenclature review
are greatly appreciated.
Literature cited
Barreto RW, Evans HC. 1994. The mycobiota of the weed Chromolaena odorata in southern Brazil
with particular reference to fungal pathogens for biological control. Mycol. Res. 98: 1107-1116.
http://dx.doi.org/10.1016/S0953-7562(09)80196-2
Bhat DJ, Sutton BC. 1985. New and interesting hyphomycetes from Ethiopia. Trans. Br. Mycol. Soc.
85: 107-122. http://dx.doi.org/10.1016/S0007-1536(85)80160-1
Castaneda Ruiz RE 1985. Deuteromycotina de Cuba. Hyphomycetes II. Cuba: Instituto de
Investigaciones Fundamentales en Agricultura Tropical. 23 p.
Castaneda Ruiz RFE. 2005. Metodologia en el estudio de los hongos anamorfos. 182-183, in: Anais
do V Congresso Latino Americano de Micologia. Brasilia.
Deighton FC, Pirozynski KA. 1972. Microfungi. V. More hyperparasitic hyphomycetes. Mycol. Pap.
128: 1-110.
Ellis MB. 1971. Dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew, Surrey.
Ellis MB. 1976. More dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew,
Surrey.
Figueras MJ, Guarro J. 1988. A scanning electron microscopic study of ascoma development in
Chaetomium malaysiense. Mycologia 80: 298-306. http://dx.doi.org/10.2307/3807625
Hughes SJ. 1979. New Zealand Fungi 25. Miscellaneous species. New Zealand J. Bot. 16: 311-370.
http://dx.doi.org/10.1080/0028825X.1978.10425143
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the fungi. 10th ed. CABI, UK,
Wallingford.
Pirozynski KA, Hodges Jr CS. 1973. New hyphomycetes from South Carolina. Can. J. Bot. 51:
157-173. http://dx.doi.org/10.1139/b73-024
Rzedowski J. 1996 Analisis preliminar de la flora vascular de los bosques mesofilos de montafia de
México. Acta Botanica Mexicana 35: 25-44.
Siboe GM, Kirk PM, Cannon PE. 1999. New dematiaceous hyphomycetes from Kenya rare plants.
Mycotaxon 73: 283-302.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.235
Volume 125, pp. 235-241 July-September 2013
A new coprophilous Gilmaniella species from Malaysia
TEIK-KHIANG GOH", Li-LING LEE? & KAH-CHENG TEO?
"Centre for Biodiversity Research, Department of Agricultural and Food Science &
*Centre for Biodiversity Research, Department of Biomedical Science
Faculty of Science, Universiti Tunku Abdul Rahman,
Bandar Barat, 31900 Kampar, Perak, Malaysia
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Gilmaniella nyukfahii sp. nov., collected from cow dung in Malaysia, is described
and illustrated. It differs from other Gilmaniella species in having globose conidia with 5-7
distinct germ pores.
Key worps — dung fungi, dematiaceous hyphomycete, mitosporic fungi, saprotroph,
taxonomy
Introduction
Species of Gilmaniella G.L. Barron (Barron 1964) are fungi that produce
masses of dematiaceous conidia from superficial semi-macronematous and
mononematous conidiophores (Ellis 1971). The conidia are unicellular, with
one or several distinct germ pores (Umali et al. 1998). There are eight reported
species of Gilmaniella (Index Fungorum 2013). Umali et al. (1998) reviewed
and keyed the seven Gilmaniella species known at that date. Dubey et al. (2011)
described a foliicolous species, G. indica Dubey et al., in which the conidia have
a single germ pore similar to those of G. humicola G.L. Barron.
During a survey of fungal diversity from cow dung in Malaysia, we found
an undescribed species of Gilmaniella in cow dung samples incubated at 28°C.
This species is described here and compared with other Gilmaniella spp.; its
holotype is conserved at the herbarium of the Centre for Biodiversity Research,
Faculty of Science, Universiti Tunku Abdul Rahman (Perak campus), Kampar,
Malaysia (UTAR).
Taxonomy
Gilmaniella nyukfahii Goh, L.L. Lee & K.C. Teo, sp. nov. Figs 1-11
MycoBank MB804095
236 ... Goh, Lee & Teo
bs *
Fics 1-5. Gilmaniella nyukfahii (holotype). 1. Conidia from natural substratum, scattered among
hyphae of other fungi (e.g., zygomycetes) and bacterial mass. 2. Conidia, each with multiple germ
pores. 3. Conidium with six visible germ pores; arrow points to a protruding germ pore; the conidial
wall is somewhat roughened. 4. Conidia with germ pores; the conidiophore (arrowed) is delicate,
hyaline, and hypha-like. 5. Developing and near-mature conidia (showing germ pores); the conidia
are thick-walled (arrowed). Scale bars: 1 = 20 um; 2,5 = 10 um; 3 =5 um; 4 = 15 um.
Differs from other species of Gilmaniella in having conidia with 5-7 distinct germ
pores.
Type: Malaysia. Perak, Kampar, on cow dung incubated at 28°C, November 2012, Li-
Ling Lee, (Holotype, UTAR(M)-0001).
Erymo.oey: nyukfahii, derived from the name of the second author’s uncle, Nyuk Fah
Lee, for his financial support of her studies at UTAR, Malaysia.
Colonies on natural substratum effuse, grayish, mycelium superficial and
immersed; stroma none; setae and hyphopodia absent; aerial hyphae absent;
conidiophores micronematous to semi-macronematous, mononematous,
straight or flexuous, thin-walled and delicate, smooth, hyaline, 0-3-septate, up
to 5 um long and ca. 0.2-0.5 um wide; conidiogenous cells monoblastic and
polyblastic, integrated, terminal and intercalary, determinate, hyaline; conidia
holoblastic, acropleurogenous, solitary, globose, 10-13 um in diameter, one-
Gilmaniella nyukfahii sp. nov. (Malaysia) ... 237
“ i‘, ¥
2 VA. ¥
< ,
a °
‘ A
q ‘ \
. y m4
J.
WATS)
< WEN YL
a. Pm
Fics 6-7. Gilmaniella nyukfahii (holotype, SEM). 6. Conidia on surface of natural
substratum. 7. Conidial germ pore which is polygonal in surface view; the conidial wall is
rugose in texture. Scale bars: 6 = 20 um; 7 = 1 um.
celled, thick-walled, slightly rugose or verrucose, yellowish or pale olivaceous
brown when mature, with 5-7 distinct, somewhat protruding, polygonal germ
pores which are ca. 0.5-0.8.5 um diam.; conidial secession schizolytic.
238 ... Goh, Lee & Teo
| ee Eibees ) ae
Fics 8-9. Gilmaniella nyukfahii (holotype, SEM). 8. Conidium still attached to the delicate
conidiophore (arrowed). 9. Conidiophore, which is smooth-walled and septate (arrowed).
Scale bars: 8 = 5 um; 9 = 1 um.
CoMMENTS— Superficially, Gilmaniella nyukfahii resembles Trichocladium
ismailiense Moustafa & Ezz-Eldin, which also produces dematiaceous conidia
with several germ pores (Moustafa & Ezz-Eldin 1990, Goh & Hyde 1999).
However, the conidial development in Trichocladium is holothallic (sensu Cole
Gilmaniella nyukfahii sp. nov. (Malaysia) ... 239
Fics 10-11. Gilmaniella nyukfahii (holotype, SEM). 10. Conidium with multiple, somewhat
protruding, distinct germ pores. 11. Conidia with germ pores; cocci and rod-shaped bacterial
cells (arrowed) are visible clinging to the conidial surface. Scale bars = 5 um.
& Samson 1979), whereas in Gilmaniella it is mono- or polyblastic. Additionally,
in accepted species of Trichocladium, conidia are septate (Goh & Hyde 1999),
whereas conidia of Gilmaniella species are unicellular (Umali et al. 1998).
240 ... Goh, Lee & Teo
Among the eight previously described Gilmaniella species, only
G. multiporosa Moustafa & Ezz-Eldin is similar to G. nyukfahii in having
conidia with more than one germ pore. However, G. multiporosa differs from
our new species in several characters: habitat (soil), conidial shape (clavate to
pyriform), conidial formation (clustered or catenate), and number of germ
pores per conidium (1-4, mostly 2-3; Moustafa & Ezz-Eldin 1989).
In addition to producing conidia with 5-7 distinct germ pores, G. nyukfahii
is also unique in its conidiophores, which are slim and delicate, and the details
of which can be revealed only under the electron microscope.
Under the scanning electron microscope, the spore wall of G. nyukfahii
appears slightly rugose and is coated with dung debris. Some bacterial cells
(cocci and rods) adhering to the hyphae and spores are commonly observed
in this habitat.
We have attempted unsuccessfully to grow G. nyukfahii in culture. At least
20 single spores of this species were isolated from its natural substratum using
the method described by Goh (1999), but none germinated, whether on water
or cow dung agar (Bills & Foster 2004). The failure of spore germination on
artificial media might be due to the lack of certain environmental conditions or
specific nutrient requirements for this particular species, which were not met
in this study.
Acknowledgements
The authors would like to thank the two peer reviewers of this paper: Dr. EHC
McKenzie (Landcare Research, Auckland, New Zealand) and Dr. Clement KM Tsui
(Department of Forest Sciences, University of British Columbia, Canada) for their
valuable comments on the manuscript. Thanks are extended to Mr. Ooh Keng Fei
(Faculty of Science, UTAR — Perak Campus) for his technical assistance in the scanning
electron microscopy. Li-Ling Lee would like to thank her uncle, Mr. Nyuk Fah Lee, for
his financial support of her studies at UTAR, Malaysia.
Literature cited
Barron GL. 1964. A new genus of hyphomycetes from soil. Mycologia 56: 514-518.
http://dx.doi.org/10.2307/3756356
Bills GE, Foster MS. 2004. Formulae for selected materials used to isolate and study fungal allies.
595-618, in: GM Mueller et al. (eds). Biodiversity of fungi: inventory and monitoring methods.
London, Academic Press.
Cole GT, Samson RA. 1979. Patterns of development of conidial fungi. Pitman, London.
Dubey RK, Rai AN, Shrivastava S, Verma NK. 2011. Two new records of hyphomycetes from India.
Indian Phytopathology 64: 390-391.
Ellis MB. 1971. Dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew, Surrey,
England.
Goh TK. 1999. Single-spore isolation using a hand-made glass needle. Fungal Diversity 2: 47-63.
Goh TK, Hyde KD. 1999. A synopsis of Trichocladium species, based on the literature. Fungal
Diversity 2: 101-118.
Gilmaniella nyukfahii sp. nov. (Malaysia) ... 241
Index Fungorum. 2013. http://www.indexfungorum.org/names/Names.asp (Accessed 3 Oct.
2013).
Moustafa AF, Ezz-Eldin EK. 1989. Gilmaniella multiporosa, a new dematiaceous hyphomycete from
Egyptian soils. Mycological Research 92: 502-505.
http://dx.doi.org/10.1016/S0953-7562(89)80200-X
Moustafa AF, Ezz-Eldin EK. 1990. Trichocladium ismailiense, a new dematiaceous hyphomycete
from Egyptian soils. Nova Hedwigia 50: 255-259.
Umali TE, Goh TK, Hyde KD. 1998. A new species of Gilmaniella from Hong Kong. Mycological
Research 102: 435-438. http://dx.doi.org/10.1017/S0953756297004966
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.243
Volume 125, pp. 243-249 July-September 2013
Hygrocybe griseobrunnea, a new brown species from China
CHAO-QUN WANG »”3, Tar-Hut Li»? & BIN SONG ”
' South China Botanical Garden, Chinese Academy of Sciences, Guangzhou 510650, China
’ State Key Laboratory of Applied Microbiology,
South China (The Ministry—Province Joint Development),
Guangdong Institute of Microbiology, Guangzhou 510070, China
° University of Chinese Academy of Sciences, Beijing 100049, China
“ CORRESPONDENCE TO:
[email protected]
ABSTRACT — Hygrocybe griseobrunnea, a new species in Hygrocybe subsect. Squamulosae,
is described and illustrated based on the morphological characters and molecular data. The
fungus is characterized by numerous greyish brown to brown or dark brown squamules on
the pileus surface, adnate to shortly decurrent lamellae, and a trichodermal pileipellis.
Key worps — Basidiomycetes, Hygrophoraceae, taxonomy
Introduction
The genus Hygrocybe (Fr.) P. Kumm. (Hygrophoraceae, Agaricales,
Basidiomycota) is distributed worldwide, with ~150 accepted species (Kirk et al.
2008) and ~670 proposed names (http://www.indexfungorum.org). Hygrocybe
sect. Squamulosae (Bataille) Singer is characterized by the dry fruitbody,
squamulose or tomentose pileus, smooth stipe, and trichodermal pileipellis (at
least in the pileus centre) (Boertmann 2010). More than 15 species in subsect.
Squamulosae have been reported from different parts of the world (Singer 1986,
Arnolds 1995, Borgen & Senn-Irlet 1995, Desjardin & Hemmes 1997, Young
& Wood 1997, Borgen & Arnolds 2004, Cantrell & Lodge 2004, Leelavathy et
al. 2006, Boertmann 2010, Ronikier & Borgen 2010, Vrinda et al. 2013). Only
three species of the subsection — Hygrocybe cantharellus (Schwein.) Murrill,
H. coccineocrenata (PD. Orton) M.M. Moser, and H. turunda (Fr.) P. Karst.
— have been recorded from China (Zeng & Yang 1991, Bi et al. 1993, Shao &
Xiang 1997, Chen & Li 2013).
Recently, a representative of subsect. Squamulosae was collected and studied
during an investigation of the agaric flora in Chebaling National Nature Reserve,
Guangdong province, China. Morphological examinations and molecular
244 ... Wang, Li & Song
analyses based on the internal transcribed spacer (ITS) sequences indicate that
the fungus is distinct from any other known species of Hygrocybe; it is therefore
described here as a new species.
Materials & methods
Specimens were photographed and annotated in the field and then dried in an electric
oven. Macroscopic depictions were gained from the original field notes and photographs.
The holotype is preserved in the Fungal Herbarium of the Guangdong Institute of
Microbiology (GDGM). Colour descriptions are according to Kornerup & Wanscher
(1978). Tissue sections were immersed in 5% potassium hydroxide (KOH) or 1% Congo
Red for microscopical examination. From a mature specimen, 20 basidiospores and 10
basidia were randomly selected and measured in KOH. The notation (a—)b-c(-d) is
used to describe basidiospore dimensions where the range b-c represents 90% or more
of the measured values, and a and d are the extreme values. The length/width ratio of
spores and basidia is presented as Q, and the mean ratio is presented as Q_. Elements of
immersed pileipellis, stipitipellis, and hymenophoral trama are also described.
Genomic DNA was extracted from the herbarium specimen using the Sangon
Fungus Genomic DNA Extraction kit according to the manufacturer’s instructions
(Sangon Biotech Co., Ltd., Shanghai, China). The ITS region was amplified by PCR, using
universal primers ITS1F and ITS4 (White et al. 1990, Gardes & Bruns 1993). Amplified
products were electrophoresed on 1% agarose gels with a known standard DNA marker
and directly sequenced by Beijing Genomic Institute (BGI), and the holotype sequence
was submitted to GenBank. These and GenBank reference sequences were used in
phylogenetic analysis after being edited and aligned using Clustal 1.81 (Thompson et
al. 1997) and MEGAS.1 (Tamura et al. 2011). The dataset was analyzed with maximum
parsimony by PAUP* 4.0b10 (Swofford 2003) following He & Li (2013).
Taxonomy
Hygrocybe griseobrunnea T.H. Li & C.Q. Wang, sp. nov. Fics 1-2
MycoBank MB 804041
Differs from Hygrocybe caespitosa by its applanate pileus with a partly uplifted margin,
longer basidia, and shorter spores and from H. melleofusca by its shorter spores and
rarity of clamp connections in its hymenophoral trama.
Type: China, Guangdong Province, Chebaling National Nature Reserve, 27 August 2010,
B. Song, C.S. Qiu & H. Huang (Holotype, GDGM 28755; Genbank, KC914883).
ErymMo_oey: from Latin, griseus = grey, brunneus = brown.
PiLEus 16-32 mm broad, slightly convex when young, expanding to applanate
with a partly uplifted margin, often cracked or even perforated in the centre
with age, weakly striate from the margin to half way to the centre when mature,
with greyish brown to brown or dark brown (6E3-5, 6F4—-8) squamules on
orange-grey to brownish grey (6B2, 6C2, 6D2) background, often with some
very slight purple to violet (14A2, 15A2, 16A2) tint here and there, becoming
paler grey (6B1, 6C1, 6D1) surface where the exfoliated scales have fallen off
Hygrocybe griseobrunnea sp. nov. (China) ... 245
/ Dh 4
Fic. 1. Hygrocybe griseobrunnea (holotype). Basidiomata in situ.
with age, usually fissile, and with violet-grey to greyish violet (18B2-3, 18C2-3)
tint at margin. LAMELLAE adnate to short-decurrent, waxy, transparent, thick,
fragile, up to 3 mm broad, concolorous at edge, white or near so, sometimes
inconspicuously yellowish white (4A2 to 5A2), partially violet-white (18A2)
especially near the pileus margin, with about 4 complete lamellae per cm,
and usually with 1-3 lamellulae of different lengths between two complete
lamellae. StrpE 12-28 x 3-6.5 mm (the length often shorter than the pileus
diameter), central, hollow, terete or more often compressed terete, usually with
a narrower base, in large fruitbodies irregularly furrowed, smooth, occasionally
curved at base, white to pale violet or violet-grey to greyish violet (18A1-3,
18B2-3), becoming brownish orange to light brown (6C3, 6D4) at lower part
when mature. CONTEXT thin, concolourous with the lamellae, fragile. SMELL
insignificant.
BASIDIOSPORES 6.0-8.5(—9.0) x 4.0-6.5(-7.0) um, Q = 1.1-1.6, Q. = 1.41,
ellipsoid to oblong, smooth, thin walled, hyaline, inamyloid. Basidia narrowly
clavate, 45-63 x 8-12 um, Q = 4.9-5.6, Q. = 5.2, thin-walled, with 2 or 4
sterigmata up to 8.0 um long, with a basal clamp connection. HYMENOPHORAL
TRAMA subregular, composed of hyaline, thin-walled, cylindrical elements
(30-110 x 9-20 um), sometimes inflated, and rarely with clamp connections.
PILEIPELLIS a trichoderm, made up of septate, thin-walled hyphae about 27-75
x 6-20 um, with brown intracellular pigment, clamp connections usually absent;
underlying hyphae repent, cylindrical, devoid of any pigments. STIPITIPELLIS a
cutis, with cells 2—7 um broad.
ECOLOGY & DISTRIBUTION — On soil, in broad-leaved forest, and so far
known only from the type locality in China.
246 ... Wang, Li & Song
20 um
4 5 um
Fic. 2. Hygrocybe griseobrunnea.
1. Basidia. 2. Hymenophoral trama. 3. Elements of pileipellis. 4. Basidiospores.
CoMMENTS — Hygrocybe griseobrunnea is well characterized by its squamulose
greyish brown to brown or dark brown pileus, subregular hymenophoral
trama, and upturned pileipellis tufts. The trichodermal pileus squamules and
subregular hymenophoral trama comprising hyphae <200 um long place this
fungus in Hygrocybe subsect. Squamulosae (Borgen & Arnolds 2004, Boertmann
2010).
Hygrocybe griseobrunnea sp. nov. (China) ... 247
Hygrocybe brunneosquamulosa Leelav. et al., described from India, is similar
to H. griseobrunnea in sharing a grey-brown pileus with darker brown scales and
sometimes having a central perforation in the mature pileus, but the two species
are quite different because H. brunneosquamulosa has bright yellow, greyish
brown or olive-brown lamellae, light yellow, amber-yellow or egg-yellow stipe,
longer spores (7-10.5(-11) x 4.5-6.5(-7.5) um), clamp-connections present
in all parts of the basidioma, and numerous dark yellow-brown intracellular
pigment in all tissues (Leelavathy et al. 2006; P. Manimohan, unpublished
photo). Hygrocybe caespitosa Murrill, described from North America, also
with a brownish squamulose pileus, is distinguished by its convex to obconic
pileus with an inrolled margin, sinuate lamellae, yellow context, longer spores
Chrysomphalina chrysophllaDQ192180
Chromosera cyanophylla DQ486688 Outgroup
Chromosera viola EU784352
Hygrocybe griseobrunnea KC9 14883
uo Hygrocybe caespitosa KF291104
100
_ Hygrocybe melleofusca KF291154
Hygrocybe cantharellus FM2 08884
100
Hygrocybe cantharellus FM208865 Subsection Squamulosae
99
79 Hygrocybe turunda FM208899
Hygrocybe miniata FM208866
100
Hygrocybe miniata FM2088 667
73
56 Hygrocybe miniata FM208886
Hygrocybe quieta FM208864 Subsection Siccae
100
Hygrocybe quieta FM208877
Hygrocybe persistens FM208 893
85 Hygrocybe spadicea FM208879
Hygrocy be persistens FM208871
78 Hygrocybe persis tens FM208872
100
Hygrocy be persis tens FM208852
Hygrocybe conica FM208882
Peroni conica FM208862
yaotybe conica FM208861 Subgenus Hygrocybe
i: Hygrocybe chlorophana FM208856
DE Seine chlorophana FM208857
Hygrocybe chlorophana FM208855
Hygrocybe intermedia FM208888
38 Hygrocybe citrinovirens FM208 853
100
10 Hygrocybe citrinovirens FM208889
Fic. 3. The phylogenetic tree obtained from Maximum Parsimony analysis of ITS sequences of
Hygrocybe species. Chromosera cyanophylla, C. viola, and Chrysomphalina chrysophylla were
selected as outgroup. Parsimony bootstrap values (>50%) are shown. The unpublished ITS
sequences of H. caespitosa and H. melleofusca were provided by Dr. D. Jean Lodge.
248 ... Wang, Li & Song
(7.5-10 x 5-6.5 um), and smaller basidia (34.5-43 x 6-7.5 um) (Murrill 1914,
Cantrell & Lodge 2004). Hygrocybe melleofusca Lodge & Pegler, described from
Puerto Rico, which resembles the new species with its dull coloured and often
perforated pileus, has longer spores (7.8-10(-12) x 5-7(-8) um) and prominent
clamp-connections in the hymenophoral trama (Lodge & Pegler 1990).
The phylogenetic analysis (Fic. 3) clusters H. griseobrunnea, H. caespitosa,
and H. melleofusca in the same clade with a 100% bootstrap value. This well-
supported clade is sister to the clade with H. turunda (type species of subsect.
Squamulosae). Bootstrap support for subsection Squamulosae (excluding
H. miniata) is 100%, indicating that H. griseobrunnea belongs in the same
subsection as H. caespitosa and H. melleofusca. Unfortunately, we were
unable to obtain sequences from H. brunneosquamulosa. Furthermore, the
ITS sequences of the Hygrocybe species formed two separated sister genetic
groups that correspond to the two subgenera (Hygrocybe and Pseudohygrocybe)
distinguished by morphological features (85% bootstrap support).
Acknowledgments
Sincere thanks are given to Dr. D. Jean Lodge and Dr. Genevieve Gates for reviewing
the manuscript. Dr. P.) Manimohan is acknowledged for providing the photo of
H. brunneosquamulosa. Thanks are also given to Dr. J.F. Liang for his constructive advice
in improving this manuscript. Acknowledgements are sincerely expressed to Mr. CS.
Qiu and H. Huang for collecting the specimen. This study was financed by the National
Natural Science Foundation of China (No. 31170026, 31070024) and the Ministry of
Science and Technology of China (No. 2013FY111200).
Literature cited
Arnolds E. 1995. Hygrophoraceae (Agaricales) in New York State and adjacent areas. 1. Introduction
and Hygrocybe subsect. Squamulosae. Mycotaxon 53: 1-27.
Bi ZS, Zheng GY, Li TH. 1993. The macrofungus flora of China's Guangdong province. Hong Kong,
China, The Chinese University Press.
Boertmann D. 2010. The genus Hygrocybe, 2™ revised edition. The Danish Mycological Society,
Denmark. 200 pp.
Borgen T, Arnolds E. 2004. Taxonomy, ecology and distribution of Hygrocybe (Fr.) P. Kumm. and
Camarophyllopsis Herink (Fungi, Basidiomycota, Hygrocybeae) in Greenland. Meddelelser om
Gronland, Bioscience 54: 1-68.
Borgen T, Senn-Irlet B. 1995. Hygrocybe glacialis spec. nov. and notes on subsection Squamulosae
based on collections from Switzerland. Doc. Mycol. 98(100): 91-102.
Cantrell SA, Lodge DJ. 2004. Hygrophoraceae (Agaricales) of the Greater Antilles: Hygrocybe
subgenus Pseudohygrocybe sections Coccineae and Neohygrocybe. Mycol. Res. 108(11):
1301-1314.
Chen JL, Li Y. 2013. The checklist of species in Hygrophoraceae from China and their distribution.
Journal of Fungal Research 11(1): 3-13.
Desjardin DE, Hemmes DE. 1997. Agaricales of the Hawaiian Island 4: Hygrophoraceae. Mycologia.
89(4): 619-638.
Hygrocybe griseobrunnea sp. nov. (China) ... 249
Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes-application
to the identification of mycorrhizae and rusts. Mol. Ecol. 2: 113-118.
http://dx.doi.org/10.1111/j.1365-294X.1993.tb00005.x
He SH, Li HJ. 2013. Pseudochaete latesetosa and P. subrigidula spp. nov. (Hymenochaetales,
Basidiomycota) from China based on morphological and molecular characters. Mycol. Progress
12: 331-339. http://dx.doi.org/10.1007/s11557-012-0838-6
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi,
10" edition. Wallingford, CABI Publishing.
Kornerup A, Wanscher JH. 1978. Methuen handbook of colour. London, Eyre Methuen.
Leelavathy KM, Manimohan P, Arnolds EJM. 2006. Hygrocybe in Kerala State, India. Persoonia
19(1): 101-151.
Lodge DJ, Pegler DN. 1990. Hygrophoraceae of the Luquillo Mountains of Puerto Rico. Mycol. Res.
94(4): 443-456.
Murrill WA. 1914. Illustrations of fungi - XVIII. Mycologia. 6: 1-4.
Ronikier A, Borgen T. 2010. Notes on Hygrocybe subsection Squamulosae from Poland. Polish Bot.
J. 55(1): 209-215.
Shao LP, Xiang CD. 1997. Forest mushrooms of China. Harbin, Northeast Forestry University
Press.
Singer R. 1986. The Agaricales in modern taxonomy. Koenigstein, Koeltz Scientific Books.
Swofford DL. 2003. PAUP”: phylogenetic analysis using parsimony (*and other methods) version
4.0b10. Sunderland, Sinauer.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGAS5: Molecular
evolutionary genetics analysis using maximum likelihood, evolutionary distance, and
maximum parsimony methods. Molecular Biology and Evolution 28(10): 2731-2739.
http://dx.doi.org/10.1093/molbev/msr121
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The CLUSTAL X windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res. 25: 4876-4882.
Vrinda KB, Varghese SP, Pradeep CK. 2013. Hygrocybe rubida, a new species from Kerala State,
India. Mycoscience 54(4):271-273. http://dx.doi.org/10.1016/j.myc.2012.10.003
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenies. 315-322, in: Innis MA, Gelfand DH, Sninsky JJ, White TJ (Eds.),
PCR protocols: A Guide to Methods and Applications. San Diego, Acad. Press.
Young AM, Wood AE. 1997. Studies on the Hygrophoraceae (Fungi, Homobasidiomycetes, Agaricales)
of Australia. Australian Systematic Botany 10: 911-1030. http://dx.doi.org/10.1071/SB96005
Zeng XL, Yang WS. 1991. Hygrophoraceae of Jilin province. Journal of Northeast Normal University
257 1=78.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.251
Volume 125, pp. 251-256 July-September 2013
Xylaria in southern China - 8. X. bannaensis sp. nov.
and X. brunneovinosa new to the mainland
Hai-x1A MA’, LARISSA VASILYEVA? & Yu Li?*
' Institute of Tropical Bioscience and Biotechnology,
Chinese Academy of Tropical Agricultural Sciences, Haikou 571101, China
? Institute of Mycology, Jilin Agricultural University, Changchun 130118, China
> Institute of Biology & Soil Science, Far East Branch of the Russian Academy of Sciences,
Vladivostok 690022, Russia
* CORRESPONDENCE TO:
[email protected]
ABSTRACT—Two Xylaria species associated with termite nests in China are reported. Xylaria
bannaensis is described as a species new to science, and X. brunneovinosa is reported for
the first time from Mainland China. The morphological descriptions and photographs of
stromata and microstructures are provided based on Chinese materials.
Key worps—Ascomycota, Xylariaceae, Xylariales
Introduction
Many Xylaria species are frequently found emerging from termite nests,
a long acknowledged association (Petch 1906). Many mycologists have been
interested in the relationships between fungi and termites (Petch 1913, Lloyd
1918a,b, 1924, Dennis 1956, 1958, 1961, Boedijn 1959, Sands 1969, Heim 1977,
Batra & Batra 1979, Rogers et al. 1987, Wood & Thomas 1989, Whalley 1996,
Ju & Rogers 1999, Rogers et al. 2005, Ju & Hsieh 2008). Xylaria species are
considered to function as either saprotrophs, inhabiting the comb material and
competing with species of the agaric Termitomyces R. Heim for nutrients (Sands
1969, Heim 1977, Wood & Thomas 1989), or symbionts, making the comb
material suitable for growth of both fungus and termite (Batra & Batra 1979).
The diversity of termitophilous Xylaria species in China is still poorly known
(Tai 1979, Abe & Liu 1995), and further investigations are highly desirable.
Materials & methods
Examined specimens are deposited in Herbarium of Mycology of Jilin Agricultural
University (HMJAU). Microscopic features and measurements were made from slide
252 ... Ma, Vasilyeva & Li
preparations mounted in water and Melzer’s iodine reagent. The photographs of
asci, ascal apical rings, and ascospores were taken by using a VHX-600E microscope
(Keyence Corporation). The photographs of stromatal surface were taken with a
ZSA30w microscope and $70 Canon camera.
Taxonomy
Xylaria bannaensis H.X. Ma, Lar.N. Vassilyeva & Yu Li, sp. nov. FIG. 1
MycoBank MB803942
Differs from Xylaria arenicola by its stromatal surface, cylindrical stromata and larger
apical ring; and from X. nigripes by its larger ascospores.
Type: China, Yunnan Province: Mengla County, Xishuangbanna Tropical Botanical
Garden, 21°43'N 101°26’E, alt. 500 m, on ground, 10 Aug 2010, Haixia Ma (Holotype,
HMJAU 23549).
EryMo oey: Refers to the place where the fungus was collected.
STROMATA unbranched, cylindrical, with rounded fertile apices, on long
glabrous longitudinally wrinkled and deeply rooted stipes, 7-10 cm total length
x 2.5-5 mm diam., externally dark brown to black, internally at first probably
white, and eventually entirely black; texture very hard; surface wrinkled,
somewhat cracked, roughened with perithecial mounds. Perithecia ovoid,
0.4-0.6 mm diam.; ostioles papillate. Asci eight-spored, cylindrical, long-
stipitate, 60-90(-95) um total length x 4—5.5 um, the spore-bearing part 40-45
uum long, with apical ring bluing in Melzer’s iodine reagent, minute, 1-1.3 um
high x 1-1.6 um broad. Ascospores brown to dark brown, unicellular, ellipsoid-
inequilateral, smooth, (5.5-)6-7(-7.5) x 3-4 um, with straight germ slit more
or less spore-length.
ComMENTs —Xylaria bannaensis resembles X. arenicola Welw. & Cutr.,
according to the key of Ju & Hsieh (2008), but their stromatal surfaces are
distinctly different. Xylaria arenicola has a rougher surface with protuberant
perithecia, unlike the somewhat cracked and wrinkled surface of X. bannaensis.
Compared to the distinctly cylindrical X. bannaensis stroma, that of X. arenicola
is more flattened. Finally X. arenicola has a slightly smaller apical ring (both
height and width are <1 um; Rogers et al. 2005).
Xylaria arenicola was listed as a synonym (Dennis 1958) or a variety (Dennis
1961) of X. nigripes (Klotzsch) Cooke. Xylaria bannaensis resembles X. nigripes
in stromatal morphology, but X. nigripes has smaller ascospores ((3.5-)4.5-5
(-6) x 2-3 um; Rogers et al. 2005).
Xylaria brunneovinosa Y.M. Ju & H.M. Hsieh, Mycologia 99(6):
941. 2008 [“2007”] Frg:2
STROMATA unbranched or sparsely branched from the base, long cylindrical
to cylindric-clavate, sometimes flattened, with long sterile and acutely tapered
Xylaria bannaensis sp. nov. (China) ... 253
bead
Fic. 1. Xylaria bannaensis (Holotype): a. Stromata; b. Fertile stromatal heads; c. Stromatal
surface; d. Ascospores; e. Asci; f. Ascal apical ring (violet). Scale bars: a, b = 1 cm; c = 0.5 mm;
d,e,f=5 um.
apices, on short or long, glabrous rooting black stipes, 3.5-7 cm total length
x 1-5(-7) mm broad, the fertile parts gray brown or brown vinaceous, stipes
black, interior at first white to cream, becoming ochraceous; texture very
hard; surface smooth except for conspicuous perithecial contours. Perithecia
globose, 0.3-0.4 mm diam., ostioles papillate. Asci eight-spored, cylindrical,
long-stipitate, (80-)90-130(-140) um total length x 4.5-5.5 um broad, the
spore-bearing part 43-55 um long, with apical ring bluing in Melzer’s iodine
reagent, rectangular, 2-3 um high x 1-2 um broad. Ascospores brown to dark
254 ... Ma, Vasilyeva & Li
Xylaria bannaensis sp. nov. (China) ... 255
brown, unicellular, ellipsoid-inequilateral, smooth, (5.8-)6-7(-7.5) x 4-5 um,
with straight germ slit slightly less than spore-length.
SPECIMENS EXAMINED: CHINA, YUNNAN PROVINCE: MENGLA County, Xishuangbanna
Tropical Botanical Garden, 21°42'N 101°25’E, alt. 500 m, on ground, 10 Aug 2010,
Haixia Ma (HMJAU 23577, 23578, 23579).
ComMENtTs — Xylaria brunneovinosa is easily recognizable by its narrow
cylindrical stromata and its stromatal exterior and interior colors. This
species, previously reported only from Indonesia and Taiwan, is reported for
the first time for Mainland China. The Chinese specimens are quite similar to
X. piperiformis Berk. and X. cirrata Pat. in stromatal morphology and ascospore
size, but X. brunneovinosa can be easily separated by its brown vinaceous
exterior and ochraceous interior. The ascospores of X. cirrata are usually
minutely pinched at the ends (Ju & Hsieh 2008). Xylaria piperiformis, described
from Indian material (Rogers et al. 2005), has a smaller apical ring (cuboid,
1.5 um), the shorter asci (44 um total length x 4.4 um broad), and shorter
spore-bearing part of asci (ca. 36 tm).
Acknowledgments
We greatly appreciate Dr. A.J.S. Whalley (Liverpool John Moores University) and
Dr. Xiu-Guo Zhang of (Shandong Agricultural University) for reviewing the presubmitted
manuscript and giving helpful comments and suggestions. This study was supported by
the Natural Science Foundation of Hainan Province (Grant no. 312048) and the Major
Technology Project of Hainan (ZAZX2013023-1). We are also grateful to the Chinese
Academy of Tropical Agricultural Sciences for funding the project entitled “The Project
of the Basic Scientific Research by the Central Public Welfare Institutes” (Grant no.
1630052013001). We thank Mr. Jian-chun Zhang (Jilin Agricultural University), who
accompanied the field trip and provided general help.
Literature cited
Abe Y, Liu Z. 1995. An annotated list of xylariaceous and diatrypaceous fungi collected from Mt.
Fengyangshan and Mt. Baishanzu, Zhejiang Prov. in East China. Bull. Nat. Sci. Mus. Tokyo,
Ser. B. 21: 75-86.
Batra LR, Batra SWT. 1979. Termite-fungus mutualism. 117-168, in: LR Batra (ed.). Insect-fungus
symbiosis — nutrition, mutualism and commensalism. Allanheld, Osmun & Co. Montclair.
Boedijn KB. 1959. On a new family of the Sphaeriales. Persoonia 1: 15-19.
Dennis RWG. 1956. Some xylarias of tropical America. Kew Bulletin 11: 401-444.
http://dx.doi.org/10.2307/4109126
Dennis RWG. 1958. Some xylosphaeras of tropical Africa. Revista de Biologia 1: 175-208.
Dennis RWG. 1961. Xylarioideae and Thamnomycetoideae of Congo. Bull. Jard. Bot. Etat Bruxelles
31: 109-154.
Fic. 2. Xylaria brunneovinosa (HMJAU 23578): a, b. Stromata; c. Fertile parts of stromata;
d, e. Stromatal surface; f, i. Asci; g. Ascospores; h. Ascal apical ring (violet). Scale bars: a, b = 1 cm;
c=5mm;d=0.5 mm; e=0.2 mm; f= 30 um; g,h =5 um; i=10 um.
256 ... Ma, Vasilyeva & Li
Heim R. 1977. Termites et champignons. Bouhée, Paris. 207 p.
Ju YM, Hsieh HM. 2008 [“2007”]. Xylaria species associated with nests of Odontotermes formosanus
in Taiwan. Mycologia 99: 936-957. http://dx.doi.org/10.3852/mycologia.99.6.936
Ju YM, Rogers JD. 1999. The Xylariaceae of Taiwan (excluding Anthostomella). Mycotaxon 73:
343-440.
Lloyd CG. 1918a. Xylaria notes no. 1: 1-16. Mycol. Writ. 5.
Lloyd CG. 1918b. Xylaria notes no. 2: 17-32. Mycol. Writ. 5.
Lloyd CG. 1924. Mycological notes no. 71. Mycol. Writ. 7: 1237-1268.
Petch T. 1906. The fungi of certain termite nests. Ann. R. Bot. Gard., Peradeniya 3: 185-270.
Petch T. 1913. Termite fungi: a résumé. Ann. R. Bot. Gard., Peradeniya 5: 303-341.
Rogers JD, Callan BE, Samuels GJ. 1987. The Xylariaceae of the rain forests of North Sulawesi
(Indonesia). Mycotaxon 29: 113-172.
Rogers JD, Ju YM, Lehmann J. 2005. Some Xylaria species on termite nests. Mycologia 97: 914-923.
http://dx.doi.org/10.3852/mycologia.97.4.914
Sands WA. 1969. The association of termites and fungi. 495-524, in: K Krishna, FM Weesner (eds).
Biology of termites. Vol. I. New York: Academic Press, New York.
Tai FL. 1979. Sylloge fungorum Sinicorum. Science Press, Peking. 1527 p.
Whalley AJS. 1996. The xylariaceous way of life. Mycol. Res. 100: 897-922.
http://dx.doi.org/10.1016/S0953-7562(96)80042-6
Wood TG, Thomas RJ. 1989. The mutualistic association between Macrotermitinae and
Termitomyces. 69-92, in: N Wilding et al. (eds). Insect-fungus interactions. Academic Press,
London. http://dx.doi.org/10.1016/B978-0-12-751800-8.50009-4
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.257
Volume 125, pp. 257-262 July-September 2013
A new species of Scutellinia from Mexico
LAURA IZQUIERDO-SAN AGUSTIN’, SIGFRIDO SIERRA’, IBETH RODR{GUEZ-
GUTIERREZ’, SANDRA CASTRO-SANTIUSTE’ & JOAQUIN CIFUENTES?*
'Lab. Taxonomia de Hongos Tremeloides (Heterobasidiomycetes), Fac. de Ciencias,
’Lab. Sistematica y Ecologia de Micorrizas, Instituto de Biologia,
*Lab. Biodiversidad y Biogeografia Ecologica de Hongos, Fac. de Ciencias, &
‘Secc. de Micologia Herbario FCME, Fac. de Ciencias,
UNAM, A.P. 70 -181, Coyoacan, C.P. 04510 México, D.F., México
* CORRESPONDENCE TO:
[email protected]
Asstract — Scutellinia ulloae sp. nov., collected on soil from Temascaltepec in central
Mexico near Nevado de Toluca (aka Xinantécatl) volcano, is described and illustrated.
A unique tuberculate ascospore ornamentation distinguishes the new species from the
approximately 60 other known Scutellinia taxa.
Key worps — Pezizales, biological diversity, Neovolcanic Axis
Introduction
In his Scutellinia monograph, Schumacher (1990) recognized 45 species
and 2 subgenera: Scutellinia and Legalia. More recent descriptions of 16 new
taxa — S. ahmadiopsis (Zhuang 2005b), S. alleghenensis (Moravec 1989),
S. beijingensis (Zhuang 2005b), S. citrina (Yao & Spooner 1995), S. crinita var.
discreta (Matoéec et al. 2005), S. fujianensis (Cao & Moravec 1989), S. jejuensis
(Han et al. 2010), S. jilinensis (Yu et al. 2000), S. kerguelensis var. microspora
(Zhuang 2005b), S. korfiana (Zhuang 2005a), S. laevispora (Moravec 1997),
S. orientalis (Choi et al. 2013), S. sinensis (Liu & Peng 1996), S. sinosetosa
(Zhuang & Wang 1998), S. totaranuiensis (Moravec 1996), and S. tuberculata
(Matocec 2000) — have brought the world total to approximately 60 recognized
species.
With a surface area of two million km’, Mexico is one of world’s five most
megadiverse countries, encompassing 10% of the world’s biodiversity (Sarukhan
1995). Guzman (1998) has estimated the number of fungal species in Mexico
at close to 200,000. In Mexico, six species of Scutellinia have been recorded:
258 ... Izquierdo-San Agustin & al.
S. asperrima (Seaver) Le Gal, S. cubensis (Berk. & M.A. Curtis) Gamundi,
S. scutellata (L.) Lambotte, S. setosa (Nees) Kuntze, S. trechispora (Berk. &
Broome) Lambotte, and S. umbrorum (Fr.) Lambotte (Denison 1959; Vazquez
del Mercado 1977; Welden etal. 1979; Frutis & Guzman 1983; Chacon & Guzman
1984; Guzman-Davalos & Trujillo-Flores 1984; Portugal et al. 1985; Bautista et
al. 1986; Medel & Chacon 1988; Téllez-Bafuelos et al. 1988; Esqueda-Valle et
al. 1992; Pompa-Gonzalez & Cifuentes 1991; Montafiez 1999; Valenzuela et al.
2004; Chanona-Goémez et al. 2007). We describe below another new species
originally collected in 1988 from the southern part of the Neovolcanic Axis
belonging to Estado de Mexico (Ferrusquia-Villafranca 1993).
Materials & methods
The only specimen of our new species (with three apothecia) was examined using
standard mycological techniques (Schumacher 1990; Cifuentes et al. 1986; Izquierdo-San
Agustin 2008) and deposited in the Herbarium FCME. The type specimen was prepared
for scanning electron microscopy according to the methods described by Zhuang
(2005b). Colors are from Methuen Handbook of Colour (Kornerup & Wanscher 1978).
We attempted to extract DNA for molecular analysis. One apothecium was used in this
process and no electrophoretic bands were detected even after PCR amplification. We
decided not to sacrifice more apothecia.
Taxonomy
Scutellinia ulloae L. Izquierdo, S. Sierra, Rodr.-Gut., C.-Santiuste &
Cifuentes, sp. nov. Fig. 1
MycoBAnk 800696
Differs from Scutellinia chiangmaiensis by a spore ornamentation of cylindrical to
obpyriform tubercles that are slightly constricted at the base and slightly connected by
small ridges that do not form a true reticulum.
Type — Mexico, Estado de Mexico, Mpio. de Temascaltepec, km 71 carretera Toluca-
Tejupilco, desviacidn a Presa Chica (19°02'14"N 100°03'00"W), alt. 1950 m, on soil,
ground, 23 IX 1988, Hilario y Villegas 1130 (Holotype, FCME 14557).
ErymMo.ocy — In honor to the eminent Mexican mycologist Dr. Miguel Ulloa, who has
contributed extensively to the knowledge of Mexican ascomycete biota.
APOTHECIA discoid, sessile, 1-4 mm in diam., hymenium surface reddish
orange (Methuen 7A8), receptacle (external surface) off-white, side straight
and cartilaginous consistency, covered with brown hairs; MARGINAL HAIRS
648-1224 x 18-35(-41) um, wall 3-3.5 mm, brown, unbranched, non-septate,
although there are bifurcate bases, there is no difference between marginal
hairs and lateral hairs; ECTAL EXCIPULUM of subangular, isodiametrical,
hyaline cells, with slightly thickened walls, 40-45 um in diam.; MEDULLARY
EXCIPULUM composed of broad and short angular cells, 9-12 um in diam.; Asc
Scutellinia ulloae sp. nov. (Mexico) ... 259
5,000 Tyan
FiGgurE 1. Scutellinia ulloae (holotype, FCME 14557). (a) Dried apothecial specimens;
(b) paraphyses; (c) marginal hair; (d, f, g) ascospores in SEM; (e) ascospores in LM (phase contrast;
arrow shows spore wall detail).
8-spored, operculate, cylindrical, 240-272 x 15.6-31.2 um wide, inamyloid;
ASCOSPORES ellipsoid (15-)17-17.5 x 12-13(-14) um, Q = 1.38, with one
guttule to multiguttulate, sPORE ORNAMENTATION: tubercles 2-2.5 um high x
260 ... Izquierdo-San Agustin & al.
2 um broad, cylindrical to obpyriform, slightly constricted at the base, some
interconnected by slim line when viewed by SEM, spore ornamentation when
stained with cotton blue easily visible in light microscopy. PARAPHYSES slender,
2-3 um wide, clavate and 5.6-8.4 um wide at the apex, septate, exceeding asci
by 15-19 um.
Discussion
Following Schumacher (1990), the species closest to Scutellinia ulloae is
S. chiangmaiensis T. Schumach.; however, the spore ornamentation differs
significantly. In S. chiangmaiensis the ornamentation is tuberculo-reticulate,
giving an alveolate spore surface, while in S. ulloae tubercles are cylindrical
to obpyriform, slightly constricted at the base and are slightly connected by
small ridges that do not form a true reticulum. The vegetation type is mixed
deciduous forest for S. chiangmaiensis and coniferous forest for S. ulloae.
The type specimen (FCME 14557) was initially misdetermined by Pompa-
Gonzalez & Cifuentes (1991) as S. diaboli (Velen.) Le Gal (= S. trechispora). The
record of S. trechispora in Mexico is no longer correct and should be deleted.
Acknowledgments
We wish to thank Dr. Wen- Ying Zhuang (Institute of Microbiology, Chinese Academy
of Sciences), Dr. Richard P. Korf (Cornell University, Ithaca, NY), and Dr. Santiago
Chacon Zapata (Instituto de Ecologia, Xalapa, Mexico) for reviewing the manuscript
and for helpful comments; Dr. Jae-Gu Han for molecular analysis; and Bidl. Lilia Pérez-
Ramirez (FCME Herbaria, Fac. de Ciencias, UNAM) for curatorial support. The SEM
photographs were made in the Laboratorio de Microscopia de Barrido, Fac. de Ciencias,
UNAM by Dr. Silvia Espinosa Matias. This research was supported by DGAPA PAPIIT
IN-223704, 209605, 218008, 207311.
Literature cited
Bautista N, Chacon S, Guzman G. 1986. Ascomicetes poco conocidos de Mexico, III. Especies del
estado de Morelos. Rev. Mex. Mic. 2: 85-104.
Cao JZ, Moravec J. 1989 [“1988”]. Scutellinia fujianensis sp. nov., a new species from China, with
notes on related species. Mycol. Helv. 3(2): 183-190.
Chacon S, Guzman G. 1984. Nuevas observaciones sobre los hongos, liquenes y mixomicetos de
Chiapas. Bol. Soc. Mex. Mic. 19: 245-252.
Chanona-Goémez F, Andrade-Gallegos RH, Castellanos-Albores J, Sanchez JE. 2007. Macromicetos
del parque educativo Laguna Bélgica, Municipio de Ocozocuautla de Espinosa, Chiapas,
Mexico. Rev. Mex. Biodiv. 78(2): 369-381.
Choi YJ, Shin HD, Han JG, Pfister DH. 2013. Scutellinia (Pezizales) in Korea, with a new species and
eight new records. Nova Hedw. 97(3-4): 457-476.
http://dx.doi.org/10.1127/0029-5035/2013/0120
Cifuentes J, Villegas M, Pérez—-Ramirez L. 1986. Hongos. In: A. Lot y F. Chiang (Eds). Manual de
Herbario. Consejo Nacional de la Flora de Mexico, A.C. Mexico, D.F.
Scutellinia ulloae sp. nov. (Mexico) ... 261
Denison WC. 1959. Some species of the genus Scutellinia. Mycologia 51: 605-635.
http://dx.doi.org/10.2307/375589 1
Esqueda- Valle M, Pérez-Silva E, Coronado AM. 1992. Nuevos registros de Pezizales para Sonora.
Rev. Mex. Mic. 8: 43-54.
Ferrusquia-Villafranca I. 1993. Geology of Mexico: a synopsis. 3-107, in: TP Ramamoorthy et al.
(eds). Biological diversity of Mexico: origins and distribution. Oxford Univ. Press, New York.
Frutis I, Guzman G. 1983. Contribucién al conocimiento de los hongos del estado de Hidalgo. Bol.
Soc. Mex. Mic. 18: 219-265.
Guzman G. 1998. Inventorying the fungi of Mexico. Biodiversity and Conservation 7: 369-384.
http://dx.doi.org/10.1023/A:1008833829473
Guzman- Davalos L, Trujillo-Flores F. 1984. Hongos del estado de Jalisco IV. Nuevos registros. Bol.
Soc. Mex. Mic. 19: 319-326.
Han JG, Choi YJ, Pfister DH, Shin HD. 2010. Scutellinia jejuensis (Pezizales) a new species from
Korea. Mycotaxon 112: 47-53. http://dx.doi.org/10.5248/112.47
Izquierdo-San Agustin L. 2008. Contribucién al conocimiento taxondmico del género Scutellinia
en Mexico. Tesis de Licenciatura, Facultad de Ciencias, UNAM, Mexico DF.
Kornerup A, Wanscher JH. 1978. Methuen Handbook of Colour. Eyre, Londres. 252 p.
Liu M, Peng H. 1996. Scutellinia sinensis, a new spherical-spored species of Scutellinia. Acta
Mycologica Sinica 15: 98-100.
Matoéec N. 2000. The genus Scutellinia (Pezizales) in Croatia III. A new species - Scutellinia
tuberculata. Mycotaxon 76: 481-488.
Matoéec N, Krisai-Greilhuber I, Scheuer C. 2005. Austrian discomycetous fungi 1. An annotated
list of species recently collected in the Eastern Alps and the Peripannonic area. Osterreichische
Zeitschrift fir Pilzkunde 14: 309-331.
Medel R, Chacon S. 1988. Ascomycetes lignicolas de Mexico, Hl. Algunos Pyrenomycetes y
Discomycetes. Mic. Neotrop. Aplic. 1: 87: 96.
Montafiez A. 1999. Analisis de la Diversidad de Macromicetos que crecen en Bosques de Encino del
Municipio de Chapa de Mota, Estado de Mexico. Tesis de Licenciatura, Facultad de Ciencias,
UNAM, Mexico DF.
Moravec J. 1989. A taxonomic revision of the Genus Cheilymenia -1. Species close to the
Cheilymenia rubra. Mycotaxon 36: 169-186.
Moravec J. 1996. Scutellinia totaranuiensis spec. nov., a new species from New Zealand.
(Discomycetes, Pezizales). Mycotaxon 58: 233-241.
Moravec J. 1997. Key to the species of Scutellinia subgen. Geneosperma (Rifai) comb. et stat. nov.
(Discomycetes, Pezizales, Pyronemataceae). Czech Mycology 50(2): 85-97.
Pompa-Gonzalez A, Cifuentes J. 1991. Estudio taxondémico de los Pezizales de los estados de
Guerrero, Hidalgo, Estado de Mexico y Michoacan. Rev. Mex. Mic. 7: 87-112.
Portugal D, Montiel E, Lopez L, Mora VM. 1985. Contribucién al conocimiento de los hongos que
crecen en la region del Texcal, estado de Morelos. Rev. Mex. Mic. 1: 401-412.
Sarukhan J. 1995. Diversidad Bioldgica. Revista Universidad de Mexico. 536-537: 3-10.
Schumacher T. 1990. The genus Scutellinia (Pyronemataceae). Opera Bot. 101: 1-107.
Téllez-Bafuelos C, Guzman-Davalos L, Guzman G. 1988. Contribucién al conocimiento de
los hongos de la reserva de la Biosfera de la Sierra de Manantlan Jalisco. Rev. Mex. Mic. 4:
123-130.
Valenzuela V, Herrera T, Pérez-Silva E. 2004. Contribucién al conocimiento de los macromicetos
de la Reserva Ecolégica del Pedregal de San Angel, DF, Mexico. Rev. Mex. Mic. 18: 61-68.
262 ... Izquierdo-San Agustin & al.
Vazquez del Mercado M. 1977. Estudio sobre algunos Pezizales, principalmente de los estados de
Veracruz y Oaxaca. Tesis de Licenciatura, Esc. Nac. Cienc. Biols, IPN, Mexico. 63 p.
Welden LA, Davalos L, Guzman G. 1979. Segunda lista de hongos, liquenes y mixomicetos de las
regiones de Uxpanapa, Coatzacoalcos, Los Tuxtlas, Papaloapan y Xalapa (Mexico). Bol. Soc.
Mex. Mic. 13: 151-161.
Yao YJ, Spooner BM. 1995. New combinations in Melastiza and Scutellinia (Pezizales). Mycotaxon
53: 467-477.
Yu ZH, Zhuang WY, Chen SL. 2000. Preliminary survey of discomycetes from The Changbai
Mountains, China. Mycotaxon 75: 395-408.
Zhuang WY. 2005a. Some new species and new records of discomycetes in China XII. Mycotaxon
93: 99-104.
Zhuang WY. 2005b. Re-dispositions of specimens filed under Lachnea on deposits in HMAS.
Fungal Diversity 18: 211-224.
Zhuang WY, Wang Z. 1998. Discomycetes of tropical China. IH. Collections from Yunnan.
Mycotaxon 69: 339-358.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.263
Volume 125, pp. 263-275 July-September 2013
Study on the phylogeny of
Nephroma helveticum and allied species
HaAI-YING WANG™, DaI-FENG JIANG’, YAN- HONG HUANG’,
PAN-MENG WANG’ & TAo LI’
'Key Laboratory of Plant Stress Research, College of Life Science, Shandong Normal University,
Jinan, 250014, P. R. China
? Food and Fermentation Engineering Key Lab of Shandong Province,
Jinan 250013, P. R. China
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — Nephroma subhelveticum sp. nov. is described, supported by both morphological
and molecular data as a species new to science. The nrDNA ITS sequence analysis indicates
that N. subhelveticum and N. flavorhizinatum are allied species of N. helveticum, and that
N. isidiosum derives from N. helveticum.
Key worps — Asia, China, evolution, lichen, taxonomy
Introduction
The species of Nephroma Ach. (Nephromataceae) have middle-sized foliose
thalli, cyanobacteria (sometimes green algae) as their photobionts, apothecia
produced on the lower surface, 8-spored asci, commonly 3-septate ascospores,
and often abundant terpenoids (James & White 1987, Burgaz & Martinez 1999,
Brodo et al. 2001, Wetmore & Nash 2002, Louwhoff 2009). This genus includes
37 species worldwide (Tian et al. 2011).
Both Nephroma helveticum and N. isidiosum are cosmopolitan species with
terpenoids, and only these two species in the genus have isidia (Brodo et al.
2001). Nephroma helveticum has lobules and flat isidia, while N. isidiosum
has true cylindrical or branched isidia (Brodo et al. 2001). Nephroma
flavorhizinatum also has lobules and terpenoids (Tian et al. 2011). The similar
morphological and chemical characters indicate that these three species may
be closely related. Recently some morphologically similar specimens that also
have terpenoids, lobules, and very crisp thalli, were found from China. The
nrDNA ITS sequences generated from these Nephroma representatives have
been analysed so as to establish their phylogenetic relationships.
264 ... Wang & al.
TABLE 1. GenBank sequences of Nephroma and Lobaria included in the molecular
analyses.
SPECIES ORIGIN GENBANK NO.
N. helveticum : China, Yunnan ? DQ001292
N. subhelveticum : South Korea ? DQ066705
(recorded as N. helveticum) i
N. resupinatum : South Korea : DQ066710
_E-macaronesica Outgroup UOT 745
APU ONGTE 2 cm sae Bh ae AICS aol Berenice Ae,
L. retigera : EU626996
Materials & methods
Morphology & chemistry
The specimens studied are preserved in SDNU (Lichen Section of Botanical
Herbarium, Shandong Normal University). The morphology and anatomy of the
specimens were examined using an OLymMpus SZX16 stereomicroscope and OLympus
BX61 compound microscope; morphological characters were photographed under
OLtympus with DP72. Lichen substances were identified using standardized thin layer
chromatography techniques (TLC) with C system (Orange et al. 2010).
Molecular analyses
TAXON SAMPLING — nrDNA ITS sequences were obtained from 41 Chinese
Nephroma specimens; 13 additional Nephroma sequences and outgroup sequences from
three Lobaria species were downloaded from GenBank (TABLE 1).
PCR AMPLIFICATION AND SEQUENCING — Total DNA was extracted by the
modified CTAB method (Rogers & Bendich 1988). E9 (TTGTACACACCGCCCGT),
NFIR (ATCCGAGGTCAATCGTGT), NF2R (TGATCCGAGGTCAATCGT), and CL2R
(TTTCTTTTCCTCCGCTTATTGA) were used for PCR amplification of the nrDNA ITS as
primers. PCR reaction program: initial denaturation at 95°C for 3 min, followed by 35
cycles of 30 s denaturation at 94°C, 45 s annealing at 58°C, 1 min extension at 72°C,
and completed with a final 8 min extension at 72°C. Products were purified with Gel
Extraction Mini Kit (SABC). Shanghai Genecore Corp. carried out the sequencing
reactions.
DaTA ANALysIs — The sequences were aligned using MAFFT version 7 (Katoh &
Standley 2013). The aligned ITS matrix was edited manually and phylogenetic analyses
were conducted using MEGA 5 (Tamura et al. 2011). The phylogenetic tree was inferred
using the Minimum Evolution method (Rzhetsky & Nei 1992) and tested by 1000 bootstrap
replications (Felsenstein 1985). The evolutionary distances were computed using the
Maximum Composite Likelihood method (Tamura et al. 2004). All positions containing
Nephroma subhelveticum sp. nov. (China) ... 265
alignment gaps and missing data were eliminated in pairwise sequence comparisons
(Pairwise deletion option). A total of 606 positions comprised the final dataset.
Morphology & chemistry
Nephroma helveticum Ach., Lich. univ.: 523 (1810) Fics 1, 2
Thallus foliose, leathery. Lobes with stout lobules (0.5 x 1 mm) at margin.
Upper surface brown; isidia and soredia absent; tomentum and pruina often
present; lobules marginal and laminal, often branched. Upper cortex pale
FiGurE 1. Nephroma helveticum (20080653). A: Thallus; B: Lobe with marginal lobules; C: Laminal
lobules; D: Rough and tomentose dorsal surface of apothecium; E: Tomentum on lower surface;
F: Apothecium immersed on lower surface.
266 ... Wang & al.
brown, ca. 35 um thick; photobiont Nostoc, ca. 65 um thick; medulla white,
with abundant crystals soluble in water, ca. 80 um thick; lower cortex pale, ca.
30 um thick. Lower surface brown, tomentose, paler and smooth at the margins;
rhizines stubby, sparse. Apothecia common, immersed on lower surface at
tips of lobes, kidney-shaped; disc dark brown, <7 mm in diameter; dorsal
surface rough, with abundant clustered tomentum; margin usually crenulate.
Epihymenium pale brown, without crystals, ca. 15 um tall; hymenium hyaline,
without crystals, ca. 40 um tall; hypothecium pale brown, without crystals, ca.
35 um tall. Paraphyses simple. Asci clavate, I+ blue, 8-spored; ascospores pale
brown, 3-septate, 15-20 x 3-4 um. Pycnidia not seen.
Spot TESTS — Thallus upper surface: K-, C-, KC-, PD-; medulla: K-, C-,
KC-, PD-.
SECONDARY METABOLITES — N1, N2, + other lichen substances (Fic. 3).
ECOLOGY & DISTRIBUTION IN CHINA— on bark or moss in Guizhou, Jilin,
Shanxi, Shaanxi, Sichuan, Tibet, and Yunnan.
SPECIMENS EXAMINED — CHINA. GuIzHOU, Kaili, Mt. Leigong, alt. 1027 m, on bark,
2 Nov 2009, H.Y. Wang 20102726. JiLin, Wangqing, Mt. Tulaopoding, alt. 1100 m, on
moss, 22 Jul 2012, H.Y. Wang 20129292. SHanx1, Ningwu, Mt. Luya, alt. 2500 m, on
bark, 26 Aug 2011, H.Y. Wang 20121819A. SHAANXI, Meixian, Mt. Taibai, alt. 2100 m,
on bark, 2 Aug 2005, W. Fu 20083001; 17 Jun 2011, Z.L. Huang 20114881(GenBank
JX867681); alt. 2150 m, on bark, 17 Jun 2011, Z.L. Huang 20114339 (GenBank JX867682);
alt. 2200 m, on bark, 2 Aug 2005, W. Fu 20080332, 20100571; alt. 2700 m, on bark, 17 Jun
2011, Z.L Huang 20114639K; alt. 2950 m, on bark, 17 Jun 2011, Z.L. Huang 20114717
(GenBank JX867703). SICHUAN, Litang, alt. 4200 m, on bark, 5 Nov 2008, H.Y. Wang
20080388; Litang, Mt. Kazila, alt. 4700 m, on bark, 7 Nov 2008, H.Y. Wang 20080323,
20080354. TrpET, Nyingchi, Dongjiuxiang, alt. 2550 m, on bark, 17 Jul 2011, YL.
Cheng 20114928, 20117991 (GenBank JX867707), 20117991A (GenBank JX867710),
20117991C (GenBank JX867713), 20118005, 20118005A, 20118005D, 20118005E,
20118005F (GenBank JX867712), 20118006B (GenBank JX867704), 20118006C
(GenBank JX867683), 20118011, 20118044, 20118255A (GenBank JX867709),
20118300 (GenBank JX867705), 20118545; Mt Sejila, alt. 4100 m, on bark, 20 Oct 2007,
G.Y. Han 20072907; alt. 4500 m, on bark, 20 Jul 2011, Y.L. Cheng 20118118A, 20118461,
20118729A (GenBank JX867706), 20118729E; Lulangzhen, observation station, alt.
2550 m, on bark, 14 Jul 2011, D.F. Jiang 20119099. YUNNAN, Shangri-La, Tianshengqiao,
alt. 3500 m, on bark, 3 Nov 2008, H.Y. Wang 20080653 (GenBank JX867708), 20081370,
20081391, 20081515, 20081715, 20081885, 20082058, 20082065, 20082181, 20082185,
20082213, 20082264, 20082270, 20082291, 20082355, 20102930, 20083063, 20083097,
20083312, 20083385, 20083861, 20086001, 20086011; Mt. Shika, alt. 4300 m, on bark, 2
Nov 2008, H.Y. Wang 20081991, 20082033, 20082218, 20083336, 20086017; Yulong, Mt.
Laojun, alt. 4000 m, on bark, 6 Nov 2009, H.Y. Wang 20100564 (GenBank JX867711); 7
Nov 2009, H.Y. Wang 20090001, 20100562; Jianchuan, Mt. Shibao, alt. 2600 m, on bark,
31 Oct 2008, H.Y. Wang 20083409; Lijiang, Mt. Yulong, alt. 3200 m, on bark, 7 Nov 2009,
M. Li 20102729A.
ComMENTs — Nephroma helveticum is considered to produce flat isidia (Brodo
et al. 2001). However, we did not find true isidia on our specimens. The lobules
of N. helveticum from China are varied (Fic. 2 I-N), sometimes very narrow and
Nephroma subhelveticum sp. nov. (China) ... 267
FiGuRE 2. Nephroma helveticum (A-H, 20080653; I, 20080323; J, 20118011; K, 20118005D;
L, 20118729E; M, 20080388; N, 20100564). A: Section of thallus; B: Crystals in thallus; C: Section
of apothecium; D: Crystals in apothecium; E: Ascus and ascospores; F: Iodine reaction of ascus and
paraphyses; G: Paraphyses; H: Ascospores; I-N: Various laminal lobules.
isidium-like but always dorsiventral. Although N. helveticum and N. isidiosum
have similar secondary substances (TLC, Fic. 3), N. isidiosum can be clearly
separated by its typical cylindrical to coralloid isidia and lack of apothecia.
268 ... Wang & al.
10 11 12 13
B .
~ ° - = =
ma. 72
ease? seen? © ON N2
: sees .-* "N2ee28ts8 2 @
4 5 6 6 &
le oe Ae, Oo Tie 8 Oe TO 1a 213
i:
. .
- =
“
=" &
See. oe */ 9) (ele! s
: :
123 4 5 6M7 8 9 10 11 12 13 SIGNI SSIoEZON
Figure 3. TLC results: A: UV254 nm before acid; B: Sunlight after acid and heating; C: UV365
nm after acid and heating. Nephroma helveticum (1, 20100564; 2, 20114717; 3, 20118255A;
4, 20117991C; 5, 20118300; 6, 20080653); N. isidiosum (7, 20080192; 8, 20081753; 9, 20084006;
10, 20083227; 11, 20084002; 12, 20114639D; 13, 20081280); N. subhelveticum (14, 20108511;
15, 20106583; 16, 20108510; 17, 20106494; 18, 20106581; 19, 20106595; 20, 20105971).
Nephroma subhelveticum sp. nov. (China) ... 269
5 0&5
5 * ( + 4.
oy Pins
aR
FiGureE 4. Nephroma isidiosum (20080192). A: Thallus; B: Lobe with marginal isidia; C: Laminal
isidia; D: Section of thallus; E: Crystals in thallus; F: Tomentum on lower surface.
Nephroma isidiosum (Nyl.) Gyeln., Annals Cryptog. Exot. 4: 126 (1931) Fic. 4
Thallus foliose, leathery. Lobes with cylindrical isidia at margin. Upper
surface brown; lobules and soredia absent; tomentum and pruina often present;
isidia marginal and laminal, cylindrical to coralloid. Upper cortex pale brown,
ca. 30 um thick; photobiont Nostoc, ca. 50 um thick; medulla white, with
abundant crystals soluble in water, ca. 90 um thick; lower cortex brown, ca. 12
uum thick. Lower surface brown, tomentose, paler and smooth at the margins;
rhizines stubby, sparse. Apothecia and pycnidia not seen.
270 ... Wang & al.
Spot TESTS—Thallus upper surface: K-, C-, KC-, PD-; medulla: K-, C-,
KC-, PD-.
SECONDARY METABOLITES — N1, N2, + other lichen substances (Fic. 3)
ECOLOGY & DISTRIBUTION IN CHINA — on bark or ground with moss in
Shaanxi, Sichuan, Tibet, and Yunnan.
SPECIMENS EXAMINED — CHINA. SHAANXI, Meixian, Mt. Taibai, alt. 2700 m, on
bark, 17 Jun 2011, Z.L. Huang 20114639D (GenBank JX867700). SIcHUAN, Litang, alt.
4200 m, terricolous, 5 Nov 2008, Z.S. Sun 20080225, 20080345, 20080753, 20080843,
20081280 (GenBank JX867701), 20084000, 20084006 (GenBank JX867689), 20084008
(GenBank JX867698); on bark, 5 Nov 2008, Z.S. Sun 20080661 (GenBank JX867694),
20083995, 20084004 (GenBank JX867693); 7 Nov 2008, H.Y. Wang 20084003 (GenBank
JX867690); Mt. Kazila, alt. 4700 m, 7 Nov 2008, on bark, H.Y. Wang 20080238 (GenBank
JX867695), 20080286, 20080769, 20080871, 20080865, 20081923 (GenBank JX867697),
20082001 (GenBank JX867687), 20084002 (GenBank JX867696), 20084005, 20084009,
20084010, Z.S. Sun 20080192 (GenBank JX867688), 20080846 (GenBank JX867691),
20080855 (GenBank JX867684), 20081753 (GenBank JX867699), 20083018 (GenBank
JX867686). TipET, Nyingchi, Lulangzhen, Dongjiuxiang, alt. 2550 m, on bark, 17 Jul
2011, Y.L. Cheng 20118005C; Lulangzhen, Observation station, alt. 3400 m, on bark,
12 Jul 2011, Y.L. Cheng 20118228. YUNNAN, Lijiang, Jiuhexiang, alt. 2700 m, on bark,
30 Oct 2008, Z.S. Sun 20081681; Shangri-La, Tianshengqiao, alt. 3500 m, on bark, 3
Nov 2008, H.Y. Wang 20082176, 20082177, 20083800, 20086000, Y.D. Du 20082092
(GenBank JX867702), Z.J. Ren 20082225 (GenBank JX867685), Z.S. Sun 20083227
(GenBank JX867692).
COMMENTS — See N. helveticum.
Nephroma subhelveticum H.Y. Wang, sp. nov. Fics 5, 6
MycoBank MB 801765
Differs from Nephroma helveticum by its crisp thin thallus, its finer marginal lobules, its
smooth ridged non-tomentose dorsal apothecial surface, and its lack of lichen substance
Nl.
Type — China. Jiangxi, Ji-An, Qianmocun, Mt. Nanfengmian, alt. 1300 m, 1 Nov 2010,
on bark, H. Y. Wang 20106583 (Holotype, SDNU; GenBank, JX867680).
EryMoLocy — Referring to the very close genetic relationship and morphological
similarity with Nephroma helveticum.
Thallus foliose, very crisp, about 4 cm in diameter. Lobes long and narrow,
usually 5 x 10 mm, with fine lobules at margin (0.1 x 0.2 mm). Upper surface
gray, smooth; tomentum, isidia, soredia and pruina absent; lobules marginal
and laminal, long or round, branched or not. Upper cortex pale, ca. 20 um
thick; photobiont Nostoc, ca. 55 um thick; medulla white, with abundant
crystals soluble in water, ca. 55 um thick; lower cortex pale, ca. 15 um thick.
Lower surface pale or pale brown, tomentose, paler and smooth at the margins;
rhizines stubby, sparse. Apothecia common, immersed on lower surface at tips
of lobes, kidney-shaped; disc dark brown, 1-4 mm in diameter; dorsal surface
with obvious ridges and lobules, without tomentum; margins usually with
Nephroma subhelveticum sp. nov. (China) ... 271
FiGuRE 5. Nephroma subhelveticum (Holotype, 20106583). A: Thallus; B: Lobe with marginal
lobules; C-D: Laminal lobules; E: Smooth and ridged dorsal surface of apothecium; F: Tomentum
on lower surface; G: Apothecium immersed on lower surface.
lobules. Epihymenium pale brown, without crystals, ca. 10 um tall; hymenium
hyaline, without crystals, ca. 38 um tall; hypothecium hyaline, without crystals,
ca. 25 um tall. Paraphyses simple. Asci clavate, I+ blue, 8-spored; ascospores
pale brown, 3-septate, 15-20 x 3-4 um. Pycnidia not seen.
Spot TESTs—Thallus upper surface: K-, C-, KC-, PD-; medulla: K-, C-,
KC-, PD-.
SECONDARY METABOLITES— N2 (FIG. 3)
272 ... Wang & al.
FiGurRE 6. Nephroma subhelveticum (Holotype, 20106583). A: Section of thallus; B: Crystals in
thallus; C: Section of apothecium; D: Crystals in apothecium; E: Asci and ascospores; F: Iodine
reaction of ascus and paraphyses; G: Ascospores; H: Paraphyses.
ECOLOGY & DISTRIBUTION IN CHINA — on bark or moss in Jiangxi and
Fujian.
ADDITIONAL SPECIMENS EXAMINED — CHINA. JIANGxI, Ji-An, Qianmocun, Mt.
Nanfengmian, alt. 1300 m, on bark, 1 Nov 2010, H.Y. Wang 20106581, 20106595; 2
Nov 2010, H.Y. Wang 20106494 (GenBank JX867679). Fujian, Wuyishan, Tongmucun,
alt. 1200 m, on moss, 25 Oct 2010, M. Li 20105971, 20108510 (GenBank JX867677),
20108511 (GenBank JX867678).
ComMENTS—The crisp and thin (rather than leathery and thick) thallus,
the fine (not stout) marginal lobules, the smooth ridged apothecial dorsal
surface of apothecia lacking in tomentum (rather than rough and tomentose),
and the absence of N1 lichen substances distinguish the new species from
N. helveticum.
Phylogeny Fig. 7
The ITS sequence analysis indicates that Nephroma_flavorhizinatum,
N. subhelveticum, N. helveticum, and N. isidiosum are very closely related.
Nephroma flavorhizinatum is a sister group (92% bootstrap support) of the clade
including N. subhelveticum, N. helveticum, and N. isidiosum, with a 0.066-0.095
Nephroma subhelveticum sp. nov. (China) ... 273
20084006 Sichuan
—e” 20081280 Sichuan
0.05 20084008 Sichuan
63 & 20082001 Sichuan
20114639D Shaanxi
20081753 Sichuan
20080192 Sichuan
90] 20082225 Yunnan
20082092 Yunnan
20081923 Sichuan N. isidiosum
20080855 Sichuan
20083018 Sichuan
20084003 Sichuan
20084002 Sichuan
1H, 20080238 Sichuan
20084004 Sichuan
78 B, 20080846 Sichuan
79 8 20083227 Yunnan
74 L. 20080661 Sichuan
99 20117991 Tibet
20080653 Yunnan
20118255A Tibet
20118005F Tibet
AY 124124 USA northwest
20117991C Tibet
AY124120 Tibet
20118006C Tibet
20114881 Shaanxi :
99 t 20114339 Shaanxi N, helveticum
20114717 Shaanxi
DQ001292 Yunnan
20117991A Tibet
Ig3 & 20100564 Yunnan
20118729A Tibet
100] F 20118006B Tibet
1 400! 20118300 Tibet
HQ455071 Macaronesia
AY124119 USA southwest
20106494 Jiangxi
20106583 Jiangxi
AY124122 China central
AY124118 China central
98 100 sa ished N. subhelveticum
97 & 20108510 Fujian
85 § 20108511 Fujian
65 AY124127 China northeast
AY124128 Russia northwest
JX867675 Sichuan +
“cod JX867676 Sichuan | N. flavorhizinatum
JX867674 Inner Mongolia °
100 © AY124148 Canada east | N. parile
JX867673 Jilin *
50! DQ066710 South Korea | N, resupinatum
Lobaria retigera JN857197
Lobaria pulmonaria AF 129284
84 Lobaria macaronesica GU072745
87
100
FigurRE 7. The ME tree inferred from ITS data. Bootstrap values >50% (1000 replicates) are
shown next to the branches.
evolutionary distance separating sister groups. Nephroma flavorhizinatum was
first reported from China as a new species differentiated by a golden yellow
rhizinal base and distinct pruina at the dorsal surface of apothecia, lobules, and
terpenoids (Tian et al. 2011). This morphological differentiation is supported
here by the molecular phylogenetic analysis.
274 ... Wang & al.
Nephroma subhelveticum is sister (100% bootstrap support) to the clade
containing N. helveticum and N. isidiosum, with a 0.046-0.068 evolutionary
distance separating sister groups. The N. subhelveticum clade (100% bootstrap
support) includes the samples from China, South Korea, and northwest Russia;
however, the evolutionary distances among these samples are only 0-0.021.
The samples within the N. subhelveticum sister group are from China, USA,
and Macaronesia, among which the evolutionary distances are also very close
(0-0.031). These results indicate that the N. subhelveticum clade is monophyletic
and not conspecific with N. helveticum. This result is supported by morphological
and chemical characters.
The N. subhelveticum clade includes six samples from GenBank (AY1241XX
sequences submitted by Lohtander et al. 2002; DQ06670X sequences by Hur
et al. 2004). The mtSSU and ITS based research by Lohtander et al. (2002)
also included samples of N. helveticum and N. subhelveticum (identified as
‘N. helveticum’) from USA, China, and Russia; their phylogenetic result is
identical with our study: two clades, both with >90% bootstrap support.
Lohtander et al. (2002) considered that N. helveticum might represent closely
related taxonomic aggregates. However, they did not compare their specimens
morphologically. We have not found detailed information regarding the
specimens sequenced by Hur et al. (2004).
The N. isidiosum clade is not sister to N. helveticum, but rather a child
(derived) clade of N. helveticum; evolutionary distances between N. isidiosum
and N. helveticum are only 0.009-0.029, suggesting that N. isidiosum and
N. helveticum are conspecific. However, N. isidiosum is a monophyletic
group with 87% bootstrap support. The genetic diversity level of ITS within
N. isidiosum is obviously lower than that within N. helveticum (TaBLE 2).
Moreover, N. isidiosum has quite different isidia from N. helveticum. These
results indicate that all the members of N. isidiosum have a common ancestor,
and the gene flow between N. isidiosum and N. helveticum has possibly stopped.
In other words, while not conspecific with N. helveticum, N. isidiosum is a
species recently derived from N. helveticum.
TABLE 2. Evolutionary ITS distances within Nephroma isidiosum and N. helveticum.
Sahl: COLLECTION LOCALITY No. OF EVOLUTIONARY
i SAMPLES : DISTANCE (MCL)
N. isidiosum Shaanxi, Sichuan, Yunnan 19 0-0.011
N. helveticum A RODA SIUC ops ai cebttdtc 88 ata tagkiaatte Blntcs Witaliades Pe OT Olea Ar Meat adiii
: Tibet 10 0-0.027
: Yunnan : 3 : 0.009-0.025
Nephroma subhelveticum sp. nov. (China) ... 275
Acknowledgements
The project was financially supported by Program for Scientific Research
Innovation Team in Colleges and Universities of Shandong Province, the National
Natural Science Foundation of China (31270059, 31000008), and Science Foundation
of Jinan (201202024). The authors thank Dr. A. Aptroot (ABL Herbarium, Soest,
The Netherlands) and Dr. Shou-Yu Guo (Key Laboratory of Systematic Mycology &
Lichenology, Institute of Microbiology, Chinese Academy of Sciences, Beijing, China)
for presubmission reviews.
Literature cited
Brodo IM, Sharnoff DS, Sharnoff S. 2001. Lichens of North America. Yale University Press: New
Haven and London. 795 p.
Burgaz AR, Martinez I. 1999. The genus Nephroma Ach. in the Iberian Peninsula. Cryptogamie,
Mycol. 20: 225-235. http://dx.doi.org/10.1016/S0181-1584(00)87030-X
Felsenstein J. 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution
39: 783-791. http://dx.doi.org/10.2307/2408678
Hur JS, Harada H, Oh SO, Lim KM, Lee SM, Kim GH, Kou YJ. 2004. Taxonomic studies on
Nephroma (lichenized Ascomycota) in South Korea. Korean Journal of Mycology 32(2): 57-65.
James PW, White FJ. 1987. Studies on the genus Nephroma I. The European and Macaronesian
species. Lichenologist 19: 215-268. http://dx.doi.org/10.1017/S0024282987000239
Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment software version 7:
improvements in performance and usability. Molecular Biology and Evolution 30: 1-23.
http://dx.doi.org/10.1093/molbev/mst010
Lohtander K, Oksanen I, Rikkinen J. 2002. A phylogenetic study of Nephroma (lichen-forming
Ascomycota). Mycol. Res. 106(7): 777-787. http://dx.doi.org/10.1017/S0953756202006068
Louwhoff SHJJ. 2009. Nephromataceae. 423-427, in: PM McCarthy (ed.). Flora of Australia,
Vol. 57. ABRS, Canberra & CSIRO Publishing, Melbourne.
Orange A, James PW, White FJ. 2010. Microchemical methods for the identification of lichens. 2nd
edition. London: British Lichen Society.
Rogers SO, Bendich AJ. 1988. Extraction of DNA from plant tissues. Plant Molecular Biology
Manual A6: 1-10. Kluwer Academic Publishers. Dordrecht.
Rzhetsky A, Nei M. 1992. A simple method for estimating and testing minimum evolution trees.
Molecular Biology and Evolution 9: 945-967.
Tamura K, Nei M, KumarS. 2004. Prospects forinferring very large phylogenies by using the neighbor-
joining method. PNAS 101: 11030-11035. http://dx.doi.org/10.1073/pnas.0404206101
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGAS5: Molecular
evolutionary genetics analysis using maximum likelihood, evolutionary distance, and
maximum parsimony methods. Molecular Biology and Evolution 28: 2731-2739.
http://dx.doi.org/10.1093/molbev/msr121
Tian Q, Wang LS, Wang HY, Zhao ZT. 2011. A new species of Nephroma (Nephromataceae) from
the Tibetan Plateau. Mycotaxon 115: 281-285. http://dx.doi.org/10.5248/115.281
Wetmore CM, Nash HI TH. 2002. Nephroma. 296-298, in: TH Nash III et al. (eds). Lichen Flora
of the Greater Sonoran Desert Region, Vol. 1. Lichens Unlimited: Arizona State University,
Tempe, Arizona. 532 p.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.277
Volume 125, pp. 277-282 July-September 2013
Hydnotrya laojunshanensis sp. nov. from China
LIN Lr”, YONG-CHANG ZHAO’, XIAO-LEI ZHANG’,
Honc- YAN Svu3, SHU-HoNG LP’? & DE-QUN ZHOU”
"Faculty of Environmental Sciences & Engineering, Kunming University of Science & Technology,
Kunming 650500, Yunnan, China
? Biotechnology & Germplasm Resources Institute, Yunnan Academy of Agricultural Sciences,
Kunming 650223, Yunnan, China
* College of Agriculture & Biological Sciences, Dali University, Dali 671003, Yunnan, China
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — In August 2012, a solitary Hydnotrya specimen was collected under Abies forrestii
var. smithii in the Laojun mountains, Yunnan Province, southwest China. Morphological
and molecular analyses showed that this was a new species, which is described here as
H. laojunshanensis.
Key worps — Pezizomycetes, taxonomy, ITS, phylogeny
Introduction
Hydnotrya Berk. & Broome (Pezizomycetes, Ascomycota) is a genus of
hypogeous fungi related to truffles. The genus was placed in Helvellaceae by
Spooner (1992), but recent molecular analyses support its placement in the
Discinaceae (O'Donnell et al. 1997; Hansen & Pfister 2006; Tedersoo et al.
2006; Lzessoe & Hansen 2007). Hydnotrya is distributed across the northern
hemisphere including Europe, North America, and Asia (Stielow et al. 2010).
There are about 15 species in the genus (Kirk et al. 2008: 325) including a
neglected new species, Hydnotrya bailii Soehner (Soehner 1959; Stielow et al.
2010). Four Hydnotrya species have been reported in China: H. cerebriformis
Harkn. in Shanxi and Xinjiang Provinces, H. cubispora (E.A. Bessey & B.E.
Thomps.) Gilkey in Sejila mountains, Linzhi, Tibet, and H. michaelis (E. Fisch.)
Trappe and H. tulasnei (Berk.) Berk. & Broome in Jilin Province (Tao & Liu 1989;
Xu 2000). In August 2012 one Hydnotrya specimen was collected in the Laojun
mountains, Yunnan Province, southwest China (PLATE 1). Morphological
examination and DNA sequence analyses clearly distinguished the specimen
from all other Hydnotrya taxa. We describe it as a new species and discuss its
relationships with other Hydnotrya species.
278 ... Li & al.
LaojJun Mountains
PLATE 1. Location of Laojun mountains, Yunnan Province, southwest China.
Materials & methods
Microscopic and macroscopic descriptions were made of specimen YAAS L2425
following the methods of Bemmann & Bandini (2011). Sections were made with a
razorblade by hand, mounted in 5% KOH solution or water, and then stained with
cotton blue or lactophenol solution. The sections were observed under an OLympus BH-
2 microscope. The type specimen was deposited in the Herbarium of Yunnan Academy
of Agricultural Sciences, Kunming, China (YAAS).
Total genomic DNA was extracted using the ZomANBIO Plant Genomic DNA Kit.
The internal transcribed spacer (ITS) rDNA region was amplified with PCR primers
ITS4 and ITS5. The PCR reactions were run on a BIO-RAD C1000TM Thermal Cycles
with the following settings: initial denaturation for 5 min at 94°C, followed by 32 cycles
of 40 s denaturation at 94°C, annealing at 56°C for 40 s, extension for 1 min at 72°C,
and final extension at 72°C for 10 min. Purifying and sequencing of PCR products were
conducted by Beijing Genomics Institute.
Hydnotrya laojunshanensis sp. nov. (China) ... 279
The Hydnotrya YAAS L2425 sequence was analyzed molecularly with 35 retrieved
from GenBank were used for phylogenetic analysis. Gyromitra infula (Schaeff.) Quél.
was selected as the outgroup. Sequences were edited and assembled using SeqMan II
(Larsson & Sundberg 2011). Alignment of nucleotide sequences was performed by
Mafft-win. Sequences were adjusted manually using BioEdit 7.0.1. Phylogenetic analyses
were carried out via PAUP* 4.0 BEAT. Equally weighted parsimony (MP) was used to
search for optimal trees, its specific procedures and analyses were following the methods
of Hofstetter et al. (2002) and Larsson & Sundberg (2011).
Results & discussion
Phylogenetic analysis
Six strict consensus trees were generated based on the MP analyses of the 36
ITS sequences (L = 607, CI = 0.883, RI = 0.927, RC = 0.818), shown in PLATE 2
with associated bootstrap supports for branches.
854 Hydnotrya tulasnei GQ149457
Hydnotrya tulasnei HM189757
Hydnotrya tulasnei GQ149461
Hydnotrya tulasnei HM189760
Hydnotrya tulasnei HM189762
Hydnotrya tulasnei HM189761
Hydnotrya tulasnei GQ149460
Hydnotrya tulasnei GQ215700
Hydnotrya tulasnei GQ215698
Hydnotrya tulasnei GQ149459
Hydnotrya tulasnei GQ215699
Hydnotrya tulasnei HM189763
Hydnotrya tulasnei HM189756
Hydnotrya tulasnei HM189755
Hydnotrya tulasnei GQ149454
Hydnotrya tulasnei GQ149455
Hydnotrya tulasnei HM189759
Hydnotrya tulasnei GQ149456
Hydnotrya tulasnei GQ149458
Hydnotrya tulasnei GQ149462
Hydnotrya tulasnei GQ149463
abbreviation: bs
67
100
100
Hydnotrya bailii GQ140238
Hydnotrya bailii GQ149464
Hydnotrya bailii GQ149465
Hydnotrya bailii GQ140237
Hydnotrya bailii GQ140239
Hydnotrya bailii AM261522
60
73
100
100 Hydnotrya cerebriformis JF908765
Hydnotrya cerebriformis GQ140235
Hydnotrya cerebriformis GQ140234
Hydnotrya cerebriformis GQ140236
100
Hydnotrya cubispora EU784273
100 p Hydnotrya michaelis EU784274 Subclade II
99 Hydnotrya michaelis EU784275 Clade I
Hydnotrya laojunshanensis KC878618, Type | Subclade I
Gyromitra infula GQ377484
PLATE 2. The strict consensus tree produced from ITS sequence analysis of Hydnotrya spp.
280 ... Li & al.
In the strict consensus tree the new species and H. michaelis form Clade
I with 99% bootstrap support. This then subdivides into two subclades.
Subclade I contains H. laojunshanensis and Subclade II H. michaelis, which
has strong bootstrap support (bs = 100%). The phylogenetic analysis supports
H. laojunshanensis as separate from (although closely related to) H. michaelis
and distinct from other Hydnotrya species.
Taxonomy
Hydnotrya laojunshanensis Lin Li, D.Q. Zhou & Y.C. Zhao, sp. nov. PLATEs 3, 4
MycoBank MB 803968
Differs from all other Hydnotrya spp. by its single-chambered ascocarp and larger
ascospores.
Type: China: Yunnan, Laojun mountains, 26°42’N 99°42’E, alt. 3786 m, in forest of
Abies forrestii var. smithii Viguié & Gaussen, 30.8.2012, Lin Li (Holotype, YAAS L2425;
GenBank KC878618).
Erymo oey: from the Latin for Laojun, the type locality.
Ascocarp irregularly globose, 1.0-1.2 cm in diameter when fresh, smooth,
single-chambered with a primary apical opening up to 0.1-0.5 cm in diameter;
cavity wall 1-2 mm thick when dry, of three layers: inner layer white, middle
layer red, outer layer reddish-brown. PERIDIUM two-layered, 605-633 um
PLATE 3. Hydnotrya laojunshanensis (holotype, YAAS L2425). Ascocarp.
Hydnotrya laojunshanensis sp. nov. (China) ... 281
PiatTE 4. Hydnotrya laojunshanensis (holotype, YAAS L2425). A. Paraphyses in lactophenol cotton
blue; B. Asci in lactophenol cotton blue; C. Ascospores in water; D. Peridium in lactophenol
solution.
thick, outer layer 223-260 um thick, pseudoparenchymatous, composed of
light brown angular or irregular cells of (27.7-)33.0-46.5(-54.0) x (19.7-)31.8
(-45.0) um, inner layer, 382-373 um thick, consisting of hyaline interwoven
hyphae. HyMENIUuM two-layered, the one next to the peridium deep orange,
another yellowish to whitish. Ascr cylindrical, 342.4-401.1 x (24.2-)29.1-35.9
um, 8-spored, regular-monoseriately arranged. Ascospore elliptical (without
ornamentation) or rectangle (with ornamentation), reddish orange, (42.5-)
50.0-57.2(-60.3) x (27.5—)30.4-36.9(-38.2) um (with ornamentation), (29.2-)
35.3-42.4(-44.0) x (20.3-)24.4-29.8(-30.0) um (with ornamentation), Q = 1.28.
PARAPHYSES hyaline, straight, 2.4-6 um in diam, apical slightly inflated up to
(10.8—)13.1-15.2(-18.3) um wide, septate, protruding up to 242.6-373.0 um.
EcoLocy & DISTRIBUTION: solitary in the soil in an Abies forrestii var. smithii
forest. Known only from Yunnan Province, China.
ComMENTS — This species is characterized by large, rectangular ascospores and
a single-chambered ascocarp, which distinguishes it from all other Hydnotrya
species. ITS sequence analysis also shows that H. laojunshanensis is distinct from
282 ... Li & al.
other Hydnotrya species, although closely related to H. michaelis. Hydnotrya
laojunshanensis differs in having larger ascospores and lacking any cerebriform
folding, whereas H. michaelis typically has strongly inwardly folded lobes.
Acknowledgements
The authors are grateful to Dr. Jan R. Hall and Dr. Wang Yun, who critically reviewed
the manuscript and provided invaluable suggestions. This study was financially
supported by the National Science Foundation of China (Nos. 31160010 and 31160160)
and Yunnan Education Department Important Project (ZD2010010).
Literature cited
Bemmann M, Bandini D. 2011. A collection of Hydnotrya confusa Spooner 1992 from Southwest
Germany. Ascomycete.org 3(3): 55-60.
Hansen K, Pfister DH. 2006. Systematics of the Pezizomycetes - the operculate discomycetes.
Mycologia 98(6): 1029-1040. http://dx.doi.org/10.3852/mycologia.98.6.1029
Hofstetter V, Clemencon H, Vilgalys R, Moncalvo JM. 2002. Phylogenetic analyses of the Lyophylleae
(Agaricales, Basidiomycota) based on nuclear and mitochondrial rDNA sequences. Mycological
Research 106: 104-1059. http://dx.doi.org/10.1017/S095375620200641X
Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi,
10th ed. Wallingford UK: CABI.
Leessoe T, Hansen K. 2007. Truffle trouble: what happened to the Tuberales? Mycological Research
111(9): 1075-1099.
Larsson E, Sundberg H. 2011. Lyophyllum shimeji, a species associated with lichen pine forest in
northern Fennoscandia. Mycoscience 52: 289-295.
http://dx.doi.org/10.1007/s10267-010-0104-1
O'Donnell K, Cigelnik E, Weber NS, Trappe JM. 1997. Phylogenetic relationships among
ascomycetous truffles and the true and false morels inferred from 18S and 28S ribosomal DNA
sequence analysis. Mycologia 89(1): 48-65. http://dx.doi.org/10.2307/3761172
Spooner B. 1992. A new species of Hydnotrya (Helvellaceae) from the British Isles. Kew Bulletin
47(3): 502. _http://dx.doi.org/10.2307/4110576
Stielow B, Bubner B, Hensel G, Miinzenberger B, Hoffmann P, Klenk HP, Géker M. 2010. The
neglected hypogeous fungus Hydnotrya bailii Soehner (1959) is a widespread sister taxon of
Hydnotrya tulasnei (Berk.) Berk. & Broome (1846). Mycol Progress 9: 195-203.
Tedersoo L, Hansen K, Perry BA, Kjoller R. 2006. Molecular and morphological diversity of
pezizalean ectomycorrhiza. New Phytologist 170: 581-596.
http://dx.doi.org/10.1111/j.1469-8137.2006.01678.x
Tao K, Liu B. 1989. Preliminary study on Hydnotrya from China. Journal of Shanxi University (Nat.
Sci. Ed.) 12(1): 81-85.
Xu AS. 2000. Two species of Hydnotrya in Xizang. Mycosystema 19(4): 568-569.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.283
Volume 125, pp. 283-288 July-September 2013
Phylogenetic divergence of three morphologically similar
truffles: Tuber sphaerosporum, T. sinosphaerosporum, and T.
pseudosphaerosporum sp. nov.
L1 FAN’ & SHUANG-FEN YUE
College of Life Science, Capital Normal University,
Xisanhuanbeilu 105, Haidian, Beijing 100048, China
* CORRESPONDENCE TO:
[email protected]
ABSTRACT — We describe and illustrate T. pseudosphaerosporum, a new species from
Yunnan, China. This is most closely related to the European T: borchii and the North
American T. gibbosum. ITS-rDNA sequence analysis reveals the phylogenetic divergence
of three morphologically similar truffle species: T. sphaerosporum from North America,
and T: sinosphaerosporum and T. pseudosphaerosporum from China. Phylogenetically,
T. sphaerosporum is most closely related to another North American species, T: californicum,
while T. sinosphaerosporum clusters with a European species, T: dryophilum.
Key worps — Ascomycota, white truffle
Introduction
In November 2012, during our yearly investigation of Tuber species
in Yunnan Province, China, we found some white truffles in a stand of the
conifer Pinus armandii Franch. This truffle differed from most known species
but was morphologically almost indistinguishable from the North American
T. sphaerosporum Gilkey (Gilkey 1954) and the Chinese T. sinosphaerosporum L.
Fan etal. (Fan et al. 2013). Our aim was to resolve the phylogenetic relationships
of these three species based on ITS-nrDNA sequences and to describe the new
species. Our phylogenetic analysis indicates that the new species is distant from
both T: sphaerosporum and T: sinosphaerosporum.
Materials & methods
Morphological studies
Fresh specimens were collected from Yunnan Province, China, and deposited in
the Herbarium of the Biology Department, Capital Normal University (BJTC), Beijing.
284 ... Fan & Yue
TABLE 1. Tuber specimens and sequences used in phylogenetic analysis.
SPECIES VOUCHER ORIGIN GENBANK No. (ITS)
T. aestivum TaeW064S-W140 (UPS) Sweden AJ888062
TaeW028I-E157 (UPS) Italy AJ888118
T. borchii GB45 Italy HM485344
T. sphaerospermum AH39190 Spain JN392246
T. californicum JT22590 USA HM485351
JT28058 USA HM485346
T. dryophilum GB69 Italy HM485353
GB37 Italy HM485354
T. gibbosum JT2789 USA FJ809869
T. lijiangense HKAS 52005 (Holotype) China KF805727
HKAS 52005 China GQ217541
T. microsphaerosporum BJTC FAN152 (Holotype) China KF805726
T. oligospermum MA: Fungi: 41010A Spain FM205506
MA: Fungi: 41010B Spain FM205507
T. oregonense JT8767 USA FJ809879
T. pseudosphaerosporum BJTC FAN250 (Holotype) China KF744063
BJTC FAN260 China KF744062
T. puberulum TL3857 Denmark AJ969625
T. sinosphaerosporum BJTC FAN135 (Holotype) China JX092086
BJTC FAN136 China JX092087
T. sphaerosporum JT12487 USA FJ809853
JT19772 USA FJ809854
Macroscopic characters were described from both fresh and rehydrated specimens.
Microscopic characters were described from razor-blade sections mounted in 3%
KOH, Melzer’s reagent, or 0.1% (w/v) cotton blue in lactic acid. For scanning electron
microscopy (SEM), spores were scraped from the dried gleba, placed onto double-sided
tape, mounted directly onto an SEM stub, coated with palladium, and then examined
and photographed using a HITACHI S-4800 SEM.
Molecular methods
Herbarium samples were crushed by shaking for 3 min at 30 Hz (Mixer Mill MM 301,
Retsch, Haan, Germany) in a 1.5 ml tube, together with one 3 mm diameter tungsten
carbide ball. Total genomic DNA was then extracted using a EZNA_Fungal DNA kit
(Omega Bio-Tek Inc. Norcross, Georgia, United States) following the manufacturer's
protocol. The ITS region was amplified by PCR using the primers ITS1 and ITS4 (White
et al. 1990). PCR was performed in a 50 ul reaction system containing 2 ul of DNA
template, 2 ul of each 10 uM primer, and 25 ul of 2x Master Mix (Tiangen Biotech Beijing
Co. Ltd., Beijing). The PCR protocol was as follows: an initial denaturation at 95°C for 3
min, followed by 30 cycles at 95°C for 2 min, 55°C for 25 s, 72°C for 2 min, with a final
extension at 72°C for 10 min. The PCR products were sent to Invitrogen Biotechnology
Co. Ltd. (Beijing, China) for purifying, sequencing, and editing. The other sequence
data included in our study were downloaded from GenBank (TABLE 1).
Tuber pseudosphaerosporum sp. nov. (China) ... 285
Phylogenetic analyses
DNA sequences were aligned using Clustal X v1.83 (Thompson et al. 1997), and
the alignment was manually adjusted using Se-Al v.2.03a (Rambaut 2000). The aligned
dataset was analyzed by maximum parsimony (MP) using PAUP* 4.0b10 (Swofford
2002). MP analysis was conducted using heuristic searches with 1,000 random addition
sequence replicates, and the tree bisection reconnection (TBR) branch-swapping
algorithm. All characters were equally weighted and unordered. Gaps were treated
as missing data to minimize homology assumptions. A bootstrap (BP) analysis was
performed with 1,000 replicates, each with 10 random addition sequence replicates, and
using TBR branch-swapping. A Bayesian analysis was performed using MrBayes 3.1.2
(Huelsenbeck et al. 2001; Ronquist & Huelsenbeck 2003) with two sets of four chains
Tuber sphaerosporum FJ809854
Tuber sphaerosporum FJ809853
Clade 1
Tuber californicum HM485351
Tuber californicum HM485346
Tuber oligospermum FM205507
Tuber sphaerospermum JN392246
Tuber lijiangense HKAS52005
Tuber lijiangense GQ217541
Tuber microsphaerosporum BJTC FAN152
Tuber sinosphaerosporum JX092087
Tuber sinosphaerosporum JX092086
Clade 2
Tuber dryophilum HM485354
Tuber dryophilum HM485353
Tuber oregonense FJ809879
Tuber gibbosum FJ809869
Tuber pseudosphaerosporum BJTC FAN260
Clade 3
Tuber pseudosphaerosporum BJTC FAN250
Tuber puberulum AJ969625
Tuber borchii HM485344
Tuber aestivum AJ888062
Tuber aestivum AJ888118
10
Fic. 1. Phylogeny derived from maximum parsimony analysis of ITS rDNA sequences from some
Tuber species with globose ascospores. Bootstrap values of >70% are shown above branches. Clades
with Bayesian posterior probabilities (PP) estimated at >0.90 are shown under branches. Tuber
aestivum was used as outgroup. Tree length (TL) = 876 steps, consistency index (CI) = 0.7021,
retention index (RI) = 0.7792, homoplasy index (HI) = 0.2979, and rescaled consistency index
(RC) = 0.5470.
286 ... Fan & Yue
(one cold and three heated) and the stoprule option in effect, halting the analyses at an
average standard deviation of split frequencies of 0.01. The sample frequency was set to
100, and the first 25% of trees were removed as burn-in. Bayesian posterior probabilities
(PP) were obtained from the 50% majority rule consensus of the remaining trees. Tuber
aestivum Vittad. was used as the outgroup.
Results
Molecular phylogeny
Maximum parsimony analysis resulted in one most parsimonious tree (Fic. 1).
Our phylogenetic analysis was based on sequences from 13 Tuber species with
globose ascospores. It revealed that T’ sphaerosporum, T: sinosphaerosporum,
and T. pseudosphaerosporum are in separate clades. Tuber sphaerosporum
clustered with T. californicum Harkn. in Clade 1 with moderate support, and
T. sinosphaerosporum clustered with T. dryophilum Tul. & C. Tul. in a well-
supported clade (Clade 2 in Fic. 1). A third clade was also strongly supported,
and contained T: pseudosphaerosporum, T. oregonense Trappe et al., T: gibbosum
Harkn., T. borchii Vittad., and T. puberulum Berk. & Broome.
Taxonomy
Tuber pseudosphaerosporum L. Fan, sp. nov. Fic. 2
MycoBank MB 803932
Differs from other Tuber species by its purple-brown gleba and regular globose
ascospores with coarse reticulum.
Type: China. Yunnan Province, Huize County, Daibu Town, in the soil under Pinus
armandii, 11 Nov. 2012, Shuang Feng 017 (Holotype, BJTC FAN250).
ETyMOLoGy: pseudosphaerosporum (Lat.), referring to the great similarity with the
North American T. sphaerosporum.
ASCOMATA 2-4.5 cm in diam., white, whitish, or whitish-yellow when fresh,
subglobose to irregular, mostly much lobed with deep furrows, firm, nearly
glabrous. Odor pungent at maturity. PERrpIUM 250-350 um in thickness, outer
layer pseudoparenchymatic, 150-250 um, composed of subglobose, subangular
or irregular cells of 5-25(-40) um, smaller and larger cells intermixed, cells
hyaline with somewhat thickened yellow walls and up to 2.5 um; toward inner
side grading into textura intricata, composed of interwoven hyphae, hyaline,
septate, thin-walled, branched, 3-5 um in diam., occasionally with a few hyphae
swollen to 20 um in diam. GLEBA white at first, gradually becoming brown, and
finally somewhat dark grey-brown with a purple tint at maturity, marbled with
larger whitish meandering veins. Asc1 1-3(-4)-spored, hyaline, thin-walled,
subglobose to ellipsoid, sessile, 55-85 x 52.5-75 um. Ascospores brown,
regularly globose, reticulate, 25-37.5 um in diam. excluding ornamentations,
Tuber pseudosphaerosporum sp. nov. (China) ... 287
Fic. 2. Tuber pseudosphaerosporum (BJTC FAN250, holotype). a. Ascomata; b. Ascospores observed
under the light microscope; c. Ascospore observed under SEM.
alveoli large and regular, up to 4-7.5 um tall and 3-4(-5) alveoli across the
spore width.
ADDITIONAL SPECIMEN EXAMINED: CHINA. YUNNAN PROVINCE, Huize County, in the
soil under Pinus armandii, 11 Nov. 2012, Xiao-yong Li 008 (BJTC FAN 260).
CoMMENTS— Tuber pseudosphaerosporum is morphologically similar to both
T. sinosphaerosporum and T: sphaerosporum. These three species are very easily
confused in most of their taxonomic characters (TABLE 2). Our phylogeny,
however, places them in separate clades (Fic. 1), indicating their independent
origins. The grey-purple tint in the gleba appears to be unique to the new species
and is not observed in T. sinosphaerosporum or T: sphaerosporum (Gilkey 1954;
Fan et al. 2013). In addition, the ascomatal surfaces of both T. sphaerosporum
and T: pseudosphaerosporum are glabrous, while T: sinosphaerosporum produces
poorly developed and non-specialized septate hyphae-like obtuse hairs on its
ascomatal peridium (Fan et al. 2013).
Discussion
Tuber pseudosphaerosporum, T: sinosphaerosporum, and T: sphaerosporum
are very similar morphologically, especially in their ascospore ornamentation
— traditionally one of the most important characters used for species
differentiation in this genus (TABLE 2). All three have large-meshed reticulate
ascospores (generally 3-4 meshes across the spore width), dark gleba, and
pale colored ascomata with nearly glabrous surfaces. Hypha-like hairs can
occasionally be found on the peridia of T! sinosphaerosporum, but these are
usually poorly developed and easily overlooked. It is thus very difficult to
separate these species on the basis of morphology. Our phylogenetic analysis
however, clearly places the three species in different clades (Fic. 1), indicating
that they have evolved in different lineages despite their morphological
similarities.
288 ... Fan & Yue
TABLE 2. Morphological comparison of the three Tuber species.
MORPHOLOGICAL
phen T. pseudosphaerosporum T. sinosphaerosporum T. sphaerosporum
Ascocarp color Whitish White to whitish Pale brown
Ascocarp size 2-4.5 cm 1.5-5.5 cm 2.5 cm
Peridium surface Glabrous Nearly glabrous Glabrous
Peridium structure _Irregularly Peeadaparenetnanatie Irregularly
pseudoparenchymatic pseudoparenchymatic
Peridium thickness 150-250 um 250-300 um _
Peridium hairs Absent Cylindrical and obtuse Absent
che Der brown wie Dark brown Dark brown
purple tint
Spore number 1-3(-4) 1-4 1
in ascus
Spore shape Regularly globose Regularly globose Regularly globose
Spore size 25-37.5 um 20-45 um 32-58 um,
including alveoli
Spore ornament Alveolate Alveolate Alveolate
Alveoli number 3-4(-5) 2-4 3-4
Alveoli height 4-7.5 um 5-7.5 um —
Tuber sphaerosporum is known only from North America, and T’ pseudo-
sphaerosporum and T. sinosphaerosporum are known only from southwestern
China.
Acknowledgments
We are grateful to Prof. Dr. Lei Cai and Dr. Ian R. Hall for their pre-submission
reviews. The study was supported by the National Natural Science Foundation of China
(No. 31270058), the Beijing Natural Science Foundation (No. 5122003) and the Key
Program of the Beijing Education Commission (KZ201110028036).
Literature cited
Fan L, Cao JZ, Li Y. 2013['2012’]. Tuber sinosphaerosporum sp. nov. from China. Mycotaxon 122:
347-353. http://dx.doi.org/10.5248/122.347
Gilkey HM. 1954. Tuberales. N. Amer. FL. Ser. I, 1: 1-36.
Huelsenbeck JP, Ronquist F, Nielsen R. Bollback JP. 2001. Bayesian inference of phylogeny and its
impact on evolutionary biology. Science 294: 2310-2314.
http://dx.doi.org/10.1126/science.1065889
Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed
models, Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180
Swofford DL. 2002. PAUP*, phylogenetic analysis using parsimony (*and other methods), version
4. Sunderland, MA, USA, Sinauer Associates.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The CLUSTALX windows
interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.
Nucleic Acids Res. 24: 4876-4882. http://dx.doi.org/10.1093/nar/25.24.4876
White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal
RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR Protocols: a Guide to
Methods and Applications. Academic Press, San Diego.
ISSN (print) 0093-4666 © 2013. Mycotaxon, Ltd. ISSN (online) 2154-8889
MY COTAXON
http://dx.doi.org/10.5248/125.289
Volume 125, pp. 289-301 July-September 2013
Spatial data for fungal specimens:
retrospective georeferencing and
practical recommendations for mycologists
RICARDO BRAGA-NETO’, RENATO DE GIOVANNI’,
FLAVIA FONSECA PEZZINI’, DORA ANN LANGE CANHOS’,
ALEXANDRE MARINO’, SIDNEI DE SOUZA’! & LEONOR CosTA MAIA?
‘Centro de Referéncia em Informacgao Ambiental, Campinas, SP, 13084-791, Brazil
?Universidade Federal de Pernambuco, Centro de Ciéncias Biol6égicas,
Departamento de Micologia, Recife, PE, 50670-420, Brazil
*CORRESPONDENCE TO:
[email protected]
ABSTRACT — The number of studies based on herbarium data for analyzing biogeographical
patterns and environmental questions is increasing, as herbaria are making their collections
available online. However, the quality of a specimen’: spatial data still varies dramatically
among records. Most historical specimen records either lack geographic information or
have only vague textual descriptions about the locality, while contemporary records may
exhibit unwarranted variation in spatial data quality, requiring increased awareness among
mycologists about the importance of high quality primary spatial data for specimens.
Georeferencing is the process of assigning geographic coordinates to a record linking it to
a geographic location on Earth, and it can be processed retrospectively for records without
geographical coordinates based on locality descriptions or directly collected in the field
using GPS handheld units. Here we provide an overview of methods for georeferencing
historical data retrospectively, discuss practical recommendations for collecting high quality
spatial data for fungal specimens, and suggest decimal degrees as a standard form for citing
geographic coordinates.
Keyworps — biogeography, conservation, ecological niche modelling, GIS, phylogeography
Introduction
Fungal taxonomy aims to investigate the diversity of fungi on Earth,
assigning names, and proposing phylogenetic relationships among species.
Global estimates for fungi vary dramatically depending on the methods
used (Blackwell 2011, Scheffers et al. 2012), ranging from 611,000 (Mora et
al. 2011) up to 9.9 million species (Cannon 1997). Presently, there are almost
290 ... Braga-Neto & al.
100,000 known fungal species (Kirk et al. 2008), which surely represent only
a small fraction of extant species. Specimens harbored in herbaria represent
occurrence records of a taxon at a given location on a specific date and provide
a fundamental reference to morphological and molecular studies that are
necessary to ascribe species names (e.g., Brock et al. 2009, Osmundson et al.
2013). They allow the delimitation and revaluation of a species identity when
more taxonomic and molecular knowledge becomes available (e.g., Cabral et al.
2012). Herbaria throughout the world are increasingly making their collections
available online, and consequently the number of studies based on herbarium
data for analyzing biogeographical patterns and environmental questions is
also increasing (Lavoie 2013). However, most biological specimen records
either lack geographic coordinates or have only imprecise textual descriptions
about the locality (Guralnick et al. 2006), severely limiting the comprehension
of species distributions. Public databases containing fungal specimen data exist
at global (e.g., Global Biodiversity Information Facility - GBIF, www.gbif.org/)
and regional scales (e.g., speciesLink network, www.splink.org.br/), but the use
of this data is still incipient among mycologists.
In the case of fungi, herbarium data have been explored to investigate
biogeographical patterns (Wu & Mueller 1997, Mueller et al. 2001, Oda et al.
2004, Wollan et al. 2008, Geml et al. 2012, Wolfe et al. 2012) and climate change
effects on sporocarp phenology (Kauserud et al. 2008, 2010, 2012), and to model
the potential distribution of invaders (Wolfe et al. 2010, Wolfe & Pringle 2012).
However, as we improve our knowledge about fungi, the quality of spatial data
still varies dramatically among records. As expected, most historical records
have vague textual descriptions of localities, and most labels lack geographical
coordinates. Nevertheless, such unwarranted variation in spatial data quality
can also be found in contemporary records, requiring an increased awareness
by mycologists.
Halme et al. (2012) discussed the need to rethink data collection, database
structure, and organization, stressing the importance for standardizing data
collection practices. However, they did not emphasize the importance of spatial
data quality for documenting species occurrence. The scarcity and variability of
data related to geographic coordinates has severe implications for biodiversity
and related life science research, including taxonomy, phylogenetics, ecology,
biogeography, biological monitoring (Halme et al. 2012), and conservation
planning (Dahlberg & Mueller 2011, Molina et al. 2011). Without specimen
occurrence information, one cannot make inferences about spatial processes
that influence the delimitation and distribution of species. Geographic
Information Systems (GIS), which were designed to manage and analyze spatial
information, can be used to integrate fungal databases with other variables such
Spatial data for fungal specimens ... 291
as land cover, protected areas, and climatic layers of present, past, and future
scenarios. The development of ecological niche models (Peterson et al. 2011),
which use known occurrence points to estimate potential species distribution
based on the ecological niche to define suitable sites, is another promising
avenue for mycological research. These models are an important biological tool
for taxonomy, ecology, evolution, conservation, epidemiology, invasive species
management, and protected area planning, as all research fields depend on
accurate and precise coordinates for specimens.
Georeferencing is the process of assigning geographic coordinates to a
record, linking it to a geographic location on Earth (Chapman & Wieczorek
2006). Legacy specimens, which usually have only textual information regarding
their locality, and recent collections made without geographic coordinates may
be georeferenced retrospectively (Murphey et al. 2004), increasing the quality
of specimen occurrence records. On the other hand, contemporary collectors
could improve the accuracy and precision of their geographic coordinates by
using Global Positioning System (GPS) handheld units.
As mycologists may not be well trained in georeferencing, we shall
discuss how to improve georeferencing quality for fungal specimens. Our
initial motivation came from practical experience, as most fungal specimens
now available from the speciesLink network (http://splink.cria.org.br/) — a
Brazilian initiative that integrates primary biodiversity data for the Brazilian
Virtual Herbarium of Plants and Fungi (http://inct-florabrasil.net/) — lack
geographical coordinates. For instance, Schizophyllum commune Fr., a widely
distributed and quite abundant species, has 410 records in speciesLink network,
but only 27 (~ 6.5%) could be selected to generate an ecological niche model.
Record selection in this case took into account a number of quality criteria
(Giovanni et al. 2012), but it is important to note that most records (85%!) were
discarded because of the absolute lack of geographical coordinates. Due to the
few records selected and their geographical bias, the generated model omits
vast regions in the study area (Braga-Neto 2013a). Similarly, of the 594 records
for Pycnoporus sanguineus (L.) Murrill available in speciesLink, only 47 (~ 8%)
were selected (Braga-Neto 2013b). Therefore, so as to increase awareness about
the importance of spatial data for fungal specimens, we provide an overview
of methods to georeference historical data retrospectively, discuss practical
recommendations for collecting high quality spatial data, and suggest a standard
form for citing geographic coordinates.
Accuracy, precision, coordinate system and datum
Understanding the distinction between accuracy and precision is crucial,
both for retrospective georeferencing of locality data and documenting
292 ... Braga-Neto & al.
localities (Murphey et al. 2004). Accuracy refers to how close a measurement
of a quantity corresponds to its true value (whereas precision is the degree to
which repeated measurements show the same results). Accuracy depends on
how data is collected and processed. At the time of collection, accuracy refers to
the quality of the location originally reported by the specimen collector, which
may be accurately or inaccurately described, regardless the level of geographic
detail recorded. In georeferencing, accuracy is related to correctly positioning
the locality points based on available information and correctly entering the
data into a spreadsheet or database. PRECISION, in the context of georeferencing,
refers to the geographic extent potentially represented by the locality
(Fics. 1-3). It is a product of the original locality description or measurement
and the georeferencing method applied. A georeference can be accurate but not
precise, precise but not accurate, neither, or both. A description of a locality
containing only information about the county may be accurate, but because a
county is a large geographic area, it is relatively imprecise. On the other hand, a
locality described retrospectively by latitude and longitude coordinates may be
precise because only a small geographic area is involved, but inaccurate if the
georeferencer assigned the values erroneously. Furthermore, a georeference can
be inaccurate and imprecise if the coordinate measurement in the field contains
a systematic error and the datum was specified incorrectly. The georeferencing
process was designed to assign accurate and precise locality data to specimen
records, but as all measurement involves some kind of error, it is very important
to document uncertainties as they can determine the suitability of data for
particular analyses (Rocchini et al. 2011).
Also important is the geographic COORDINATE SYSTEM, which enables every
location on Earth to be specified unambiguously. The most common global
systems are Latitude/Longitude (preferentially expressed in decimal degrees)
and the Universal Transverse Mercator (UTM), which uses a metric-based
Cartesian grid to locate positions on the Earth's surface. The UTM system is
not a single map projection but a series of map projections (known as zones),
one for each of sixty 6-degree bands of longitude. On the other hand, the earth's
surface is not perfectly round, so it is necessary to correct these undulations. The
DATUM is a mathematical model of the size and shape of the earth, and of the
origin and orientation of coordinate systems. Coordinates without a horizontal
datum do not uniquely specify a location, so failure to record the correct datum
associated with coordinates can result in positional errors of hundreds to
thousands of meters on a global scale (Wieczorek et al. 2004). Given its impact
on precision, it is essential to provide information about the datum used as an
essential part of the coordinate description. Datum shifts must be taken into
Spatial data for fungal specimens ... 293
FIGURES 1-3. Geographical projections of estimated errors as a function of the number of decimal
places in the decimal degree format (Wieczorek et al. 2004). The most precise coordinate was used
as a reference point around which errors were depicted as buffer zones; the darker the buffer the
more precise. A specimen recorded originally with 5 decimal places (e.g., Latitude -22.33214,
Longitude —48.87189) has very precise spatial data, because it includes an error radius of only 1.51
m estimated for this latitude. 1. If the coordinate chosen as an example did not contain any decimal
place (e.g., Latitude -22, Longitude -49) the error dramatically would increase 100,000-fold. This
error is depicted as the light gray 151 km radius buffer within Sao Paulo State, Brazil. 2. Close-up of
Sao Paulo State showing the same buffer and a smaller and darker one that represents the 15.1 km
expected error if the coordinate contained only one decimal place (e.g., Latitude -22.3, Longitude
-48.9). 3. A closer view shows that a coordinate with two decimal places (e.g., Latitude -22.33,
Longitude -48.87) is expected to embody an error of 1.51 km, which decreases to 150 m if the
coordinate included three decimal places (e.g., Latitude -22.332, Longitude —-48.872). The dashed
polygon in Fic. 3 represents a Protected Area where the original point was obtained.
account when comparing data of different datum or re-projecting data to avoid
the inclusion of errors. The most common global horizontal datum is WGS84
(World Geodetic Survey 1984), but there are some regional datums frequently
used, such as NAD83 in North America, and SAD69 in South America.
294 ... Braga-Neto & al.
Retrospective georeferencing of specimen records
Most herbaria that house fungal specimens collected over the past centuries
currently face the task of georeferencing a vast amount of historical records,
inevitably complicated by imprecise text descriptions, inconsistent formatting,
misspellings, old names that have changed, different languages, and even
contradictory information about collection sites. Traditionally, herbarium
specimen labels have included several levels of text information specifying
the site where the collection was made (such as country, county, city, and/or
a reference to a place or geographic feature using some measure of distance
and direction) but rarely including geographic coordinates. Essentially,
retrospective georeferencing is a hypothesis that interprets quantitatively
a locality description based on best available geographic information, along
with associated uncertainty (Wieczorek et al. 2004). It attempts to define a
standardized process by minimizing subjectivity, but it is a time consuming
process (Murphey et al. 2004, Guralnick & Hill 2009, Hill et al. 2009), especially
if carried out on a specimen-by-specimen basis (Guralnick et al. 2006).
There are some methods being developed to georeference locality
descriptions objectively, some of which can be widely implemented even if
GIS expertise is lacking (Chapman & Wieczorek 2006). Basically, the methods
classify the locality descriptions, determine coordinates and extents, calculate
uncertainties, and document the georeferencing process. The Wieczorek et al.
(2004) point-radius method provides a relatively easy, practical solution for
georeferencing localities and estimating uncertainties. It takes into account
aspects of the precision and specificity of the site description, as well as the
map scale, datum, precision, and accuracy of the sources used to determine
coordinates. Each locality is described as a circle, with a point marking the
position most closely described by the site description and a radius describing
the maximum distance from that point within which the site is expected to
occur. However, the Wieczorek et al. (2004) method tends to overestimate the
uncertainty, since it is essentially additive and does not consider the probability
distribution for each uncertainty source (Guo et al. 2008); some other methods
have developed more complex estimates of uncertainties as probability surfaces
(Guo et al. 2008, Liu et al. 2009).
Along with setting appropriate methods, there is a general concern for
developing processing tools to increase the rate for georeferencing locations by
focusing on automated methods and batch processing (Guralnick et al. 2006,
Hill et al. 2009). These initiatives apply documented data standards and provide
essential information about the data processing steps to ensure the process is
replicable and may be improved upon, as the methods are still being developed
(Hill et al. 2009). Even so, Wieczorek et al. (2004) recommend checking
Spatial data for fungal specimens ... 295
automated results to ensure that they were interpreted correctly. Development
of these integrative tools will reduce redundancy of effort by returning assigned
coordinates directly to the data curators, increasing efficiency along the process
(Guralnick et al. 2006, Hill et al. 2009).
Depending on the data volume to be processed and the world region, another
promising and increasingly adopted approach to retrospective georeferencing
is based on Google Earth© (Garcia- Milagros & Funk 2010, Naparus & Kuntner
2012, Weirauch et al. 2012). This convenient and freely available popular
software offers a friendly interface that easily allows information visualization,
accepts data imported from different sources and formats (including decimal
degrees), includes uncertainty and datum, overlays maps, creates paths, points,
and polygons, measures linear distances or paths, checks point elevations,
manages points and associates them with notes and photos, shares data, and
exports to other software. However, the time needed to georeference each
specimen may be considerable (Garcia-Milagros & Funk 2010).
Georeferencing specimen records today
Collecting data in the field is the first step towards good georeferencing
procedures (Chapman & Wieczorek 2006). The most important improvement
in georeferencing practices stems from the Global Positioning System (GPS), a
satellite-based navigation system which determines location points anywhere
on Earth and in all weather conditions and is freely accessible to anyone with
a GPS receiver. Given the high accuracy and precision of GPS devices in
recording locality data, we strongly recommend GPS use in the field. All GPS
devices provide latitude and longitude, and some also calculate altitude. Since
the end of the ‘Selective Availability’ period on 1 May 2000, the accuracy of
hand-held GPS units improved from more than 100 m (McElroy 1998) to less
than 1 m.
The most useful devices for biological surveys are hand-held GPS units,
which are relatively cheap, small, and effective. Most modern units have a
colorful screen that displays map features and allows fast handling, along
with 12 parallel channels for acquiring GPS satellite signals faster and more
accurately. It is best to choose waterproof or at least water-resistant models
with replaceable batteries for collecting specimens in the field. Currently, GPS
units do not have basemaps by default, but it is possible to transfer maps and
increase their usefulness. For instance, the BirdsEye Satellite Imagery service
offers high-resolution color satellite imagery of surrounding environments
that at an additional cost can be uploaded to Garmin handheld GPS units. The
highest resolution images can help mycologists navigate, find trails, avoid edges
in forest fragments, and estimate spatial coverage, among several potential
296 ... Braga-Neto & al.
applications. Halme et al. (2012) demonstrated how to estimate sampling effort
by recording tracks produced by GPS during an inventory of wood-inhabiting
fungi in Finland. All these data require memory space, so devices with a USB
connection are highly recommended.
However, GPS data should not replace text descriptions of localities, which
are essential for validating the points. In contrast to legacy records, modern
collectors have the advantage of being directly responsible for specimen
data quality and can use many techniques and tools to ensure accurately
georeferenced locations. Hence, site descriptions should be as specific,
unambiguous, complete, and accurate as possible (Chapman & Wieczorek
2006). Collectors should avoid using vague terms such as ‘near’, ‘along’ and
‘center of’ without providing an offset distance estimate. To reduce uncertainty,
localities to be used as reference points should be permanent sites covering
small areas. If the site can only be tracked down by distances measured along a
path, road, or river, it is important to be accurate.
If no GPS device was available in the field, coordinates should be assigned
as soon after collection as possible from online maps (e.g., Google Earth) or
gazetteers (e.g., Alexandria Digital Library, Fuzzy Gazetteer). Some tools are
available globally (e.g., Geonames; www.geonames.org/), while others focus on
particular regions (e.g., GeoLoc, a web service for finding localities in Brazil;
http://splink.cria.org.br/geoloc). Various online maps carry more or less detailed
text information, such as forest district names that are often cited by collectors. Such
maps are available at the national level (e.g., France: www.geoportail.gouv.fr/accueil;
Australia: www.aus-emaps.com/topo.php) or sub-national level (e.g., Bavaria,
Germany: http://geoportal.bayern.de/bayernatlas/). Other useful tools are
GEOLocate (www.museum.tulane.edu/geolocate/), a platform dedicated to
georeferencing natural history collections data, and MaNIS Georeferencing
Calculator [(http://manisnet.org/gc.html], mostly helpful in calculating
offset distances and errors. It is important to assign the coordinates while the
information is still fresh, so you can easily and accurately locate the geographical
references.
How to improve accuracy and precision of GPS data
GPS accuracy depends mostly on the type of GPS unit used, the number of
satellites visible to your receiver, the strength of satellite signals, the geometric
positioning of the satellites in the sky, and atmospheric conditions. There is
always a degree of uncertainty that should be associated with any coordinate. A
GPS unit uses four or more satellites to calculate your latitude, longitude, and
altitude on Earth. However, handheld GPS altitude measurements are usually
inaccurate, so the most reliable measurements are horizontal. Maximizing
Spatial data for fungal specimens ... 297
170 1000000
160
150
__ 140 100000
430 =
g 120 —
% 110 % 10000
& 100 Fe
ui 90 wi
Q 8 9 1000
q 70 <
= 60 = 100
% 50 o
wu 40 ”
30 10
20
10
0
0 1 2 3 4 5 : ts) 1 2 3 4 5
4 NUMBER OF DECIMAL PLACES 5 NUMBER OF DECIMAL PLACES
Figures 4-5. The precision of geographic coordinates depends on the number of decimal places
in the decimal degrees format. 4. A geographic coordinate expressed in decimal degrees lacking
decimal places is expected to embody an error of hundreds of kilometers. However, errors vary with
Latitude; regions at the Equator are expected to include up to 35% more error than the ones near
the Poles. 5. The magnitude of the error, expressed in meters in a semi log scale, is negatively related
to the number of decimal places. The error is expected to decrease 10-fold for every increased
decimal place, so we recommend recording the most complete available information. ‘The inclusion
of five decimal places in all measurements ensures enough precision for most applications.
signal strength and the number of satellites available when measuring will
produce the best horizontal accuracies. Ensure that your device reads the signal
of at least four satellites, but if possible wait for more satellites to be detected.
Most GPS units express signal strength and horizontal accuracy, so wait a few
minutes or move to an area with better signal reception, taking note of the
distance and direction from the original point. GPS satellite signal may be
impaired by solid objects, such as mountains and dense forest canopy, causing
errors and even no reading at all. If you are working in a closed canopy area, it
is useful to turn on the GPS while still in an open area.
It is essential to configure the GPS coordinate system and datum in advance.
We recommend Latitude/Longitude in decimal degrees as the coordinate
system, and the datum WGS84 as a standard, as it is geocentric and globally
consistent. Since this configuration is followed by most systems, it will also
facilitate data exchange. A measurement in decimal degrees to five decimal
places is recommended (Fics. 4-5). Most GPS devices do not directly record
accuracy with the waypoint data but provide it in the interface showing current
satellite conditions. As the importance of estimating uncertainties also applies
to GPS-derived data, we recommend noting the accuracy of each point. To
forestall problems, it is a good practice to record GPS coordinates and associated
data (decimal latitude, decimal longitude, and accuracy) in a notebook. Most
importantly, document your data with proper metadata. Metadata is data about
data, describing the data with information about who, what, when, where, why,
and how; including the model of the device used is important.
298 ... Braga-Neto & al.
Standard form for geographical coordinates
One of the most critical georeferencing steps (and a major source of error)
is data entry. Reduce errors by adopting good practices. The most convenient
format for storing and managing geographic coordinates is DECIMAL DEGREES
(Wieczorek et al. 2004), which relies on just two attributes (decimal latitude,
decimal longitude) and does not include extra symbols, minimizing the
chances of transcription errors. Using different variations of the unit symbols
in the classical degrees, minutes, and seconds input format may produce
errors of more than 1 km (Hans Otto Baral, pers. comm.). Decimal latitude is
expressed by positive values to the North and negative values to the South of
the Equator, varying from 0 to 90 to the North Pole, and 0 to —90 to the South
Pole. Decimal longitude is expressed by positive values to the East and negative
values to the West of the Greenwich Meridian, varying from 0 to 180 in the East
and from 0 to —180 in the West. If possible, record the coordinates in decimal
degrees to five decimal places, as insufficiently precise coordinates can result in
uncertainties (Fics. 1-3). Error is expected to increase 10-fold every decimal
place lost (Fic. 5), so we recommend to record the most complete available
information. It is essential to provide information about the datum used (e.g.,
Latitude: —26.92856, Longitude: —49.04896, Datum: WGS84). There are online
tools that can help convert different formats to decimal degrees, as Converter
(http://splink.cria.org.br/conversor), an open access web-based service
developed by the Reference Center on Environmental Information (CRIA) that
converts different types of geographic coordinates and datums commonly used
in Brazil, and GeoCalc (www.geocomp.com.au/geocalc/), a free software that
converts coordinate data files between commonly-used mapping systems in the
world.
Final comments
Providing high quality geographic coordinates is an essential step in creating
species distribution maps, either by simply plotting the occurrence points
on the map or by modelling and projecting the ecological niche to depict its
potential distribution (Peterson et al. 2011). The adoption of simple practices
guarantees the collection of high quality primary spatial data for fungal
specimens. Data quality could be increased even further if herbarium curators
and editors of taxonomic, ecological, and conservation journals emphasized
the importance of providing geographic data for all specimens. Currently, most
fungal taxonomic journals do not require geographic coordinates as essential
information of specimens examined, leaving the responsibility of providing
locality data to collectors and herbarium curators. We encourage researchers
to obtain high quality data in the field and editors and curators to encourage
Spatial data for fungal specimens ... 299
geographic coordinates for specimens, greatly improving data availability and
maximizing their usefulness.
Acknowledgements
The initial motivation to write this paper arose from cleaning data in the speciesLink
network, which serves the Brazilian Virtual Herbarium of Plants and Fungi (INCT-
HVFF). We appreciate the support of Lorelei Norvell and Shaun Pennycook. We thank
Hans-Otto Baral, Panu Halme, and Tiara Sousa Cabral for valuable comments and
suggestions that improved the manuscript. We are also most grateful to all biological
collections that are integrating their data through speciesLink network, and the Brazilian
Ministry of Science, Technology and Innovation (MCTI). Financial support was
provided by the Brazilian National Council for Scientific and Technological Development
(CNPq), as scholarships to Ricardo Braga-Neto (350082/2013-8) and Flavia Fonseca
Pezzini (380768/2013-5), and research grants to INCT-HVFF (573.883/2008-4) and
Reflora (565.048/2012-4).
Literature cited
Blackwell M. 2011. The fungi: 1, 2, 3... 5.1 million species? American Journal of Botany 98:
426-438. http://dx.doi.org/10.3732/ajb.1000298
Braga-Neto R. 2013a. Schizophyllum commune Fr. [v.1]. Biogeografia da Flora e dos Fungos do
Brasil. INCT Herbario Virtual (http://biogeo.inct.florabrasil.net/proc/4585).
Braga-Neto R. 2013b. Pycnoporus sanguineus (L.) Murrill [v.1]. Biogeografia da Flora e dos Fungos
do Brasil. INCT Herbario Virtual (http://biogeo.inct.florabrasil.net/proc/4582).
Brock PM, Doring H, Bidartondo MI. 2009. How to know unknown fungi: the role of a herbarium.
New Phytologist 181: 719-724. http://dx.doi.org/10.1111/j.1469-8137.2008.02703.x
Cabral TS, Marinho P, Goto BT, Baseia IG. 2012. Abrachium, a new genus in the Clathraceae, and
Itajahya reassessed. Mycotaxon 119: 419-429. http://dx.doi.org/10.5248/119.419
Cannon PF. 1997. Diversity of the Phyllachoraceae with special reference to the tropics. 255-278,
in: KD Hyde (ed.). Biodiversity of tropical microfungi. Hong Kong University Press.
Chapman AD, Wieczorek J. 2006. Guide to best practices for georeferencing. Global Biodiversity
Information Facility, Copenhagen.
Dahlberg A, Mueller GM. 2011. Applying IUCN red-listing criteria for assessing and reporting on
the conservation status of fungal species. Fungal Ecology 4: 147-162.
http://dx.doi.org/10.1016/j.funeco.2010.11.001
Garcia-Milagros E, Funk VA. 2010. Improving the use of information from museum specimens:
Using Google Earth© to georeference Guiana Shield specimens in the US National Herbarium.
Frontiers of Biogeography, 2.
Geml J, Timling I, Robinson CH, Lennon N, Nusbaum HC, Brochmann C. 2012. An arctic
community of symbiotic fungi assembled by long-distance dispersers: phylogenetic diversity
of ectomycorrhizal basidiomycetes in Svalbard based on soil and sporocarp DNA. Journal of
Biogeography 39: 74-88. http://dx.doi.org/10.1111/j.1365-2699.2011.02588.x
Giovanni R, Bernacci LC, Siqueira MF, Rocha FS. 2012. The real task of selecting records for
ecological niche modelling. Natureza & Conservacao 10: 139-144. http://dx.doi.org/10.4322/
natcon.2012.018
Guo Q, Liu Y, Wieczorek J. 2008. Georeferencing locality descriptions and computing associated
uncertainty using a probabilistic approach. International Journal of Geographical Information
Science 22: 1067-1090. http://dx.doi.org/10.1080/13658810701851420
300 ... Braga-Neto & al.
Guralnick R, Hill A. 2009. Biodiversity informatics: automated approaches for documenting global
biodiversity patterns and processes. Bioinformatics 25: 1-8.
http://dx.doi.org/10.1093/bioinformatics/btn659
Guralnick RP, Wieczorek J, Beaman R, Hijmans RJ. 2006. BioGeomancer: automated georeferencing
to map the world’s biodiversity data. PLoS Biology 4: e381.
http://dx.doi.org/10.1371/journal.pbio.0040381
Halme P, Heilmann-Clausen J, Rama T, Kosonen T, Kunttu P. 2012. Monitoring fungal biodiversity
- towards an integrated approach. Fungal Ecology 5: 750-758.
http://dx.doi.org/10.1016/j.funeco.2012.05.005
Hill AW, Guralnick R, Flemons P, Beaman R, Wieczorek J, Ranipeta A. 2009. Location, location,
location: utilizing pipelines and services to more effectively georeference the world’s biodiversity
data. BMC bioinformatics 10(Suppl. 1): S3. http://dx.doi.org/10.1186/1471-2105-10-S14-S3
Kauserud H, Stige LC, Vik JO, Okland RH, Hgiland K, Stenseth NC. 2008. Mushroom fruiting
and climate change. Proceedings of the National Academy of Sciences of the United States of
America 105: 3811-3814. http://dx.doi.org/10.1073/pnas.0709037 105
Kauserud H, Heegaard E, Semenov MA, Boddy L, Halvorsen R, Stige LC. 2010. Climate change and
spring-fruiting fungi. Proceedings of the Royal Society, B 277: 1169-1177.
http://dx.doi.org/10.1098/rspb.2009.1537
Kauserud H, Heegaard E, Biintgen U, Halvorsen R, Egli S, Senn-Irlet B. 2012. Warming-induced
shift in European mushroom fruiting phenology. Proceedings of the National Academy of
Sciences of the United States of America 109: 14488-14493.
http://dx.doi.org/10.1073/pnas.1200789109
Kirk P, Cannon P, Minter D, Stalpers J. 2008. Ainsworth & Bisby’s dictionary of the fungi. 10th edn.
CAB International.
Lavoie C. 2013. Biological collections in an ever changing world: herbaria as tools for biogeographical
and environmental studies. Perspectives in Plant Ecology, Evolution and Systematics 15: 68-76.
http://dx.doi.org/10.1016/j.ppees.2012.10.002
Liu Y, Guo QH, Wieczorek J, Goodchild MF. 2009. Positioning localities based on spatial assertions.
International Journal of Geographical Information Science 23: 1471-1501.
http://dx.doi.org/10.1080/13658810802247114
McElroy S. 1998. Exploring GPS: a GPS users guide. Global Positioning System Consortium, New
South Wales.
Molina R, Horton TR, Trappe JM, Marcot BG. 2011. Addressing uncertainty: how to conserve and
manage rare or little-known fungi. Fungal Ecology 4: 134-146.
http://dx.doi.org/10.1016/j.funeco.2010.06.003
Mora C, Tittensor DP, Adl S, Simpson AGB, Worm B. 2011. How many species are there on Earth
and in the ocean? PLoS Biology 9: e1001127. http://dx.doi.org/10.1371/journal.pbio.1001127
Mueller GM, Wu Q-X, Huang Y-Q, Guo S-Y, Aldana-Gomez R, Vilgalys R. 2001. Assessing
biogeographic relationships between North American and Chinese macrofungi. Journal of
Biogeography 28: 271-281. http://dx.doi.org/10.1046/j.1365-2699.2001.00540.x
Murphey PC, Guralnick RP, Glaubitz R, Neufeld D, Ryan JA. 2004. Georeferencing of museum
collections: a review of problems and automated tools, and the methodology developed by
the Mountain and Plains Spatio-Temporal Database Informatics Initiative (Mapstedi).
PhyloInformatics 3: 1-29.
Naparus M, Kuntner M. 2012. A GIS model predicting potential distributions of a lineage: a test
case on hermit spiders (Nephilidae: Nephilengys). PloS One 7: e30047.
http://dx.doi.org/10.1371/journal.pone.0030047
Spatial data for fungal specimens ... 301
Oda T, Tanaka C, Tsuda M. 2004. Molecular phylogeny and biogeography of the widely distributed
Amanita species, A. muscaria and A. pantherina. Mycological Research 108: 885-896.
http://dx.doi.org/10.1017/S0953756204000620
Osmundson TW, Robert VA, Schoch CL, Baker LJ, Smith A, Robich G. 2013. Filling gaps in
biodiversity knowledge for macrofungi: contributions and assessment of an herbarium
collection DNA barcode sequencing project. PloS One 8: e62419.
http://dx.doi.org/10.1371/journal.pone.0062419
Peterson AT, Soberén J, Pearson RG, Anderson RP, Martinez-Meyer E, Nakamura M. 2011.
Ecological niches and geographic distributions. Princeton University Press, New Jersey.
Rocchini D, Hortal J, Lengyel S, Lobo JM, Jimenez- Valverde A, Ricotta C. 2011. Accounting for
uncertainty when mapping species distributions: the need for maps of ignorance. Progress in
Physical Geography 35: 211-226. http://dx.doi.org/10.1177/0309133311399491
Scheffers BR, Joppa LN, Pimm SL, Laurance WE. 2012. What we know and don't know about Earth's
missing biodiversity. Trends in Ecology & Evolution 27: 501-510.
http://dx.doi.org/10.1016/j.tree.2012.05.008
Weirauch C, Alvarez C, Zhang G. 2012. Zelus renardii and Z . tetracanthus (Hemiptera: Reduviidae):
biological attributes and the potential for dispersal in two assassin bug species. BioOne 95:
641-649. http://dx.doi.org/10.1653/024.095.0315
Wieczorek J, Guo Q, Hijmans R. 2004. The point-radius method for georeferencing locality
descriptions and calculating associated uncertainty. International Journal of Geographical
Information Science 18: 745-767. http://dx.doi.org/10.1080/13658810412331280211
Wolfe BE, Pringle A. 2012. Geographically structured host specificity is caused by the
range expansions and host shifts of a symbiotic fungus. The ISME Journal 6: 745-755.
http://dx.doi.org/10.1038/ismej.2011.155
Wolfe BE, Richard F, Cross HB, Pringle A. 2010. Distribution and abundance of the introduced
ectomycorrhizal fungus Amanita phalloides in North America. New Phytologist 185: 803-816.
http://dx.doi.org/10.1111/j.1469-8137.2009.03097.x
Wolfe BE, Kuo M, Pringle A. 2012. Amanita thiersii is a saprotrophic fungus expanding its range in
the United States. Mycologia 104: 22-33. http://dx.doi.org/10.3852/11-056
Wollan AK, Bakkestuen V, Kauserud H, Gulden G, Halvorsen R. 2008. Modelling and predicting
fungal distribution patterns using herbarium data. Journal of Biogeography 35: 2298-2310.
http://dx.doi.org/10.1111/j.1365-2699.2008.01965.x
Wu Q, Mueller GM. 1997. Biogeographic relationships between the macrofungi of temperate
eastern Asia and eastern North America. Canadian Journal of Botany 75: 2108-2116.
http://dx.doi.org/10.1139/b97-922
ISSN (print) 0093-4666 © 2013 Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/125.303
Volume 125, pp. 303 July-September 2013
Regional annotated mycobiotas
new to the Mycotaxon website
ABSTRACT — MycotTaxon is pleased to announce two new species distribution lists to our
‘web-list’ page covering the Russulaceae in Brazil (by Sa, Baseia & Wartchow) and poaceous
rusts in Pakistan (by Afshan & Khalid). This brings to 107 the open access mycobiotas now
available on the MycoTaxon website <www.mycotaxon.com/resources/weblists.html>.
SOUTH AMERICA
Brazil
MariANnA C.A. SA, IuRI G.BASEIA & FELIPE WartcHow. Checklist of
Russulaceae from Brazil. 14 p.
ABsTRACT— A checklist of species belonging to the family Russulaceae in Brazil
is provided. The list, which includes all species recorded in Brazil up to 2013,
cites 3 genera and 41 species covering 21 Lactarius, 17 Russula, and 3 Lactifluus
species. Brief descriptions, distribution notes, and references are provided.
ASIA
Pakistan
N.S. AFSHAN & A.N. Kuatip. Checklist of the rust fungi on Poaceae in
Pakistan. 17 p.
ABSTRACT — This paper presents a checklist of rust fungi on family Poaceae in
Pakistan together with their known host plants. A total of 80 taxa are mentioned
here including 65 species of genus Puccinia and 15 of Uromyces. A host index
is also provided.
ISSN (print) 0093-4666 © 2013 Mycotaxon, Ltd. ISSN (online) 2154-8889
MYCOTAXON
http://dx.doi.org/10.5248/125.305
Volume 125, pp. 305 July-September 2013
NOMENCLATURAL NOVELTIES AND TYPIFICATIONS
PROPOSED IN MYCOTAXON 125
Digitella R.F. Castafieda, Heredia & R.M. Arias, p. 228
Digitella rigidophora R.F. Castafieda, Heredia & R.M. Arias, p. 228
Drechslerella hainanensis Jian Y. Li & Z.F. Yu, p. 185
Emericella miraensis L.C. Zhang, Juan Chen & S.X. Guo, p. 132
Fuscoporia xerophila Raymundo, R. Valenz. & Esqueda, p. 38
Geosmithia tibetensis Y.M. Wu & T.Y. Zhang, p. 61
Gilmaniella nyukfahii Goh, L.L. Lee & K.C. Teo, p. 235
Golovinomyces clematidis T.Z. Liu & Jing Wen, p. 107
Gyroporus purpurinus Singer ex Davoodian & Halling, p. 104
Hydnotrya laojunshanensis L. Li, D.Q. Zhou & Y.C. Zhao, p. 280
Hygrocybe griseobrunnea T.H. Li & C.Q. Wang, p. 244
Jayarambhatia Pratibha, p. 140
Jayarambhatia rhizophorae Pratibha, p. 140
Leptonia ambigua Largent, p. 18
Leptonia boardinghousensis Largent, p. 13
Leptonia omphalinoides Largent, p. 22
Leptonia umbraphila (Noordel. & Hauskn.) Largent, p. 30
Mattirolia mutabilis (Sacc.) Checa, M.N. Blanco & G. Moreno (lectotypified), p. 153
Mattirolia ohiensis (Ellis & Everh.) Checa, M.N. Blanco & G. Moreno (lectotypified), p.
154
Mattirolia platensis (Speg.) Checa, M.N. Blanco & G. Moreno, p. 154
Micropeltis costi (FE. Stevens & Manter) H.X. Wu & K.D. Hyde, p. 7
Micropeltis multiseptata (F. Stevens & Manter) H.X. Wu & K.D. Hyde, p. 8
Nephroma subhelveticum H.Y. Wang, p. 270
Nidula shingbaensis K. Das & R.L. Zhao, p. 54
Phyllosticta ephedricola L. Jin &Yan Wang, p. 165
Radulidium xigazense Y.M. Wu & 'T.Y. Zhang, p. 124
Redbia inflata Heredia, R.M. Arias & R.E. Castafieda, p. 230
306 ... MYCOTAXON 125
Repetophragma fragile R.F. Castafieda, Hern-Restr., Gené & Guarro, p. 210
Repetophragma ibericum R.F. Castafieda, Hern-Restr., Gené & Guarro, p. 210
Rhinocladiella tibetensis Y.M. Wu & T.Y. Zhang, p. 125
Scleroderma yunnanense Y. Wang, p. 195
Scolecopeltis liciniae (F. Stevens & Manter) H.X. Wu & K.D. Hyde (lectotypified), p. 6
Scutellinia ulloae L. Izquierdo, S. Sierra, Rodr.-Gut., C.-Santiuste & Cifuentes, p. 258
Scutellospora alterata Oehl, J.S. Pontes, Palenz., Sanchez-Castro & G.A. Silva, p. 172
Septobasidium fissuratum Wei Li bis & L. Guo, p. 91
Septobasidium heliciae Wei Li bis & L. Guo, p. 92
Septobasidium hoveniae Wei Li bis, S.Z. Chen, L. Guo & Yao Q. Ye, p. 97
Setosynnema yunnanense Y.L. Bai & Z.F. Yu, p. 22
Sympodioplanus goaensis Pratibha, p. 145
Thyridium lasiacidis (Samuels & Rogerson) Checa, M.N. Blanco & G. Moreno, p. 159
Tuber pseudosphaerosporum L. Fan, p. 286
Xylaria bannaensis H.X. Ma, Lar.N. Vassilyeva & Yu Li, p. 252
bad taxonomy
©
can KILL