QL
BY |
NES
Ch 1"
BEN |
NOTA
LEPIDOPTEROLOGICA
Published by Societas Europaea Lepidopterologica (SEL)
Wome 33 - Number 2 - 2010
http://www.soceurlep.eu
HONORARY MEMBERS
Giinter Ebert (D), Pamela Gilbert (GB), Barry Goater (GB), Peter Hattenschwiler (CH),
Prof. Dr Niels P. Kristensen (DK)
COUNCIL
President: Dr Gerhard Tarmann (A)
Vice-President: Prof. Dr Joaquin Baixeras (E)
General Secretary: Dr David Agassiz (UK)
Treasurer: Dr Robert Trusch (D)
Membership Secretary: Willy De Prins (B)
Ordinary Council Members: Prof. Dr Stoyan Beshkov (BG), Dr Feza Can (TR),
David Demerges (F), Dr Jorg Gelbrecht (D),
Dr Andras Kun (H)
NOTA LEPIDOPTEROLOGICA
A journal focussed on Palaearctic and General Lepidopterology
Published by the Societas Europaea Lepidopterologica e.V.
Editors. Dr Bernard Landry (Genève, CH), e-mail: bernard.landry @ ville-ge.ch
Dr Matthias Nuss (Dresden, D), e-mail: [email protected]
Paul Sokoloff (Kent, UK), e-mail: [email protected]
Editorial Board. Dr Enrique Garcia-Barros (Madrid, E), Prof. Dr Roger L. H. Dennis
(Wilmslow, UK), Dr Thomas Fartmann (Münster, D), Dr Axel Hausmann (Munich, D),
Dr Peter Huemer (Innsbruck, A), Ole Karsholt (Copenhagen, DK), Dr Erik van Nieukerken
(Leiden, NL), Dr Thomas Schmitt (Trier, D), Dr Wolfgang Speidel (Bonn, D),
Dr Carlos Lopez-Vaamonde (F)
© Societas Europaea Lepidopterologica (SEL)
ISSN 0342-7536
Type setting: blattwerk | dd
Printed by Druckhaus Dresden GmbH
All rights reserved. No part of this journal may be reproduced or transmitted in any form or by any means, electronic or
mechanical including photocopying, recording or any other information storage and retrieval system, without written
permission from the publisher. Authors are responsible for the contents of their papers.
NOTA LEPIDOPTEROLOGICA
Volume 35 No. 2 . Dresden, 24.01.2011 ; ISSN 0342-7536
ie F à
Yuri P. Nekrutenko (1936-2010) AN 0 CT 202011 | Pa 179-186
LIB ES
Jukka Jalava (1950-2005) = R AR ere 187-189
John R. Langmaid, Klaus Sattler & Carlos Lopez-Vaamonde. Morphology
and DNA barcodes show that Calybites hauderi does not occur in the British Isles
GCM ARIAS ver... ee ee Ie cio liens 191-197
Jänos Päl Töth, Judit Bereczki, Nigel Spring & Zoltän Varga. Dispersal ability
and habitat selection in Melitaea telona kovacsi Varga, 1967 and M. phoebe
(Denis & Schiffermüller, 1775) (Nymphalidae) in steppe grassland ........................... 199-207
Andreas H. Segerer, Alfred Haslberger & Theo Grünewald. Occurrence of
Olethreutes subtilana (Falkovitsh, 1959) ın Central Europe uncovered by
DNA ‘barcoding (Tortricidae: Olethreutinae) ess. 209-218
Hans Blackstein & Timm Karisch. Zur Wicklerfauna Tunesiens (Tortricidae) ........... 219-229
Axel Hofmann & Thomas Keil. Contribution to the knowledge of the genus
Zygaena Fabricius, 1775, in Iran (Zygaenidae). Part IX: On two newly discovered
Mesembrynus taxa from the central and southern Zagros range ................ nenn 233-248
Lutz Lehmann. Lithostege stadiei sp.n. from North Iran
(Comedie: larentinae) eu... hd ee een 249-251
Lukasz Przybylowicz & Paul Sammut. Filema marcida (Mann, 1859) — A new
species for Malta with remarks on the other members of Maltese Lithosiinae
CANON EE ARR see 253-259
Michael Fibiger, Knud Larsen & Ulf Buchsbaum. Phauda bicolor sp. n. from
North Sumatra (Indonesia) (Zygaenidae: Phaudinae) ......................unensnnnenenneenn 263-269
Jürg Schmid. Teleiopsis laetitiae sp. n. and Teleiopsis lindae sp. n., two hitherto
overlooked mountainous European species (Gelechiidae: Teleiodini)) ...................... 271-283
Boyan Zlatkov. A preliminary study of everted vesicae of several
ERRONÉE To Tee en 2 ee een. ec iii 285 — 300
OC CRE MAUÉ SR ne nee nt eee eee 230; 252, 260,270
178 Contents
Reply 1.2... hosen MN eee aaa 302-304
Coftigenda nr. ee ee ee EEE 178
Index to-Nota 32 Sfr me RER PP RER 305-307
Corrigenda
Zoltan Varga & Laszlo Rakosy
Addition to the paper “The Dusky Large Blue — Maculinea nausithous kijevensis (Shel-
juzhko, 1928) in the Transylvanian basin: New data on taxonomy and ecology” by
L. Rakosy, A. Tartally, M. Goia, C. Mihali & Z. Varga, published in Nota lepidoptero-
logica 33 (1): 31-37.
For the „Acknowledgements“ of our paper on Maculinea nausithous, the following
sentence should be added:
„Ihe survey was carried out with financial support from the IDEI PNII grant nr. 552/
2007 accomplished by the Romanian Ministry of Education, Research and Youth.“
Nota lepid. 33 (2): 179-186 179
Yuri P. Nekrutenko
30.04.1936 — 12.06.2010
It happened in the Lepidoptera collection hall of the Museum für Naturkunde during
the late 1990s. Outside, the east wing of the imperial building was still in ruins, bombed
during World War II. To the left of me were the rows of wooden cabinets. Above, the
high ceiling and to the right the windows with the wooden frames on which the imperial
colour was still visible but peeling off. An old man came up to me, unhurried, thoughtful
and hobbling, using a walking stick in his right hand. He introduced himself to me as
Yuri Nekrutenko. Only several months later did I learn that Yuri was walking on only
one leg, the other replaced by a full prosthesis, a situation that prompted him to say
that he had already died as a field entomologist. During this stage of his life, Yuri spent
months at German Natural History Museums curating butterfly collections and writing
type catalogues, earning some additional money for his life in Kiev.
Yuri Nekrutenko was born on April 30, 1936 in Kiev, into a family of an artist of the
Ukrainian Theatre and a movie studio. In 1941, Yuri together with his mother, was
evacuated to Uzbekistan. He went to shool in Urgut, a small town at the foothills of
the Zeravshan mountains. During this time he developed his interested in butterlies. It
was in Urgut, where he saw his first “machaon”. After secondary school he entered the
Biological Faculty of the Shevchenko University in Kiev. During his University years,
along with specialization in zoological systematics, he studied zoogeography, animal
Nota lepidopterologica, 24.01.2011, ISSN 0342-7536
180 Nuss: Obituary to Yuri P. Nekrutenko (1936-2010)
morphology and evolution, using every possible opportunity to collect butterflies dur-
ing student’s practical field studies. At the same time, he also studied human anatomy
and histology at Kiev Medical Institute as well as Latin and Slavic languages at the
University.
One of the largest Lepidoptera collections in the former Soviet Union, the Sheljuzhko
collection deposited at the Zoological Museum of Kiev University, provided him
with a sound for base studying Holarctic butterflies. Later, Yuri came in contact with
L. Sheljuzhko who lived at that time in Munich, and who became his most important
instructor in the taxonomy of Lepidoptera.
In 1958, during his first expedition to the Caucasus, Yuri made contact with Dr E. S.
Miljanowski (Sukhumi) and Prof. Dr A. S. Danilevsky (Leningrad), who influenced his
first steps into lepidopterology as a field of professional activity.
After his graduation from University in 1962, Yuri was employed as a research assistant
in the Division of Quaternary Studies, Institute of Geological Sciences, as a specialist in
systematics and zoogeography working on the interpretation of phylogenetic systematics
and Quaternary-recent historical zoogeography. Having access to necessary technical
facilities, he started his studies on the ultraviolet reflectance wing pattern of Gonepteryx
butterflies, which resulted in the publication of numerous articles and a monograph,
submitted as a doctoral thesis presented in 1969 at the Academy of Agricultural Sciences
in Kiev.
In 1967, Yuri was appointed first as junior, and a year later, as senior researcher in sys-
tematic entomology at the Ukrainian Plant Protection Institute. There, supported by the
Director, Academician V. P. Vasiliev, he concentrated his research efforts on faunal and
taxonomic studies of the butterflies of Crimea and the Caucasus, paying a particular
attention to nature conservation. From 1969-1979, he was the editor of the Institute pe-
riodical “Plant Protection”. During this period, every year, from April to September, he
explored the Crimea and Caucasus, accumulating a comprehensive butterfly collection
from these regions. Today, his butterfly collection is deposited at the National Museum
of Natural History of Ukraine.
In 1979, Yuri was appointed full-time lepidopterist and member of the senior research
staff of the Schmalhausen Institute of Zoology, Ukrainian Academy of Sciences, by
then officially involved in the study of the butterfly fauna of the Ukraine, Crimea and
Caucasus. He published numerous articles on the fauna, and the books on the butter-
flies of Crimea (1985) and the Caucasus (1990) certainly became his most well-known
publications.
During the last four years, Yuri was editor of “Zbirnyk prac Zoologichnogo Muzeyu”,
the annual almanac published by Zoological Museum, National Museum of Natural
History of Ukraine, were he was employed.
In 2007, Yuri was elected as honorary member of our Society (SEL News 43: 21), and
had also been an honorary Member of the Polish Entomological Society.
When I met Yuri, he was living in Kiev with his much younger girl friend Oksana. Yuri
first married in 1961, and again in 1970. His two children were born in 1962 (Olga) and
1973 (Anton). He loved to talk about his children, was proud of them and clearly missed
them when he was away from Kiev.
Nota lepid. 33 (2): 179-186 181
Yuri had a really impressive command of languages used to good effect in his editorial
activities in Ukrainian, Russian, English and Polish. By 1982, Yuri had been appoint-
ed as scientific editor of the Vestnik Zoologii, a bi-monthly journal published by the
Institute of Zoology. In 1993, Yuri was nominated for the Editor of the newly established
quarterly Journal of the Ukrainian Entomological Society (published from 1993 until
1998). He also was, from 1997, an active editorial board member of Nota lepidoptero-
logica, providing invaluable support to Alain Olivier and myself. In contrast to the mod-
ern practice where scientific journals review and often largely rephrase author’s manu-
scripts, Yuri was of the opinion that the individual style of authors should be retained for
publication. Regarding his linguistic abilities, I remember well that he asked me only
twice during his more than six months work at the Zoological Museum in Dresden to
help him in the translation of a part from an original description of a butterfly species
written in German. In both cases, I could not figure out the meaning, as the German
authors stumbled over their own nested sentences, making it impossible to interpret the
text. In editing books, Yuri became an important supporter of Vadim V. Tshikolovets
who published on the butterflies of Turkmenistan (1998), Uzbekistan (2000), Transbaikal
Siberia (2002), Tajikistan (2003) and Kyrgyzstan (2005). It has been Yuri’s opinion
that not everything should be published in English, which is especially important in the
case of field guides, which are primarily needed by the local people in certain regions,
and thus are important for encouraging nature conservation. Yuri retained his stubborn
views on language, planning for the second part of “The Butterflies of the Caucasus”
to be published in Russian, like the first part, but could not find a publisher willing to
do this and later lost interest. Thus, one of the major projects of his life remained unfin-
ished. However, Vadim Tshikolovets is now preparing a new volume “The Butterflies
of Caucasus and Transcaucasia” in the series “The Butterflies of Palaearctic Asia”, for
which Yuri wrote a comprehensive introduction and provided much support for the en-
tire volume. Thus, his dream of a book on Caucasian butterflies will be fullfilled in the
near future. Nevertheless, Yuri was undeterred and especially keen to publish the “The
Butterflies of Ukraine” in the Ukrainian language (Nekrutenko & Tshikolovets 2005)
and also translated the International Code of Zoological Nomenclature into his mother
language (Nekrutenko 2003). Yuri was deeply into love with his home country Ukraine.
Once, Yuri and I took a walk along the former “death strip” isolating West-Berlin from
eastern Germany. He expressed his heartfelt happiness at the end of the Cold War along
with the independence of the Ukraine. How many Ukrainian people did not have this
luck! During his final years, Yuri spent much time and enthusiasm translating Mikhail
Bulgakov’s novel “Master and Margarita” into Ukrainian, a fact that has been acknowl-
edged after his death in the Kiev newspaper “Chreschatik” (June 14, 2010). Yuri would
have written a reply to this article, asking why it has not been written in Ukrainian!
Yuri was a hard working entomologist. He arose early in the morning, working until
late in the evening, even in his 6" decade. He drank a lot of coffee and was certainly a
chain smoker, sometimes getting up at night to take a cigarette. His humour was much
in evidence, even in serious situations. During one of his visits to Dresden, he collapsed
one morning after drinking only coffee for a long time. We called the ambulance. One
of us kneeled down, bent over him asking “Yuri, can you hear me?” Yuri slowly moved
182 Nuss: Obituary to Yuri P. Nekrutenko (1936-2010)
his head to the left, then to the right and clearly answered “No!” He was dehydrated,
and happily, we got him back from hospital the same evening. Yuri visited Dresden three
times, curating all butterfly types and the lycaenid collection at the Zoological Museum.
I invited him to stay with me, during which we had much time to work, to talk, to see
nature and to visit friends. These times will never be forgotten. One major lesson I basi-
cally learned from Yuri during this time was editing our journal, Nota lepidopterologica.
I really enjoyed being taught by you — “Thank you so much, my dear friend!”
MATTHIAS Nuss
List of publications on Lepidoptera
Nekrutenko, Y. P. 1964. The hidden wing-pattern of some Palearctic species of Gonepteryx and its taxo-
nomic value. — Journal of Research on the Lepidotera 3 (2): 65—68.
Nekrutenko, Y. P. 1964. On a method of quantitative analysis of the wing-pattern of Pieridae butterflies. —
Dopovidi Akademii Nauk Ukrainskoi RSR 3: 405—407 (In Ukrainian; Russian & English summa-
ries).
Nekrutenko, Y. P. 1964. A contribution to the revision of the genus Apatura Fabr. (Lepidoptera, Nympha-
lidae). — Dopovidi Akademii Nauk Ukrainskoi RSR 10: 1391—1394 (In Ukrainian; Russian & English
summaries).
Nekrutenko, Y. P. 1964. On the Apaturinae of the Palearctic fauna. — Zoologitscheskij Zhurnal 43 (7):
1041-1046 (In Russian; English summary).
Nekrutenko, Y. P. 1965. “Gynandromorphic effect” and the optical nature of the hidden wing-pattern in
Gonepteryx rhamni. — Nature, London 205 (4969): 417-418.
Nekrutenko, Y. P. 1965. On the unusual variability of Satyrus actaea Esp. (Lepidoptera, Satyridae) in the
Crimea and its possible causes. — Zoologitscheskij Zhurnal 44 (4): 617-620 (In Russian; English
summary).
Nekrutenko, Y. P. 1965. A new Tertiary representative of the family Nymphalidae (Lepidoptera). — Pale-
ontologitscheskij Zhurnal 4: 97—99 (In Russian).
Nekrutenko, Y. P. 1965. The value of zoogeographic investigations for the purposes of paleobiogeographic
reconstructions. — Materialy po chetvertichnomu periodu Ukrainy (Quaternaria Ucrainica), Kiev, Na-
ukova Dumka: 114—121 (In Russian; English summary).
Nekrutenko, Y. P. 1966. Three cases of gynandromorphism in Gonepteryx: an observation with ultraviolet
rays. — Journal of Research on the Lepidotera 4 (“1965”) (2): 103-108.
Nekrutenko, Y. P. 1966. Tertiary Nymphalid butterflies and some phylogenetic aspects of systematic lepi-
dopterology. — Journal of Research on the Lepidotera 4 (“1965”) (3): 149-158.
Nekrutenko, Y. P. 1966. Papilio machaon kamtschadalus Alph. (Lepidoptera, Papilionidae) and the prob-
lem of Bering land bridge. — Abstracts IV Zoogeographic Conference Odessa: 185-186 (In Russian).
Nekrutenko, Y. P. 1966. Occurrence and geographic variation of Papilio machaon (Lepidoptera, Papilioni-
dae) in the Ponto-Caspian area. — Abstracts IV Zoogeographic Conference Odessa: 187—188 (In
Russian).
Nekrutenko, Y. P. 1966. Review: Niels L. Wolff, The Lepidoptera of Greenland. The Danish Zoogeogra-
phical Investigations in Greenalnd. Kobenhavn. — Biologicheskiye Nauki 4: 232—234 (in Russian).
Nekrutenko, Y. P. 1966. Some properties of the hidden wing-pattern in Coliidinae (Lepidoptera, Rhopa-
locera). — Dopovidi Akademii Nauk Ukainskoi RSR (B) 9: 1227-1230 (In Ukrainian; Russian &
English summaries).
Nekrutenko, Y. P. 1966. On the dimorphism of Papilio machaon kamtschadalus Alpheraky (1897) (Lepi-
doptera, Papilionidae). — Dopovidi Akademii Nauk Ukrainskoi RSR (B) 11: 1506-1509 (In Ukrainian;
Russian & English summaries).
Nekrutenko, Y. P. 1966. Eine neue Subspecies von Gonepteryx rhamni L. aus dem Kaukasus (Lep. Pieri-
dae). — Zeitschrift der Wiener entomologischen Gesellschaft 51: 44—47.
Nota lepid. 33 (2): 179-186 183
Nekrutenko, Y. P. & E. A. Didmanidze 1966. Eine neue Unterart von Papilio machaon aus dem Kaukasus
(Lep., Pepilionidae). — Deutsche entomologische Zeitschrift (N.F.) 13 (4-5): 461-464.
Nekrutenko, Y. P. 1967. An attempt of compiling a key to species of the genus Gonepteryx Leach (1815)
(Lepidoptera, Pieridae) using hidden wing-pattern. — Dopovidi Akademii Nauk Ukrainskoi RSR (B) 3:
263-265 (In Ukrainian; Russian & English summaries).
Nekrutenko, Y. P. 1967. West-Palearctic subspecies and geographical variability of the hidden wing-pat-
tern in Gonepteryx rhamni (L.) (Lepidoptera, Pieridae). — Dopovidi Akademii Nauk Ukrainskoi RSR
(B) 9: 845—849 (In Ukrainian; Russian & English summaries).
Nekrutenko, Y. P. 1968. Phylogeny and geographic distribution of the genus Gonepteryx (Lepidoptera,
Pieridae). A study in historical zoogeography. — Naukova Dumka, Kiev. 128 pp., 20 pls.
Nekrutenko, Y. P., V. P. Pristavko & A. G. Gontar 1968. Injurious insects population and density monitoring
aided by light traps. — Biologicheskiy metod borby s vreditelyami rastenii, Riga: 257—260 (In Russian).
Nekrutenko, Y. P. 1968. Properties of the masked (sic!) wing-pattern in Gonepterygidi (Lepidoptera, Pieri-
dae). — Abstracts of papers 13th International Congress Entomology, Moscow 2: 180.
Nekrutenko, Y. P. 1969. Geographic variation of the hidden wing-pattern and the subspecies of Gonepteryx
rhamni (L.) in Europe and Asia Minor (Lepidoptera, Pieridae). - Abhandlungen und Berichte des Na-
turkundemuseums Görlitz 44 (2): 119-128.
Nekrutenko, Y. P. 1970. Comments on forms of Gonepteryx aspasia (Pieridae) described by Shi-iti Mura-
yama. — Journal of the Lepidopterists’ Society 24 (3): 213-217.
Nekrutenko, Y. P. 1970. A new subspecies of Gonepteryx rhamni from Tian-Shan mountains, U.S.S.R. —
Journal of the Lepidopterists’ Society 24 (3): 218-220.
Nekrutenko, Y. P. 1971. Properties of the hidden wing-pattern of Gonepterygidi (Lepidoptera, Pieridae). —
Proceedings of the 13th International Congress on Entomology, Moscow, 1968 2: 29.
Nekrutenko, Y. P. 1972. A new subspecies of Eumedonia eumedon (Lycaenidae) from Caucasus. — Journal
of the Lepidopterists’ Society 26 (4): 215-218.
Nekrutenko, Y. P. 1973. A new subspecies of Gonepteryx amintha (Pieridae) from Yunnan, mainland Chi-
na, with comparative notes. — Journal of Research on the Lepidotera 11 (“1972”) (4): 235-240.
Nekrutenko, Y. P. 1973. Review: Niles L. Wolff - Lepidoptera. The zoology of Iceland, vol.III, part 45. —
Biologichskiye Nauki 6: 138— 140 (In Russian).
Nekrutenko, Y. P. 1973. On the taxonomic position of the Caucasian form of Callophrys rubi L. (Lepi-
doptera, Lycaenidae). — Dopovidi Akademii Nauk Ukrainskoi RSR (B) 10: 949-952 (In Ukrainian;
Russian & English summaries).
Nekrutenko, Y. P. 1974. Lepidoptera. — Vrediteli sel’skokhozyaistvennykh kultur 1 lesnykh nasazhdenyi.
Kiev, Urozhai 2: 50 pp. (In Russian)
Nekrutenko, Y. P. 1974. Comparative notes on certain West-Palerctic species of Agriades, with description
of a new subspecies of Agriades pyrenaicus from Turkey (Lycaenidae). — Journal of the Lepidopterists’
Society 28 (3): 278-288.
Nekrutenko, Y. P. 1975. A new species of Melitaea (Nymphalidae) from Armenia. — Journal of the Lepi-
dopterists’ Society 29 (2): 102-105.
Nekrutenko, Y. P. 1975. Two new subspecies of Plebejus (Plebejides) pylaon from the Southern and North-
ern sides of the West Caucasus (Lycaenidae). — Journal of the Lepidopterists’ Society 29 (3): 151-
1153.
Nekrutenko, Y. P. 1975. On the synonymy on some butterfly forms described from Caucasus (Lepidoptera,
Rhopalocera). — Doklady Akademii Nauk Ukrainskoi SSR (B) 3: 275-278 (In Russian, English
summary).
Nekrutenko, Y. P. & E. A. Didmanidze 1975. New data on geographic variation of ultraviolet reflectance
pattern in Gonepteryx rhamni L. (Lepidoptera, Pieridae) in the Caucasus. — Doklady Akademii Nauk
Ukrainskoi SSR (B) 4: 374—377 (In Russian; English summary).
Nekrutenko, Y. P. 1976. Review: Torben B. Larsen, Butterflies of Lebanon. National Council for Scientific
Research (C.N.R.S.). Beirut, 1974. — Biologicheskiye nauki 3: 139-141 (In Russian).
Nekrutenko, Y. P. 1977. Obituary: Eugene S. Miljanowski (1908 — 1976). — Journal of the Lepidopterists’
Society 31 (1): 76-77.
Nekrutenko, Y. P. 1977. E. S. Miljanowski. In Memoriam (1908 — 1976). — Entomologitscheskoje Obozre-
nie 56: 930-932 (Bibliography; in Russian).
184 Nuss: Obituary to Yuri P. Nekrutenko (1936-2010)
Nekrutenko, Y. P. 1977. An undescribed taxon of the Polyommatus eros-eroides group (Lepidoptera, Ly-
caenidae) from Caucasus Major. — Doklady Akademii Nauk Ukrainskoi SSR (B) 2: 183-185 (In
Russian; English summary).
Nekrutenko, Y. P. 1977. Two little-known Lycaenid butterflies (Lepidoptera, Lycaenidae) from the South-
ern Ukraine, Crimea and Caucasus. — Doklady Akademii Nauk Ukrainskoi SSR (B) 3: 277-281 (In
Russian; English summary).
Nekrutenko, Y. P. 1977. A new subspecies of Heodes (Thersamonia) ochimus from the Caucasus Minor
(Lepidoptera, Lycaenidae). — Doklady Akademii Nauk Ukrainskoi SSR (B) 5: 459-462 (In Russian;
English summary).
Nekrutenko, Y. P. 1978. Review: Willian H. Howe (ed.), The Butterflies of North America. — Biologiches-
kiye Nauki 5: 139—141 (In Russian).
Nekrutenko, Y. P. 1978. Two new subspecies of the Lycaenid butterfly subfamily Strymoninae (Lepido-
ptera, Lycaenidae) from East Georgia and West Azerbaijan. — Doklady Akademii Nauk Ukrainskoi
SSR (B) 1: 84—88 (In Russian; English summary).
Nekrutenko, Y. P. 1978. New and little-known butterfly forms of the Crimea (Lepidoptera, Rhopalocera). —
Doklady Akademii Nauk Ukrainskoi SSR (B) 7: 645-649 (In Russian; English summary).
Nekrutenko, Y. P. & R. M. E. Effendi 1979. A new species of the genus Lysandra (Lepidoptera, Lycaenidae)
from Transcaucasian area. — Doklady Akademii Nauk Ukrainskoi SSR (B) 7: 583-585 (In Russian;
English summary).
Nekrutenko, Y. P. 1980. Revisional notes of lycaenid butterfly species assigned to Ultraaricia Beuret (Ly-
caenidae). — Nota lepidopterologica 3 (1/2): 55—68.
Nekrutenko, Y. P. & R. M. E. Effendi 1980. A new species of Tomares from Talysh Mountains (Lycaeni-
dae). — Nota lepidopterologica 3 (1/2): 69-72.
Nekrutenko, Y. P., Y. P. Korshunov & KR. M. E. Effendi 1982. Critic remarks on the fauna and systematics
of butterflies (Lepidoptera, Rhopalocera) of the Transcauacsia. Communication 1. — Vestnik Zoologii
1982 (1): 50-55 (In Russian; English summary).
Nekrutenko, Y. P. 1982. A new locality of Phassus schamyl (Christoph) (Lepidoptera, Hepialidae). — Vest-
nik Zoologii 1982 (1): 55 (In Russian).
Nekrutenko, Y. P., Y. P. Korshunov & KR. M. E. Effendi 1982. Critic remarks on the fauna and systematics
of butterflies (Lepidoptera, Rhopalocera) of the Transcaucasia. Communication 2. — Vestnik Zoologii
1982 (3): 38—43 (In Russian; English summary).
Nekrutenko, Y. P. 1983. Neolysandra alticola (Christoph, 1893), comb. et stat. n. = Albulina alexander
Higgins, 1981, syn. n. — Vestnik Zoologii 1983 (1): 52 (In Russian).
Nekrutenko, Y. P. 1983. Pontia glauconome Klug 1829 (Lepidoptera, Pieridae). — Vestnik Zoologii 1983
(1): 52 (In Russian).
Nekrutenko, Y. P. 1983. A revision of the genus Hyrcanana (Lepidoptera, Lycaenidae). — Vestnik Zoologii
1983 (3): 7-16 (In Russian; English summary).
Nekrutenko, Y. P. & R. M. E. Effendi 1983. A review of the blue butterflies of the Lycaena phoenicurus
group (Lepidoptera, Lycaenidae) with description of a new species from Azerbaijan. — Vestnik Zoologii
1983 (4): 8-16.
Nekrutenko, Y. P. & I. G. Plushch 1983. Agriades pyrenaicus (Boisduval) (Lepidoptera, Lycaenidae) in the
territory of the Ukrainian SSR. — Vestnik Zoologii 1983 (6): 15 (In Russian).
Nekrutenko, Y. P. 1984. The blue butterflies of the USSR fauna, assigned to the genus Chilades (Lepido-
ptera, Lycaenidae). — Vestnik Zoologii 1984 (3): 29-40 (In Russian; English summary).
Nekrutenko, Y. P. 1984. A revision of the type specimens of Lycaena phoenicurus group (Lepidoptera,
Lycaenidae). — Vestnik Zoologii 1984 (6): 43-49 (In Russian; English summary).
Nekrutenko, Y. P. 1985. The Butterflies of the Crimea. A Guide. — Kiev, Naukova Dumka. 152 pp., 123
ills, 24 colour pls.
Nekrutenko, Y. P. 1985. The blue butterflies of the genus Vacciniina (Lepidoptera, Lycaenidae) in the
fauna of Transcaucasia. — Vestnik Zoologii 1985 (2): 87 (In Russian).
Nekrutenko, Y. P. 1985. New blue butterfly taxa (Lepidoptera, Lycaenidae) from Transcaucasia and Middle
Asia. — Vestnik Zoologii 1985 (4): 29-35 (In Russian; English summary).
Nekrutenko, Y. P. & E. Balletto 1986. A new blue butterfly species (Lepidoptera, Lycaenidae) from Middle
Asia. — Vestnik Zoologii 1986 (1): 76—78 (In Russian; English summary).
Nota lepid. 33 (2): 179-186 185
Nekrutenko, Y. P. & I. M. Kerzhner 1986. On the species and varieties of Parnassius (Lepidoptera, Pa-
pilionidae) established by E. Menetries in the book of J.Siemaschko “Russkaya fauna”. — Entomolo-
gitscheskoje Obozrenie 65 (4): 769-779 (In Russian; English summary).
Nekrutenko, Y. P. 1987. A new genus of subfamily Lethinae (Lepidoptera, satyridae). — Vestnik Zoologii
1987 (2): 83-85 (In Russian; English summary).
Nekrutenko, Y. P. 1987. Esperella Nekrutenko, nom. n. pro Esperia Nekrutenko. — Vestnik Zoologii 1987
(3): 62 (In Russian).
Nekrutenko, Y. P., Y. A. Pesenko & V. N. Tanasiychuk 1987. Insect in the Red Data Book of the USSR. —
Zoologitscheskij Zhurnal 66: 198-210 (In Russian; English summary).
Nekrutenko, Y. P. 1988. Esperarge Nekrutenko, nom.n. pro Esperella Nekrutenko. — Vestnik Zoologii
1988 (1): 50 (In Russian).
Nekrutenko, Y. P. 1988. Information: Seminar “Systematics, Faunistics, Ecology and Protection of the
Butterflies” (Novosibirsk, 1987). — Vestnik Zoologii 1988 (1): 86 (In Russian).
Nekrutenko, Y. P. 1988. Review: Official Lists and Indexes of Names and Works in Zoology, R. V. Melville
& J. D. D.Smith 1987, London: International Trust for Zoological Nomenclature; on behalf of Internatio-
nal Commision on Zoological Nomenclature. 366 pp. — Vestnik Zoologii 1988 (3): 83—84 (In Russian).
Nekrutenko, Y. P. 1988. Information: VI Congress of the Societas Europaea Lepidopterologica (San Re-
mo). — Vestnik Zoologii 1988 (6): 82 (In Russian).
Nekrutenko, Y. P. 1989. New taxa of the Satyrid butterflies (Lepidoptera, Satyridae) from Zangezur moun-
tain range. — Vestnik Zoologii 1989 (1): 14—18 (In Russian; English summary).
Nekrutenko, Y. P. 1989. The history of butterfly research in the Caucasus. — Nota lepidopterologica, Suppl.
1: 65.
Nekrutenko, Y. P. 1990. The Butterflies of Caucasus. A Guide. [vol. 1] Families Papilionidae, Pieridae,
Satyridae, Danaidae. — Kiev, Naukova Dumka. 215 pp., 106 ills., 32 colour pls.
Nekrutenko, Y. P. & O.A. Mikhalevich 1992. Some Remarks on the Computerization of the Biological
Subjects Classification. — Vestnik Zoologi 1992 (3): 79—83 (In Russian).
Nekrutenko, Y. P. 1993. Editorial Foreword. — Journal of the Ukrainian Entomological Society 1 (1): 2 (In
Ukrainian).
Nekrutenko, Y. P. 1993. VIII Congress of the Societas Europaea Lepidopterologica. — Journal of the Ukrai-
nian Entomological Society I (1): 10 (In Ukrainian).
Nekrutenko, Y. P. 1993. An annotated catalogue of butterflies and skippers (Lepidoptera: Hesperioidea,
Papilionoidea) named by Emilio Turati. — Bollettino del Museo Regionale di Scienze Naturali Torino
11 (1): 121-135.
Nekrutenko, Y. P. 1994. 9th European Congress of Lepidopterology in Lednice (Czech Republic), 5—9
September 1994. — SEL News 24: 2-3.
Nekrutenko, Y. P. 1995. Index of publications on European Lepidoptera. No. 14 (1991-1992). — Societas
Europaea Lepidopterologica. 105 pp.
Nekrutenko, Y. P. & V. V. Tshikolovets 1995. Critic remarks to the publications of Zs. Balint on Lycaenid
butterflies of Central Asia, with new synonyms (Lepidoptera, Lycaenidae). — Journal of the Ukrainian
Entomological Society 2 (1): 25—30 (In Russian, Ukrainian and Englash summaries).
Nekrutenko, Y. P. 1997. In Memoriam. Andrzej W. Skalski (1938—1996). — Nota lepidopterologica 20
(1/2): 137—144 (Bibliography).
Nekrutenko, Y. P. & V. V. Tshikolovets 1997. A New species of the genus Callophrys (Lepidoptera, Lycae-
nidae) from Turkmenistan. — Journal of the Ukrainian Entomological Society 3 (2): 3-4 (In Russian,
Ukrainian and English summaries).
Nekrutenko, Y. P. & C. L. Häuser 1998. Comments on ”Nomina Lepidopterorum nova” by S.K. Korb (Pa-
pilionidae, Nymphalidae). — Nota lepidopterologica 21 (1): 74-84.
Nekrutenko, Y. P. 1998. A catalogue of the type specimens of Riodinidae and Lycaenidae deposited in
the collection of Zoologisches Forschungsinstitut und Museum Alexander Koenig (Bonn). — Nota
lepidopterologica 21 (2): 119-148.
Nekrutenko, Y. P. & A. Olivier 2000. The butterflies described by Johann Christoph Friedrich Klug
(1775— 1856) in his Symbolae Physicae, Insecta (Lepidioptera: Pieridae, Lycaenidae, Nymphalidae):
An annotated review, with a catalogue of the existing types. — Deutsche Entomologische Zeitschrift
47 (1): 95-104.
186 Nuss: Obituary to Yuri P. Nekrutenko (1936-2010)
Nekrutenko, Y. P. 2000. A catalogue of the type specimens of Lycaenidae deposited in the collection of
the Staatliches Museum fiir Tierkunde Dresden (Insecta: Lepidoptera: Rhopalocera). — Entomologische
Abhandlungen Museum für Tierkunde Dresden 59: 143-215.
Nekrutenko, Y. P. 2000. A catalogue of the type specimens of Palaearctic Riodinidae and Lycaenidae (Le-
pidoptera, Rhopalocera) deposited in the collection of the Museum für Naturkunde der Humboldt
Universität zu Berlin. — Nota lepidopterologica 23 (3-4): 192-352.
Nekrutenko, Y. P. 2001. A catalogue of the type specimens of Riodinidae deposited in the collection of
the Staatliches Museum für Tierkunde Dresden (Insecta: Lepidoptera: Rhopalocera). — Entomologische
Abhandlungen Museum für Tierkunde Dresden 59: 319-323.
Nekrutenko, Y. P. 2001. A catalogue of the type specimens of Nymphalidae deposited in the collection of
the Staatliches Museum für Tierkunde Dresden (Insecta: Lepidoptera: Rhopalocera). — Entomologische
Abhandlungen Museum für Tierkunde Dresden 59: 325-403.
Nekrutenko, Y. P. 2001. A catalogue of the type specimens of Papilionidae deposited in the collection of
the Staatliches Museum für Tierkunde Dresden (Insecta: Lepidoptera: Rhopalocera). — Entomologische
Abhandlungen Museum für Tierkunde Dresden 59: 405-453.
Nekrutenko, Y. P. 2003. A Catalogue of the type specimens of Hesperiidae and Pieridae deposited at the
Museum fiir Tierkunde Dresden, with additions to the catalogues of Nymphalidae, Riodinidae and
Lycaenidae (Insecta: Lepidoptera). — Entomologische Abhandlungen Museum für Tierkunde Dresden
60: 79-109.
Nekrutenko, Y. P. 2003. The Lepidoptera Collection of the Zoological Museum, Kyiv Taras Shevchenko
National University: a national treasure of Ukraine. — Pratsi Zoolohichnoho Muzeiu Kyivskoho Na-
tsionalnoho Universytetu imeni Tarasa Shevchenka 1 (1): 7-15.
Nekrutenko, Y. P. 2003. International Code of Zoological Nomenclature. 4th edition. Adopted by the Inter-
national Union of Biological Sciences. — Bibliotheka Ofiziinich Widan, Kiev, xliii + 175 pp. (translated
into Ukrainian).
Nekrutenko, Y. & V. Tshikolovets 2005. The Butterflies of Ukraine. — Rayevsky Scientific Publishers, Kyiv,
231 pp. (In Ukrainian).
Nekrutenko, Y. 2006. Reply to a review by I. G. Pljuscha on the book by Nekrutenko, Y. & V Tshikolovets,
The Butterflies of Ukraine. — Vestnik Zoologii 2006 (6): 563—566.
Nota lepid. 33 (2): 187-189 187
Jukka Jalava
11 March 1950 - 28 December 2005
A prominent Finnish lepidopterist, Jukka Jalava, was born 60 years ago and passed
away five years ago, in December 2005. Even though Jukka was a self-taught re-
searcher without academic training, he was recognised as an outstanding expert on the
Lepidoptera of Finland and in the micro-moths of the entire Palaearctic region. With
his superb “eye for identification” and a wide knowledge of entomology and of natural
history in general, Jukka contributed much to the flourishing of microlepidopterology
in Finland from the late 1970s.
Jukka Jalava was an enthusiastic and efficient collector. He participated in many
Finnish-Soviet/Russian joint expeditions in the 1980s and 1990s to the Altai, Caucasus
and Polar Ural Mountains, and to Tuva, Buryatia, Murmansk, Vladivostok and Maga-
dan areas. In the field he collected by day and by night: during the night at light or
with baits, and after sorting and preparing material from the previous night he was
netting day-flying butterflies and moths. His active field work substantially increased
the Lepidoptera collections of the Zoological Museum, University of Helsinki (now
the Finnish Museum of Natural History), where he was periodically employed as a
museum assistant between 1980 and 1999. Three microlepidopteran species from the
Altai Mountains have been named after Jukka Jalava: Scythris jalavai Sinev, 1993,
Gnorimoschema jalavai Povolny, 1994 and Stephensia jalmarella Kaila, 1992 (after
one of his nicknames “Jalmari”).
Nota lepidopterologica, 24.01.2011, ISSN 0342-7536
188 KOPONEN, KULLBERG, KAILA & KozLov: Jukka Jalava (1950-2005)
Jukka Jalava published about 20 scientific papers (listed below), and described Ne-
phopterix (now Sciota) lucipetella Jalava, 1978 from Finland. He is a co-author of
Elachista adelpha Kaila & Jalava, 1994, Elachista coeneni titanella (now E. titanella
Kaila & Jalava, 1994) and Amselghia (now Coleophora) balkara Falkovitsh & Jalava,
1997 from North Caucasus, and of Cochylimorpha arenosana Kuznetsov, Jalava &
Kullberg, 1998 from Tuva. He also wrote many short notes in Baptria, the journal
of the Finnish Lepidopterological Society, mostly reporting new faunistic records of
Microlepidoptera and brief results of collecting trips, and contributed to several books
dealing with the nature of Finland.
Jukka Jalava was friendly, helpful and supportive. He was keen to teach younger col-
leagues, and he identified their specimens and checked identifications. We will remem-
ber Jukka as a free-and-easy, social and colourful fellow.
SEPPO KOPONEN, JAAKKO KULLBERG, LAURI KAILA, and MIKHAIL KOZLOV
Main publications by Jukka Jalava
Jalava, J., E.M. Laasonen & S. Nenye 1976. Hada skraelingia (Lepidoptera, Noctuidae): finds from Fin-
land and description of the genitalia. — Notulae Entomologicae 56: 105—108.
Jalava, J. 1977. Coleophora frischella and Coleophora alcyonipennella (Lepidoptera, Coleophoridae) in
Eastern Fennoscandia. — Notulae Entomologicae 57: 39-31.
Jalava, J. 1977. The female of Coleophora unigenella (Lepidoptera, Coleophoridae). — Notulae Ento-
mologicae 57: 70.
Jalava, J. 1978. Nephopterix lucipetella n. sp. from southern Finland (Lepidoptera: Pyralidae). — Ento-
mologica Scandinavica 9: 317—318.
Jalava, J. 1980. Tineidae (Lepidoptera) from nests of the Ural Owl (Strix uralensis Pall.). — Notulae En-
tomologicae 60: 96—100.
Jalava, J. & J. Kyrki 1980. Notes on the taxonomy and distribution of western Palaearctic Trichophaga
species (Lepidoptera, Tineidae). — Notulae Entomologicae 60: 107-110.
Laasonen, E., J. Jalava & E. S. Nielsen 1981. The identity of /ncurvaria vetulella (Zetterstedt, 1839)
and /. circulella (Zetterstedt, 1839), two distinct species (Lepidoptera: Incurvariidae). — Entomologica
Scandinavica 12: 57—64.
Kyrki, J. & J. Jalava 1983. Plutella haasi Staudinger, 1883 (Lepidoptera: Plutellidae), a species new to the
British Isles. — Entomologist’s Gazette 34: 61-64.
Laasonen, E. M., J. Kyrki, J. Karvonen, J. Jalava & L. Laasonen 1984 Nephopterix fumella (Lepidoptera,
Pyralidae) new to Fennoscandia. — Notulae Entomologicae 64: 145-150.
Varis, V., J. Jalava & J. Kyrki 1987. Check-list of Finnish Lepidoptera. Suomen perhosten luettelo. — No-
tulae Entomologicae 67: 49-118.
Kuznetsov, V. I. & J. Jalava 1988. Soviet-Finnish entomological expeditions to Southern Siberia 1982 —
1984. 2. Tortricidae (Lepidoptera). — Nota lepidopterologica 11: 126-138.
Kozlov, M. V., J. Jalava, A. L. Lvovsky, K. Mikkola & L. N. Shvetsova 1996. Diversity and abundance of
Lepidoptera along an air pollution gradient in the Kola Peninsula. P. 270. — In: M. V. Kozlov, E. Hau-
kioja & V. T. Yarmishko (eds.), Aerial Pollution in Kola Peninsula: Proceedings of the International
Workshop, April 14-16, 1992, St. Petersburg. — Kola Science Centre, Apatity.
Kozlov, M. V. & J. Jalava 1994. Lepidoptera of Kola Peninsula, Northwestern Russia. — Entomologica
Fennica 5: 65-85.
Kaila, L. & J. Jalava 1994. Elachista adelpha sp. n., E. coeneni titanella ssp. n., and other Elachistidae
(Lepidoptera) from North Caucasus. — Entomologica Fennica 5: 97—102.
Nota lepid. 33 (2): 187-189 189
Varis, V., M. Ahola, A. Albrecht, J. Jalava, L. Kaila, S. Kerppola & J. Kullberg 1995. Checklist of Finnish
Lepidoptera — Suomen perhosten luettelo. — Sahlbergia 2: 1-80.
Kozlov, M. V., J. Jalava, A. L. Lvovsky & K. Mikkola 1996. Population densities and diversity of Noctui-
dae (Lepidoptera) along an air pollution gradient on the Kola Peninsula, Russia. — Entomologica
Fennica 7: 9-15.
Falkovitsh, M. I. & J. Jalava 1997. Coleophoridae collected in the North Caucasus in 1990, with descrip-
tion of a new species (Lepidoptera). — Zoosystematica Rossica 5: 309-311.
Falkovitsh, M. I., J. Jalava & K. Mikkola 1997. Records of casebearers from Siberia, Russia (Coleopho-
ridae). — Nota lepidopterologica 20: 310-321.
Kuznetsov, V. I., J. Jalava & J. Kullberg 1998. The leaf-rollers (Lepidoptera, Tortricidae) of western Tuva,
with description of Cochylimorpha arenosana sp. n. — Entomologica Fennica 9: 197-209.
Jalava, J. & W. E. Miller 1998. Boreal Olethreutini 1. (Lepidoptera: Tortricidae): new synonymies and
Holarctic records. — Entomologica Fennica 9: 137-142.
Kozlov, M. V., J. Jalava & E. Shutova 2000. New records of Lepidoptera from the Kola Peninsula, North-
western Russia. — Entomologica Fennica 11: 131-136.
Miller, W. E. & J. Jalava 2000. Boreal Olethreutini 2: Wing and genitalia illustrations, a new synomymy,
and a new holarctic addition. — Journal of Lepidopterological Society 54: 47-51.
mie Veh?
‘ 2e? | um METZ
i Te & 18
: =
LA +
> y = =
we
Ss
Das
~—
= 7. Ed
I, ‘x 3
= SF. A
4
, 2
Ed
Ir
7 Fe
1
1
H LA
Br -
Le
= |
à en
Li =
É
J
ia
\
'
Fu
__ =
on =
e
a
+4
>
af
1
®
e 5 oe
Ton
| u a ‘on => 44
rs
A ve
=> 2 i au u
ee
Nota lepid. 33 (2): 191-197 191
Morphology and DNA barcodes show that Calybites hauderi
does not occur in the British Isles (Gracillariidae)
JOHN R. LANGMAID!, KLAUS SATTLER? & CARLOS LOPEZ-V AAMONDE ?
! Wilverley, 1 Dorrita Close, Southsea, Hampshire, PO4 ONY, U.K.;
[email protected]
2 Department of Entomology, Natural History Museum, Cromwell Road, London SW7 5BD, U.K.;
[email protected]
> INRA, UR0633 Zoologie Forestière, F-45075 Orléans, France;
[email protected]
Abstract. Evidence is presented that all British specimens of Calybites hauderi (Rebel, 1906) are not that
species but the first brood of bivoltine Caloptilia semifascia (Haworth, 1828). C. hauderi is removed from
the British list and its occurrence in Belgium is questioned. C. semifascia is normally univoltine in the
British Isles but bivoltine populations are now spreading in southern counties.
Zusammenfassung. Der Nachweis wird erbracht, daß es sich bei allen britischen Calybites hauderi (Rebel,
1906) um die erste Generation der bivoltinen Caloptilia semifascia (Haworth, 1828) handelt. C. hauderi
wird von der britischen Liste gestrichen und das Vorkommen in Belgien wird angezweifelt. C. semifascia
ist auf den Britischen Inseln normalerweise univoltin doch breiten sich in den südlichen Grafschaften
zunehmend bivoltine Populationen aus.
Introduction
Calybites hauderi (Rebel, 1906) was first recorded from Britain in 1933 by L. T. Ford
under the name Gracilaria [sic] pyrenaeella (Chrétien, 1908) as identified by E. Meyrick
(Ford 1933: 230). Ford had reared nine adults in early July 1933 from a quantity of the
characteristic cones he had collected on 9 June on field maple (Acer campestre L.). The
single locality was a small area of woodland with much Acer campestre at St Helen’s,
near the coast in the east of the Isle of Wight. The first record from the English mainland
was ın 1991, when the species was discovered in West Sussex (Agassiz et al. 1993: 162).
It appeared in Hampshire in 2000 (Langmaid & Young 2001: 244), since when it has
been recorded there regularly, in Surrey in 2007 (JRL, pers. obs.), Oxfordshire in 2008
(Sims 2009: 169) and Kent in 2009 (P. A. Sokoloff, pers. comm. ).
In the British literature this species was variously recorded as Gracilaria [sic] pyrenae-
ella (Ford 1933: 230), Caloptilia pyrenaeella (Fletcher 1940: 8; Wakely, 1960: 247),
Euspilapteryx (Gracilaria) pyrenaeella (Wakely 1962: 120), Calybites pyrenaeella
(Bradley et al. 1972: 9; Emmet 1979: 53), Calybites hauderi (Emmet et al. 1985: 273)
and Caloptilia hauderi (Bradley 1998: 9). It is worth noting that Emmet et al. (loc. cit.)
expressed doubt about the validity of Calybites Hübner, 1822, and Caloptilia Hübner,
1825, as distinct genera in view of their extremely similar biology.
Gracilaria [sic] hauderi was originally described from a pair of specimens collected by
Hauder in Austria, Oberösterreich, Kirchdorf [not Kirschdorf!] on 18.v111.1904 (male)
and 13.1v.1905 (female). Gracilaria [sic] pyrenaeella was originally described from the
French Basses-Pyrénées from an unspecified number of adults reared by Chrétien from
larvae that lived on Acer campestre, much in the manner of other ‘Gracilaria’ species,
Nota lepidopterologica, 24.01.2011, ISSN 0342-7536
192 LANGMAID et al.: Calybites hauderi does not occur in the British Isles
1.e. initially mining and later producing the charac-
teristic cones. The adults emerged in late June and
July and Chrétien did not observe a second brood
although he suspected there might be one. For an
English translation of Chrétien’s description see
Fletcher (1940: 8). Subsequently, Leraut (1983: 36)
synonymized G. pyrenaeella with G. hauderi, af-
ter designating lectotypes for both, and transferred
| the species to the genus Calybites. It is currently
Fig. 1. Caloptilia falconipennella first listed in the Global Taxonomic Database of Gracil-
brood f. oneratella. lariidae (http://gc.bebif.be) as Calybites hauderi (=
pyrenaeella) and its distribution is given as Austria,
Belgium, Czech Republic, France, Hungary, Italy, Romania, Switzerland and United
Kingdom.
C. hauderi was recorded in Belgium on the strength of two photographs taken in 2004
of a moth that had subsequently been released (De Prins et al. 2005: 53-354, fig. 1).
However, with its sub-triangular rather than sub-quadrate costal blotch in the forewing,
the specimen looks more like the first brood form oneratella Zeller, 1847, of Caloptilia
falconipennella (Hübner, 1813) (Fig. 1) and the occurrence of C. hauderi in Belgium
must be considered as unconfirmed. All records of C. hauderi elsewhere should be reas-
sessed in the light of our findings.
Material and Methods
Suspicions that all was not as it seemed arose in 2008 when a huge abundance of
Caloptilia spinnings was found in a small grove of Acer campestre trees on some com-
mon land in Portsmouth, Hampshire, in early June. These spinnings produced moths in
July all of which were, apparently, ‘hauderi’ (Fig. 3). This was followed in August of the
same year with an equally great abundance of spinnings at the same locality (Fig. 2) all
of which produced specimens typical of C. semifascia (Haworth) (Fig. 4) in September
of that year. Although this was the situation in Portsmouth, which is on the south coast
of England, it was different 50 km inland at Farnham in Surrey. Here, between 19 May
and 12 June 2007, a large number of Caloptilia spinnings were collected in the hope of
breeding C. hauderi. Of approximately one hundred moths that were reared, only two
were ‘hauderi’ whereas all others were typical semifascia.
Many British specimens of what was thought to be hauderi (Fig. 3), including some
from Ford’s locality in the Isle of Wight, and typical semifascia (Fig. 4) were dissected
following standard protocol.
DNA was extracted from adult specimens (dry hind legs) using the routine protocol of
the CCDB (Ivanova et al. 2006 and the CCDB website: www.dnabarcoding.ca/pa/ge/
research/protocols). The ‘DNA barcode’ region of COI was amplified, sequenced and
analysed following the protocol described in De Prins et al. 2009.
In total ten individuals of Caloptilia were barcoded (Tab. 1); Caloptilia stigmatella
(Fabricius, 1781) is used as outgroup for the analysis.
Nota lepid. 33 (2): 191-197 193
Fig. 2. Caloptilia semifascia larval spinnings on Acer campestre.
Records for those specimens are gathered within the project ‘Gracillariidae — PUBLIC
records’ (code GRPUB) in the Published Projects section of the Barcode of Life Data
systems (BOLD; www.barcodinglife.org) (Ratnasingham & Hebert 2007). Information
on specimen vouchers (field data and GPS coordinates) and sequences (nucleotide com-
position, trace files) are found in this project by following the ‘view all records’ link
and clicking on the ‘specimen page’ or ‘sequence page’ links for each individual record.
Sequences are also available on GenBank (Tab. 1).
Results
The female genitalia show no differences between the two British forms, ‘hauderi’ and
semifascia. In the males (Figs 5—7) there are only minor differences in the shape of the
cucullus between what we were now recognising as the two superficially distinguishable
broods of a single species, C. semifascia, and even those differences are not consist-
ent. A request was then made to the Naturhistorisches Museum, Vienna, for the loan
of the lectotype male and paralectotype female genitalia slides of Calybites hauderi.
Examination of them showed that our British specimens definitely did not belong to
that species and were not even congeneric with it. The true hauderi male is distinct in
having a strong ventral spine at about the middle of the valva; such a spine is absent in
Caloptilia. The hauderi female has only one signum in the corpus bursae in contrast to
the pair of signa present in semifascia and other Caloptilia species.
DNA barcodes were obtained for ten specimens of Caloptilia; all sequences are complete
barcodes of 658 bp except for one (GRACI353-08), which is 398 bp long. Two haplo-
194 LANGMAID et al.: Calybites hauderi does not occur in the British Isles
Figs 3-4. Caloptilia
semifascia.
3. First brood form.
4. Second brood form.
types are reported; one occurs in Denmark (GRPAL118-10) and the Czech Republic
(GRACI449-09) and is distinct by a single nucleotide substitution. The mean genetic
variation within Caloptilia semifascia ıs 0.05, with a maximum distance of 0.15 between
the nine individuals analysed. Interspecific distances are high in Caloptilia with up to
11.8 between C. semifascia from Denmark (GRPAL118-10) and C. stigmatella. The
interspecific distances observed within the genus Caloptilia are on average 10.73 but
can go up to 15.64 (Lopez Vaamonde unpublished data). These values are as high as
those found in the genus Phyllonorycter (De Prins et al. 2009).
These divergences were calculated using Kimura’s 2 parameter model (K2P), since it
takes into account the possibility that the rates of substitutions (transitions and transver-
sions) per site may vary. This is clearly the case for mitochondrial DNA where transitions
are generally more frequent than transversions and therefore this model is normally
used in Barcode studies to calculate distance values. Please see Hall (2008) and Page
& Holmes (1998) for further details about the K2P model and other distance measures
for nucleotide sequences.
DNA barcoding, that is the use of a single genetic marker (1.e. COI) to assign the name
of a known species to a specimen of unknown identity has been criticised among other
things because sometimes two different species may have the same DNA barcode, for
instance some Grammia Rambur, 1866 (Arctiidae) (Schmidt & Sperling, 2008) and
Agrodiaetus Hiibner, 1822 (Lycaenidae) species (Wiemers & Fiedler, 2007). However,
species pairs with 0% interspecific divergence are rare as shown by Hebert et al. (2009)
in a large survey of more than 1300 Lepidoptera species from the eastern half of North
America. They found only nine pairs of species that shared the same barcode. These
cases always involved closely related species. In our case the similarity of both DNA
barcodes and genitalia morphology among all nine individuals examined clearly indi-
cates that the British material of ‘C. hauderi’ belongs to C. semifascia.
It is therefore apparent that C. semifascia, which was previously thought to be univoltine
in Britain, was actually bivoltine in the Isle of Wight locality at the time of Ford’s dis-
covery in 1933. It has become so also in some southern counties of the English mainland
over the past twenty years. Furthermore, the massive infestation of the Acer campestre
trees in Portsmouth, together with the observation that only a single parasitic hymenop-
teran was bred from a hundred or so spinnings, might indicate a recent invasion of the
bivoltine form of semifascia from either continental Europe or possibly the “hauderi”
locality in the Isle of Wight. The fact that the first brood larvae from Portsmouth all
Nota lepid. 33 (2): 191-197 195
Tab. 1. Samples used for the DNA barcoding analysis. The SampleID code is a unique identifier linking
the record in the BOLD database and the voucher specimen from which the sequence is derived. Additional
collecting and specimen data are accessible in BOLD’s public project GRPUB, as well as all sequence data.
Country Barcode Number Accession number
(BOLD) (NCBI GENBANK)
IBERO004-09 GU695245.1
(identified as C. hauderi)
Caloptilia semifascia IBERO003-09 GU695244.1
(identified as C. hauderi)
Caloptilia semifascia GRACI353-08 HQ171490
(identified as C. hauderi)
UK
UK
UK -
Caloptilia semifascia UK
UK
UK 5
Sample ID Species
CLV0409 Caloptilia semifascia
CLV0309
CLV24508
CLV0109
CLV21808
CLV0209
G09semi
DP09127
DP09128
GO8stigm Caloptilia stigmatella
Caloptilia semifascia
Caloptilia semifascia
Figs 5-7. Male genitalia of Caloptilia semifascia. 5-6. First brood. 7. Second brood.
produced the form resembling hauderi and the ones from Farnham mostly produced
specimens typical of the second brood of semifascia lends some weight to that possibility.
C. semifascia is recorded from almost all European countries and Morocco, Tajikistan,
Turkey and Turkmenistan (De Prins & De Prins 2010). Unfortunately we are unable
at this stage to comment on its bivoltinism in continental Europe because of confusion
with the first brood of C. falconipennella and the true Calybites hauderi.
It should be noted that the name onustella Hübner, 1813, was sometimes applied to a
form of semifascia Haworth, 1828, and would, of course, antedate the latter (Karsholt
1996: 303). In fact, World Catalogue of Insects (De Prins & De Prins 2005: 110) and the
Global Taxonomic Database of Gracillariidae (Lepidoptera) (http://gc.bebif.be) record
Caloptilia onustella Hübner as a valid species, with semifascia in synonymy. Serious
doubt about the identity of onustella with semifascia was raised by JRL, and a recent
reassessment does indeed indicate that Hübner’s name does not apply to a Caloptilia
196 LANGMAID et al.: Calybites hauderi does not occur in the British Isles
species (Bengtsson 2010: 106). We therefore continue to use semifascia, the name uni-
versally applied to this species in the British entomological literature.
Acknowledgements
Thanks are due to Sabine Gaal-Haszler (Naturhistorisches Museum, Vienna), for the loan of the genitalia
slides of Calybites hauderi. We would also like to thank Bengt A. Bengtsson (Farjestaden), Jurate De
Prins (Tervueren), Ole Karsholt (Copenhagen), Martin Honey (Natural History Museum, London), Zdenék
Laëtüvka (Brno), David Lees (Orléans), Rodolphe Rougerie (Rouen), Ian Sims (Reading), Paul Sokoloff
(Orpington), Poul Szyska (Gedser), Ian Thirlwell (Southsea) and Gerry Tremewan (Truro), for information,
specimens, logistic support, discussions and comments on the manuscript. Rodolphe Rougerie (Rouen), is
also thanked for processing the DNA samples at Guelph Barcoding Center. Sequencing of DNA barcodes
was supported by a grant from Genome Canada to the international Barcode of Life project (iBOL).
References
Agassiz, D., R. Heckford & J. Langmaid 1993. Microlepidoptera Review for 1991. — Entomologist‘s Record
and Journal of Variation 105 (7—8): 159-170.
Bengtsson, B. Ä. 2010. Caloptilia jurateae sp. n., a sibling species of C. semifascia (Haworth, 1828)
(Lepidoptera Gracillariidae). — Entomologisk Tidskrift 131 (2): 105-112.
Bradley, J. D. 1998. Checklist of Lepidoptera Recorded from the British Isles. — Private Publication,
Fordingbridge, Hants. vi+106 pp.
Bradley, J. D., D. S. Fletcher & P. E. S. Whalley 1972. Lepidoptera. — Jn: G. S. Kloet & W. D. Hincks, A
Check List of British Insects, Second Edition, Part 2. vini+153 pp. Royal Entomological Society, London.
Chrétien, P. 1908. Microlépidoptères nouveaux pour la faune française. — Le Naturaliste 30: 245-246.
De Prins, J. & W. De Prins 2010. Global Taxonomic Database of Gracillariidae (Lepidoptera). Royal
Museum for Central Africa, Belgian Biodiversity Platform, Tervuren, Brussels, Belgium. — http://
gc.bebif.be (accessed 21 April 2010).
De Prins, J., W. De Prins & M. Jacobs 2005. Caloptilia hauderi, a new species for the Belgian fauna
(Lepidoptera: Gracillariidae). — Phegea 33 (2): 53-54.
De Prins, J., R. Mozüraitis, C. Lopez-Vaamonde & R. Rougerie 2009. Sex attractant, distribution and
DNA barcodes for the Afrotropical leaf-mining moth Phyllonorycter melanosparta (Lepidoptera:
Gracillariidae). — Zootaxa 2281: 53-67.
Emmet, A. M. 1979. A Field Guide to the Smaller British Lepidoptera. — The British Entomological and
Natural History Society, London. 271 pp.
Emmet, A. M., I. A. Watkinson & M. R. Wilson 1985. Gracillariidae. — Jn: J. Heath & A. M. Emmet (eds),
The Moths and Butterflies of Great Britain and Ireland. — Harley Books, Colchester. 460 pp.
Fletcher, T. B. 1940. Caloptilia pyrenaeella, Chrétien 1908. — Entomologist’s Record and Journal of Var-
lation 52 (1): 8-9.
Ford, L. T. 1933. Gracilaria pyrenaeella, Chret., an addition to the British list. - Entomologist 66: 230.
Hall, B. G. 2008. Phylogenetic trees made easy: a how-to manual. — Sinauer Associates. 233 pp.
Hebert, P. D. N., J. R. deWaard & J.-F. Landry 2009. DNA barcodes for 1/1000 of the animal kingdom. —
Biological letters. doi: 10.1098/rsb1.2009.0848)
Ivanova, N. V., J. R. deWaard & P. D. N. Hebert 2006. An inexpensive, automation-friendly protocol for
recovering high-quality DNA. — Molecular Ecology Notes 6: 998-1002.
Karsholt, O. & J. Razowski 1996. The Lepidoptera of Europe. — Apollo Books, Stenstrup. 380 pp.
Langmaid, J. R. & M. R. Young 2001. Microlepidoptera Review of 2000. — Entomologist’s Record and
Journal of Variation 113 (6): 241-254.
Leraut, P. 1983. Quelques changements dans la nomenclature des Lépidopteres de France [Lep. Tineidae,
Gracillariidae]. — Entomologica Gallica 1 (1): 35-36.
Page, R. D. M. & Holmes, E. 1998. Molecular evolution, a phylogenetic approach. — Blackwell Science
Ltd. 346 pp.
Nota lepid. 33 (2): 191-197 197
Ratnasingham S. & P. D. N. Hebert 2007. BOLD: The Barcode of Life Data System (http://www.barco-
dinglife.org). — Molecular Ecology Notes 7: 355 — 364.
Schmidt, B. C. & F. Sperling 2008. Widespread decoupling of mtDNA variation and species integrity in
Grammia tiger moths (Lepidoptera: Noctuidae). — Systematic Entomology 33: 613-634
Sims, I. 2009. Exhibit, 2008 Annual Exhibition, British Microlepidoptera. — British Journal of Entomology
and natural History 22 (3): 168-169.
Wakely, S. 1960. Caloptilia pyrenaeella Chret. and Gracillaria semifascia Hw. in the Isle of Wight. — Ento-
mologist’s Record and Journal of Variation 72: 247-248.
Wakely, S. 1962. Further notes on Euspilapteryx (Gracilaria) pyrenaeella Chretien. — Entomologist’s Record
and Journal of Variation 74: 120-121.
Wiemers, M. & K. Fiedler 2007. Does the DNA barcoding gap exist? — a case study in blue butterflies (Le-
pidoptera: Lycaenidae). — Frontiers in Zoology 4: 8.
PA
iT vs
Er.
= z=
=, a
= ne
3 u ei
:
as *
is
Ae
ne
= nn
+
ee
ae
-
-
dip. vf
Sr
+
Ee ra eh
ay
Î
LE
7 5
Nota lepid. 33 (2): 199-207 199
Dispersal ability and habitat selection in Melitaea telona kovacsi
Varga, 1967 and M. phoebe (Denis & Schiffermüller, 1775)
(Nymphalidae) in steppe grassland
JANos PAL TOTH'?, JuDIT BERECZKI', NIGEL SPRING? & ZOLTAN VARGA!
! Department of Evolutionary Zoology and Human Biology, University of Debrecen, Egyetem ter 1,
4010 Debrecen, Hungary
? European Conservation Action Network, Dorset, UK
3 Corresponding author: [email protected]
Abstract. Melitaea telona is a protected species in Hungary. The known range has shown significant con-
traction over the last decades. In order to conserve this species it is important to understand its dispersal
ability and patterns of movement. The, mobility of M. telona and the related M. phoebe were studied using
capture-recapture methods. 307 M. telona and 139 M. phoebe individuals were marked and 12% recaptured
during May 2009 in three study areas with ten sample sites. We estimated the densities of the larval food
plant (Cirsium pannonicum) and of the most important nectar source (Dianthus pontederae). M. telona is
moderately localized: the species is able to reach habitat patches several hundred metres distant. It tends to
occur in high numbers where the food plant is abundant. In these sites, fewer M. phoebe were found, while
there were higher numbers in the more degraded patches. Our data suggests that the density of the food
plant is more important than the abundance of nectar sources in habitat selection by M. telona.
Introduction
Melitaea telona kovacsi Varga, 1967 is a protected forest-steppe species in Hungary. It
lives only in habitats where Cirsium pannonicum grows in significant density. Evidence
from museum specimens suggest that in the 1960°s this species was widely distributed in
the central and northern hills of Hungary. Nowadays it is known from only a few locali-
ties in the Budai Hills, the region of the Aggtelek-Karst and the Borsodi Hills. Perhaps
the most drastic decline has been observed in the Bükk Mts. There are many museum
specimens from this region, but in the last few years we could not confirm the species’
continuing presence here. The Aggtelek region seems to be the only locality where this
species still has strong populations and has any chance of a long term conservation
(Varga 2007; Varga et al. 2005). In this region there are many suitable habitats for the
species in close proximity to each other. The situation in the Bükk Mts. is totally differ-
ent with the known, suitable habitats sometimes tens of kilometres apart.
Habitat isolation depends on both the hostility of the environment in between and the
organism’s gap-crossing ability (Ricketts 2001; Schmitt et al. 2000; Tischendorf and
Fahrig 2000; Wratten et al. 2003). Thus to understand isolation, one must consider the
distance between all potential source populations and also the landscape between the
habitat fragments. Landscape connectivity does not need to imply structural connectiv-
ity, but rather functional connectivity. Overall, depending on the species concerned, the
landscape context may facilitate or impede movements of insects between habitat patches
(Tscharntke and Brandl 2004). The mobility of the species can vary considerably even
within a relatively small group like butterflies (Scott 1975).
We have carried out a capture-recapture survey on Melitaea telona kovacsi and
M. phoebe. Our questions were: how localized are the populations, and how strong is
Nota lepidopterologica, 24.01.2011, ISSN 0342-7536
200 TOrtH et al.: Dispersal and habitat selection of Melitaea in steppe grassland
the connection between the habitat patches at different distances apart? In addition we
were interested in other basic biological concerns: which plant species are the main
nectar sources? What is the relationship between the supply of the larval food plant and
the population size?
Material and methods
Target species. M. telona Fruhstorfer, 1908 is distributed in the Ponto-Mediterranean
belt. Its range extends from the eastern part of the Mediterranean Sea coast across Asia
Minor to the north-western part of Balkan Peninsula and southern Italy including Sicily.
The subspecies in the Carpathian basin has become isolated from the main distribu-
tion area and it has patchy habitats. In Hungary the only known food plant is Cirsium
pannonicum while in other regions it feeds on different types of Asteraceae, mainly on
Centaurea species, mostly local endemics (Russell et al. 2007). The species is univoltine,
flying from mid-May to mid-June. The females lay their eggs near to the ground on the
undersides of the food plant leaves. The young caterpillars live in a web, spreading out
over the plant as they feed, leaving only the upper epidermis intact. When the warmer
part of the summer arrives, the caterpillars enter diapause and overwinter in the third
instar. The next spring they continue feeding, gregariously at first, but later becoming
solitary. When fully developed, pupation occurs in the grass litter. The imago emerges
one or two weeks later (Varga et al. 2005).
Melitaea phoebe (Denis & Schiffermiiller, 1775) has the widest distribution in the tribus
Melitaeini, with many described subspecies. Its range is nearly continuous, extending
from North Africa over Eurasia to the Far East. It is widely distributed in Hungary, and
was found at all of the sample sites. It is known to use several larval food plant species:
Centaurea, Carduus, Cirsium spp. and, like all member of the tribus Melitaeini, is able
to absorb iridoid glycosides from the plant (Wahlberg 2000). It is possible to feed the
caterpillars with Cirsium pannonicum. Moreover, we collected young caterpillars from
this plant and later realised they were Melitaea phoebe. Generally it is only possible to
separate the caterpillars once they have reached the 4" instar, based on the coloration
of the head capsule. M. phoebe has a black and M. telona has a brick red larval head
capsule (Russell et al. 2007). The young caterpillars feed together like M. te/ona, but
M. phoebe is bivoltine. The first brood flies nearly at the same time as M telona and the
second flies from the end of June/beginning of July to the end of August/beginning of
September. To summarise the comparison of these two species, we can say that while
M. phoebe is a widely distributed euryoecious species, M. telona is a narrowly distrib-
uted food plant specialist.
Even though these two species are very similar; we are able to separate them with a high
degree of accuracy based on the morphology of wings and the shape of the tips of the
antennae (Varga 2007; Varga et al. 2005).
Data sampling. Our study areas were in three well-known M. telona localities: Szölöhegy
near to Jösvafö, and Zabanyik and Borhäz-tetö between Tornakapolna and Varböc in the
Aggtelek-Karst area. The vegetation of the study areas belongs to the alliance Polygalo
Nota lepid. 33 (2): 199-207 201
majori-Brachypodietum pinnati. The choice of these study areas was based on three
main considerations: the presence of the focal species, a variety of distances between
the sample sites, and a variation in the density of the food plant in the different sites.
The Szölöhegy study area has been extensively cultivated for a long time, most typically
for fruit production, using widely spaced fruit trees with seasonally mown herbaceous
vegetation. Thanks to this sensitive management, the vegetation on this hill has become
very similar to that of forest steppe. We had five sample sites here.
A: is good condition steppic grassland with Stipa tirsa, S. joannis and Iris pumila.
Cirsium pannonicum has a high density here. It is rich in dicots (Jurinea mollis,
Inula ensifolia, Polygala major, Scorzonera purpurea, many tall forb Asteraceae
and Apiaceae etc).
B: with degraded vegetation, dominated by grasses. There is little evidence of the food
plant here.
C: formerly used as a forestry hayfield. Nowadays, this site is mown irregularly by the
staff of the national park. It is characterized by many different grass and herbaceous
species, including some tall forbs and polycormon-forming species (Echium macu-
latum, Peucedanum cervaria, Centaurea spp., and Inula hirta, I. ensifolia, Thymus
spp., Dorycnium germanicum)
L: 1s cut every year. Some Fabaceae are abundant here, e.g. Onobrychis arenaria,
Hippocrepis comosa and Vicia tenuifolia.
N: isa slightly bushy patch, poor in dicotyledonous plants.
On the Zabanyik hill we can see the remains of fruit trees, indicating ıts former use as
an orchard, similar to the Szölöhegy. Compared with the Szölöhegy, this hill is drier and
warmer. Probably the species-rich patches are edaphically treeless. However, close to the
top we can see some old Italian pubescent oaks (Quercus virgiliana) with a species-rich
fringe vegetation (Anemone sylvestris, Cytisus procumbens, Dracocephalum austriacum,
Euphorbia polychroma). We had three sample sites here.
G: This site is very near the oak forest on the south-east slope of the hill. It is a species-
rich semi-natural grassland.
H: Facing Szölösardö on the south-west slope of the hill, this site is drier and a little
poorer in species. Stipa joannis and S. tirsa are characteristic here.
I: is very bushy and poor in species. The south-east and north-east parts border Pinus
nigra plantations.
The Borhaz-tet6 used to be a fruit production area too. Nowadays we can only see a few
relict vines which bear witness to this activity. The north-east slope with Bromus erectus
has been burned every year. We chose two sample sites here on the western slope very
close to each other:
J: is aslightly bushy and dry patch with clastic soil. Some parts of this are very rich
in Stipa tirsa and S. joannis.
K: is near to the forest with many bushes; the dominant grass species is Brachypodium
pinnatum.
202 TOTH et al.: Dispersal and habitat selection of Melitaea in steppe grassland
mn
Jösvafö-szölöhegy
Lj] telona
© 2009 Geocentre,Consulting ER re EA
92000 ROW M TE MI phoebe
©2009 Tele Atlas’ =" : +.
_Imace © 2009 DiaitatGiobef
Fig. 1. Topography of sample sites, as well as the observed ratios of M. phoebe (black) and M. telona (white).
Methods. Our data were collected through capture-recapture surveys on three or four
occasions (Tab. 1) in 2009 May 15-25 from ten sample quadrats (sample sites) with di-
mensions 50 x 40 m. We worked on five sites simultaneously between 9:00 and 13:00 for
3 hours, only in good weather conditions. Captured butterflies were marked with a water
Nota lepid. 33 (2): 199-207 203
Borhaz-tetö
Jösvafö-Szölöhegy
Zabanyik Hill
Fig. 2. The observed movement events. The size of the circles is commensurate with the number of but-
terflies, and the thickness of the lines with the frequency of the movement events. The distances are the
measured distances between the middles of the sample quadrats.
resistant XF marker pen. We wrote a code on the underwing, consisting of a letter and a
number. This code enabled butterflies to be recognized on recapture and their movement
pattern deduced. The following information was registered on the field sheets: the sex,
the species, and the activity before capture (or recapture), the latter being important in
identifying nectar sources. M. phoebe and M. telona are very similar, so all specimens
were re-identified on recapture to double-check. Misidentifications were not noticed.
From the daily distribution of the marked animals we concluded that the sampling was
made at the second part of the flight period (Tab. 1). It may have been better if we had
started the survey before the peak of the flight period. However, it came earlier than we
had anticipated because of the hot and dry weather conditions.
204 TOTH et al.: Dispersal and habitat selection of Melitaea in steppe grassland
Tab. 1. Marked individuals of M. telona (t) and M. phoebe (ph) with date. Some of the sites we could not
sample on the first day (—).
The coordinates of the sample sites were measured with GPS, and were matched with
Google Earth to a satellite image. The centres of the sample quadrats were connected
with lines and measured. The value was used as the distance between the quadrats.
Movement patterns were drawn from the field sheets data.
After the capture-recapture survey, we estimated the density of Cirsium pannonicum and
Dianthus pontederae. Five 2 x 2 m quadrates were marked randomly at each sample site,
and the two plant species were counted in these sample sites. We calculated the density of
plants per m?. The relation between the observed numbers of butterflies and the density
of the nectar source and the larval food plant were analysed using Pearson’s correlation.
Results
307 M. telona and 139 M. phoebe were marked; 12% of M. telona and 14% of
M. Phoebe were recaptured. The sex ratio was 56% male and 44% female in the case of
M. telona and 70% male and 30% female in case of M. phoebe individuals.
The most Melitaea individuals were observed in the sites “A” and “G”, and the fewest
in sites “N” and “B” (Tabs 1 and 2). M. telona and M. phoebe were observed at every
sample site but in very varying proportions (Fig. 2). The biggest differences were in
the Szölöhegy. The ratio changed from 92% to 36%. The smallest differences were
observed in the Borhäztetö 46% and 44%, respectively, but in this place the two sample
sites were very close to each other. On the Zabanyik Hill this ratio varied between 93%
and 77%, respectively.
Feeding M. telona individuals (51% males, 49% females) were observed on 64 occa-
sions during the capture-recapture survey. This sex ratio is not significantly different
from the sex ratio of the marked butterflies. Feeding was recorded 62 times on Dianthus
pontederae (96%), once on Ajuga reptans and once on Polygala major.
We found a significant (p<0.05) but slightly different level of correlation between the
density of Dianthus pontederae and Cirsium pannonicum and the observed number of
Nota lepid. 33 (2): 199-207 205
Tab. 2. The sum of observed M. telona (Nt) and individuals: r=0.7 for the nectar source, and
M. phoebe (N ph) individuals on the last three _
days, as well as the density of C. pannonicum r=0.9 for the larval food plant. The connec-
(C.p.) and Dianthus pontederae (D.p.) in the tion between the two sources is not statisti-
sample sites.
cally significant. If we compare the ratio of
M. telona and M. phoebe with the density of
the food plant we can see M. phoebe never
has a significant ratio where Cirsium pan-
nonicum grows densely (Tab. 2).
From the 37 movement events discernible
for M. telona we conclude that the individu-
als can fly several hundred metres (Fig. 2).
The longest registered distance was 420 m.
The greater the distance between two sample
sites, the less likelihood there is of observing
flights between them. Naturally these distances are just approximate values, calculated
from a map. However, as butterflies do not fly in straight lines, in reality their routes
will surely be much greater than our estimated values.
Discussion
The closely related Melitaea cinxia Linnaeus, 1758 can survive for 12—13 days in
cloudy cool weather (Hanski et al. 2006). Similar results were obtained by us in an
air-conditioned laboratory environment, using overwintered M. phoebe and M. telona
caterpillars collected from the sample sites in spring. These butterflies hatched in
the laboratory, and were fed on Spiraea sp. flowers with a honey and water mixture as
a supplement, and were able to survive more than 14 days at stable temperatures of
22° C. During the field work, the warm, very dry weather probably reduced the
butterflies’ life expectancy. Because the intervals between samplings were usually
2 days (maximally 4 days), we think that the low level of recaptures cannot be explained
simply by a high level of mortality caused by the dry weather. Rather by the mobility
of butterflies — because all the sample sites are in large areas with suitable vegetation
for M. telona, this species can easily move out from the sample sites. From our results
we can see that the butterflies can move between patches several hundred metres apart.
This ability could be very important for the long term survival of populations, espe-
cially in habitats which are subjected to deliberate partial or complete burning in spring.
These fires can be extremely dangerous for M. telona — they could possibly kill all
the individuals in a patch, because the species feeds, overwinters, and pupates in
the litter at ground level. However if there are patches where the species can survive
within flying distance, then recolonization is possible and the species will not necessarily
become extinct.An important question for the conservation of M. telona is its relationship
with M. phoebe. In our survey, M. phoebe occurred at all the sample sites. Moreover,
in some quadrats, greater numbers of M. phoebe were recorded than of M. telona.
These were the sites with degraded vegetation. M. phoebe has the ability to develop
on Cirsium pannonicum but interestingly M. phoebe tends to be found in lower num-
206 TOTH et al.: Dispersal and habitat selection of Melitaea in steppe grassland
bers where that plant is abundant. We have information from studies of strong and
stable populations over several decades. Almost certainly M. phoebe has always
occurred in these places or nearby, but cannot displace M. telona. We think the main
condition for the long-term survival of M. te/ona 1s the high density of the larval food
plant.
An additional exciting question is the possibility of hybridisation. Enzyme electrophore-
sis has not shown any evidence of hybridisation between these two species (Pecsenye
et al. 2007), but this does not mean that they do not mate. It is possible that the hybrids
are sterile or have a lower viability (or perhaps they do not hatch from eggs). It might
be that there is so-called ‘reproductive interference’ between these two species (Gröning
and Hochkirch 2008) and that this could explain the extinction of M. telona from some
of its former known localities and the continued occurrence M phoebe in these places.
Further work is needed to resolve this question.
Our survey shows there is a strong connection between the target species observed
numbers and the density of Cirsium pannonicum and Dianthus pontederae. In spite of
the presence of many other flowering plants like Campanula sibirica, Cytisus procum-
bens, Genista tinctoria, Helianthemum ovatum, Inula ensifolia, Lotus corniculatus,
Onobrychis arenaria, Polygala major and so on, feeding was recorded on mostly (96%)
Dianthus pontederae.
Many plants such as Jurinea mollis, Centaurea scabiosa or Cirsium pannonicum were
flowering later and mostly in very low numbers because the extremely dry spring. We
have recorded butterflies feeding on these plants several times in the last few years. So
it could be a mistake to conclude from our findings this year that this species is a nec-
tar source specialist — an impression supported by the fact that M. phoebe individuals
were also only recorded on D. pontederae, when we know that this species also lives
in habitats where pink flowers do not occur (for example several weedy associations).
In order to get more complete information about the nectar sources, we should have to
repeat the survey in a year with more average weather.
The situation with the larval food plant is totally different. The target species, M. telona,
is a true specialist. The species occurs only where C. pannonicum also occurs. One very
interesting site is “T”, where the nectar source has a significant density (6.75/m?) but the
marked butterflies’ numbers were much lower than we expected (Tab. 2). The larval food
plant also had a very low density here (0.35/m?). If we delete this sample site from the
dataset, we get a much stronger correlation (p<0.01, r=0.892) between nectar source
and larval food plant, so this data is very valuable in our few samples because it indicates
the secondary importance of the nectar source.
In conclusion, contrary to our expectations, M. te/ona has a greater mobility than we
would have expected from its insular distribution and its specialisation (in nature) on one
larval food plant. Future surveys will have to take this into consideration. If we want to
increase the number of recaptures to get more accurate information about the popula-
tion size or the dispersion ability, we must achieve a better coverage of the habitat with
sample sites. It is better to choose habitats where there is a high density of food plants,
not just because we observed the largest number of M. telona in these places but because
we also observed the lowest number of M. phoebe.
Nota lepid. 33 (2): 199-207 207
Acknowledgements
Without the following people we would not have been able to carry out this survey. Wendy Astill, Karen
Aylward, Tim Baker, Jonathan Bradley, Jess Chappell, Richard and Ann Collier, Sam Hyde-Roberts,
Stephanie Rogers, Linda Meadows, Richard Muirhead, David Norfolk, and Tim Thomas all of whom
worked very hard in the field. Thanks to Kathy Henderson the coordinator of the European Conservation
Action Network, Attila Huber, Roland Farkas, and Sandor Boldogh, the members of Aggtelek National Park
who helped us to organize the work. The survey was aided by the European Conservation Action Network,
supported by the Leonardo da Vinci fund of the EU Lifelong Learning Programme.
References
Groning, J. & A. Hochkirch 2008. Reproductive interference between animal species. — The quarterly reviev
review of biology 83: 257-282.
Hanski, I., M. Saastamoinen & O. Ovaskainen 2006. Dispersal-related life-history trade-offs in a butterfly
metapopulation. — Journal of Animal Ecology 75: 91-100.
Pecsenye, K., J. Bereczki, A. Toth, E. Meglécz, L. Peregovits, E. Juhasz & Z. Varga 2007. Connection of
the population structure and genetic variability in some protected butterfly species. [A populäciöstruk-
tura és a genetikai variabilitas kapcsolata védett nappalilepke-fajainknäl.]. Pp. 241-260. — In: L. Forro
(ed.), The genesis of the wildlife of the Carpathian basin. The zoological values and faunal genesis.
[A Kärpät-medence allatvilaganak kialakuläsa. A Kärpät-medence ällattani értékei és faunajanak ki-
alakuläsa.]. Hungarian Natural History Museum [Magyar Természettudomanyi Müzeum], Budapest.
Ricketts, T. H. 2001. The matrix matters: effective isolation in fragmented landscapes. — The American
Naturalist 158: 87-99.
Russell, P., W. J. Tennent, J. Pateman, Z. Varga, D. Benyamini, G. Pe’er, Z. Balint & M. Gascoigne-Pees
2007. Further investigations into Melitaea telona Frushstorfer, 1908 (= ogygia Frushstorfer, 1908 =
emipunica Verity, 1919) (Lepidoptera: Nymphalidae), with observations on biology and distribution. —
Entomologist’s Gazette 58: 137-166.
Schmitt, T., Z. Varga & A. Seitz 2000. Forests as dispersal barriers for Erebia medusa (Nymphalidae,
Lepidoptera). — Basic and Applied Ecology 1: 53-59.
Scott, J. A. 1975. Flight patterns among eleven species of diurnal Lepidoptera. — Ecology 56: 1367-1377.
Tischendorf, L. & L. Fahrig 2000. How should we measure landscape connectivity? — Landscape Ecology
15: 633-641.
Tscharntke, T. & R. Brandl 2004. Plant insect interaction in fragmented landscapes. — Annual Review of
Entomology 49: 405—430.
Varga, Z. 2007. The Kovacs’ Fritillary (Melitaea telona kovacsı Varga, 1967) in the Carpathian basin.
[A Koväcs-tarkalepke (Melitaea telona kovacsi Varga, 1967) a Karpat-medencében.]. Pp. 143-152. —
In: F. Laszlo (ed.), The genesis of the wildlife of the Carpathian basin. The zoological values and
faunal genesis. [A Kärpät-medence allatvilaganak kialakulasa. A Karpat-medence allattani értékei és
faunajanak kialakulasa.]. Hungarian Natural History Museum [Magyar Természettudomanyi Muzeum],
Budapest.
Varga, Z., S. Szabo & P. Kozma 2005. Melitaea ogygia kovacsi Varga, 1967 (Lepidoptera, Nymphalidae)
in the Pannonian region: taxonomy, bionomy, conservation biology. — Studies on the Ecology and
Conservation of butterflies in Europe 2: 65-68.
Wahlberg, N. 2000. The ecology and evolution of Melitaeine butterflies. Department of Ecology and
Systematics. — Helsinki, University of Helsinki.
Wratten, S. D., M. H. Bowie, J. M. Hickman, A. M. Evans, J. R. Sedcole & J. M. Tylianakis 2003. Field
boundaries as barriers to movement of hover flies (Diptera: Syrphidae) in cultivated land. — Oecologia
134: 605-611.
i
FD
Nota lepid. 33 (2): 209-218 209
Occurrence of Olethreutes subtilana (Falkovitsh, 1959)
in Central Europe uncovered by DNA barcoding
(Tortricidae: Olethreutinae)
ANDREAS H. SEGERER !, ALFRED HASLBERGER * & THEO GRUNEWALD?
' Zoological Collection of the State of Bavaria (Zoologische Staatssammlung München),
Münchhausenstr. 21, 81247 München, Germany; [email protected]
? Waschau 14, 83317 Teisendorf, Germany; [email protected]
3 Klötzlmüllerstr. 202, 84034 Landshut, Germany; dr [email protected]
Abstract. We identified a total of 14 specimens of the olethreutine moth, Olethreutes subtilana (Falkovitsh,
1959) from various locations in southern and central Germany (Bavaria, Rhineland-Palatinate, Thuriniga).
This species was previously known from European Russia through the eastern Palearctic; hence the findings
represent the first records for Central Europe. Specimens were detected among large series of the wide-
spread and common ©. arcuella (Clerck, 1759); they had been overlooked and confused with the latter,
as O. arcuella, with its very characteristic wing pattern, was believed to represent the only species of this
group in Central and Western Europe. The first O. subtilana was only accidentally detected in the course
of a genetic all-species survey of the Bavarian animals (“Barcoding Fauna Bavarica”). This paper compiles
and illustrates the key characters allowing unambiguous identification, and describes the present state of
knowledge of distribution, habitats and phenology in Germany. The impact of the finding 1s briefly discussed
with respect to the potential of DNA barcoding, the value of scientific collecting, and the importance of
sufficient sample sizes in faunistic surveys.
Zusammenfassung. Insgesamt 14 Exemplare des Wicklers Olethreutes subtilana (Falkovitsh, 1959) wur-
den von verschiedenen Fundorten in Mittel- und Stiddeutschland nachgewiesen (Bayern, Rheinland-Pfalz,
Thüringen); dies sind zugleich die ersten mitteleuropäischen Belege dieser nach bisheriger Kenntnis vom
Nordwesten des europäischen Russlands bis Ostasien verbreiteten Art. Die Tiere befanden sich innerhalb
großer Serien der verwandten, weit verbreiteten und häufigen O. arcuella (Clerck, 1759). Sie wurden bis-
her wahrscheinlich deswegen übersehen, weil man ©. arcuella als die einzige in West- und Mitteleuropa
vorkommende Art aus dieser Gruppe betrachtete, welche nach äußeren Merkmalen als unverwechselbar
und eindeutig bestimmbar galt. Die Entdeckung des ersten Stückes erfolgte daher auch zufällig im Rahmen
einer laufenden Studie zur genetischen Charakterisierung der bayerischen Tierarten (“Barcoding Fauna
Bavarıca”). Die vorliegende Arbeit fasst die wesentlichen Unterscheidungsmerkmale beider Arten zusam-
men und stellt den gegenwärtigen Stand des Wissens zu Verbreitung, Lebensraum und Phänologie von
O. subtilana in Deutschland dar. Darüber hinaus werden einige übergeordnete Aspekte im Zusammenhang
mit den Funden kurz diskutiert: das Potenzial der ‘DNA Barcoding’ Methode, die Bedeutung von wissen-
schaftlichen Aufsammlungen und von hinreichender Stichprobengröße.
Introduction
DNA barcoding is a modern molecular approach for efficient ad hoc re-identification
of species by using a defined signature sequence (Hebert et al. 2003, 2004; Steinke &
Brede 2006; Ratnasingham & Hebert 2007; Stoeckle & Hebert 2008). It is claimed that
the sequence of the 658 bp long ‘barcode region’ at the 5’ end of the mitochondrial cy-
tochrome oxidase subunit I gene is a marker which allows unambiguous identification
of animal species, though this topic remains controversial (e.g., Janzen 2004; Meyer
& Paulay 2005; Will et al. 2005; DeSalle 2006; Rubinoff 2006; Rubinoff et al. 2006,
Elias et al. 2007) and a number of exceptions to the rule have been reported (e.g.,
Hurst & Jiggins 2005; Whithwort et al. 2007; Wiemers & Fiedler 2007). Suitability of
DNA barcoding for large-scale assessments of Lepidoptera was nevertheless shown by
Hebert et al. (2010).
Nota lepidopterologica, 24.01.2011, ISSN 0342-7536
210 SEGERER et al.: Olethreutes subtilana in Central Europe
In the course of a current all-species barcoding survey of the fauna of Bavaria, southern
Germany (Haszprunar 2009; BFB 2010), we accidentally discovered the presence of
the leaf roller Olethreutes subtilana (Falkovitsh, 1959) in Germany. This species,
originally described from Siberia (Vaganovo, Kemerovskoy oblast), was hitherto known
to occur from north-western and central Russia through Siberia, reaching the Amur
and Primorye regions, the Kurils, Korea, China and Japan in the east (Kawabe 1982;
Kuznetsov 1987; Park & Park 1988; Razowski 2003; Aarvik 2010; Dubatolov 2010).
Though being readily identifiable by morphological characters, it has been overlooked
in Central Europe and confused with the widely distributed and common species, O. ar-
cuella (Clerck, 1759). This paper presents the first records of O. subtilana from Central
Europe and discusses the impact of this finding under some general aspects.
Abbreviations
AH Alfred Haslberger
AHS Andreas H. Segerer
BC Barcoding
BFB Barcoding Fauna Bavarica
BOLD Barcode of Life Data System
CCDB Canadian Centre for DNA Barcoding
COI Cytochrome oxidase subunit I
iBOL international Barcode of Life project
RCAH Research Collection of Alfred Haslberger, Teisendorf
RCTG Research Collection of Theo Grünewald, Landshut
TG Theo Grünewald
ZSM Zoological Collection of the State of Bavarıa, Munich
Methods
Dissection of terminalia was done following the standard protocol of Robinson (1976).
Forewing length was measured under a stereo binocular from wing base to apex,
excluding the fringes.
As a complement to traditional morphological observations, DNA barcodes were ob-
tained by sampling dry legs from collected specimens and sequencing at the CCDB
(Canada) using the standard high-throughput protocol as described in Ivanova et al.
(2006); regularly updated protocols used at the CCDB can also be found at: http://www.
dnabarcoding.ca/pa/ge/research/protocols. All barcoded specimens of the two species
in question are listed below in the paragraph ‘Material’. Images and further details
such as voucher hosting institution, GPS coordinates and trace files can be obtained
from the Barcode of Life Data System (BOLD) (Ratnasingham & Hebert 2007) in the
public-access project FBLTO. Sequences were analyzed using BOLD analysis tools.
The terms ‘sequence variation’ and ‘genetic distance’ refer to the analysis of the COI 5’
barcode fragment (full length 658 bp) with Kimura 2 Parameter. Genetic distances
between species are given in % minimum pairwise distance, infraspecific variation in
% maximum pairwise distance. The distribution map was created using the publicly
accessible GPS Visualizer website (http://www.gpsvisualizer.com/).
Nota lepid. 33 (2): 209-218 au
Fig. 1. Olethreutes subtilana (left column) and O. arcuella (right column) from Germany, each column
displaying a specimen of very small (top), typical (middle) and very large size (bottom). The specimen in
the upper left was the first O. subtilana recognized in Germany (©, Salzachau near Laufen, 2.6.2008; leg.
et coll. A. Haslberger, barcode no. BC ZSM Lep 25167). The comparatively large size of the specimen in
the lower left is untypical for ©. subtilana (9, Huberspitz, M.6.1993, leg. et coll. A. Speckmeier (in ZSM).
Scale bar, 1 cm.
Material. Olethreutes subtilana (Falkovitsh, 1959): 10, Russia, Tolmatschewo, Leningradsk. Obl.[ast],
14.v1.1961, leg. et det. Falkovitsh; ZSM (coll. Klimesch), slide M3667-AHS; 20°, same data, not dissected;
19 dto., 12.vi.1961; slide M3668-AHS. 10°, Germany, Thüringer Wald, 30.v.[no year specified, estimated
~1920], [collector unknown]; ZSM, slide M3677-AHS. 10°, Oberbayern, Salzachau bei Laufen, 400m,
2.1.2008, leg. A. Haslberger; RCAH, slide 111/2010 AH, BC ZSM Lep 25167, GenBank accession No.
HM422134. 19, Emmerting/Alzau, 2.vi.1997, leg. L. Wihr; ZSM (coll. Wihr), slide M3680-AHS. 19,
Hammer bei Siegsdorf, 26.v1.1994, leg. L. Wihr; ZSM (coll. Wihr), slide M3685-AHS. 10°, Huberspitz,
800 m, M.vi.1993, leg. A. Speckmeier; ZSM (coll. Speckmeier), slide M3670-AHS; 19, same data, slide
M3684-AHS; 39, same data, not dissected. 19, Pattenberg, 19.vi.1994, leg. L. Wihr; ZSM (coll. Wihr),
slide M3688-AHS. 19, Pechschnait bei Traunstein, 1.vii.1994, leg. L. Wihr; ZSM (coll. Wihr), slide M3681-
AHS. 19, Munich, Obermenzing, A.vi.1948, leg. H. Pfister; ZSM (coll. Pfister), slide M3671-AHS. 1¢,
Dattinger Berg, 7.v1.2002, leg. T. Grünewald; RCTG, slide TG 01/2010-AHS. 19, Rhineland-Palatinate,
Neustadt/Weinstraße, 31.v.1964, leg. U. Roesler senior; ZSM (coll. Roesler sen.), slide M3683-AHS. —
Olethreutes arcuella (Clerck, 1759): 10°, Bulgaria, Burgas, Primorsko, Arkutino Marshland Reserve,
25.v.—15.vi.1980, leg. Eichler; ZSM (coll. Eichler). 30, Romania, Südkarpathen, Transsylvanien,
Cibinsgebirge, 25.v.1918, leg. Dannehl; ZSM, slide M3682-AHS. 19, Slovakia, Karpaten, Slowakischer
Karst, Zadielska planina, 28.vi.1952, leg. Zouhar; ZSM (coll. Eichler), slide M3669-AHS. 10°, KoSicky kraj,
212 SEGERER et al.: Olethreutes subtilana in Central Europe
Turña nad Bodvou, 30.v.1970, leg. Zouhar; ZSM, slide M3687-AHS. 10°, Czech Republic, Mittelböhmen,
[Praha-]Kr£, 10.vin.1956, leg. Vorlicek; ZSM. 10°, Austria, Steiermark, Liezen, Ardning, Pürgschachener
Moos, 2.v11.1982, leg. J. Klimesch; ZSM (coll. Klimesch). 19, Niederösterreich, Leitzersdorf, Rohrwald,
19.v.1922, [collector unknown]; ZSM. 19, Niederösterreich, Leitzersdorf, Rohrwald, Waschberg,
31.v.1923, leg. Ortner; ZSM (coll. Klimesch), slide M3673-AHS. 10°, Oberösterreich, St. Dionysen b.
Traun, 29.v.1946, leg. J. Klimesch; ZSM (coll. Klimesch). 19, Land Salzburg, Muhr, 1200m, 15.v1.2004,
leg. A. Haslberger, RCAH, slide 114/2010 AH. 19, Nordtirol, Landeck, Kauns, 1.—- 14.1x.1953, leg.
Daniel; ZSM. 19, Germany, Mecklenburg-Vorpommern, Heringsdorf, Ahlbeck/Swinemünde, 5.vi.1941,
[collector unknown]; ZSM. 10°, Niedersachsen, Harz, Goslar-Grauhof, Grauhöfer Holz, 30.v.1915, leg.
Bauer; ZSM, slide M3678-AHS. 19, Sachsen-Anhalt, Bitterfeld-Wolfen, Goitzsche, 1.vi.1914, [collector
unknown]; ZSM. 10°, Naumburg/Saale, Sperlingsholz, 17.v.1911, leg. Bauer; ZSM. 19, Thüringer Wald,
[no data]; ZSM, slide M3686-AHS. 10°, Pfalz, Neustadt/Weinstraße, 2.v11.1963, leg. U. Roesler senior;
ZSM (coll. Roesler sen.). 10°, Bavaria, Mittelfranken, Lauf (Pegnitz 16.vi.1972, leg. H. Pröse; ZSM (coll.
Pröse), slide M3676-AHS. 19, Oberpfalz, „Regensburg“, no data, leg. E. Frank; ZSM (coll. Osthelder).
19, Oberpfalz, Etterzhausen, 17.vi.1965, leg. Kuchler; ZSM (coll. Fauna Bavarica). 19, Oberpfalz,
Nittendorf, Tf 5.v1.2009, leg. A. Segerer; ZSM (coll. Segerer), BC ZSM Lep 25740, GenBank Accession
No. GU707046. 19, Oberpfalz, Nittendorf, Tf 30.v.2009, leg. A. Segerer; ZSM (coll. Segerer), BC ZSM
Lep 25481, GenBank accession No. GU706704. 19, Oberpfalz, Pfatter, Geisling, 16.vi.1941, leg. M.
Sälzl jun; ZSM (coll. Pfister), slide M3666-AHS. 19, Oberpfalz, Regenstauf, Linglhof, Tf 27.vi.1995,
leg. A. Segerer; ZSM (coll. Segerer), BC ZSM Lep 28613, GenBank accession No. HM391970. 19,
Oberpfalz, Schwarzenbach, Parkstein-Hiitten, Lf 26.vi.1999, leg. A. Segerer; ZSM (coll. Segerer), BC
ZSM Lep 25249, GenBank accession No. GU706703. 10°, Niederbayern, Kelheim, 9.vi.1918, leg. L.
Osthelder; ZSM, slide M3674-AHS. 19, Niederbayern, Eugenbach, 30.v.— 1.v1.1996, leg. T. Grünewald;
RCTG, BC ZSM Lep 23174, GenBank accession No. HM391732. 10, dto., 28.v.1942, leg. M. Sälzl jun.;
coll. Pfister, ZSM, slide M3665-AHS. 19, Oberbayern, Berg, Sibichhausen, 5.vi.1969, leg. Pröse; ZSM
(coll. Pröse). 10°, Oberbayern, Bernau/Chiemsee, 12.v1.1916, leg. Dorsch; ZSM (coll. Fauna Bavarica).
19, Oberbayern, Grafrath, 27.vi.1969, leg. A. Speckmeier; ZSM (coll. Speckmeier). 19, Oberbayern,
Miesbach, Miesbach, 1.vi.1952, leg. Freund; ZSM (coll. Fauna Bavarica). 10°, Oberbayern, Mittenwald,
3.v1.1923, leg. Bauer; ZSM (coll. Fauna Bavarica). 10°‘, dto., Hoher Kranzberg, 27.v1.1922, leg. Bauer;
ZSM (coll. Fauna Bavarica). 10, Oberbayern, Oberschleißheim, 26.v.1949, leg. Marx; ZSM (coll. Fauna
Bavarica). 10, dto., 24.v11.1948, leg. Marx; ZSM (coll. Fauna Bavarica). 10, Oberbayern, Starnberg,
12.v1.1955, leg. Stadelhofer; ZSM (coll. Fauna Bavarica). 19, Oberbayern, Obing, Griessee, 11.v1.1947,
leg. L. Osthelder; ZSM (coll. Fauna Bavarica). 19, Oberbayern, Sachsenkam, Kirchsee, 16.vi.1931, leg. L.
Osthelder; ZSM (coll. Osthelder), slide M3672-AHS. 10°, Oberbayern, Samerberg, Hochries, 2.vii.1993,
leg. Heinsdorff: ZSM. 10°, Oberbayern, Siegsdorf, Hammer, 15.vi.1953, leg. Wihr; ZSM (coll. Wihr). 10°,
Oberbayern, Marktlerforst/Überfuhr, 26.v.1997, leg. L. Wihr; ZSM (coll. Wihr), slide M3679-AHS. lo,
Oberbayern, Salzachau bei Fridolfing/Nilling, 370m, 24.vi.2010, leg. A. Haslberger, RCAH, slide 113/2010
AH. 19, Oberbayern, Schneizlreuth, Baumgarten/Rötelbach, 800 m, 27.v1.2005, leg. A. Haslberger: RCAH,
slide 112/2010 AH, BC ZSM Lep 23463, GenBank accession No. GU706567. 19, Oberbayern, Melleck,
Steinbachtal, 580m, 1.v11.2010, leg. A. Haslberger, RCAH, slide 115/2010 AH. 10°, France, Lorraine,
Vosges, Haute Moselotte, Ventron, 13.vi.1940, leg. Fischer; ZSM (coll. Osthelder).
Results
Discovery of Olethreutes subtilana in Germany. Olethreutes arcuella (Clerck, 1759)
— the type species of Olethreutes Hiibner, 1822 —1s a well-known leaf roller occurring in
wood- and scrubland of almost any European country (Razowski 2003; Aarvik 2010).
In the second half of the 20" century, two species of similar appearance were described
from Russia, but thought to represent eastern palearctic vicariants not present in Central
Europe: O. subtilana (Falkovitsh, 1959) and O. captiosana (Falkovitsh, 1960) (see also
Aarvik 2010).
The discovery of O. subtilana in Germany just happened by chance in the course of the
genetic BFB survey of Bavarian animals. Although the BFB database of O. arcuella
had been already completed, we decided to include a further specimen which stood out
from a series of O. arcuella by its exceptionally small size. To our great surprise, its
COI 5’ partial sequence (‘barcode’) turned out to be markedly different from that of
Nota lepid. 33 (2): 209-218 2153
Fig. 2. Terminalia of O. subtilana and O. arcuella. a: O. subtilana, male, prep. M3677-AHS. b: O. arcu-
ella, male, prep. M3672-AHS. c: O. subtilana, female, prep. M3671-AHS. d: O. arcuella, female, prep.
M3666-AHS. Figures are not given to the same scale.
O. arcuella (6.8 % genetic distance), suggesting that it could belong to a distinct species
of Olethreutes. For comparison, the mean distance of species within Olethreutinae
genera is 8.9%, the mean variation within species 0.6% (n = 455; preliminary, original
data from the BFB project, queried from BOLD as of June 30, 2010).
Subsequent dissection of the specimen in question showed the species to be O. sub-
tilana. Morphological follow-up screening of our collections unveiled the presence
of even more specimens of ©. subtilana from further places in southern and central
Germany (see chapter ‘Material’ above, and fig. 3), hitherto unrecognized within large
series of O. arcuella. To date, we have been able to trace 14 specimens of O. sub-
tilana among a total of ~250 Central, Western and Eastern European specimens of
‘O. arcuella’ present in our collections.
Differential diagnosis. Though strongly resembling O. arcuella in its external mark-
ings, the wingspan of O. subtilana is conspicuously small. (The name ‘subtilana’ was
therefore very appropriately chosen). Of 18 specimens examined thus far, all but one
were distinctly smaller than even the very smallest O. arcuella; only one exceptionally
large specimen had a forewing length in the range of very small O. arcuella (6.8 mm)
(Tab. 1, Fig. 1 — lower left). |
Thus, size is a good marker for selecting specimens worth studying in further detail,
and the very smallest ones of a series should be dissected to confirm the identity. The
terminalia of both species are highly distinctive in both sexes, allowing unambiguous
identification. As the original description of Falkovitsh (1959) may not be familiar to all
microlepidopterists, and the figures of the adults in Razowski (2003) are unfortunately
drawn to the same size (1.e., to different scales), we give a compilation of the essential
differences of both species below in order to facilitate identification (Tab. 1, Figs 1—2).
Alternatively, the species can be easily recognized by DNA barcoding (for access to
reference data, see chapter ‘Methods’).
214 SEGERER et al.: Olethreutes subtilana in Central Europe
Tab. 1. Morphological key characters suitable for identification of O. subtilana and O. arcuella. * Only the
smallest 45 out of a series of -250 specimens were measured.
Length of | 5.4-6.8 mm Small specimens: 6.5—8.5 mm*
forewing | mean 6.0 mm (n = 18) mean: 7.2 mm (n = 45)*
(Fig. 1) Overall aspect of specimens in almost
Overall aspect of specimens in almost
any case distinctly smaller than O. any case distinctly larger than O.
arcuella; only 1 specimen was in the | subtilana
size range of O. arcuella
Male
terminalia
(Fig. 2)
Valva
Ventral margin simple, not markedly | Sacculus with a strong, conspicuous
irregular nor conspicuously edged. outer edge and an irregularly
Tuft of bristles on sacculus located scalloped margin posterior of edge.
Tuft of bristles on sacculus located
closer to basal opening than to
close to cucullus
cucullus
Phallus Vesica simple, cornuti absent Vesica containing ~10 small cornuti,
usually visible at the posterior tip of
phallus
Distinctly notched at apex Barely notched at apex
Female Antrum simple, cylindric to funnel- Posterior part of antrum protruded,
terminalia | shaped, with ring-like ostium bursae | conspicuously swollen around ostium
(Fig. 2) bursae, like a knob
Distribution, habitats and phenology. Distribution and frequency of O. subtilana in
Central Europe are still poorly understood.
Our efforts to verify O. subtilana from C and W European countries other than Germany
were thus far in vain (see chapter ‘Material’ above), but we have checked the available
material from our own collections only, and no systematic survey on a larger scale has
been undertaken yet.
Our present observations suggest that O. subtilana might be a quite local and possibly
rare species. All known places of occurrence are within, or at least closely associated to,
mountainous regions (Alps, Bavarian Forest, Thuringian Forest, and Palatine Forest)
(Fig. 3) and lie generally below 900 m altitude. Adults are active during day, flying
in deciduous wood- and scrubland of different types (including alluvial forests, bog
forests, trivial woodland and parks). Behaviour and biotopes are obviously similar to
those of O. arcuella, and in most places both species occur syntopically.
The bulk of specimens known to date is from south eastern Bavaria but this may well
be an artefact: the records from other, widely separated parts of Germany (Thuringia,
Palatinate) rather indicate that the species may have a much wider distribution than
previously thought. We expect to find further populations especially in the low mountain
ranges of Germany as well as in adjacent countries, but possibly also in more distant
areas.
Nota lepid. 33 (2): 209-218 215
Fig. 3. Records of O. subtila-
| na in Germany (red). To faci-
- | litate orientation, the cities of
Berlin (B), Frankfurt/Main (F)
and Munich (M) are displayed
in black (Map produced with
GPS Visualizer).
Most specimens of O. subtilana were caught within the first half of June, about one
week later than the peak flight of ©. arcuella; this observation, however, 1s statistically
not well supported and may be artificial due to small sample size (Fig. 4).
Discussion
Though O. subtilana was already known from Eastern Europe (north-western and
central Russia: Kuznetsov 1987), the identity of O. arcuella as the sole species of
the group occurring in Central Europe was obviously never in doubt until Razowski
(2003) and Aarvik (2010). This may at least in part be due to the fact that O. arcuella
is very common and widely distributed and cannot be mistaken for any other palearctic
tortricid, except for the two ‘eastern’ species mentioned above. Thus, visual diagnosis
has been considered to be safe and unequivocal for identification of central European
‘O. arcuella’ and there seemed to be no need for any closer examination of series by
collectors. As a result, O. subtilana has been overlooked in Central Europe for decades.
Retrospectively, its occurrence in Germany is not completely surprising. It seems quite
evident that the zoogeographic pattern of its distribution refers to a so called ‘euro-
siberian’ species, the range of which reaches further to the west than previously thought
(Lattin 1967: 378). The question of the exact western and southern boundaries of its
range must be left open at present.
216 SEGERER et al.: Olethreutes subtilana in Central Europe
Olethreutes subtilana Olethreutes arcuella
No. of Specimens (n)
No. of Specimens (n)
Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec
Month Month
Fig. 4. Phenograms of adult flight of ©. subtilana (n = 18) and O. arcuella (n = 105), as calculated from
the data of the specimens listed in section ‘Material’.
O. subtilana does not seem to be a neozoon currently expanding its area. Instead, there
are records dating back to the 1940s and probably the 1920s (see chapter ‘Material’).
The seeming accumulation of records in recent years in south-eastern Bavaria is most
probably a bias caused by enhanced microlepidoterological collecting activities in this
area since the 1990s.
In order to elucidate the pattern of distribution, we encourage European collectors to
check their series of ‘O. arcuella’, and to collect very small ‘O. arcuella’ systematically
in the field.
Beyond being a finding of mere zoogeographical and faunistic interest, the detection of
O. subtilana in Germany is also an issue of more general impact:
First, the finding adds substance to a growing body of literature corroborating the potential
of DNA barcoding for species identification, biodiversity assessment, biogeography
and other disciplines. The late detection of O. subtilana in Central Europe despite the
extensive work of so many lepidopterists is clearly a case where DNA barcoding has
effectively and efficiently enhanced the knowledge of the German fauna, demonstrating
that the method is well capable of challenging pre-existing hypotheses about the
spectrum of species occurring within a certain area. Although the demands and efficacy
of DNA barcoding have been a matter of controversy (e.g., Janzen 2004; Meyer &
Paulay 2005; Will et al. 2005; DeSalle 2006; Rubinoff 2006; Rubinoff et al. 2006, Elias
et al. 2007), and there are some papers reporting poor performance and pitfalls in some
groups (e.g., Hurst & Jiggins 2005; Whithwort et al. 2007; Wiemers & Fiedler 2007),
the general benefits for identification of species are clearly evident. As a preliminary
result of the BFB project, the method is suitable for unambiguously identifying
approximately 98% of the Bavaria moth species (Hausmann, Segerer, unpublished).
The remainder corresponds to interesting cases of barcode sharing. In contrast, about
5% of the species show deep infraspecific COI-splits (Hausmann, unpublished), but
this is not affecting re-identification because these haplotypes do not match with other
species. Such genetic polymorphisms, including possible cryptospecies need to be
studied in detail in the future. Secondly, the detection of ©. subtilana in Central Europe
is a textbook example of the importance of scientific collecting. Though there is general
Nota lepid. 33 (2): 209-218 ZAG
agreement that collecting is an indispensable scientific standard in entomology, it has
been and is consistently claimed even by some professionals that in-field identification
of ‘unmistakable’ species (either by sight or photography) is equivalent to collecting,
in terms of both efficiency, protection of natural resources, and nature conservation.
Following this argument, O. subtilana would not have been detected in Bavaria, due
to confusion with another species hitherto thought to be “absolutely unmistakable”.
Rather, it was the presence of large series of ‘O. arcuella’ collected from many different
places that eventually led to the discovery of O. subtilana. Countless numbers of ‘O.
arcuella’ have been recorded by in-field sighting of which the accuracy has to be
questioned now.
A third lesson that can be learned is about the importance of sufficiently large sample
sizes in barcoding (or any other faunistic) studies. The particular project design of BFB
generally limits the number of specimens to be barcoded to four per species, preferably
from geographically distinct and widely separated areas of Bavaria. This strategy 1s
evidently sufficient for most, but not all cases: While ©. arcuella is very common in
Germany, O. subtilana apparently is not. The occurrence of the latter would have been
definitely overlooked in the course of BFB simply for statistical reasons, unless we had
not decided to extend the database of O. arcuella to a further specimen of somewhat
‘strange’ appearance. We conclude that some entomological intuition can be important
and helpful when selecting specimens for studies restricted to small sample sizes.
Acknowledgements
We thank Paul Hebert and his colleagues at the Biodiversity Institute of Ontario (Canada) for their
enthusiastic support of our project and the agencies that support their work: Genome Canada, the Ontario
Ministry of Research and Innovation, and the Natural Sciences and Engineering Research Council of
Canada (NSERC). We are highly grateful to Axel Hausmann (ZSM) for invaluable discussions and critical
comments on the paper. Further thanks to Miki Sakamoto (Neuötting) for translating Japanese literature,
Olga Schmidt (ZSM) for her help with Russian literature, Paul Sokoloff (Kent, UK) for improving the
English, and Ulf Buchsbaum and Mei-Yu Chen (both: ZSM) for excellent technical support. The current
study is part of the „Barcoding Fauna Bavarica“ project (BFB) which is financially supported by the
Bavarian Ministry of Science, Research and Art (Bayerisches Staatsministerium fiir Wissenschaft, For-
schung und Kunst, Munich, Germany).
Literature
Aarvik, L.E. 2010. Tortricidae. — /n: O. Karsholt & E. J. van Nieukerken (eds), Fauna Europaea: Lepido-
ptera, Moths. — Fauna Europaea, version 2.2. — http://www.faunaeur.org [as of June 30, 2010]
BFB 2010. Barcoding Fauna Bavarica. — http://www.faunabavarica.de/ [as of June 30, 2010]
BOLD 2010. Barcode of Life Data System. — http://www.boldsystems.org/views/login.php [as of June 30,
2010]
DeSalle, R. 2006. Species discovery versus species identification in DNA barcoding efforts: response to
Rubinoff. — Conservation Biology 20 (5): 1545-1547.
Dubatolov, V. V. 2010. Tortricoidea collection of Siberian Zoological Museum. — http://szmn.sbras.ru/old/
Lepidop/Tortric.htm [as of June 30, 2010]
Elias, M.,R. I. Hill, K. R. Willmott, K. K. Dasmahapatra, A. V. Z. Brower, J. Mallet & C. D. Jiggins 2007.
Limited performance of DNA barcoding in a diverse community of tropical butterflies. — Proceedings
of the Royal Society of London. Series B, Biological Sciences 274: 2881-2889.
218 SEGERER et al.: Olethreutes subtilana in Central Europe
Falkovitsh, M. I. 1959. Novye i maloizvestnye vidy roda Argyroploce (s. lat.) iz Yuzhnoy Sibiri (Lepido-
ptera, Tortricidae). — Entomologicheskoe Obozrenie 38 (2): 460-466.
Falkovitsh, M. I. 1960. Phiaris captiosana, sp. n., — vikariant Phiaris arcuella CI. v vostochnykh rayonakh
palearktiki (Lepidoptera, Tortricidae). — Entomologicheskoe Obozrenie 39 (3): 690-692.
Haszprunar, G. 2009. Barcoding Fauna Bavarica — eine Chance für die Entomologie. — Nachrichtenblatt
der bayerischen Entomologen 58 (1/2): 45-47.
Hebert, P. D. N., A. Cywinska, S. L. Ball & J. R. DeWaard 2003. Biological identifications through DNA
barcodes. — Proceedings of the Royal Society of London. Series B, Biological Sciences 270: 313-321.
Hebert, P. D. N., M. Y. Stoeckle, T. S. Zemlak & C. M. Francis 2004. Identification of birds through DNA
barcodes. — PLoS Biology 2 (10): e312. doi: http://dx.do1.org/10.1371/journal.pbio0.00203 12.
Hebert, P. D. N., J. deWaard & J.-F. Landry 2010. DNA barcodes for 1/1000 of the animal kingdom. — Bio-
logy Letters 6 (3): 359-362.
Hübner, J. 1822. Systematisch-alphabetisches Verzeichniss aller bisher bey den Fürbildungen zur Samm-
lung europäischer Schmetterlinge angegebenen Gattungsbenennungen; mit Vormerkung auch augs-
burgischer Gattungen. — Bey dem Verfasser zu finden, Augsburg. Pp. [I]—[III]—IV—VI, [1]-2-81.
Hurst, G. D. D. & F. M. Higgins 2005. Problems with mitochondrial DNA as a marker in population, phy-
logeographic and phylogenetic studies: the effects of inherited symbionts. — Proceedings of the Royal
Society of London. Series B, Biological Sciences 272 (1572): 1525-1534.
Ivanova, N. V., J. R. deWaard & P. D. N. Hebert 2006. An inexpensive, automation-friendly protocol for
recovering high-quality DNA. Molecular Ecology Notes 6: 998— 1002
Janzen, D. H. 2004. Now is the time. — Philosophical Transactions of the Royal Society. Series B, Biolo-
gical Sciences 359 (1444): 731-732.
Kawabe, A. 1982. 10. Tortricidae, pp. 62-151. — /n: Inoue, H., S. Sugi, H. Kuroko, S. Moriuti & A. Ka-
wabe (eds), Moths of Japan. — Kodansha, Tokyo. 2 vols., 966 + 552 pp.
Kuznetsov, V. I. 1987.21. Family Tortricidae (Olethreutidae, Cochylidae). — Tortricid moths, pp. 279-956. —
In: G. S. Medvedev (ed), Keys to the insects of the European part of the USSR, vol. IV (Lepidoptera),
part I. — Oxonian Press, New Delhi, Calcutta. 991 pp.
Meyer, C. P. & G. Paulay 2005. DNA Barcoding: Error Rates Based on Comprehensive Sampling. — PLoS
Biology 3 (12): e422. doi: http://dx.doi.org/10.1371/journal.pbi0.0030422.
Moritz, C. & C. Cicero 2004. DNA Barcoding: Promise and Pitfalls. - PLoS Biology 2 (10): e354. doi:
http://dx.doi.org/10.1371/journal.pbio.0020354.
Park, U. & K. T. Park 1988. Korean species of the genus Olethreutes (Lepidoptera: Tortricidae). — Korean
Journal of Applied Entomology 27 (2): 68-80.
Ratnasingham, S. & P. D. N. Hebert 2007. BOLD: The Barcode of Life Data System (http://www.barco-
dinglife.org). — Molecular Ecology Notes 7 (3): 355-364.
Razowski, J. 2003. Tortricidae of Europe. Vol. 2. Olethreutinae. — Frantisek Slamka Publ., Bratislava.
301 pp.
Robinson, G. S. 1976. The preparation of slides of Lepidoptera genitalia with special reference to the Mi-
crolepidoptera. — Entomologist’s Gazette 27: 127-132.
Rubinoff, D. 2006. Utility of mitochondrial DNA barcodes in species conservation. — Conservation Bio-
logy 20 (4): 1026-1033.
Rubinoff, D., S. Cameron & K. Will 2006. A genomic perspective on the shortcomings of mitochondrial
DNA for “barcoding” identification. — Journal of Heredity 97 (6): 581-594.
Steinke, D. & N. Brede 2006. DNA-Barcoding - Taxonomie des 21. Jahrhunderts. — Biologie in unserer
Zeit 36 (1): 40—46.
Stoeckle, M. Y. & P. D. N. Hebert 2008. Barcode of life. — Scientific American 299 (4): 82—88.
Whitworth, T. L., R. D. Dawson, H. Magalon & E. Baudry. 2007. DNA barcoding cannot reliably identify
species of the blowfly genus Protocalliphora (Diptera: Calliphoridae). — Proceedings of the Royal
Society of London. Series B, Biological Sciences 272 (1572): 1525-1534.
Wiemers, M. & K. Fiedler. Does the DNA barcoding gap exist? — A case study in blue butterflies (Lepi-
doptera: Lycaenidae). — Frontiers in Zoology 4: 8. doi: http://dx.doi.org/10.1186/1742-9994-4-8.
Will, K. W., B. D. Mishler & Q. D. Wheeler 2005. The perils of DNA barcoding and the need for integrative
taxonomy. — Systematic Biology 54 (5): 844-851.
Nota lepid. 33 (2): 219-229 219
Zur Wicklerfauna Tunesiens (Tortricidae)
Hans BLACKSTEIN! & TIMM KARISCH ?
! Buckower Weg 1, 14712 Rathenow, Germany; [email protected]
2 Straße der Jugend 6, 01877 Demitz-Thumitz, Germany; [email protected]
Abstract. The authors present new records of Tortricidae from the poorly known fauna of Tunisia.
23 species were captured during several expeditions between 2005 and 2008 by the German collectors
H. Hoppe, T. Lange, L. Lehmann and A. Rudolph. The male and female genitalia of Cnephasia cf. albatana
(Chretien, 1915) and the female genitalia of the holotype of Eana antiphila Meyrick, 1913 are figured for
the first time. Aethes hoppei sp. n. is described as new species and belongs to the Aethes bilbaensis (Rössler,
1877) species group.
Einleitung
Die Erforschung und Bearbeitung der Kleinschmetterlingsfauna Nordafrikas setzte ım
wesentlichen erst Anfang des 20. Jahrhunderts ein und erfolgte regional sehr ungleich-
mäßig. Mit den Namen wie Amsel, Chrétien, Joannis, Jourdan, Le Cerf, Lucas, Mey-
rick, Razowski, und Roesler sind Beschreibungen zahlreicher neuer Arten aus diesem
Gebiet und die Bearbeitung meist kleinerer Ausbeuten verbunden. Zusammenfassende
Faunen gibt es jedoch nur wenige. Für Marokko sind die Kleinschmetterlinge in Rungs
(1979) verzeichnet, und für die südalgerischen Gebirge (Hoggar und Tassili n’Ajjer) in
Speidel & Hassler (1989).
Für Tunesien gibt es keine zusammenfassende Kleinschmetterlingsfauna und auch kei-
ne entsprechende Bearbeitung der Wickler. Angaben zu letzteren sınd ın der Literatur
spärlich und weit gestreut. Und obgleich das Land in den letzten zwei Jahrzehnten Ziel
zahlreicher Expeditionen war, wurden die Wickler trotz des schlechten Kenntnisstan-
des nur selten gesammelt. Umso erfreulicher war es, als die Autoren die Tortricidae der
Ausbeuten der Herren Henri Hoppe, Thomas Lange, Lutz Lehmann und Andreas Ru-
dolph zur Bearbeitung vorgelegt bekamen. Sie wurden in vier Forschungsreisen zwi-
schen 2005 und 2008 eingetragen. Im Jahr 2005 legen Beobachtungen vom Oktober
und in den Jahren 2006 bis 2008 von den Monaten April und Mai vor. Damit dürfte
schon ein guter Eindruck von der artenarmen Wicklerfauna des Landes entstehen.
Material und Methoden
Nach Informationen von Hoppe und Lehmann (i. litt. 2010) listen wir nachfolgend die
wichtigsten Fundorte nebst einer Kurzcharakterisierung auf.
Nordwesttunesien, Provinz Jendouba, Kroumirie, südlich Ain Draham, 36°57’N, 08°47'O, 630 m, Licht-
fang (LF); Lebensraumausstattung: bewachsene Dünen; Naturpark Feija, 15 km nordwestlich Ghardimaou,
36°30'28.4N” 8°19.17"O, 820 m, LF; Lebensraumausstattung: Eichenwald.
Nordwesttunesien, Provinz Beja, Cap Negro, nördlich Nefza, 37°05’N, 09°04’O, 90 m, LF; Lebensraum-
ausstattung: bewaldetes Hügelland mit Macchie sowie Quercus coccifera, ©. suber, Pinus pinaster und
Populus alba.
Nota lepidopterologica, 24.01.2011, ISSN 0342-7536
220 BLACKSTEIN & KARISCH: On Tortricidae from Tunisia
Nordwesttunesien, Provinz El-Kef, südwestlich El Kef, 36°6'55.2"N, 08°31'41"O, 410 m, LF; Lebens-
raumausstattung: gebirgiger Westteil des Tell-Atlas um El-Kef mit landwirtschaftlichen Nutzflachen und
atlanto-mediterran beeinflußten Aleppo-Kiefernwäldern.
Dorsale, Provinz Kasserine, Südrand Jebel Chambi, 20 km westlich Kasserine, 35°09'54"N, 08°42’41”O,
840 m, LF; 12 km westlich Kasserine, Südhang, Nationalpark Jebel Chambi, 35°09'55.6"N, 08°42'29.2"0,
865 m, LF; 21 km südwestlich Kasserine, 35°09'12"N, 08°40'1"E, 900 m, LF; 19 km südwestlich
Kasserine, 35°08’90”N, 08°42'40"0, 850 m; Lebensraumausstattung: landwirtschaftliche Nutzflächen mit
Feldern und Obstplantagen sowie überweideten Halfagrasseppen (Lygeum spartum), an Berghängen Pinus
halepensis-Wälder mit Quercus ilex und Elementen der Macchie.
Dorsale, Provinz Nabeul, Strandhotel Cedria Beach, nordwestlich Soliman, 36°42'75"N, 10°24'64”0,
20 m, LF; Lebensraumausstattung: bewachsene Dünen, dahinter Lagunen und offene Wasserflächen mit
Röhrichten und Salzwiesenelementen; nordöstlich Korbous, nördlich Menzel Bouzelfa, 36°50’07"N,
10°35'24"O, 170 m; Lebensraumausstattung: Macchie mit Quercus ilex, O. coccifera und Pinus halpensis,
z. T. auch noch bewaldete Hiigelketten.
Sahelzone, Provinz Gafsa, Qued Melah bei El Ksar, südöstlich Gafsa, 34°22'86"N, 08°50'03”0, 250 m,
LF (2); Bou Omrane, Jebel Biada, 28 km östlich Gafsa, 34°20'N, 09°03'O, 300 m, Lichtfalle; 30 km östlich
von Gafsa, Gebirge Jebel El Onk., LF; Lebensraumausstattung: steppenartige, beweidete Vegetation in
den Höhenlagen, bei Gafsa größere, meist trockene Flußbetten (Oueds) mit Tamarisken und halobionter
niederer Vegetation.
Sahelzone, Provinz Jerid, südöstlich Tamerza, 70 km westlich Gafsa, 34°23’N, 07°55’O, 280 m, LF.
Sahelzone, Provinz Kebili, nördlich Steftini, 15 km nördlich Kebili, 33°48'45"N, 09°00'40"O, 26 m, LF;
2 km südwestlich Bazma, 12 km südlich Kebili, 33°37'56"N, 08°58'22"O, 30 m, LF; Lebensraumaus-
stattung: Salztonebenen mit salzsumpfartigen Flächen am Rande und vegetationslosen Bereichen im
Zentrum; zwei halbwüstenartige Gebirgsketten von West nach Ost verlaufend.
Sahelzone, Provinz Gabes, Wadi 3 km westlich Cafe Jelili, 33 km westlich Matmata, 33°34’N, 09°39’O,
175 m, LF; Nordteil Jebel Dahar, 3 km östlich Matmata, 33°32’N, 09° 59'O, 500 m, LF; nordwestliches Da-
hargebirge 1 km südlich Matmata, 450 m; Zmerten, 9,2 km südlich Toujane, 33°23’N 10°06'O, 525 m, LF.
Sahelzone, Provinz Tatouine, Südteil Jebel Dahar, 4 km westlich Chenini, 32°54'30"N, 10°13'50”0, 500 m,
LF; Lebensraumausstattung: beweidete Beifuß-Halfagrassteppe, bei weniger starkem Weidedruck und an
Felshängen auch Gebüsche und Halbsträucher (Cytisus, Lygos, Thymelaea, Haloxylon, Lycium, Scabiosa,
Thymus u. a.)
Abkürzungen
coll. HB Privatsammlung Hans Blackstein, Steckelsdorf
coll. TK Privatsammlung Timm Karisch, Demitz-Thumitz
DEI Senckenberg Deutsches Entomologisches Institut, Müncheberg
MNHN Museum national d’histoire naturelle, Paris
MNB Museum für Naturkunde Berlin
Ergebnisse
Es folgt das Verzeichnis der aus Tunesien nachgewiesenen Arten. Die Nomenklatur
folgt Brown et al. (2005), die systematische Anordnung weitgehend Razowski (2002,
2003).
Tortrix viridana Linnaeus, 1758
Material. 3 Expl. Nordwesttunesien: Cap Negro N Nefza, 19.V.2008, Lange & Hoppe, coll. HB (19
Gen.-Präp. 1425, Blackstein).
Nota lepid. 33 (2): 219-229 221
Phtheochroa syrtana Ragonot, 1888
Material. 1 ©, Sahelzone: Qued Melah bei El Ksar, 05.X.2005, leg. Hoppe, coll. TK (Gen.-Präp. 2562,
Karisch).
Cochylimorpha cultana (Lederer, 1855)
Material.60, 29, Dorsale, SW Park National Jebel Chambi, 19.1V.2006, Lange & Lehmann, coll.
HB (19 Gen.-Präp. 1406, Blackstein); 50, Dorsale, Südrand NP Jebel Chambi, 07.1V.2007, Hoppe &
Rudolph, coll. TK (1 S Gen.-Präp. 2558, Karisch); 19, gleicher Fundort, 27.1V.2008, Lange & Hoppe,
coll. HB; 10°, Dorsale, südlich Jebel Chambi, 19.1V.2006, Hoppe, coll TK (Gen.-Präp. 2560, Karisch).
30, 19, Sahelzone, 1 km S Matmata, Mt., 22.-23.1V.2006, Lange & Hoppe, coll. HB; Jebel Dahar, 10
14.1V.2006, Hoppe coll. TK (Gen.-Präp. 2561, Karisch); 49, 29, Zmerten, 13.05.2008, Lange & Hoppe,
coll. HB.
Cochylimorpha straminea (Haworth, 1811)
Material. 29, Dorsale, Strandhotel Cedria Beach, 13.1V.2006, Hoppe, coll. TK (1 9 Gen.-Präp. 2557,
Karisch). 19, Sahelzone, Zmerten, 13.05.2008, Lange & Hoppe, coll. HB.
Cochylimorpha alternana (Stephens, 1834)
Material. 19, Sahelzone: Zmerten, 13.V.2008, Lange & Hoppe, coll. HB.
Aethes hoppei sp. n. Figs 1,8
Material. Holotypus ©: „Tunesien | Prov. Kebili | 2 km südwestl. Bazma | 12 km südlich Kebili |
33°37'56"N, 08°58'22"E | 30 m, LF. 14.04.2007 | leg. Hoppe/Rudolph“, ,,Gen.-Prap. 2556 | präp. Karisch,
2009“. coll. MNB. — Paratypus: 10°, gleiche Daten, coll. TK.
Beschreibung. Flügelspanne © 12 mm. Grundfarbe der Vorderflügel kräftig gelb; zwei
parallele, rotbraune Binden, die besonders auf der medianen Seite gezackt sind; Mittel-
binde an der Discoidalzelle schmal durchschnitten und leicht zum Außenrand ver-
breitert; Costa von der Wurzel bis zur Mittelbinde rotbraun. Fransen von Grundfarbe.
Hinterflügel hell bräunlich-gelb, Fransen etwas heller.
JO Genital (Fig. 8): Uncus stumpf; Socii lang sichelartig; Tegumen mit zwei dorn-
förmigen Fortsätzen; Valve breit, gedrungen, Cucullus breit gerundet, Sacculus kräftig
sklerotisiert, caudal vorgewölbt; Vinculum basal stark verbreitert. Aedeagus ziemlich
schlank, mit zwei lateralen Fortsätzen, die am Ende mit zwei Zähnen besetzt sind und
unterseits einen weiteren, feinen, dornförmigen Fortsatz aufweisen; Schaft des Apex
ventro-apical zugespitzt.
Weibchen: Unbekannt.
Differentialdiagnose. Die neue Art gehört in die Aethes bilbaensis (Rössler, 1877)-
Gruppe und ähnelt äußerlich Aethes bilbaensis sehr, von der sie sich im Genital durch
den fehlenden caudalen Vorsprung des Sacculus und stark verbreiterte Arme des
Vinculum unterscheidet. Allerdings zeigt A. hoppei im Genital mehr Beziehungen zu
229 BLACKSTEIN & KARISCH: On Tortricidae from Tunisia
Figs 1-7. Tunesische Tortricidae. 1. Aethes hoppei sp. n., Holotypus. 2. Cnephasia zernyi Razowski, 1959.
3. Periclepsis accinctana (Chrétien, 1915). 4. Cnephasia cf. albatana Chrétien, 1915. 5. Cydia cf. suc-
cedana. 6. Cydia triangulella (Goeze, 1783), braune Form. 7. Eana antiphila Meyrick, 1913, Holotypus.
A. confinis Razowski, 1974, jedoch ragt bei Aethes hoppei sp. n. der Cucullus viel deut-
licher vor, die caudale Vorwölbung des Sacculus ist verkürzt und die lateralen Arme des
Phallus sind deutlich breiter und auch etwas kürzer. Das Coecum ist nicht so schmal
wie bei A. confinis, sondern breit wie bei A. bilbaensis.
Verbreitung. Die neue Art ist bisher nur vom Typenfundort bekannt.
Lebensweise. Informationen zu den Präimaginalstadien liegen nicht vor.
Cochylis molliculana Zeller, 1847
Material. 19, Dorsale, Strandhotel Cedria Beach, 13.1V.2006, Hoppe, coll. TK (Gen.-Präp. 2559,
Karisch); 29, gleiche Daten, aber 24.1V.2006, Hoppe & Rudolph, coll. TK.
Anmerkung. Erster Nachweis für Nordafrika.
Cnephasia cf. albatana (Chretien, 1915) Figs 4, 9, 11
Material. 40,29, Dorsale, SW Park National Jebel Chambi, 19.1V.2006, Lange & Lehmann, coll. HB
(1 © Gen.-Präp. 1432, Blackstein); 10°, Dorsale, Südrand NP Jebel Chambi, 06.1V.2007, Hoppe & Ru-
dolph, coll. TK (Gen.-Präp. 2551, Karisch). 80°, 29, Sahelzone, 1 km S Matmata, Mt., 22.—23.IV.2006,
Hoppe & Lange, coll. HB (2% Gen.-Präp. 1388, 1389 Blackstein; 19 Gen.-Präp. 2565, Karisch); 19, SO
Matmata, 450 m, 29.1V.2008, Lange & Hoppe, coll. HB; 10°, Nordteil Jebel Dahar, 09.1V.2007, Hoppe,
Rudolph & Lange, coll. TK; 10°, Siidteil Jebel Dahar, 17.1V.2007, Hoppe & Rudolph, coll. TK; 19, Wadi 3
km W Cafe Jelili, 10.1V.2007, Hoppe & Rudolph, coll. TK; 30°, Jebel Biada, 16.1V.2006, Hoppe, coll. TK;
20, Zmerten, 13.V.2008, Lange & Hoppe, coll. HB; 19, W Chenini, 430 m, 12.V.2008, Lange, coll. HB.
Anmerkungen: Nach dem vorliegenden Material in Tunesien gern im steppenartigen
Gelände. C. albatana ist von Biskra und Gafsa beschrieben (Razowski, 1965) und nach
Nota lepid. 33 (2): 219-229 225
unseren Daten in Tunesien weiter verbreitet. Razowski (1965) bringt nur die übersetzte
Originalbeschreibung der Art, bildet aber die Genitalien und den Falter nicht ab. Lei-
der ist der Holotypus von C. albatana derzeit nicht verfügbar (Luquet 1. litt. 2010), so
daß keine Sicherheit bei der Determination des vorliegenden Materials erlangt werden
kann. Da uns Tiere von C. cf. albatana in beiderlei Geschlecht vorliegen, bringen wir
nachfolgend die Beschreibung und Abbildung der Genitale sowie ein Foto des Falters
(Fig. 4), um auch später eine Überprüfung der Zuordnung des hier erwähnten Materials
zu gewährleisten.
Beschreibung. © Genital (Fig. 9). Uncus mäßig lang, schmal, knapp oberhalb der
Basis bis unterhalb des Apex mit kurzen, rauen Borsten; Socii sehr klein, rundlich;
Gnathosarme kräftig, Endplatte vergleichsweise klein; Valve schmal, terminal stark
verschmälert und recht lang ausgezogen; Sacculus kräftig, mit einem am Ende fein
bedornten Prozessus, der leicht konkav ist und am Ende frei vorspringt; Vinculum ver-
breitert. Phallus schlank, am Bulbus ejaculatorius proximal verbreitert, apikal seitlich mit
einem zahnförmigen Vorsprung; distales Ende des Phallus abgeflacht und mit scharfen
Seitenecken; Coecum relativ schmal.
© Genital (Fig. 11). Papillae anales breit und rundlich; Sterigma breit dreieckig, cau-
dal mit ausgefranstem Rand; Colliculum kappenförmig, zentral weniger sclerotisiert,
mit breiter Wulst am Ostium bursae; Ductus bursae kurz und mäßig breit; Corpus bursae
länglich-sackförmig, mit schmalem, dornigem Band, welches bis etwa 2/3 der Länge
in den Corpus bursae ragt.
Differentialdiagnose. Cnephasia cf. albatana ähnelt sehr der von Kleinasien bekannten
C. virginana (Kennel, 1899), ıst aber reiner weiß. Die Zeichnung ist eher noch dürftiger
und bei Chrétien (1915) treffend charakterisiert. Die Genitale von C. virginana werden
bei Razowski (1971, ©) und Razowski (1965, 9) abgebildet. Im @-Genitale hat C. cf.
albatana einen median nicht verbreiterten und stumpfer endenden Uncus, kürzere Socij,
eine breitere Endplatte des Gnathos, eine breitere Juxta, eine deutlich spitzer zulaufende
Valve sowie einen konkaven Valvenarm. Der Phallus von C. cf. albatana ist breiter, la-
teral mit einem Zahn versehen und caudal abgeflacht und verbreitert. Das 9-Genital von
C. cf. albatana zeigt viel rundere Papillae anales, ein breiteres Sterigma, ein ausgeprägt
kappenförmiges Colliculum, einen breiteren und viel kürzeren Ductus bursae und ein
weniger lang bedorntes und nicht in den Ductus reichendes Band auf dem Corpus bursae.
Cnephasia zernyi Razowski, 1959 Fig. 2
Material. 19, Dorsale, SW Park National, Jebel Chambi, Bergfuß, 19.1V.2006 LF, Lange & Lehmann,
coll. HB (Gen.- Präp. 1404 Blackstein). 19, Sahelzone: Jebel El Onk., 18.1V.2006 LF, Lange & Lehmann
& Hoppe, coll. HB (Gen.-Präp. 1433 Blackstein).
Anmerkung. Im Hochgebirge (Marokko) wurde die Art im Juli beobachtet. Nachwei-
se sind aus Marokko (Großer Atlas, Tachdirt in 2200-2700 m) und Algerien (nach
Razowski 1965) bekannt. Es handelt sich hier offenbar um eine ausschließlich nordaf-
rikanische Gebirgsart, die in Tunesien in Mittelgebirgen lebt. Die bisher festgestellten
Flugzeiten lassen auf zwei Generationen im Jahr schließen.
224 BLACKSTEIN & KARISCH: On Tortricidae from Tunisia
Eana antiphila Meyrick, 1913 Figs 7, 10
Material. Holotypus 9: „Tunis | 9:5 | Coll.O Leonhard.“, ,,Cnephasia | antiphila Meyr. | type“, „T 35“,
„Holotypus“. coll. DEI.
Eana antiphila ist als Cnephasia von Tunis beschrieben und von Obratzsov (1956) in
die Gattung Eana Billberg, 1820 transferiert worden. Razowski (1965) gibt nur die
Originalbeschreibung wieder und bildet weder Falter noch Genitalien ab. Da die in den
Ausbeuten von Hoppe und Lange vorliegenden Cnephasia-Arten mit allen bisher aus
der Region bekannten Spezies verglichen werden mußten, machte sich die Typenunter-
suchung von E. antiphila erforderlich. Im Ergebnis dessen kann hier der Holotypus (9)
abgebildet und eine Beschreibung des weiblichen Genitals gegeben werden.
© Genital (Fig. 10). Papillae anales breit und relativ lang; Apophyses sehr kräftig;
Sterigma breit, mit ausgezogenen Ecken, caudal stärker gebuchtet und in der Mitte ein-
geschnitten; Ostium bursae mit schmalem, sclerotisiertem Rand; Colliculum länger als
breit, proximal einseitig etwas verlängert; Ductus bursae mäßig lang und breit; Corpus
bursae länglich oval, mit langem, proximal verbreitertem Dornenband.
Batodes angustiorana (Haworth, 1811)
Material. 20, Nordwesttunesien, Cap Negro N Nefza, 19.V.2008, Lange & Hoppe, 10 coll. HB, 10
coll TK.
Periclepsis accinctana (Chrétien, 1915) Fig. 3
Material. 40, Dorsale, Südrand NP Jebel Chambi, 12.X.2005, Hoppe, coll. TK.
Anmerkung. P. accinctana ist eine nordafrikanische Art (Brown et al. 2005; coll.
MNHN).
Lozotaenia cupidinana (Staudinger, 1859)
Material. 20, Nordwesttunesien, SW Le Kef, 410 m, 25.1V.2008, Lange & Hoppe, coll. HB (10
Gen.-Präp. 1446, Blackstein). 20°, Dorsale, SW Park National Jebel Chambi, 19.1V.2006 LF, Lange &
Lehmann, coll. HB (19 Gen.-Präp. 1390, Blackstein); 19, Südrand Jebel Chambi, 12.X.2005, Hoppe,
coll. TK; 20, nordöstlich Korbous, 1 @ 05.1V.2007, Hoppe & Rudolph, coll. TK (19 Gen.-Präp. 2550,
Karisch).
Anmerkungen. Die Genitaluntersuchung bestätigte die Zugehörigkeit der tunesischen
Stücke zu L. cupidinana. Da die Art auch von Sizilien bekannt ist (Trematerra 2003),
überrascht das Vorkommen in Tunesien nicht. Von Algerien wurde die ähnliche L. ce-
drivora Chambon, 1990 beschrieben.
Cacoecimorpha pronubana (Hübner, 1799)
Material. 19, Nordwesttunesien, Cap Negro N Nefza, 19.V.2008, Hoppe & Lange, coll. TK.
Nota lepid. 33 (2): 219-229 225
Anmerkung. Mediterrane Art, die nach Südafrika und Nordamerika (Razowski 2003)
sowie nach Mitteleuropa eingeschleppt wurde (z. B. Spitzenberg 2004).
Clepsis neglectana (Herrich-Schäffer, 1851)
Material. 10, Nordwesttunesien, SW Le Kef, 410 m, 25.1V.2008 LF, leg. Lange & Hoppe, coll. HB
(Gen.-Präp. 1442, Blackstein). 19, Dorsale, NP Jebel Chambi, 865 m, (Gen.-Präp. 1445, Blackstein)
27.1V.2008, Lange & Hoppe, coll. HB.
Clepsis consimilana (Hübner, 1814-1817)
Material. 20, Nordwesttunesien, südöstlich Cap Negro, 02.X.2005, Hoppe, coll. TK (19 Gen.-
Präp. 2552, Karisch); 20°, Kroumirie, 01.X.2005, Hoppe, coll. TK (1 S Gen.-Präp. 2555, Karisch); 19,
SW Le Kef, 410 m, 25.1V.2008, Lange & Hoppe, coll. HB (Gen.-Prap. 1441, Blackstein); 20°, Feija,
15 km nordwestlich von Ghardimaou, 26.1V.2008, Lange & Hoppe, coll. HB (10 Gen.-Präp., 1447,
Blackstein). 29, Dorsale, Strandhotel Cedria Beach, 06.-07.X.2005, Hoppe, coll. TK (1Q Gen.-Präp.
2554, Karisch).
Anmerkung. C. consimilana ist von Europa bis zur Ukraine und Südrußland sowie
vom westlichen Afrika bis Kleinasien (Razowski 2002; Kuznetsov 1994) verbreitet;
nach Kuznetsov (1994) auch auf Madagaskar und in Nordamerika (eingeführt).
Clepsis siciliana (Ragonot, 1894)
Material. 19, Dorsale, SW Park. National Jebel Chambi, 19.1V.2006, Lange & Lehmann, coll. HB
(Gen.-Präp. 1405, Blackstein); 1, NP Jebel Chambi, 865 m, 27.1V.2008 LF, Lange & Hoppe, coll. HB
(Gen.-Präp. 1444, Blackstein).
Crocidosema plebejana Zeller, 1847
Material. 19, Dorsale, Nordöstlich Korbous, 05.1V.2007, Hoppe & Rudolph, coll. TK (Gen.-Präp.
2548, Karisch). 19, Sahelzone, südöstlich Matmata, 450 m, 16.V.2008 LF, Lange & Hoppe, coll. HB.
Pelochrista bleuseana (Oberthür, 1888)
Material. 10, Dorsale, Südrand NP Jebel Chambi, 07.1V.2007, Hoppe & Rudolph, coll. TK (Gen.-
Präp. 2543, Karisch).
Pelochrista modicana (Zeller, 1847)
Material. 60, Sahelzone, Nördlich Steftini, 20.1V.2007, Hoppe & Rudolph, coll. TK (1 © Gen.-Präp.
2542, Karisch); 10, nördlich Kebili, 04.V.2008 LF, Lange & Hoppe, coll. HB (Gen.-Präp. 1438, Black-
stein).
Anmerkung. Die Individuen von Tunesien sind sehr kontrastreich gezeichnet.
226 BLACKSTEIN & KARISCH: On Tortricidae from Tunisia
Fig. 8—11. Tunesische Tortricidae, Genitale. 8. Aethes hoppei sp. n., Paratypus. 9. Cnephasia cf. albatana
Chrétien, 1915. 10. Eana antiphila Meyrick, 1913, Holotypus. 11. Cnephasia cf. albatana Chrétien, 1915.
Nota lepid. 33 (2): 219-229 227
os
Fig. 12. O-Genital von Cydia cf. succedana (Denis & Schiffermüller, 1775). a. zentraler Teil mit Juxta
und Phallus. b. Valve.
Cydia blackmoreana (Walsingham, 1903)
Material. 19, Sahelzone, südöstlich Tamerza, 08.1V.2007, Hoppe & Rudolph, coll. TK.
Cydia cf. succedana (Denis & Schiffermüller, 1775) Fig. 5, 12
Material. 19, Dorsale, NP Jebel Chambi, 12 km W Kasserine, 27.1V.2008, Lange & Hoppe, coll. HB
(Gen.-Präp. 1443, Blackstein).
Anmerkungen. Das Exemplar weicht etwas von typischen C. succedana Tieren ab
und stimmt auch nicht ganz mit der aus Tunesien beschriebenen C. funisiana Aarvik &
Karsholt, 1993 überein, gehört jedoch nach Genitalvergleich (Fig. 12) in die unmittel-
bare Nähe dieser Arten. Erst wenn weiteres Material vorliegt, kann gegebenenfalls eine
weitere Differenzierung vorgenommen werden.
Cydia triangulella (Goeze, 1783) Fig. 6
= splendana Hübner, 1796 — 1799
Material. 20, 89, Nordwesttunesien, Kroumirie, 01.X.2005, Hoppe, coll. TK (19, 39 Gen.-Präp.
2545-2547, 2553 Karisch); 10°, südöstlich Cap Negro, 02.X.2005, Hoppe, coll. TK (Gen.-Präp. 2544,
Karisch).
Anmerkung. Ein vorliegendes Cydia-Q von Kroumirie (Gen.-Präp. 2563, Karisch;
Imago Fig. 6), 01.X.2005, Hoppe, coll. TK, ist von brauner Grundfarbe. Es entspricht
genitaliter jedoch C. triangulella, so dass es unter Vorbehalt zunächst hier eingereiht
werden soll.
228 BLACKSTEIN & KARISCH: On Tortricidae from Tunisia
Selania leplastriana (Curtis, 1831)
Material. 10‘, Sahelzone, nördlich Steftini, 20.1V.2007, Hoppe & Rudolph, coll. TK (Gen.-Präp. 2549,
Karisch); 19, 19, Dahar, 4 km westlich Chenini, 430 m, 12.V.2008, Lange, coll. HB.
Zusammensetzung der Fauna
Von den Expeditionen Hoppes, Langes, Lehmanns und Rudolphs liegen den Autoren
insgesamt 23 Arten Tortricidae vor, wobei die Schwerpunkte der Erfassungen in der
Dorsale und Sahelzone lagen. Erwartungsgemäß wird hiernach die Fauna im Norden
von in größeren Teilen Europas und Nordafrika verbreiteten Arten bestimmt. Auf die
nördliche und südliche Mittelmeerregion beschränkte Spezies waren überraschend
spärlich vertreten. Ihr Anteil steigt in der Dorsale signifikant. Gleiches gilt für den
Anteil an rein nordafrikanischen Arten. In der Sahelzone treten die von großen Teilen
Europas bis nach Nordafrika verbreiteten Spezies noch weiter zurück. Hier rekrutiert
sich die Fauna im wesentlichen aus mediterranen und rein nordafrikanischen Arten.
A. hoppei sp. n. ist die vermutlich einzige eremische Art und wurde auf Salztonebenen
am Nordrand der Sahara gefunden. Verbreitungsangaben zu den einzelnen Arten kön-
nen den Werken von Karsholt & Razowskı (1996), Kuznetsov (1994) und Razowski
(2002, 2003, 2008, 2009) entnommen werden.
Danksagung
Die Autoren danken den Herren H. Hoppe, Klein Pravtshagen, und T. Lange, Wittenberge, für die Über-
lassung des interessanten Materials. Für Auskünfte zu den Fundorten wird Herrn L. Lehmann, Eisenhüt-
tenstadt, für die Erlaubnis zur Untersuchung des Typus von Cnephasia antiphila den Herren C. Kutzscher
und Dr. A. Taeger, Senckenberg Deutsches Entomologisches Institut (DEI), Müncheberg, für Recher-
chearbeiten Herrn Dr. G. Luquet, Museum national d’histoire naturelle, Paris, und für die Unterstützung
bei der Anfertigung von Genitalfotos Herrn Dr. M. Nuß, Senckenberg Museum für Tierkunde Dresden,
gedankt.
Literatur
Chrétien, P. 1915. Contribution a la connaisance des Lépidopteres du Nord de l’Afrique. — Annals de la
Societé entomologique de France 84: 289-374.
Karsholt, O. & J. Razowski 1996. The Lepidoptera of Europe. A Distributional Checklist. — Apollo Books,
Stenstrup, 380 S.
Kuznetsov, V. I. 1994. Insects and Mites — Pest of agricultural Plants. Volume III: Lepidoptera, Part 1. —
Nauka, St. Petersburg, 315 S.
Obraztsov, N. 1956. Die Gattungen der Palaearktischen Tortricidae. I. Allgemeine Auftheilung der Familie
und die Unterfamilien Tortricinae und Sparganothinae. — Tijdschrift voor Entomologie 98: 147—228.
Razowski, J. 1965. The Palaearctic Cnephasiini (Lepidoptera, Tortricidae). — Acta Zoologica Cracoviensis
10 (3): 199-343.
Razowski, J. 1971. The Type Specimens of the Species of Some Tortricidae (Lepidoptera). — Acta Zoo-
logica Cracoviensia 16 (10): 403-541.
Razowski, J. 2002. Tortricidae (Lepidoptera) of Europe. Volume 1: Tortricinae and Chlidanotinae. —
F. Slamka, Bratislava, 247 S.
Nota lepid. 33 (2): 219-229 229
Razowski, J. 2003. Tortricidae (Lepidoptera) of Europe. Volume 2: Olethreutinae. — F. Slamka, Bratislava,
301 S.
Razowski, J. 2008. Tortricidae of the Palaearctic Region. Volume 1, Tortricini. — F. Slamka, Bratislava,
52 S.
Razowski, J. 2009. Tortricidae of the Palaearctic Region. Volume 2, Cochylini. — F. Slamka, Bratislava,
1958.
Rungs, Ch. E. E. 1979. Catalogue raisoné des Lépidoptères du Maroc. Tome I. — Travaux de l’Institut
Scientifique, Serie Zoologie, no. 39: | —222.
Speidel, W. & M. Hassler 1989. Die Schmetterlingsfauna der südlichen algerischen Sahara und ihrer Hoch-
gebirge Hoggar und Tassili n’Ajjer. — Nachrichten des entomologischen Vereins Apollo, Supplement
8: 1-156.
Spitzenberg, D. 2004. Nachweis des Mittelmeer-Nelkenwicklers Cacoecimorpha pronubana (Hübner,
1799) in Sachsen-Anhalt. — Entomologische Mitteilungen Sachsen-Anhalt 12 (1): 38-39.
Trematerra, P. 2003. Catalogo dei Lepidoptera Tortricidae della fauna italiana. — Bollettino di Zoologia
agraria e di Bachicoltura, Serie II, 35 (suppl. 1): 1-270.
230 Book review
Joop H. Kuchlein & Leo E. J. Bot 2010. Identification keys to the Microlepidoptera
of The Netherlands. — TINEA Foundation, Wageningen & KNNV Uitgevereij, Zeist.
ISBN 978 90 5011 341 0. 414 pp. Price 59.95 € (bilingual: Dutch & English).
Recently, two teams of lepidopterists independently from each other provided evidence that
‘Microlepidoptera’ do not form a natural community of descent, and that butterflies are deep-
ly nested within this artificial group, close to gelechioids (Regier et al. 2009; Mutanen et al.
2010). For practical reasons, the term ‘Microlepidoptera’ is still in use, because methods of
collecting and preparation are different for larger and smaller Lepidoptera and there is a need
for identification guides to those Lepidoptera which are not treated in the bulk of literature on
‘Macrolepidoptera’ in the traditional sense. The recently published book by Joop Kuchlein &
Leo Bot on the ‘Microlepidoptera’ from The Netherlands might thus be highly welcome.
The book is divided into an introduction, an illustrated glossary, a revised checklist of the
Dutch Microlepidoptera, a list of scientific and Dutch names of Microlepidoptera, the identifi-
cation keys (comprising 300 pages) and is completed with an index to the scientific names of
Lepidoptera. The inside pages of the book cover provide colour photos of a set moth of each
family of Microlepidoptera, which may help direct the reader to the correct family. Otherwise,
identification should start using the key to families which contains supporting black and white
drawings. At the family level, additional explanations are provided to the taxa and reference is
made to the key of species of the respective family. Here, it is a bit impractical that one needs
to check the page number in the contents at the beginning of the book to find the next key. For
larger families, the ‘key to species’ starts with a key to subfamilies and reference is made to the
next sub-key, but the page number has to be checked in the contents again. Beside this little in-
convenience, the keys are clear and quick to use. Once keyed to a particular species, additional
information is provided on wingspan, further morphological characters, and adult flight-time.
For a final check of identification, the authors refer to the colour photographs presented on the
website www.kleinevlinders.nl. On that site, the same identification keys are available and even
more comfortable to use.
I have checked the Pyraloidea in greater detail, which is treated by the authors as one fam-
ily Pyralidae. While it is still a matter of dispute whether to translate the basal dichotomy in
Pyraloidea into two families Crambidae and Pyralidae or not, other examples of systematics and
nomenclature used by Kuchlein & Bot are less acceptable. The use of ‘Pyraustinae’ in the sense
of Pyraustidae sensu Marion (1954) is rather outdated. This taxon contains the Acentropinae,
Evergestinae, Odontiinae, Pyraustinae, Schoenobiinae, Scopariinae and Spilomelinae. The lat-
ter taxon is not mentioned at all; together with Pyraustinae it forms the “Pyraustinae (narrow
sense)” sensu Kuchlein & Bot. Other examples are the use of Nymphulinae which have for
some time been synonymised with Acentropinae, Conobathra and Trachycera with Acrobasis
as well as Dipleurina and Witlesia with Eudonia. This makes the use of the book unnecessarily
confusing. The nomenclature could have been easily updated by using www.faunaeur.org or, in
case of the Pyraloidea, also by www.pyraloidea.org. The key to the family failed to mention for
the Pyraloidea two important characters which can easily be recognised using a magnification
lens or a stereomicroscope, without further preparation: the presence of scales at the base of
proboscis as well as the abdominal tympanal organ, of which the tympana can be recognised in
dried specimens. At species level, I wonder whether identification can rely on external charac-
ters only. It would make the investigation of genitalia obsolete, saving a lot of time. But things
are not that easy. Looking at Scoparia ambigualis and S. basistrigalis, two species which are
frequently mixed up in collections, the keys do not provide precise characters for their identi-
fication. I know small specimens of S. basistrigalis as well as S. ambigualis specimens with a
Nota lepid. 33 (2): 179-186 231
well chequered forewing fringe, making the key characters given by Kuchlein & Bot obsolete.
In contrast, an important character for S. basistrigalis, the black streak at the base of forewing,
which gives this species its name, is not mentioned at all. S. ambigualis has a distinct uniform
grey coloured base of forewing. Nevertheless, individual variation will require that, from time
to time, even the most experienced lepidopterist checks the genitalia for proper identification of
these two species, as it is the case for many Lepidoptera. This should at least have been men-
tioned in a book of this nature.
MATTHIAS Nuss
References
Marion, H. 1954. Révision des Pyraustidae de la faune française (suite). — Revue française de Lépido-
ptérologie 14: 181—188.
Regier, J. C., A. Zwick, M. P. Cummings, A. Y. Kawahara, S. Cho, S. Weller, A. Roe, J. Baixeras, J. W.
Brown, C. Parr, D. R. Davis, M. Epstein, W. Hallwachs, A. Hausmann, D. H. Janzen, I. J. Kitching,
M. A. Solis, S.-H. Yen, A. L. Bazinet & C. Mitter 2009. Toward reconstructing the evolution of ad-
vanced moths and butterflies (Lepidoptera: Ditrysia): an initial molecular study. - BMC Evolutionary
Biology 9: 280.
Mutanen, M.; N. Wahlberg & L. Kaila 2010. Comprehensive gene and taxon coverage elucidates radia-
tion patterns in moths and butterflies. — Proceedings of the Royal Society B: Biological Sciences 277:
2839-2848.
0
=
=
+
%
=.
ee
Aer ht ; ban il
Nota lepid. 33 (2): 233-248 233
Contribution to the knowledge of the genus Zygaena Fabricius,
1775, in Iran (Zygaenidae). Part IX: On two newly discovered
Mesembrynus taxa from the central and southern Zagros range
AXEL HOFMANN! & THOMAS KEIL?
! Verenenweg 4, 79206 Breisach-Hochstetten, Germany; [email protected]
? Wachwitzer Bergstr. 5b, 01326 Dresden, Germany; [email protected]
Abstract. Two new taxa of the genus Zygaena are described from the Iranian Zagros range: Zygaena mir-
zayansi sp. n. from the central part of the Zagros and Z. fredi valii ssp. n. from the mountainous regions in
the province Kerman. There are observations on the preimaginal biology of the two taxa. For Z. mirzayansi
sp. n., the full grown larva is known. It was found on Eryngium billardieri. Zygaena fredi valii ssp. n. feeds
on Bupleurum exaltatum (M. Bieb.) or a very close related Bupleurum. The larvae of Z. fredi syntopica,
Z. fredi escaleraiana and Z. mirzayansii are figured for the first time. The type-localities of Z. fredi escale-
raiana and Z. escalerai have been located more precisely. The types of Z. fredi, Z. fredi escaleraiana, Z.
fredi syntopica and Z. mirzayansi are figured.
Zusammenfassung. Aus dem iranischen Zagrosgebirge werden zwei neue Zygaenentaxa beschrieben:
Zygaena mirzayansi sp. n. aus dem zentralen Zagros und Z. fredi valii ssp. n. aus den Gebirgsregionen der
Provinz Kerman. Beobachtungen zur Präimginalbiologie beider Taxa sind sehr spärlich. Von Z. mirzayansi
sp. n. ist die erwachsene Raupe bekannt. Sie wurde auf Eryngium billardieri gefunden. Zygaena fredi valii
ssp. n. lebt an Bupleurum exaltatum (M. Bieb.) oder einer sehr verwandten Bupleurum Art. Erstmals werden
die Larven von Z. fredi syntopica, Z. fredi escaleraiana und Z. mirzayansi abgebildet. Die Typenlokalitat
von Z. fredi escaleraiana und Z. escalerai konnte präzisiert werden. Von Z. fredi, Z. fredi escaleraiana, Z.
fredi syntopica und Z. mirzayansi werden die Typen abgebildet.
Introduction
The phylogenetic relationships within the manlia-group are complicated. Revisions
were proposed by Naumann & Racheli (1978), Naumann & Tarmann (1983) and
Naumann & Tremewan (1984) but were never published. Although our knowledge of
the biology has increased because of recent, intensive fieldwork in Iran, the status of
many of the nominal taxa remains unclear. During the last decade, new taxa have been
described, including some whose systematic position and status remain unclear (e.g.
Z. ginnereissi Hofmann, 2000, Z. rubricollis shahkuhica Hofmann, 2005, Z. rubricol-
lis tenhageni Hofmann & Tremewan, 2003); others have been raised or reinstated to
species level (e. g. Z. nocturna Ebert, 1974, Z. aisha Naumann & Naumann, 1988,
Z. fredi Reiss, 1938), or transferred from one species to another (e. 8. Z. manlia kerma-
nensis Tremewan, 1974 to Z. rubricollis kermanensis, Z. manlia araxis Koch, 1936
to Z. araxis and later to Z. rubricollis araxis). Investigation of type-material as well
as new discoveries of localities where several sympatric species of the manlia-group
occur are of great importance in determining specific and infraspecific relationships.
Some confusion still exists. For example, at Shah-Kuh (Gorgan S.) it seems that, in
addition to Z. cacuminum Christoph, 1877 and Z. manlia Lederer, 1870, there are one
or two further species group taxa of the manlia-group occurring in this locality. One
has been described as Z. rubricollis shahkuhica Hofmann, 2005. Another population
discovered by T. Keil in the eastern Alborz close to the type-locality of Z. cacumi-
Nota lepidopterologica, 24.01.2011, ISSN 0342-7536
234 HOFMANN & KEIL: New Mesembrynus taxa from the Zagros Mountains
num is neither this taxon nor Z. manlia. It is at present unnamed and might belong to
“shahkuhica” although it is reasonably well differentiated, added to which we are still
unsure what the taxa “shahkuhica” and “manlia” really are.
In the vicinity of Semirom (Esfahan), there are biotopes where Z. fredi and Z. rubricol-
lis tenhageni are syntopic, thus directly confirming their heterospecificity. In the same
biotope a third species of the manlia-group was found in 2002, and later at other places
and provinces (Fars, Chaharmahal-va Bakhtiyari, Esfahan). Another taxon became
known to us from the province of Kerman. Several larvae were found on Bupleurum
exaltatum (M. Bieb.) or a very close related Bupleurum. Morphological characters,
host-plant association and its distribution provide arguments for conspecifity with
Z. fredi from the central Zagros range. Here we are describing these new taxa.
Abbreviations
CAHO Collection Axel Hofmann, Breisach-Hochstetten, Germany.
CTKD Collection Thomas Keil, Dresden, Germany.
HMIM Hayk Mirzayans Insect Museum, Tehran, Iran.
NRMS Naturhistoriska Riksmuseet, Stockholm, Sweden.
TLMF Tiroler Landesmuseum Ferdinandeum, Innsbruck, Austria.
ZFMK Zoologisches Forschungsmuseum A. Koenig, Bonn, Germany.
Zygaena fredi Reiss, 1938 Figs 1, 25, 41
“Zygaena (Peristygia) fredi n. spec.“ Reiss, H. 1938: 290, fig. d3. Type locality: “Iran, Fars, beim Fort Sine
Sefid an der Straße Chiraz-Kazeroun in etwa 2200 m Höhe“.
The original description was based on 10°, 19, on loan from Wilhelm Brandt and col-
lected by Fred Brandt on 29 May 1937; one further © was collected but was not avail-
able to Reiss, one © is figured (d3) in monochrome and is referred to as “Type”, 1.e.
holotype. While the original figure depicts this specimen with both antennae, both are
now lost and the position of the abdomen has changed as genitalia dissection had been
made (vide Fig. 1). The holotype 1s deposited in the NRMS. Taxonomically placed in
the cuvieri-group, the author compared Z. fredi with Z. cacuminum and Z. manlia.
During fieldwork undertaken in 2002 in the Gol Andaz valley near Deh Bakri (Kerman,
Bam W.), G. M. Tarmann and T. Keil found specimens that were not easily referable to
any other taxon. The association of these diurnal moths with a yellow-flowered, nar-
row-leaved Bupleurum sp. was readily apparent, as most of the individuals were found
close to these plants. The “new taxon” occurred in the biotope together with two further
Mesembrynus species (Z. aisha Naumann & Naumann, 1980, Z. ginnereissi Hofmann,
2000), while Z. chirazica Reiss, 1938 and Z. sengana Holik & Sheljuzhko, 1956, were
also observed there. On 10 May, T. Keil found a female depositing eggs on one of these
Bupleurum plants and a few weeks later (2.vi.2002) A. Kallies found several batches
of eggs that were deposited irregularly at the base of the stems inside these plants. The
same day the first larvae emerged and accepted only Bupleurum as a host-plant.
Based on these observations, specific investigations have been possible during sub-
sequent years to provide new data, especially on the distribution of this Bupleurum-
Nota lepid. 33 (2): 233-248 235
feeding species. Independently, A. Hofmann had already found a few specimens at
Shingara (Jiroft N.) the same year. There the moths showed the same association with
Bupleurum at a site where no Eryngium species were present. The same or a very simi-
lar Bupleurum species was noted in 2005 and 2009 at Kuh-e Garin (Prov. Hamadan), at
Kuh-e Bol (Eqlid vic.) and at Semirom (Prov. Esfahan); at the latter site, T. Keil found a
full-grown larva of Z. fredi syntopica under a stone directly beneath a Bupleurum plant
on 9.v.2005. Larvae from Semirom were reared in captivity (A. Hofmann, unpubl.)
through the diapause stage to LS on several Bupleurum species (B. falcatum, B. rotun-
difolium) None of the Eryngium species that was offered was accepted.
More than two dozen fully grown larvae (25.6.2009) and batches of eggs (8.7.2005)
were observed lower down on the stems of the Bup/eurum plants at Kuh-e Garin, (Prov.
Hamadan, Nahavand SW, Gardaneh-ye Gema Siab, 2,750—2,850 m) (A. Hofmann).
Two fully grown larvae were found on 17.6.2009 at Gardaneh-ye Cheri (Prov. Chahar-
mahal-va-Bakhtiyari, Zarde-Kuh-reg., Samsami vic., 3,100 m). Like on Kuh-e Garin;
they were sitting deep down in the wooden parts of thorny Astragalus bushes, amongst
which the larval host-plant was present and protected from grazing herbivores (A.
Hofmann).
Moreover, a population presumably belonging to Z. fredi (or a closely related taxon) was
recently discovered in the central Alborz (A. Hofmann, unpubl.). Here, on the south side
of the Kendevan pass, a female was noted nectaring at the white flowers of Cephalaria
microcephala next to a solitary plant of Bupleurum exaltatum (M. Bieb.); an intensive
search provided a single batch of 35 eggs that had been laid around a stem of the plant
(T. Kia-Hofmann, pers. obs.). Two further females were kept in boxes in which both
individuals deposited batches of eggs (n = 45), but only on the stems and flowers of
Bupleurum. After seven days the larvae emerged. As host-plants, only Bupleurum spe-
cies were accepted, the larvae initially showing a preference for the flowers.
There can be no doubt that a widely distributed species, or even a group of species, live
on Bupleurum spp. in the Irano-Afghan highlands, knowledge that has been overlooked
until recently. Very recent fieldwork in 2007 by A. Hofmann in central and eastern
Afghanistan confirms this observation. At Kuh-e Paghman (Prov. Kabul), in the vicin-
ity of Panjao (Prov. Bamiyan) and in the Panjshir valley (near Astanah), adults of Z.
rubricollis Hampson, 1900 were observed in biotopes where only a single species of
umbellifer was growing. In captivity, two females from Cheshmeh Gardaneh (Prov.
Panjshir, Astanah — Shava) laid eggs on the narrow leaves of an offered Bupleurum spe-
cies, behaviour that is identical to that observed in Iranian Bupleurum-feeder species
(Hofmann, 2009).
Zygaena fredi escaleraiana Holik, 1958 Figs 2, 26, 42
“Zygaena (Coelestis) seitzi escaleraiana n. ssp.” Holik, O. 1958: 68: 17. Type locality: Iran, ,,Haut-
Kharoum, Chindaar Vallée“.
The original description was based on 10°, 19 from the “Sammlung René Oberthiir, die
sich jetzt im Museum Alexander Koenig in Bonn befindet” (Holik, 1958).
236
HOFMANN & KEIL: New Mesembrynus taxa from the Zagros Mountains
Original der
Farbaufnahme
1959
LL
ven
det. O. Holik |
Genitaluntersuchung
C. Naumanp praep.
Praep. Nr. /02.4%
IRAN, Esfahan
Semirom vic., Kuh-e Behrouz
2650-2900 m, 11. -12. 6.2002
| [19/02]. A. HOFMANN, A.KALLIES,
C.NEUMANN, J.U. MEINEKE leg.
The author mentioned that both specimens, labelled “Perse, Escalera”, were collected
by de la Escalera on the same date and probably at the same site. Holik referred to
Poujade (1900) when re-describing Zygaena escalerai, specimens of which had the
Nota lepid. 33 (2): 233-248 237
same labels, and gave more detailed information in the locality: „Haut-Kharoum,
Chindaar Vallée“. He mentioned that all efforts to find the exact geographical location
for this locality had failed.
The © is cited as “Holotypus”, the 9 as “Allotypus”; both were collected “VII. 1899
(?)”. The citation on the label is erroneous: “escalarica” or “escalerica”.
Holik compared the specimens with Z. seitzi and stated that the only difference is in
the coloration of the forewings, which were red instead of yellow. He supposed thıs red
form to be the more ancestral one.
Originally described as a subspecies of Z. seitzi, the position of this taxon has remained
unclear, as the type specimen had never been figured. We found the original & speci-
men in coll. C. M. Naumann (now Museum Alexander Koenig, Bonn) where apparently
it was on loan for the major revision of the whole manlia-group. Although the specimen
is not in perfect condition, it is obvious to us that it belongs to the Bupleurum-feeding
group of species and the nominal taxon escaleraiana 1s here placed as a subspecies
of Z. fredi. Furthermore, we have succeeded in tracing the exact location of the hith-
erto doubtful type-locality. Hofmann & Tremewan (1996) inconsistently give: “Iran:
Khuzestan, upper reaches of the Karun River (‘?Haut-Kharoum, Chindaar vallée’)”
for Z. rubricollis escaleraiana and “Iran: Lorestan, upper reaches of the Karun River
(‘?Haut-Kharoum, Chindaar vallée’)” for Z. escalerai. In fact there is a village named
“Chendär” that is situated by the Kuhrang river, a primary tributary of the Karun River
in the province of Caharmahal-va-Bakhtiyari east of the Zarde-Kuh.
We define here the type-locality for Z. fredi escaleraiana and Z. escalerai as follows:
“Tran, Caharmahal-va-Bakhtiyari, Chelgerd SE., Chendar vic., Ab Kuhrang, [32°18'
BEN: 50°13’12E]”.
Based on phenotypic similarity to the holotype, we provisionally refer the geographi-
cally surrounding populations to this subspecies until more material 1s available:
Lorestan, Kuh-e Garin, Nahavand SW, 2400-2750 m
Lorestan, Osturan-Kuh, vic. Dorud, 3200 m
Esfahan, Khonsar, pass NW, 2800—2900 m
Esfahan, Khonsar S, Derre Bid, 2600—3000 m
Esfahan, Fereydun Shahr S, Kamaran valley, 2600—3000 m
Chaharmahal-va-Bakhtiyari, Zarde-Kuh-region, Samsami vic., 2900—3100 m.
Figs 1-12. Zygaena fredi. 1. Z. fredi fredi Reiss, 1938. Holotype, ©, (NRMS). 2. Z. fredi escaleraiana
Holik, 1958. Holotype, ©, (ZFMK). 3. Z. fredi syntopica Hofmann & Tremewan, 2003. Holotype, ©,
(CAHO). 4-12. Z. fredi vallii n. ssp., 4. Holotype, ©, (CAHO). 5. Paratype, ©, same data as holotype,
(CAHO). 6. Paratype, 9, same data as holotype, (CAHO). 7. Paratype, ©, “Iran, Kerman, Str. Jiroft-
Rayen, 10 km südl. Dalford, 2,400—2,500 m, 22.—23.5.2002, leg. P. Hofmann”, (CAHO). 8. Paratype,
©, “Iran, Kerman, Jiroft NW, Gardaneh Sarbishan, Shingara vic., 2,900—3,100 m, [07/02], 3.6.2002, A.
Hofmann leg.“, (CAHO). 9. Paratype, ©, „N-Iran, Prov. Kerman, 60 km N Jiroft, 1,950-3,250 m, 16.—
25.5.2005, leg. G. Betti, (CAHO), 10. Paratype, 9, „Iran, Kerman, Darb-e Behesht, 2,700-2,900 m,
20.-22.5.2001, leg. Ramos & Westphal“, (CAHO). 11. Paratype, ©, „Südiran, Kerman, Qorhud-Mts.,
25 km N Baft, Kefenu-Paß, 2,900 m, 4.6.1998, leg. Keil“, (CTKD). 12. Paratype, 9, „Südiran, Kerman,
Qorhud Mountains, 35 km W Baft, 2,150 m, 17.5.2001, leg. Thomas Keil“, (CTKD).
238 HOFMANN & KEIL: New Mesembrynus taxa from the Zagros Mountains
In 2004 and 2005, Zygaena fredi was found on the Gardaneh-ye Cheri, a pass in the
vicinity of Samsämı (Zarde-Kuh region), at a higher altitude of around 3,000 m, ca
18 km from the type-locality as the crow flies. Here Z. fredi is sympatric and partly
synchronous with Z. seitzi, thus confirming their heterospecificity, although gene flow
cannot be completely ruled out as T. Keil found a single specimen of Z. seitzi with
orange-red forewing spots. However, all other observed specimens (37 males, 14 fe-
males of Z. seitzi; 6 males, 6 females of Z. fredi) are clearly referable to one or the other
species. Zygaena fredi was observed at the end of its flight period (9-10 July 2005)
when the adults of Z. seitzi were in fresh condition. The two species are not precisely
syntopic, as their biotopes are separated by ca 500 m. While Z. seitzi flies 100 m higher
together with Z. cambysea and Z. bakhtiyari, in the biotope of Z. fredi only Z. chirazica
was noted. At this site several plants of a narrow-leaved Bupleurum sp. were present.
Zygaena seitzi from Samsami was reared ab ovo on Eryngium spp., as with all other
populations of this species. On 17.6.2009, A. Hofmann found fully grown larvae of
both species at this site, when the first specimens of Z. fredi were already flying. The
larvae of both syntopic species cannot be confused (figs 65, 71).
Both species also seem to be sympatric in the Shiraz region, as the original specimens
of Z. fredi were labelled “Fort Sine ...”. However, there are no recent records of Z. fredi
from that area since its discovery there by F. Brandt in 1938.
Zygaena fredi syntopica Hofmann & Tremewan, 2003 Figs 3, 27—28, 43—44, 57
Hofmann, A. & Tremewan, W. G. 2003: 19: 17, 20, figs 1—3. Type locality: “Iran: Esfahan, Semirom vic.,
Kuh-e Behrouz, 2650—2900 m.”.
Although other populations from the central Zagros range, e.g. from Gardaneh Meymand
(Boyer Ahmad-va Kohgiluyeh, 2,550—3,000 m), from Kuh-e Bol (Fars, Eqlid SSE,
2,700—3,000 m) and from Gardaneh Timur Gun (Fars, Eqlid W, 2,650—2,750 m), are
not so strongly darkened as typical Z. fredi syntopica from the vicinity of Semirom,
they are provisionally referred to this subspecies.
Zygaena fredi valii ssp. n. Figs 4-12, 29-31, 45-47, 58
Derivatio nominis: Shah Nematollah Vali (ca 1350-1452 A.D.), Grand Master of Sufism, buried in Ma-
han/Kerman.
Material. Holotype ©, 26 mm wingspan, “Iran, Prov. Kerman, Kuh-e Jabal Barez, ca. 5 km SSE
Deh Bakri, 2600-2700 m, E 57°56,961’ / N 29°00,147', 10.—11.v.2002 (DEHBA 6); leg. T. Keil & G.
M. Tarmann“, ex coll. G. Tarmann, in coll. A. Hofmann (to be deposited later in Staatliches Museum für
Naturkunde Karlsruhe). — Paratypes: 10°, 19, same data as holotype, coll. A. Hofmann; 89, 29, same
data as holotype, coll. TLMF; 70, 49, „Südiran, Kerman, Kuh-e Gebal Barez, 60 km SW Bam, Deh-
Bakri 2.500 m, 10.5.2002“, leg. et coll. T. Keil; 19, 19, ibidem, 5.v.2006, leg. et coll. Ch. & Th. Keil;
19, „Südiran, Kerman, Qohrud-Mts., 25 km N Baft, Kefenu-Paß 2.900 m, 4.6.1998“, leg. et coll. T. Keil;
19, „Südiran, Kerman, Qohrud-Mts. 35 km W Baft, 2.150 m, 17.5.2001“, leg. et coll. T. Keil; 19, „Iran :
Kerman, Jiroft (NW.), vic. Shingara Gardaneh Sarbishan, 2700-2900 m, 23.v.2004. Hossein Rajay [leg.]“,
Nota lepid. 33 (2): 233-248 239
coll. W. G. Tremewan; 10°, 19, same data as holotype, coll. HMIM in the Plant Pests & Diseases Research
Institute, Tehran, Iran; 10°, “C-Iran, Kerman, vic. Deh Bakri, 2500 m, 31.5.1994, leg. C. M. Naumann,
Coll.-Nr. 2289”, coll. A. Hofmann; 10°, 19, “Südiran, Kerman, Kuh-e Gebal Barez, 60 km SW Bam,
Deh Bakri, 2500 m, 10.5.2002, leg. Keil“, coll. A. Hofmann; 19, “Iran, Kerman, Dehbakri, Gol Andaz,
2700-3000 m, 25.5.2004, A. Hofmann & T. Keil leg.“ coll. A. Hofmann; 30°, 19, “Iran, Kerman, Jiroft
NW, Gardaneh Sarbishan, Shingara vic., 2900-3100 m, [07/02], 3.6. 2002, A. Hofmann leg.” coll. A.
Hofmann; 19, “Iran, Kerman, Jiroft NW, Gardaneh Sarbishan, Shingara vic., 2600-2800 m, [08/04],
26.5.2004, A. Hofmann & J.U. Meineke leg.” coll. A. Hofmann; 10°, “Siidiran, Kerman, Deh Bakri Mt., 55
km NNW Jiroft, Derba, 2800 m, 6.5.2006”, leg. et coll. Ch. & Th. Keil; 49, “Iran, Prov. Kerman, Str. Jiroft
— Rayen, 60 km nördl. Jiroft, 2400 m, 23.5.2002, M. Dietz leg.”, coll. A. Hofmann; 19, “Iran, Kerman, Str.
Jiroft — Rayen, 10 km südl. Dalford, 2400-2500 m, 2.- 23.5.2002, leg. P. Hofmann”, coll. A. Hofmann;
19, “Iran, Kerman, Darb-e Behesht, 2700-2900 m, 20.—22. 5. 2001, leg. Ramos & Westphal”, coll.
A. Hofmann; 20, 19, “Iran, prov. Kerman, 60 km N. Jiroft, 16/25-5-05, 2950-3250 m, Collection [leg.]
G. Betti, coll. A. Hofmann”; 30°, 29, “Iran: Qohrud Mts., Sarbijan, 2700-2900 m, 29°05’ N, 57°33’ E,
04.—06.06.2005, leg. Jiri Klir”, coll. J. Klir/Litomerice; 10, 39, „Iran, Sarbijan, 2700-2900 m, 04.06.
2005, let. Bures V., N 25 05 00 E 57 32 37”, coll. A. Hofmann.
Diagnosis. Of medium size (9 25-27 mm, 9 25-28 mm). Head and antenna black,
thorax black with double red patagia, abdomen black with a red cingulum present on
one segment, closed on the underside, always present in both sexes, extremities black.
Forewing ground colour black with slight greenish sheen, coloration of spots warm
red. Basal blotch formed by confluence of spots 1+2+2a; spot 2 prominent, spots 1
and 2a small, longitudinal, each forming a streak; spot 2a reaching the dorsum of wing,
while a black streak along the costa is located above spot 1; spot 3 small, triangular
(occasionally rounded), never connected to subquadrate, well-developed spot 4. Spot
5 in size between that of spots 4 and 3, oval or rounded-subquadrate, isolated, occa-
sionally connected to spot 6 in the area crossed by the medial veins. Spot 6 elongate,
always reduced in its upper part. Hindwing warm red, slightly translucent, especially
in the discal area. Black border pronounced from apex to the anal field and significant-
ly developed as a tooth near tornus, the tooth extending towards the translucent field
(this character is less significant in specimens from further west (Shingara and Darb-e
Behesht). Easily distinguished from all other populations of Z. fredi by the remarkable
tooth on the hindwing and the always reduced spot 6 in its upper part.
Male genitalia (n = 3). Uncus processes very short, triangular (Figs 29-31),
lamina dorsalis with 4 “Hauptdorne” present on each side (figs 45—47); these charac-
ters agree well with the genitalia of the male specimen of Z. fredi from Estabanat fig-
ured by Görgner & Hofmann (1982: 51, figs 7.1—7.4). The uncus of Z. fredi syntopica
is of the same shape, although it appears to be slightly longer; the “Hauptdorne” on the
lamina dorsalis are less pronounced.
Female genitalia (n=2; Fig. 58). Ostium bursae weakly sclerotized as in other
Irano-Afghan Mesembrynus species. “Schildchen” very characteristic, crescent-shaped,
more weakly developed than in Zygaena mirzayansi sp. n. (Fig. 61).
Distribution. Zygaena fredi valii ssp. n. is restricted to the province of Kerman where
specimens have been found by several lepidopterists in at least five localities on the
south side of the Kuh-e Hezar, between Darbmarzar and Deh Bakri. No records are
available from the north side of the high mountains such as Kuh-e Hezar and Kuh-e
Lallezar.
240 HOFMANN & KEIL: New Mesembrynus taxa from the Zagros Mountains
Paratype
ena -manka Ki.
Le
Original der
Farbaufnahme
1959 °
jrs Fa
| Zygaena
Manlia b dutschcr
Prep : 24,6. ‘ : I “ss nor Co ,
det. Thomas Kell | _ Aype specimen /
- oes lec fohy pe J”
le in Dreslan, /
AND, col Koch, ;
N°:
i Zygaene (ubannus
1 Masembrynys Dh.)
Manths ssp.
belutschishani ‘Koh.
coli. Naumann)
Zygoens (Subgenus AN Eh re
Mesembrynus Hb.) À PGM der. P3
| Manlıa ssp.
j
hetghishani Koh, |
IE Non det,, 19?
Nota lepid. 33 (2): 233-248 241
Bionomics. In the Gol Andaz valley (Deh Bakri vic.), at an altitude of around 2,800 m,
the first moths were already flying on 10 May 2002. The latest recorded date is 4 June
(Sarbishan, 2,900 m), indicating a flight period from the end of the first week of May to
the beginning of June. This is extraordinarily early, as all localities are situated at high
altitudes between 2,600 and 3,250 m. In the nearer vicinity of Deh Bakri, at around
2,000 m, where Z. chirazica and Z. ginnereissi are found from mid May, no specimens
of Z. fredi valii ssp. n. were ever observed.
We have received a detailed description of this locality from our colleague G. M.
Tarmann/Innsbruck: “The slopes contain strongly changing rocks of volcanic origin;
they consist partly of dark, black, bluish or reddish porphyrites or volcanic ash, partly
of almost white granite. In the gravel of the riverbed, even Palaeozoic chalks are nota-
ble. Here the vegetation is dominated by Artemisia sp. and small bushes of Prunus spp.
Higher up, Prangos also occurs. The slopes are dominated by Artemisia sp., cushions
of different Astragalus spp., Acantholimon sp., Polygonum spinosa and Prunus spp.;
moreover, several small Acer trees are present.” Several larvae of Z. fredi valii were
found on Bupleurum exaltatum (M. Bieb.) or a very close related Bupleurum.
Taxonomic remarks. As the Bupleurum-feeding group was only recently recognised
as a distinct species-group, further taxonomic changes are to be expected when more
detailed and comparable information on the biology and distribution of several nominal
taxa becomes available. For the moment it would be speculative to postulate how many
nominal taxa and biospecies are involved in this species complex. Morphological and
phenotypic similarities with Z. fredi from Estabanat, with its type-specimens from the
vicinity of Shiraz, and with specimens described as Z. fredi syntopica suggest a taxo-
nomic placement of va/ii as an infraspecific taxon of Z. fredi although this cannot be
properly supported by some diagnostic characters such as the extraordinary “hind-wing
tooth”.
Investigating species boundaries and biotopes are of special interest as the syntopic
occurrence of two or more taxa provides confirmation of their heterospecificity. From
the province of Esfahan (vicinity of Semirom), the nominal taxa Z. rubricollis ten-
hageni Hofmann & Tremewan, 2003 and Z. fredi syntopica Hofmann & Tremewan,
Figs 13-18. Zygaena mirzayansi sp. n., 13. Holotype, 9, (CTKD), 14. Paratype. ©, “Iran, Esfahan, Semi-
rom vic., Kuh-e Behrouz, 2,700 m, 31.5.2004, leg. Thomas Keil”, (CTKD). 15. Paratype, ©, “Iran, Esfa-
han, Semirom vic., Kuh-e Behrouz, Paß, 2,800-2,900 m, 2.6.2004, A. Hofmann, J.U. Meineke leg.”,
(CAHO). 16. Paratype, 9, “Iran, Bakhtiyari, 25 km E. Shar-e Kord, Sefid Dasht NW, 2,500 m, 30.5.2006,
leg. Thomas Keil”, (CTKD), 17. Paratype, 9, “Iran, Esfahan, Fereydun Shahr S, Sibak SE, Kuh-e Sibak,
2,550-2,700 m, [31/02], 17. u. 18.6.2002, [A. Hofmann, A. Kallies], J.U. Meineke leg.”, (CAHO). 18.
Paratype, 9, “C-Iran, Prov. Esfahan, Suriyan [Bavanat] SW, Madane Shayan Fenjan, 2,800 m, 8.7.2005, leg.
A. Karbalaye”, (CAHO). 19-21. Z. ?manlia taftanica Reiss, 1960. 19. Holotype, ©, “Iran, Baloutchistan,
Kouh 1 Taftan (Khach), 3,500 m, 28.6.1938, coll. Brandt”, (NRMS), 20. Paratype, ©, same data as holo-
type, (NRMS), 21. Paratype, 9, (labelled allotype), “Iran, Baloutchistan, Kouh i Taftan (Khach), 3,000 m,
Juni 1938, coll. Brandt”, (NRMS). 22-23. Z. manlia belutschistani Koch, 1941. 22. Paratype (non
holotype!), ©, “Iran, Baloutchistan, Kouh i Taftan (Khach), 2500 m, 15.5.1938, coll. Brandt”, (NRMS),
23. Paratype, 9, (labelled allotype), same data, (NRMS). 24. Z. ?manlia ssp. ?, “Iran, Elbursgebirge, Nissa,
2,500 m, 28.7.1936, coll Brandt”, (NRMS).
242 HOFMANN & KEIL: New Mesembrynus taxa from the Zagros Mountains
2003 were described, their type-localities (biotopes) being on the same mountain slope.
Ecologically, they are only slightly separated by their different phenologies. While the
adults of Z. seitzi tenhageni occur together with Z. haematina from the beginning to
the middle of June and can even be observed until the first week of July, Z. fredi syn-
topica flies together with Z. chirazica, both species occurring earlier and are at the
end of their flight period when Z. seitzi tenhageni and Z. haematina begin to emerge.
Surprisingly, in 2002 a further biospecies of this complex was discovered at the same
locality by Thomas Keil. Investigations at home and comparisons with all other species
have shown that this new species is related to the other two syntopic Mesembrynus-
species and it is described below.
Etymology. Shah Nematollah Vali (ca 1350-1452 A.D.), Grand Master of Sufism,
buried in Mahan/Kerman.
Zygaena mirzayansi sp. n. Figs 13-18, 37, 53, 61
Material. Holotype ©, 27 mm wingspan, “Iran, Esfahan, Semirom vic., Kuh-e Behrouz, 2.700 m,
30.5.2002, leg. Thomas Keil”, coll. T. Keil (to be deposited later in Staatliches Museum fiir Tierkunde
Dresden). — Paratypes: 40°, 19, same data as holotype, coll. T. Keil, 19, 19, same data as holotype, coll.
A. Hofmann; 50, 49, ibidem, 31.5.2004, leg. et coll. T. Keil; 1¢,“Iran, Semirom vic., Kuh-e Behrouz,
2.700 m, 2.6.2007, leg. et coll. Thomas Keil; 19, ibidem, 2.6.2007 e.l., leg., cult. et coll. Thomas Keil;
119, 79, “Iran, Esfahan, Semirom vic., Kuh-e Behrouz, 2800-2900 m, [14/04], 1.—2.6. 2004, leg. A.
Hofmann & J.-U. Meineke’, coll. A. Hofmann; 10°, 19, same data, coll. Hayk Mirzayans Insect Museum,
Plant Pests & Diseases Research Institute, Tehran, Iran; 19 “Iran: Esfahan, vic. Semirom, Kuh-e Behrouz,
2650 m. 1.v1.2004. W. G. Tremewan.“ leg. et coll. W. G. Tremewan; 10, ibidem, 2.vi.2004, leg. et
coll. W. G. Tremewan; 10°, 19 (copula), “Iran: Esfahan, vic. Semirom, Kuh-e Behrouz (pass), 2900 m.
2.v1.2004. W. G. Tremewan.” leg. et coll. W. G. Tremewan; 19, “Iran, Esfahan, Fereydun Shahr S, Sibak
SE, Kuh-e Sibak, 2550-2700 m, 18.6.2002, A. Hofmann, A. Kallies & J.-U. Meineke“, coll. A. Hofmann;
19, 19, “C-Iran, Prov. Esfahan, Suriyan (Bavanat) SW, Madane Shayan Fenjan, 2800 m, 8.7.2005, leg.
A. Karbalaye”, coll. A. Hofmann; 29, “C-Iran, Prov. Esfahan, Suriyan (Bavanat) SW, Madane Shayan
Fenjan, 3100 m, 21.7.2005, leg. A. Karbalaye”, coll. A. Hofmann; 10°, “Iran, Bakhtiyari, 25 km E Shahr-e
Kord, Sefid Dasht NW, 2500 m, 30.5.2006, leg. Thomas Keil”, coll. T. Keil; 19, ibidem, 31.5.2007, leg.
et coll. T. Keil.
Diagnosis. Species of medium size (S 25-28 mm, Q 25-30 mm). Head and antenna
black, antennae short, especially in females. Thorax black with double red patagia,
abdomen black with a red cingulum present on one segment, closed on the underside,
always present in both sexes, extremities black; abdomen and thorax in males notice-
ably hairy, in fresh moths reminding one of Z. exu/ans. Forewing ground colour black,
without sheen, coloration of spots warm red, spots 1+2+2a confluent, forming a blotch
but never reaching the dorsum of wing where a black streak is always present; spot 3
small, triangular, always connected to subquadrate spot 4, without any tendency of
separation. Spot 5 variable, rounded, mostly isolated, occasionally connected to spot
6 in the area of the medial vein. Spot 6 elongate. Hindwing warm red, a black border
pronounced at apex and as a double tooth near tornus, which occasionally extends into
the discal area when there is a tendency to divide the red field by a black streak that is
also visible on the underside.
Nota lepid. 33 (2): 233-248 243
Male Genitalia (n=5). Uncus processes short, broad basally, triangular (Fig. 37),
lamina dorsalis narrower basally, distally extending with 5-6 “Hauptdorne” present
on each side; distal spines protruding beyond distal end of lamina dorsalis (Fig. 53).
Compared with the other two syntopic Mesembrynus species, the processes of the un-
cus are more triangular in Z. mirzayansi sp. n. In the lamina dorsalis of Z. fredi and
Z. seitzi tenhageni, the main spines are less significant and the basal part of the lamina
is broader basally.
Female Genitalia (n=1; Fig. 61). Ostium bursae weakly sclerotized, “Schild-
chen” well developed, triangular.
Bionomics. In the vicinity of Semirom the new species was found at two separate,
not very steep, east to south-east facing slopes about 2—3 km from each other. In both
localities, Z. mirzayansi sp. n. inhabits weakly grazed, comparatively mesophilous bi-
otopes that are relatively rich in herbs mixed with high grasses. Only a single male was
found at the adjacent, very steep boulder scree , where Z. chirazica, Z. haematina and
Z. fredi syntopica are common.
At the type-locality, moths were observed from 30 May—2 June and were flying syn-
chronously with Z. rosinae, while the other syntopic species begin to fly during the
second half of the flight period of Z. mirzayansi sp. n. It is remarkable that all three
biotopes are located at an altitude of over 2600 m. Therefore, the flight period seems
to be relatively early in the season. This may be one reason why this new species was
not discovered before.
During several days at the beginning of June 2004, copulae were observed relatively
early, between 12.00 h and 13.00 h local time, some of the copulae being accompanied
by a second male. Not a single un-copulated female was observed, thus indicating that
this is the normal mating time of Z. mirzayansi sp. n. No moths were observed nectar-
ing.
In spite of intensive fieldwork that was undertaken from 2002 to 2009 in order to find
larvae or cocoons, our knowledge of the preimaginal stages of Z. mirzayansi sp. n.
remains poor. From several larvae, all of which were referred to Z. seitzi tenhageni
in the field, one 9 of Z. mirzayansi sp. n. emerged (e.p.: 10.7.2007, cult. T. Keil). The
fully grown larva was found on the underside of an Eryngium leaf. It is very similar in
coloration to that of Z. seitzi tenhageni. However, there is a good character for separat-
ing it from Z. seitzi tenhageni, viz. the black setae that are shorter and are present on all
segments (Figs 66, 67).
Systematic position. As long as no molecular investigations have been undertaken for
comparison with the phylogenetic tree published by Niehuis et al. (2007), no satisfac-
tory decision can be made on the systematic position of Z. mirzayansi sp. n. except that
it belongs in the subgenus Mesembrynus and that it might be closely related to some of
the species that were formerly placed under Z. rubricollis.
Moreover, detailed data on the preimaginal biology and confirmation of the larval host-
plant are urgently needed. The fact that Z. mirzayansi sp. n. is syntopic with Z. fredi
syntopica and Z. seitzi tenhageni shows that conspecificity of Z. mirzayansi sp. n. with
either of these two taxa is not possible. Without this evidence, which was obtained
directly during fieldwork, one would hesitate to separate it as a distinct species in spite
: New Mesembrynus taxa from the Zagros Mountains
HOFMANN & KEIL
244
Nota lepid. 33 (2): 233-248 245
Figs 57-61. Female genitalia. 57. Zygaena fredi syntopica Hofmann & Tremewan, 2003, Semirom, Kuh-e
Behrouz 2,700 m, 31.v.2004, leg. Keil, GU 507, CTKD. 58. Z. fredi valii n. subsp., Deh Bakri 2,500 m,
10.v.2002, leg. Keil, GU 508, CTKD. 59. Z. rubricollis tenhageni Hofmann & Tremewan, 2003, Semirom,
Kuh-e Behrouz 2,700 m, e.l. 8.v.2005, leg. Keil, GU 506, CTKD. 60. Z. manlia kermanensis Tremewan,
1975, 25 km N Baft, Gardaneh-ye Kefenu 2,900 m, 4.v1.1998, leg. Keil, GU 510, CTKD. 61. Z. mirzayansi
sp. n., Semirom, Kuh-e Behrouz 2,700 m, 31.v.2004, leg. Keil, GU 509, CTKD. (photos T. Keil)
of some of the extraordinary phenotypic characters : the strongly haired thorax and
abdomen, the connection of the black ground colour dorsad of spot 2a to the thorax and
the strange double tooth of the hindwings underline the isolated position of this new
species.
Distribution. In the same year when T. Keil found the first specimens at Semirom,
J.-U. Meineke collected a single female near the village of Sibak, south of Fereydun
Shahr. Here Z. mirzayansi sp. n. 1s syntopic with other Mesembrynus species (Z. man-
Figs 25-56. Male genitalia. 25—40. Uncus-tegumen complex, 41-56. Lamina dorsalis. 25, 41. Zygaena
fredi Reiss, 1938, holotype, (data see Fig. 1). 26, 42. Z. fredi ad escaleraiana Holik, 1958, 20 km NW
Damaneh, Kuh-e Dere Bid, Godar Chonsar 2,660 m, 14.v1.2000, leg. Keil, GU 442, CTKD. 27, 43. Z. fredi
ad syntopica Hofmann & Tremewan, 2003, Kuh-e Dinar, 5 km S Meimand 2,400 m, 6.vi.1999, leg. Keil,
GU 445, CTKD. 28, 44. Z. fredi syntopica, Semirom, Kuh-e Behrouz 2,700 m, 17.v1.2003, leg. Keil, GU
451, CTKD. 29, 45. Z. fredi valii n. subsp., Deh Bakri 2,500 m, 10.v.2002, leg. Keil, GU 440, CTKD.
30, 46. Z. fredi valii n. subsp., 40 km N Baft 2,600 m, 18.v.2001, leg. Keil, GU 450, CTKD. 31, 47. Z.
fredi valii n. subsp., 35 km W Baft 2,150 m, 17.v.2001, leg. Keil, GU 449, CTKD. 32, 48. Z. manlia ker-
manensis Tremewan, 1975, 20 km SE Surmaq 2,150m, 24.iv.2001, leg. Klir, GU 447, CTKD. 33, 49. Z.
manlia kermanensis Tremewan, 1975, 20 km E Neyriz, Chasanabad 2,000m, 15.v.2001, leg. Keil, GU 448,
CTKD. 34, 50. Z. manlia askarii Tremewan, 1975, GU 446 (T. Keil): Qaderabad-Paß, 2,200 m, 14.v.2001,
leg. Keil, CTKD. 35, 51. Z. ginnereissi Hofmann, 2003, Deh Bakri 2,500 m, 10.v.2002, leg. Keil, GU 444,
CTKD. 36, 52. Z. rubricollis tenhageni Hofmann & Tremewan, 2003, Semirom, Kuh-e Behrouz 2,700 m,
e.l. 18.v.2002, leg. Keil, GU 441, CTKD. 37, 53. Z. mirzayansi sp. n., Semirom, Kuh-e Behrouz 2,700 m,
30.v.2002, leg. Keil, GU 439, CTKD. 38, 54. Z. ?manlia taftanica Reiss, 1960 (data see Fig. 19). 39, 55. Z.
?manlia taftanica Reiss, 1960 (data see Fig. 20). 40, 56. Z. manlia belutschistani Koch, 1941 (data see Fig.
22). (photos T. Keil)
HOFMANN & KEIL: New Mesembrynus taxa from the Zagros Mountains
io,
Nota lepid. 33 (2): 233-248 247
lia, Z. tamara, Z. cambysea). In 2005, A. Karbalaye and a colleague from Esfahan
collected a small series of the new species in the vicinity of Suriyan, thus confirming
that the species has a wider distribution in the central Zagros range. One further record
was made in 2006 when T. Keil found the new species near Shahr-e Kord, where it flies
together with Z. rosinae, Z. tamara and other Zygaena species. It can therefore be as-
sumed that this early-flying species will be found in further localities within this area
and new records are also expected further north and south-east in the Zagros range.
Etymology. Dedicated to the Iranian entomologist Hayk Mirzayans (1920-1999) who,
in 1945, founded the Insect Museum at Evin/Tehran.
Acknowledgements
We thank our colleagues Dr Axel Kallies, Dr Jörg-Uwe Meineke, Mr Bernard Mollet, Dr Hannes Rietzsch,
Professor Dr Gerhard M. Tarmann and Dr W. Gerald Tremewan for their help and companionship during
our fieldwork in Iran. G. M. Tarmann and W. G. Tremewan discussed the present paper with us and once
more the latter improved the English manuscript. Thanks also to Dr Wolfgang ten Hagen for providing us
with information on the interesting localities near Semirom and Borujen. Messrs Georges Betti, Manfred
Dietz, Jiri Klir, Peter Hofmann, Ahmad Karbalaye (Tehran, Iran) and Alireza Naderi (Karaj, Iran) gen-
erously provided invaluable information on localities, together with collected material. We also thank
our friends, field guides and drivers in Iran: Messrs Amir Hanafi, Mohammad Dawarnejad, Gholamreza
Shadadian, Hamid Mohareri and Reza Shirazi. Moreover, we thank our helpful colleagues from the
Department of Biology (University of Tehran): Professor Dr H. Sepehri and her colleagues Dr Alireza Sari
and Professor Dr Hossein Akhani; Dr Ebrahim Ebrahimi and Ms Helen Alipanah (Plant Pests & Diseases
Research Institute, Tehran). The host-plants mentioned in this paper were kindly determined by Professor
Dr H. Akhani. Last but not least we thank our respective wives Tabassom and Christine for understanding
our time-consuming passion and for their support.
Figs 62-71. Preimaginal stages of Zygaena fredi, Z. mirzayansi and closely related species. 62-67. Fully
grown larvae. 62. Z. ginnereissi (Iran, prov. Kerman, Jiroft NNW, Shingera vic., Gardanye Sarbishan,
2,600—2,800 m, e.o., iv.2005, leg. et cult. A. Hofmann). 63. Z. fredi syntopica (Iran, prov. Esfahan, Se-
mirom, vic. Kuh-e Behrouz, 2,800 m, 9.v.2005, leg. et cult. T. Keil). 64. Z. fredi escaleraiana (Iran, Prov.
Lorestan, Dorud 22 km E, Darb Astaneh / Saravand E: “Kuh-e 66”, 3,200—3,250 m, 24.v1.2009, leg.
et cult. A. Hofmann). 65. Z. fredi escaleraiana (Iran, prov. Chaharmahal-va-Bakhtiyari, Zarde-Kuh-reg.,
Samsami vic., Gardaneh-ye Cheri, 2,800—2,950 m, 17.v1.2009, leg. et cult. A. Hofmann). 66. Z. mirzayan-
si (Iran, prov. Esfahan, Semirom, Kuh-e Behrouz 2,700 m, 2.v1.2007, leg. T. Keil). 67. Z. seitzi tenhageni
(Iran, prov. Prov. Esfahan, Semirom vic., Kuh-e Behrouz, 2,800 m, e.o., iv.2005, leg. et cult. A. Hofmann).
68—70. Batches of eggs. 68. Z. fredi syntopica deposited on Bupleurum exaltatum (Iran, prov. Esfahan,
Semirom, Kuh-e Behrouz 2,700 m, 9.v.2005, leg. T. Keil). 69. Z. fredi valii (same data as in Fig. 63).
70. Z. fredi syntopica (Iran, prov. Fars, Eqlid SSE, Kuh-e Bol, Darre Zard Ab, 2,750 -2,900 m, 12.vi.2009,
leg. et cult. A. Hofmann). 71. Fully grown larva of Z. seitzi syntopic with Z. fredi (Fig. 65) hidden in a
gap between stones (Iran, prov. Chaharmahal-va-Bakhtiyari, Zarde-Kuh-reg., Samsami vic., Gardaneh-ye
Cheri, 3,000-3,100 m, 17.vi.2009, leg. et cult. A. Hofmann).
248 HOFMANN & KEIL: New Mesembrynus taxa from the Zagros Mountains
References
Alberti, B. 1958-1959. Über den stammesgeschichtlichen Aufbau der Gattung Zygaena F. und ihrer Vor-
stufen (Insecta, Lepidoptera). — Mitteilungen aus dem Zoologischen Museum in Berlin 34: 245-396,
pls 1-32 (1958); 35: 203 —242, pls 33-64 (1959).
Görgner, E. & Hofmann, A. 1982. Eine neue Zygaenenart für die Türkei (Lepidoptera; Zygaenidae, Zy-
gaena Fabricius, 1775, Subgenus Mesembrynus Hübner, [1819]). -Entomofauna 3: 33—54, figs 1-7.
Hofmann, A. 2000. Contribution to the knowledge of the genus Zygaena Fabricius, 1775 in Iran (Lepi-
doptera, Zygaenidae). Part I: Introduction, systematic part: Zygaena (Mesembrynus) seitzi, Z. ?seitzi
nocturna, Z. manlia. — Linneana Belgica, Wetteren 17: 171-196.
Hofmann, A. 2009. Zur Präimaginalbiologie afghanischer Rotwidderchen-Arten: Zygaena rubricollis
Hampson, 1900 (Lepidoptera: Zygaenidae). — Entomologische Zeitschrift, Stuttgart 119 (4) 2009:
161-166.
Hofmann, A. & Kia-Hofmann, T. 2008. Contribution to the knowledge of the genus Zygaena Fabricius,
1775 in Iran (Lepidoptera, Zygaenidae). Part VIII: Bionomics of high-mountain species in the Alborz
Mountains and adjacent areas (introduction; Z. speciosa, Z. cacuminum). — Nota lepidopterologica 31
(1922532.
Hofmann, A. & Tremewan, W. G. 1996. A Systematic Catalogue of the Zygaeninae (Lepidoptera: Zygae-
nidae). — Harley Books, Colchester, Essex, England, 251 pp.
Hofmann, A. & Tremewan, W. G. 2001. Contribution to the knowledge of the genus Zygaena Fabricius,
1775, in Iran (Lepidoptera, Zygaenidae). Part V: Zygaena tamara. — Linneana Belgica, Wetteren 18:
125-136.
Hofmann, A. & Tremewan, W. G. 2003. Contribution to the knowledge of the genus Zygaena Fabricius,
1775, in Iran (Lepidoptera, Zygaenidae). Part VI: Zygaena nocturna, Z. aisha, Z. rubricollis and Z. fre-
di (addenda based on results of fieldwork in 2001 and 2002). — Linneana Belgica, Wetteren 19: 9-20.
Holik, O. 1958. Zygaena (Coelestis) seitzi escaleraiana n. ssp. — Entomologische Zeitschrift 68: 17.
Keil, Th. 2003. New data on the biology of Zygaena (Agrumenia) rosinae Korb, 1903 and Z. (A.) sengana
Holik & Sheljuzhko, 1956 stat. rev. in south Iran (Lepidoptera: Zygaenidae, Zygaeninae). — Abstracts
of the VIII International Symposium on Zygaenidae, Dresden — Germany, 10—14 September 2003:
29-30.
Keil, Th. 2003. Attend for a new classification of the taxa around Zygaena rubricollis Hampson, 1900
(Lepidoptera: Zygaenidae, Zygaeninae). — Abstracts of the VIII International Symposium on Zygae-
nidae, Dresden — Germany, 10-4 September 2003: 31-32.
Reiss, H. 1938. Die Zygaenen der Umgebung von Chiraz (Provinz Fars) in Südiran. — Entomologische
Rundschau, Stuttgart 55: 249-254, 290-292, 310-314.
Tremewan, W. G. 1979. On Zygaena Fabricius (Lepidoptera: Zygaenidae) from Iran. — Entomologist’s
Gazette, Brightwood 30: 249-256.
Tremewan, W. G. 2002. The Genetics of Burnet Moths, Zygaena Fabricius, 1775 (Insecta: Lepidoptera,
Zygaenidae, Zygaeninae). Unpublished Ph.D. thesis, University of Aberdeen. xiii + 381 pp.
Nota lepid. 33 (2): 249-251 249
Lithostege stadiei sp.n. from North Iran
(Geometridae: Larentiinae)
LUTZ LEHMANN
Friedrich-List-Str. 41, 15890 Eisenhüttenstadt, Germany; [email protected]
Abstract. Lithostege stadiei sp. n. is described from North Iran and compared with Lithostege buxtoni
Prout, 1920. A list of Iranian Lithostege species is provided.
Zusammenfassung. Lithostege stadiei sp. n. aus dem Nordiran wird beschrieben und mit Lithostege buxtoni
Prout, 1920 verglichen. Die bisher aus dem Iran bekannten Lithostege-Arten werden aufgelistet.
Introduction
Members of the genus Lithostege Hiibner, 1825 are distributed throughout the Holarctic
region. They prefer steppe-like to arid habitats and are especially species rich in the
Middle East from Turkey to western Central Asia. Adults often fly in early spring,
sometimes even in the winter months. The species included in the genus are prob-
ably not monophyletic, and the genus still awaits a thorough revision considering the
whole Holarctic fauna and including DNA analysis. Our knowledge of the Asian spe-
cies is still incomplete and new species have been described in the last two decades,
even from Europe (L. clarae Gaston & Redondo, 2004, from Spain) or were recorded
as new for Europe (Hausmann & Seguna 2005). Twelve species have been recorded
from Iran so far: L. amoenata Christoph, 1885, L. dissocyma Prout, 1938 (recently
reported by Lehmann et al. 2009), L. coassata (Hübner, 1817), L. griseata (Denis &
Schiffermiiller, 1775), L. palaestinensis Amsel, 1935, L. fissurata Mabille, 1888, L. no-
tata Bang-Haas, 1906, L. luminosata Christoph, 1885, L. flavicornata (Zeller, 1847), L.
odessaria Boisduval, 1848, L. witzenmanni Standfuss, 1892 and L. buxtoni Prout, 1920
(according to literature and material in the Hayk Mirzayans Insect Museum (HMIM)
of the Iranian Research Institute of Plant Protection in Tehran (IRIPP, formerly PPDRI)
examined by Hossein Rajaeı and the author). A new, characteristic species of Lithostege
found by two of the numerous Hungarian lepidopterological expeditions to Iran will be
described below.
Lithostege stadiei sp. n. Figs 1-3, 5
Material. Holotype, ©: “Iran, Prov. Zangan | 20 km NE of Zangan, 2220 m | 36°42’'N; 48°45’E, 25.X.
2000 | leg. B. Benedek & Gy. Fabian | col. György Fabian / Hungary”, “Holotype © | Lithostege stadiei
Lehmann”, “L: Lehmann Gen. Prep. Nr. | 10/2008”, in coll. L. Lehmann, will be deposited in ZMHB
(Berlin). — Paratypes: 10°, same data as holotype, coll. L. Lehmann, Eisenhüttenstadt; 30°, same data as
holotype, ©, same data, but 26.x.2000, all coll. N. Pöll, Bad Ischl, Austria; 1 ©, Iran, Mts. Sendan | Prov.
Zanjan 2200 m | Zanjan-Gilvan pass | 2009.x.09—11. | Leg. Hacs-Sum | coll. SMNK (Karlsruhe).
Description. (Figs 1-3). Wingspan 29 mm, forewing length 15 mm. Head beige-grey.
Antenna dark grey, setose. Thorax grey. Forewing sand-coloured with characteristic
Nota lepidopterologica, 24.01.2011, ISSN 0342-7536
250 LEHMANN: Lithostege stadiei sp. n. from Iran
Figs 1-4. Adults of Lithostege spp. 1. Holotype of L. stadiei sp. n., ©’, upper side. 2. Same as Fig. 1, but
underside. 3. Paratype of L. stadiei sp. n., ©’, upper side. 4. L. buxtoni Prout, 1920, ©, Iran, Prov. Bushehr,
Tange Fayab, 680 m, 5.1.2008, leg. Lehmann.
Figs 5-6. Male genitalia of Lithostege spp. 5. L. stadiei sp. n. (slide no. 10/2008 L. Lehmann). 6. L. bux-
toni Prout, 1920 (slide 544 R. Zahiri) (scale bars: 1 mm).
narrow whitish band, running from basal area to wing tip, broadest above discocellular
vein, bordered below by a darker brownish line which bends towards apex at the end
of the cell, terminal line whitish, fringes brown at base. Forewing below the longitu-
dinal band towards inner margin darker, suffused with grey scales. Hindwing white.
Forewing underside (Fig. 2) paler, pattern reminiscent of that of the upperside but much
more diffuse, slightly darker towards costa. Hindwing underside whitish.
Nota lepid. 33 (2): 249-251 251
Male genitalia (Fig. 5). Uncus short, stout, tapered. Valva short, broad, taper-
ing, not rounded as in most other Lithostege. Costa sclerotised, without separate proc-
ess. Valva membranous. Basal projection of valve (harpe) long, strout, reaching nearly
length of costa. Saccus strongly developed, long, broad at base.
Aedeagus relatively long, nearly straight, not curved, slightly constricted, without cor-
nutus.
Female. Unknown.
Diagnosis. Due to its characteristic coloring and pattern, the species can not be confused
with any other. The systematic position of the new species in Lithostege and its clos-
est relatives remain unclear. Judging from wing pattern and male genitalia, Lithostege
buxtoni Prout, 1920 distributed in South Iran (Lehmann et al. 2009) seems to be related.
The new species differs by the tapering valva and the length and shape of the saccus.
Distribution. Altogether seven specimens were collected at the southern slopes of the
northwestern Elburs (Alborz) mountain chain in North Iran, Province of Zanjan (Kuh-e
Sendan Dag Mts.). The area is characterized by rather hot and dry mountain slopes.
Unfortunately, the first received specimen, agreeing with the holotype, was lost during
a car theft in Prague.
Life history. Unknown. The type series was collected beginning to late October, an
unusual flight time for Lithostege species.
Derivatio nominis. The new species is dedicated to Dirk Stadie, renowned expert of
the life history of West Palaearctic Macrolepidoptera and companion on collecting trips
to South Iran, Jordan and Oman.
Acknowledgements
I am grateful to Balasz Benedek and György Fabian (Budapest, Hungary) for presenting the material
from Iran for description and to Norbert Poll (Bad Ischl, Austria) and Robert Trusch (SMNK Karlsruhe,
Germany) for the permission to include their material. I express my sincere thanks to Reza Zahiri (Tehran,
now Turku, Finland) for the genitalia preparation of Lithostege buxtoni and to Hossein Rajaei (Tehran,
now Karlsruhe, Germany) for disposing his knowledge of Iranian Larentiinae. I also thank Axel Hausmann
(ZSM Munich, Germany) for improving the manuscript.
References
Hausmann, A. & A. Seguna 2005. Lithostege fissurata Mabille, 1888 from Malta, new for the fauna of
Europe (Geometridae, Larentiinae). — Nota lepidopterologica 28 (1): 11-15.
Lehmann, L., D. Stadie & R. Zahiri 2009. Zum Winteraspekt der Makrolepidopterenfauna Siidirans mit
Anmerkungen zur Biologie einiger Arten (Lepidoptera: Bombycoidea, Papilionoidea, Geometroidea,
Noctuoidea). — Nachrichten des entomologischen Vereins Apollo N.F. 30 (3): 105-119.
252 Book review
Günter Ebert 2010. Auf Expedition in Afghanistan. Ein Insektenforscher erzählt
von seinen Reisen (1957-1971). — Naturwissenschaftlicher Verein Karlsruhe. 342 pp.
(in German) — ISBN 978-3-937783-45-1. Price 39.90 €. *
To most lepidopterists, Günter Ebert is known as the editor and author of the book series “Die
Schmetterlinge Baden-Württembergs”, published in German between 1991 and 2005 (see
book review Nota lepidopterologica 31 (2008): 24). He travelled to Afghanistan several times
between 1957 and 1971 studying butterflies and moths. In his new book “Auf Expedition in
Afghanistan”, based on his diary of these travels, Günter Ebert describes his experiences in 22
chapters with 250 original photographs in black and white or colour.
At that time, the world was very different from today. In the 1950s, a flight ticket was much too
expensive, and thus, the young enthusiast Günter Ebert travelled by train to Italy, changed to
a ship for Karachi, continuing by bus to Afghanistan. A one way journey took him one month
(today, we can easily manage an entire trıp using air plane and a four wheel drive vehicle
within one month). Inside Afghanistan, Günter Ebert met the inevitable time consuming diffi-
culties with bureaucratic officials and slow transportation by corroded buses or going by yak
and horse. We are told about the Afghan people he met during his journey, from nature, cities
and villages in a poor country, at that time still in peace. The narrations are fascinating and
strongly inspirational.
As Günter Ebert received financial support for his travel via Hans Georg Amsel (Karlsruhe)
and Walter Forster (München), two men who were interested in the afghan Micro- and Macro-
lepidoptera respectively, he collected Lepidoptera, deposited at the zoological collections in
Karlsruhe and München today. This material served as a base for many publications on afghan
Lepidoptera, including the descriptions of many new species, e.g. of Pyraloidea, by Hans Georg
Amsel und Rolf-Ulrich Roesler. In this context, the book also is very interesting as it serves as
a rich source of information on the physical geography and vegetation zones of Afghanistan,
illustrated by maps. Many afghan localities which are familiar to us from type localities and la-
bels pinned on dried moths are mentioned in the book, along with descriptions on their position
and local conditions at that time. An index at the end of the book helps to find these localities in
the book, giving different spellings which are in use for the geographic names. The book also
contains an index to names of plants and animals and a short list of references.
Beside its value for entomologists, Günter Ebert’s book makes fascinating reading for anyone.
It reports from a time before Afghanistan became a country of wars (since 1979!) and thus is
a strong contrast to the everyday news in the media. Reading the book makes us dream of a
peaceful Afghanistan, with happy people and butterflies on the wings...
MATTHIAS Nuss
* To be obtained from: Naturwissenschaftlicher Verein Karlsruhe, c/o Staatliches Museum fiir Naturkunde
Karlsruhe, Erbprinzenstr. 13, 76133 Karlsruhe, Germany; [email protected]
Nota lepid. 33 (2): 253-259 253
Eilema marcida (Mann, 1859) — A new species for Malta
with remarks on the other members of Maltese Lithosiinae
(Arctiidae)
LUKASZ PRZYBYLOWICZ ! & PAUL SAMMUT?
! Institute of Systematics and Evolution of Animals, Polish Academy of Sciences, Stawkowska 17,
31-016 Krakow, Poland; [email protected]
2 137, ‘Fawkner/2’, Dingli Road, Rabat RBT 9023, Malta; [email protected]
Abstract. Eilema marcida (Mann, 1859) is recorded for the first time from Malta. Specimens belonging to
this taxon were originally determined as Eilema pygmaeola Doubleday which does not belong to the lepi-
dopterofauna of Malta. Some biological and faunistic data on E. marcida and Eilema caniola are provided.
Information on all the three species of Maltese Lithosiinae 1s summarized.
Introduction
The Maltese Islands are a group of small, low-lying islands situated almost at the centre
of the Mediterranean, from 35°48'28” to 36°0’0"N and 14°11'04" to 14°34'37"E. They
are 92 km south of Sicily and 252 km north of the Libyan coast. The total area of
the archipelago is 320 km/sq. The Maltese archipelago is composed of three inhabited
islands, Malta, Gozo and Comino and a number of smaller, uninhabited islets and rocks.
From the ecological point of view, the most important of these are Cominotto, Filfa, St.
Paul’s Island and Fungus rock. Malta is the main island. The highest point is at Dingli,
on the west side of Malta and is 253 m above sea level. Lakes and rivers are lacking and
only a few permanent freshwater springs are to be found.
The Maltese climate is typically Mediterranean, with mild, wet winters and hot, dry
summers. Annual rainfall is variable and the average for the last forty years 1s about 500
mm. Most of the rain falls between October and March and the period between April
and September constitutes the dry season. The mean temperature for the last 45 years
was 18.7° C. The average for February, the coldest month 1s 12.36° C, while that for
August, the hottest month is 26.39° C. Snow never falls. Relative humidity is generally
high (65-80%) all the year round. Windy conditions are the norm. About 92% of the
days of the year have a minimum of 1.85 km per hour of wind and the prevailing wind
is the mistral or the north-westerly wind.
The natural vegetation of the Maltese Islands is dominated by the Mediterranean scrub
communities of which the best representatives are the various types of garigue, typical
of rocky ground and characterized by such species as Thymbra capitata (L.) Cav.,
Anthyllis hermanniae L., Teucrium fruticans L., Erica multiflora L., and the endemic
Euphorbia melitensis Parl., (Lanfranco 1995). Garigue ecosystems, such as found at
Ras il-Pellegrin, il-Kortin tal-Mellieha and Ta’ Cené in Gozo, make up to about 10% of
the natural environment (Lanfranco 2002). In favoured situations, such as under cliff
faces, scrub community occurs as maquis, with Ceratonia siliqua L., Olea europaea L.,
Pistacia lentiscus L., Rhamnus oleoides (L.), Teucrium flavum L., Prasium majus L.,
Lonicera implexa Ait., Smilax aspera L., Acanthus mollis L., Capparis orientalis Du-
Nota lepidopterologica, 24.01.2011, ISSN 0342-7536
254 PRZYBYLOWICZ & SAMMUT: Eilema marcida new to Malta
mahel, and others (Lanfranco 1995). Less than 3% of the natural environment is of this
type (Lanfranco 2002).
No natural woods occur, although remnants of a few Quercus ilex woods, such as found
at Buskett, near Dingli, at Wardija and Mellieha still remain or are reduced to maquis.
The semi-artificial woodland at Buskett is fairly characteristic of a Mediterranean
evergreen wood (Lanfranco 1995). Wooded areas account to only 1.4% of the natural
environment (Lanfranco 2002).
Freshwater habitats are scarce in Malta, especially during the summer months. Permanent
streams, such as at Wied il-Lug in Buskett, Wied tal-Bahrija in Bahrija and Wied il-
Lunzjata in Gozo are dominated by plant communities comprising Arundo donax L.,
Cyperus longus L., Holoschoenus vulgaris Link., Populus albus L., Salix pedicellata
Desf., Ulmus canescens Melville, sometimes accompanied by Laurus nobilis L.
Dune communities are also very rare and are largely degraded. These are characterized
by species belonging to Salicornia, Suaeda, Crithmum, Limonium, Phrgamites australis
(Cav.) Trin. ex Steudel, Juncus acutus L., Pancratium maritimum L., Euphorbia, Sal-
sola, Medicaga, and others (Lanfranco 1995). Dune areas still exist at Ghadira Bay and
Rdum il-Hmar in Mellieha, at Armier Bay and Ramla in Gozo. The botanical nomen-
clature follows Weber & Kendzior (2006)
Material and methods
The moths were collected at light, either using moth traps running throughout the night
with 18W Actinic light, or at light against a white sheet, using 250 W mixed MV and
UV light run on a portable 1000 W generator for about three hours, mostly on moonless
nights. Moths from the light traps were retrieved in the morning while those attracted to
white sheets were handpicked when they settled on the sheet. All collecting sites, except
Rabat and Naxxar which are in built up areas, are open countryside and away from
human habitations. They are mostly garigue and maquis habitats with small groves of
Pinus halepensis Mill. and Ceratonia siliqua L. It is not uncommon to find dead branches
of these trees completely covered with lichens of the genus Ramalina. Although in Malta
the actual larval host plants for none of the Lithosiinae species have been established, it
is not impossible that such lichens form the diet of the larvae of Ei/ema species.
Results
Eilema marcida (Mann, 1859) Figs 1—2, 20-38, 41
Material. Malta, Rabat, 35°52'35"N, 14°23'44"E, 30°, 12.vi.[19]83, 20.viii.[19]83, 23.1x.[19]84,
29, 4.vi.[19]84, 10/17.v.2006, leg. Sammut. Rabat, Dwejra 35°54'15"N 14°22'33"E, 59, 12., 27.vil.,
27.v111.2007, leg. Sammut; 10, 29, 12.v.2007, leg. A. & K. Seguna. Rabat, Fort Bingemma, 35°54'85.3"N
14°22'33.0"E, 20°, 69, 27.v.2006, leg. A. & E. Seguna. Naxxar, 35°54'35"N 14°26'29”E, 108 m, 19, 29,
19., 23., 30.v.2006, leg. A. Seguna. San Pawl il-Bahar, Wied tal-Mistra, 35°57'32"N 14°23'42"E, 10, 1.vi.
[19]85, leg. A. Seguna; Mtahleb, 35°52'30”N 14°20'32"E, 19, 15.v.[19]85, leg. P. Sammut.
Nota lepid. 33 (2): 253-259 DSS
Figs 1-2. Male genitalia of E. marcida (Mann) with everted vesica. 1. Vesica with 3 cornuti, Rabat,
12.vi.83. 2. vesica with 2 cornuti, Rabat, Fort Bingemma, 35°54'85.3"N 14°22'33.0"E, 27.v.2006.
Distribution. Northwest Africa (Morocco, Tunisia), south Spain, France (only Corsica),
central and south Italy, Sardinia and Sicily.
Remarks. E. marcida was for a long time confused with Eilema pygmaeola (Double-
day, 1847) and treated as a synonym of subspecies E. pygmeola pallifrons (Zeller,
1847). Recently Grassi & Zilli (2005) confirmed its species level status on the base of
examination of male and female genitalia. This opinion is also followed by later authors
(Gaston, Macia & Ylla 2007; Leraut 2006). From the Maltese Islands only E. pygmeola
pallifrons has been recorded until now. However the specimens sent for the examination
to the first author belong undoubtedly to E. marcida. Further examination of additional
material including the specimen being the first “E. pygmeola pallifrons” recorded from
Malta revealed all known specimens to be E. marcida. The misidentification is caused
by the fact that when the specimen was collected, the taxon E. marcida was widely
accepted as only a synonym of E. pygmeola pallifrons.
As a result of the present study, E. pygmeola pallifrons (Zeller, 1847) should be excluded
from the list of Maltese Lepidoptera.
256 PrRzyBYLOwICz & SAMMUT: Eilema marcida new to Malta
Analyzed material indicates that on Malta the species produces two generations per
year. Moths of the spring generation (f.g.) fly for a much shorter time than these of the
summer generation (s.g.) with about one month gap from the mid-June until the mid-
July. The first generation flies in May (first 12.v.) and June (last 12.vi.). The second
generation lasts from July (first 12.vii) until September (last 23.1x.). Moths of the first
generation (Figs 20-31) are significantly larger compared to the representatives of the
second generation (Figs 32-38). Forewing length of males (7 examined) belonging to
f.g. varies between 11-12 mm (on average 11,5 mm) while those of s.g. (2 examined)
varies between 8-9 mm (on average 8.5 mm). In females, forewing length of f.g.
(12 examined) varies between 10-12 mm (on average 10 mm) while those of s.g.
(5 examined) is about 9 mm. The colouration of moths from the s.g. is also significantly
paler and more homogenous with usually much less distinct dark suffusion of outer
portion of hind wing especially in the males.
The occurrence of two generations is also reported from Italy (Parenzan 1982) where,
in contrast to Malta, “in the more southern districts” the species shows “two largely
overlapping generations in early summer and late summer-early autumn” (Grassi &
Zilli 2005).
During the study 11 specimens (4, 79), belonging to the first (20°, 49) and the second
(20, 39) generation were dissected. Among the dissected males there is one specimen
with only 2 cornuti in the vesica (Fig. 2). The middle cornutus is absent. The remaining
two retain the position and shape typical for the species (Fig. 1). This feature was,
without any details, already noted by Grassi & Zilli (2005), although it was never
illustrated.
Eilema caniola (Hübner, 1808) Figs 3-19, 41
Material. Malta, Rabat, 35°52'35"N 14°23'44"E, 19, 7.iv.2006, 10°, 27.1v.2002, 19, 27.1v.2005,
19, 30.v.[19]83, 19, viii.[19]81, 39, 5.x.[19]84, 19, 29.x.[19]73, 19, 4.x1.[19]80, 19, 7.x1.[19]80, 29,
6.x.[19]86, leg. P. Sammut; Rabat, Dwejra, 35°54’15"N 14°22'33"E, 19, 28.vi1.2008, leg. P. Sammut;
Dingli, Dingli Cliffs, 35°51'20"N 14°22'33"E, 39, 4.x.2004, leg. A. Seguna; Naxxar, 35°54’35"N 14°26’
29"E, 108 m, 19, 14.v.2007, 19, 1.v.[19]97, leg. A. Seguna; Mosta, Bidnija, 35°55’32"N 14°24'08"E, 19,
29, 2.v.[19]97, leg. A. Seguna; Burmarrad, Ghajn Rihana, 35°55'27"N 14°24'57"E, 20, 19, 18.x.[19]91,
leg. P. Sammut; Burmarrad, Wied Qannotta, 35°56'09"N, 14°24'14"E, 19, 22.iv.2002, leg. P. Sammut;
Mellieha, Mgiebah, 35°58'05"N 14°22'56"E, 19, 8.x.2004, leg. A. Seguna; Mellieha, L-Ahrax tal-
Mellieha, 35°59'15"N 14°22'28”E, 19, 14.1x.2007, leg. A. Seguna; Buskett, 35°51'27"N 14°23’56”E, 19,
6.vii.2004, leg. P. Sammut; Bahrija, Wied tal-Bahrija, 35°53’40"N 14°20'21”E, 19, 5.viii.2003, leg. P.
Sammut.
Distribution. West Palaearctic. West and South Europe north to the south of Ireland,
western part of North Africa, Asia Minor and the Caucasus. Known also from Sicily
(de Freina & Witt 1987). Recorded from Malta for the first time by A. Valletta (1973).
Remarks. The species is common on the island and has been collected in many places.
Imagoes can be found in two periods. The first generation (Figs 3-11) is on the wing
during April and May while the second generation (or the overlapping second and third
generation) flies during July and the beginning of November (Figs 12-19).
Nota lepid. 33 (2): 253-259 231
Figs 3-19. Uppersides of E. caniola (Hübner). 3-11. First generation; 3-6. ©, 7-11. 9. 12-19. Second
generation; 12-13. 0; 14-19. 9.
Figs 20-38. Uppersides of E. marcida (Mann). 20-31. First generation; 20-24. 0; 25-31. 9. 32-38.
Second generation; 32-33. 0; 34—38. 9.
258 PrzyBYLowicz & SAMMUT: Eilema marcida new to Malta
Figs 39—40. Uppersides of males of L. quadra (Linnaeus). 39. Mellieha, 3.vi1.1976 40. Naxxar, 11.x1.1996.
Comino
6
ae
Cominotto
P St. Paul's Island
Q Pantelleria
Linosa Gozo
>
° S Malta
ee
Lampedusa
Fig. 41. Map of Maltese Archipelago showing distribution records. @ E. marcida (Mann), @ E. caniola
(Hübner), À L. quadra (Linnaeus).
Lithosia quadra (Linnaeus, 1758) Figs 39-41
Material. Malta, Mellieha, Ghadira Bay, 35°58'14"N, 14°20'57"E, 10°, 3.viii.1976, L. Cassar leg; Nax-
xar, 35°54'35"N 14°26'29"E, 10°, 11.x1.1996, A. Seguna leg.
Distribution. Palaearctic. From Western Europe to Japan. Absent in North Africa. On
Sicily recorded only recently from Saracena, Scagliola (Giuliano & Parenzan 1994),
Portella Arena (Bella, Russo & Parenzan 1995) and Galvarina (Parenzan & Porcelli
2006).
Nota lepid. 33 (2): 253-259 259
Remarks. This very characteristic species was collected on Malta for the first time
by L. Cassar (Sammut 1984). Until now only 2 specimens are known. This fact, and
the fact that the second specimen has been collected more than 20 years after the first,
strongly suggest that they have reached the Maltese Islands during some occasional
migration and as yet, have failed to establish permanent population.
Acknowledgements
We cordially thank Anthony Seguna for the loan of his Ei/ema material from Malta and Alberto Zilli for
providing some bibliographical data.
References
Bella, S., P. Russo & P. Parenzan 1995. Contributi alla conoscenza della lepidotterofauna siciliana 3. Bom-
bici e Sfingi. — Phytophaga 6: 85—109.
de Freina, J. & T. Witt 1987. Die Bombyces und Sphinges der Westpalearktis. Band 1. — Forschung &
Wissenschaft, Miinchen, 708 pp.
Gaston, J., R. Macia & J. Ylla 2007. Sobre la presencia de Filema marcida (Mann, 1859) en Espana (Le-
pidoptera: Arctiidae). - SHILAP Revista de Lepidopterologia 35 (140): 491—497.
Giuliano, F. & P. Parenzan 1994. Contributi alla conoscenza della Lepidotterofauna siciliana II. I Macro-
lepidotteri dei Monti Nebrodi. — Phytophaga 5: 85—111.
Grassi, A. & A. Zilli 2005. New data on the distribution and ecology of some Italian species of Eilema
and reppraisal of Eilema marcida new rank (Insecta, Lepidoptera, Arctiidae). — Aldrovandia 1: 5-15.
Lanfranco, E. 1995. The Vegetation of the Maltese Islands. — /n: F. Giusti, G. Manganelli & P. J. Schembri,
The non-marine molluscs of the Maltese Islands. Monografie XV. — Museo Regionale di Scienze
Naturali, Torino. 607 pp.
Lanfranco, S. 2002. Kullana Kulturali 45. — L-Ambjent Naturali tal-Gzejjer Maltin. Pubblikazzjonijiet
Indipendenza. Malta. 196 pp.
Leraut, P. 2006. Moths of Europe. Vol. 1: Saturnids, Lasiocampids, Hawkmoths, Tiger Moths. — N.A.P.
Editions, 394 pp.
Parenzan, P. 1982. Bombyces e Sphinges (Lepid. — Heterocera) dell’ Italia meridionale (addenda). — Ento-
mologica 17: 103-125.
Parenzan, P. & F. Porcelli 2006. I Macrolepidotteri italiani — Fauna Lepidopterorum Italiae (Macrolepi-
doptera). — Phytophaga 15 (2005-2006): 5—393.
Sammut, P. 1984. A systematic and synonymic list of the Lepidoptera of the Maltese Islands. — Neue ento-
mologische Nachrichten 13: 1—124.
Valletta, A. 1973. The Moths of the Maltese Islands. — Progress Press, 120 pp.
Weber, H. C. & B. Kendzior 2006. Flora of the Maltese Islands — A field guide. — Margraf Publishers,
Weikersheim, Germany. iv + 384 pp.
260 Book review
Peter Huemer & Ole Karsholt 2010. Gelechiidae II (Gelechiinae: Gnorimosche-
mini). — /n: P. Huemer, O. Karsholt & M. Nuss (eds), Microlepidoptera of Europe 6:
1-586. — Apollo Books, Stenstrup. ISBN 978-87-88757-87-3. Price: € 140.
The Gelechiidae are a globally distributed family, currently with some 4700 validly described
and countless unnamed species. The fauna of North America has been partially treated in a con-
temporary fashion by R. W. Hodges; that of southern Africa about half a century ago by A. J. T.
Janse. The Gelechiidae of other parts of the world have been unevenly treated, some areas like
the Russian Far East have been well covered, but many others are still nearly untouched. Even
though these moths can be found virtually everywhere, and particularly in xerothermic habitats
they can be extremely abundant, they have never been among the most popular Lepidoptera.
Their appearance which is often of a more modest type among Lepidoptera, and identification
problems due to the external similarity of numerous species — supplemented by intraspecific
variation that can be similar in many species — are obvious reasons for this situation. Dissection
of genitalia is often the only means of getting a reasonably safe identification, especially if the
moth is taken outside the collector’s backyard, or the collector is very experienced.
The Gelechiidae fauna of Europe is now at good hands. After publication of the first of the
planned four volumes dedicated to the European Gelechiidae (Huemer & Karsholt 1999) in
the book series Microlepidoptera of Europe (Apollo Books) the second volume is now avail-
able. One may wonder why it took a decade to cover a quarter of the European species of a
moth family. The reasons for this “delay” become immediately apparent when a closer look is
taken at the new volume, covering the large tribe Gnorimoschemini. Just a brief glance to the
abstract: a total of 211 species in 20 genera are recognized in Europe, including descriptions of
fifteen new species. What catches the reader’s eye is the amount of new synonymies proposed:
no less than 42 species group names are sunk as synonymy (and some other taxonomic changes
are also made). The history of Lepidoptera study in Europe has traditionally been plagued by
synonymies that as a general feature is historically understandable due to the difficulties in
correctly interpreting verbal descriptions of more or less greyish brown species. Yet, the gnori-
moschemini Gelechiidae seem a particularly troubled exception. This was the favourite group
of the late Dalibor Povolny. As much as he contributed to the knowledge of this group, he also
created a lot of obscure taxa by describing species based on insufficient material, often worn
singletons, sometimes males, sometimes females.
The present authors have had to face of a jungle of all imaginable (and some unimaginable) ob-
stacles: misidentified type species, mixed type series, types in desperately bad condition, faked
types, stolen types (“cleptotypes’’), no types at all, transitions of slides of primary type material,
difficulties built to make the study of crucial material as difficult as possible, last minute mas-
sive additions of crucial new material especially from SE Europe, not to mention the profound
trouble: the Gnorimoschemini are a particularly difficult group of moths. Species are similar to
each other; they vary in a similar fashion; their genitalia are often quite similar to each other.
Many species are known from a very wide geographical area by extremely scattered records.
So, the authors have first had to face a heroic task to form a concept about “what is a species”,
in every single case — in cases of allopatry there cannot even be a single correct answer, but
the status of each population should nevertheless be considered. As if that was not enough, in
attempting to find correct names for each of these species, the troublesome issues described
above had to be resolved. All this effort makes this book extraordinary among identification
guides. It is also a thorough taxonomic revision that raises the state-of-art of the study of this
group to a new level. As a colleague I cannot but sympathise with the present authors, as read-
ing the book I find many similarities with my own work as a taxonomist attempting to resolve
Nota lepid. 33 (2): 179-186 261
another inadequately studied gelechioid group (Elachistidae). In this world taxonomists have
enough to study. The world is losing biodiversity, and taxonomic expertise should be channeled
to improving our knowledge of the insect fauna. The enormous efforts needed to rectify inad-
equate prior studies seem to impose an unfair burden on those taxonomists. Few practicing tax-
onomist can easily keep track on everything when studying any larger group. An obvious help
for them would be the use of peer-reviewed journals as publication forums. They should be
considered as life-insurance as providing last-minute rescue from errors and (often) invaluable
second opinions the value of which the author can consider prior to publication. Peer-review
should not be seen as a hinderance to publication or a limitation on the freedom of publication.
It is a means to improve the quality of publication which is also for the author’s benefit.
If one wants to search for inadequacies, some inconsistencies might be picked as examples.
Caryocolum schleichi is considered to be a widely distributed species with different appear-
ance, genitalia and biology in different allopatric populations that are treated as subspecies.
Scrobipalpa salinella as ‘traditionally’ understood is divided in three species: S. salinella, S. sper-
gulariella and E. salicorniae. The arguments for this division seem rather vague, referring to
differences in size and wing markings (host plants overlap between ‘species’) and different
colour of larva (what might be the effect of differently pigmented food substrate??). The ar-
gument-based decisions in this complex are in my view inconsistent when contrasted to those
arguments which nevertheless are considered as sufficient to keep the populations of C. schlei-
chi conspecific. The reader gets the feeling that in cases like these two the last word has not yet
been said. But, these particular points illustrate one of the greatest virtues of the book. I wish
to draw attention to the transparency of the authors in explaining their reasoning behind each
taxonomic or other decision. They do not hide behind ‘authority’, but give their arguments
which can then be further elaborated and tested by focused studies. That makes this volume a
formidable scientific contribution, the kind and quality towards which all taxonomists should
aim. Certainly, the European Gnorimoschemini are not yet “ready”, as novel methods, especial-
ly those based on DNA studies are fast becoming easier and cheaper. But their contribution can
only be built on, and put to perspective against, background knowledge like the present volume
provides. Let the book tell the rest.
LAURI KAILA
Reference
Huemer, P. & Karsholt. O. 1999. Gelechiidae I (Gelechiinae: Teleiodini, Gelechiin1). — /n: P. Hue-
mer, O. Karsholt & L. Lyneborg (eds), Microlepidoptera of Europe 3: 1-356.
Nota lepid. 33 (2): 263-269 263
Phauda bicolor sp.n. from North Sumatra (Indonesia)
(Zygaenidae: Phaudinae)
MICHAEL FIBIGER !, KNUD LARSEN? & ULF BUCHSBAUM
' Molbechs Alle 49, 4180 Sore, Denmark; [email protected]
? Rontoftevej 33, 2870 Dyssegärd, Denmark; [email protected]
3 Zoologische Staatssammlung München, Münchhausenstr. 21, 81247 München, Germany;
[email protected]
Abstract. During an expedition to Sumatra in February and March 2002 the authors discovered an unde-
scribed zygaenid moth: Phauda bicolor, sp. n. Forty five specimens were obtained. In order to clarify its
systematic position one specimen was preserved in ethanol for molecular analysis. The male and female
genitalia are illustrated. A potential related species from North India: Phauda fuscalis Swinhoe, 1892
is compared. DNA sequence of the mitochondrial gene cytochrome oxidase subunit I 1s included in the
character set.
Zusammenfassung. Während einer Expedition im Februar und März 2002 konnten die Autoren eine
Zygaenidae finden, welche sich als neue Art herausstellte: Phauda bicolor, sp. n. Fünfundvierzig Exemplare
konnten gesammelt werden. Zur Klärung der systematischen Stellung wurde ein Exemplar in Alkohol
für eine spätere DNA-Analyse aufbewahrt. Die männlichen und weiblichen Genitalien werden abgebil-
det. Eine Schwester-Art zu der neuen Art aus Sumatra ist von Nord-Indien beschrieben: Phauda fuscalis
Swinhoe, 1892. Die DNA Sequenz des mitochondrialen Gens Cytochrom Oxidase Untereinheit I wird in
das Merkmalsset aufgenommen.
Introduction
With excellent help from the late Dr. E. W. Diehl, Pematang Sıantar (N Sumatra), the
authors visited some of the vanıshing mountain rainforests in northern and western
Sumatra. Between two collecting sites the authors stopped to admire and photograph an
enormous tree of the Fig family (Fig. 1). In spider webs on the bark we found several
specimens of a peculiar looking zygaenid moth. Soon we also discovered a number of
live specimens under the tree’s leaf-crown. When we returned, we stopped again by
the tree and managed to collect more material, to preserve a specimen in ethanol; and
look for larvae and food plant. Genitalia examination confirmed that the species can
be associated with Phaudinae. The subfamily is only known from East- and Southeast
Asia (Fanger et al. 1999; Holloway et al. 2001; Scoble 1992) from China to the Malay
Archipelago (Alberti 1954). Phaudinae was established by Kirby (1892). Alberti
(1954) discussed the systematic placement of Phauda Walker, 1854 and Alophogaster
Hampson, 1892) in this subfamily. On the best available interpretation, we come to the
conclusion that the moths collected on Sumatra belong to an undescribed species related
to Phauda fuscalis (Swinhoe, 1892). Here we describe this new species. To complete the
character set of the new species, we provide DNA sequence information as suggested
by Tautz et al. (2003) & Knölke et al. (2005). DNA was extracted from thoracic muscle
tissue of one paratype (sample ID: DNATA X02239) using Qiagen (Hilden, Germany)
tissue kit according to manufacturers protocols. Mitochondrial (mtDNA) cytochrome
oxidase subunit I (COI) gene was amplified with PCR using protocols and primers as
in Simon et al. (1994). Direct sequencing of dye labelled (BigDye V2 ready reaction
master mix, Applied Biosystems) templates was carried out using an ABI 377 auto-
Nota lepidopterologica, 24.01.2011, ISSN 0342-7536
264 FIBIGER et al.: Phauda bicolor sp.n. from Sumatra
mated sequencer (Applied Biosystems).
Sıx sıngle strand sequences were as-
sembled to 1547bp of COI gene and
the tRNA beforehand and aligned
to the COI gene of Bombyx mori
(Linnaeus, 1758) (Lepidoptera: Bom-
bycidae; GenBank accession number
NC_002355). DNA 1s stored in the
frozen DNA collection of the Zoolo- |
gische Staatssammlung München under Fig. 1. The prominent Fig-tree on North Sumatra, with
storage number DNATA X02239. the authors and Giinter Riedel. (photo: Tanja Kothe)
Figs 2-3. Spread specimens of Phauda bicolor sp. n. 2. Holotype, ©. 3. Paratype, 9. (photos: Ulf Buchs-
baum)
Phauda bicolor sp. n. Figs 2, 3
Material. Holotype © (Fig. 2): Indonesia, North Sumatra, Purba, 1 km South of Seribudolok,
2°54'59"N 98°38'24”"E, 1380 m, 3.11.2002, leg. Fibiger, Larsen & Buchsbaum, coll. ZSM. — Paratypes,
440 and Q (Fig. 3), same data as holotype (10 genit. prep. 4273, 19 genit. prep. 4274 M. Fibiger; 19 DNA
ID-No.: DNATAX02239), coll. Fibiger, Larsen, Zoologische Staatssammlung München, Shen-Horn Yen,
C. Naumann (Zoologisches Forschungsmuseum Alexander Koenig, Bonn), G. Tarmann, G. Tremewan.
Diagnosis. Wingspan: male 22-26 mm, forewing 10-13 mm; female 26-34 mm,
forewing 13-16 mm. Proboscis rudimentary, less than 1 mm long. Labial palps 2-
segmented, rudimentary, less than % mm long; maxillary 1-segmented. Antennae
thread-like, ciliate in both sexes. Ocelli absent. Chaetosemata present, relatively large.
Head, antennae, eyes, thorax, and all scales on thoracic segments, legs and wings pitch
black and more or less shining, though not on the wings. Both fore- and hindwings
elongated, broadest at %. The forewing venation is with a full CuP. Scales on wings
narrow, hair-like. Hindwings semitranslucent, Abdomen bright orange. The first two
segments black dorsally; a black and quadrangular bar present dorsally on remain-
ing segments. Underside of the abdomen bright orange. In P fuscalis the abdomen
is wholly black (Swinhoe 1892)). Male with two long, slightly orange coremata-
brushes arising from the 8" segment laterally and posteriorly. The same brushes on
Nota lepid. 33 (2): 263-269 265
P. fuscalis are “fiery red hairs” (Swinhoe
1892).
Male genitalia (Fig. 4). Uncus large,
broad, arrow-shaped; subapically spatu-
late; apically with a down-curved hooked
tip. Tegumen broad, as long as vinculum.
Saccus finger-like, almost as long as vin-
culum. Juxta circular. Fultura superior
M Sina /; \ membranous, covered with diminutive
PARATYPE: A spines. Valva broadest at base, attenuate
oe at slightly upturned apex. Sacculus sclero-
tised at base. Clavus digitate. slightly se-
tosed. Editum large, globular, dominating
the valva, comprising hundreds of small
circular cells with short hair-like scales.
Valva with long, spreading hair-like setae.
phallus long, narrow, tapered from mid
coecum to apex. Vesica a little shorter
than phallus, curving 90 degree dorsally;
broadest 2/3 covered with numerous spi-
cules out; on dorsal side from base to mid
clothed with spicules.
Female genitalia (Fig. 5). Papillae
analis lunar-shaped; the straight sides
against each other. Posterior apophyses
slightly longer than the ovipositor valves.
The 8" abdominal segment slightly scle-
rotised. Anterior apophyses rather short,
heavily fused to the 8" segment. Lamella
postvaginalis prominent, ovoid, slightly
sclerotised. The antevaginal plate small,
sclerotised. Antrum with a ventral sclero-
tised plate, upon which the ductus semi-
oe nalis arises. First third of ductus bursae
LE. almost straight; the second part tightly
coiling ten times before the large globular
corpus bursae.
4173 N. Fibyer
Figs 4—5. Genitalia of Phauda bicolor sp. n. 4. ©,
3.0:
266 FiBIGER et al.: Phauda bicolor sp.n. from Sumatra
Figs 6 a-b. Adults of Phauda bicolor sp. n. sitting in the ground vegetation close around the Ficus tree.
(photo: Ulf Buchsbaum)
À
ALP ARK
A
Fig. 7. Type locality of Phauda bicolor sp. n. shown on the map for North Sumatra (Indonesia).
Cytochrome oxidase subunit I (COI-SP).
Phauda bicolor sp. n. (Sample ID: AJ556909; Barcode ID: GBGL0272-06; GenBank
Accession: AJ556909; Residues: 901; Comp. A: 294; Comp. G: 135; Comp. C: 133;
Comp. T: 336; Ambiguous: 0):
Nota lepid. 33 (2): 263-269 267
CGAAAATGATTATTTTCCACAAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAACAGGAATA
GTAGGAACTTCTTTAAGTCTATTAATTCGAGCAGAATTAGCTAACCCAGGATCTTTAATTGGAAAT---GATCAA
ATTTATAATACAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATGGTTATACCAATTATAATTGGAGGA
TTTGGAAATTGATTAGTACCTTTAATATTGGGAGCCCCTGATATAGCATTCCCACGAATAAATAATATAAGATTT
TGACTTCTTCCCCCCTCATTTATACTTTTAATCTCAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACA
GTTTACCCCCCACTTTCATCAAATATTGCCCATAGAGGAAGATCAGTTGATTTAGCAATTTTTTCCTTACACTTA
GCAGGAATCTCTTCAATTTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGACCTAATAATATAATA
TTTGATCAAATACCATTATTTATTTGAGCTGTAGGAATTACAGCTTTACTTTTACTTTTATCATTACCAGTATTA
GCTGGGGCTATTACTATACTACTTACAGATCGAAATTTAAATACTTCATTTTTTGATCCTGCAGGGGGTGGTGAT
CCAATTTTATATCAACATTTATTTTGATTTTTTGGTCATCCTGAAGTTTATATTCTAATTCTCCCAGGATTTGGA
ATAATCTCACACATTATTTCCCAAGAAAGAGGTAAAAAAGAAACTTTTGGATGCTTAGGAATAATTTATGCTATA
ATAGCAATTGGTTTATTAGGGTTTGTAGTTTGAGCTCACCATATATTTACAGTAGGAATAGATATTGATACTCGA
G
Phauda mimica Strand, 1915 (Sample ID: LS-06-0055.1; Barcode ID: LEFIA 1293-10;
GenBank Accession: -; Residues: 670; Comp. A: 208 ; Comp. G: 97 ; Comp. C: 98 ;
Comp. T: 265 ; Ambiguous: 0):
GAACATTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAAC-TCTT-AAGTTTATTAATTCGAGCAGAAC
TGGGAAATCCAGGATCTCTTATTGGTAATGATCAAATTTATAACACAATTGTCACAGCTCATGCTTTTATTATAA
TTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTACCATTAATATTAGGAGCTCCTG
ATATAGCATTTCCACGAATAAATAATATAAGATTTTGACTTCTACCTCCCTCATTAATACTTTTAATTTCAAGTA
GAATTGTTGAAAATGGAGCAGGTACCGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCATAGAGGTA
GTTCAGTTGACTTAGCAATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATTTTAGGAGCTGTAAATTTCATCA
CTACAATTATTAATATACGACCTAATAATATAACATTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTA
CAGCTTTATTATTATTATTATCTTTACCAGTATTAGCTGGAGCTATTACTATATTACTTACAGATCGAAATTTAA
ATACTTCTTTTTTTGATCCTGCAGGAGGTGGAGATCCTATTTTATATCAACATCTATTTTGATTTTTTGG
Bionomy. We suggest that the habitat for the moth is in the leaf-crown of fig trees. The
authors probably found a relict population in a tree surviving from the once undisturbed
rainforest. The moths were diurnal, flying in early March. Figs 6 a, b show two living
specimens at the type locality on 03 March 2002 in the ground vegetation close around
the Ficus tree. The larvae of Phauda are possibly specialists on Moraceae (Fänger et al.
1999, Holloway et al. 2001)
Distribution. Phauda bicolor, sp. n. is only known from the type locality. The authors
believe it will not be easy to find it elsewhere. On Fig. 8 the type locality is represented
on the map of Sumatra.
Remarks. The systematic position of Phaudinae remains controversial. The taxon
comprises approximately 50 species, all occuring in South East Asia (Epstein et al.
1999). Phaudinae is recognised by the absence of ocelli; the well developed chaetose-
mata; the elongated, narrow forewing; the translucent, sometimes spiralled ductus bur-
sae; and the bipectinate (male) or biserrate (female) antennae. However, the antennae
of both the male and female are ciliate in Phauda bicolor sp. n. One of the charac-
ters of the Phaudinae is the only distally present CuP of the forewing; however, in
Phauda bicolor sp. n. the CuP vein matches those of the Zygaeninae, Chalcosiinae, and
Procridinae. The hindwing venation in Phauda bicolor sp. n. has a full CuP, which is
distally stalked with Cu2. The pair of hairs at the posterior abdomen, which is charater-
istic for Phausdinae, is present in P bicolor sp. n.
268 FIBIGER et al.: Phauda bicolor sp.n. from Sumatra
Vergroserung- BX
Figs 8—12. SEM illustrations of Phauda spp.
8. Head of P fuscalis (Swinhoe, 1892).
9. Head of P. bicolor sp. n.
10. Compound eye of P. bicolor sp. n.
11. Antenna of P. bicolor sp. n.
12. Brush at abdomen of P. bicolor sp. n.
Acknowledgements
The authors wish to express their gratitude to their travel companions, who recorded several specimens
of Phauda bicolor, sp. n., to Shen-Horn Yen for help with identification and discussion, to the late Prof.
Dr. Clas M. Naumann for comments and improvements to the manuscript. Special thanks to Michael A.
Miller and Konstantin Witt for their excellent and efficient DNA Lab work. The genetic part of this paper,
conducted at the Zoologische Staatssammlung Munich, Germany, was part of the DNA-TAX (www.zsm.
mwn.de/DNATAX) project aimed at establishing an insect sequence database for DNA taxonomy pur-
poses. The project is part of the Entomological Data Information System (EDIS) initiative under the direc-
tion of BIOLOG, founded by the German Federal Ministry for Education and Research (BMBF project
ID 01LC99004/2).
Nota lepid. 33 (2): 263-269 269
Literature
Alberti, B. 1954. Über die stammesgeschichtliche Gliederung der Zygaenidae nebst Revision einiger Grup-
pen (Insecta, lepidoptera). — Mitteilungen aus dem zoologischen Museum Berlin 30: 117-480.
Epstein, M. E., H. Geertsema, C. M. Naumann & G. M. Tarmann 1998. The Zygaenoidea. Pp. 159-180. —
In: N. P. Kristensen (ed.), Handbook of Zoology. Volume IV. Arthopoda: Insecta. — Walter de Gruyter,
Berlin & New York.
Fänger, H., S.-H. Yen & C. M. Naumann 1999. External morphology of the last instar larva of Phauda
mimica Strand, 1915 (Lepidoptera: Zygaenoidea). — Entomologica scandinavica 29 (4): 429-450.
Holloway, J. D., G. Kibby & D. Peggie 2001. The families of Melesian moths and butterflies. — Fauna Me-
lesiana Handbook 3. — Brill, Leiden, Boston, Köln. 455 pp.
Jordan, K. 1933. Zygaenidae. — Jn: A. Seitz, Die Großschmetterlinge der Erde. 10. Band: Die Indo-Austra-
lischen Spinner und Schwärmer. — Alfred Kernen Verlag Stuttgart.
Kirby, W. F. 1892. A systematic Catalogue of Lepidoptera Heterocera, Vol. 1. — London & Berlin. xii +
951 pp.
Knölke, S., S. Erlacher, A. Hausmann, M. A. Miller & A. H. Segerer 2005. A procedure for combined ge-
nitalia dissection and DNA extraction in Lepidoptera. — Insect Systematics and Evolution 35: 401-409.
Scoble, M. J. 1992. The Lepidoptera: form, function, and diversity. — Oxford University Press: New York.
404 pp.
Simon, C., F. Frati, A. Beckenbach, B. Crespi, H. Liu & P. Flock. 1994. Evolution, weighting and phylo-
genetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain
reaction primers. — Annals of the Entomological Society of America 87 (6): 651-701.
Swinhoe, C. C. 1892. Catalogue of Eastern and Australian Leipdoptera Heterocera in the Collection of the
Oxford University Museum. Part I Sphinges and Bombyces with eight Plates. — Oxford.
Tautz, D., P. Arctander, A. Minelli, R. H. Thomas & A. P. Vogler. 2003. A plea for DNA taxonomy. — Trends
in Ecology & Evolution 18 (2): 70-74.
270 Book review
Ylla, J., R. Macia & F. J. Gaston 2010. Manual de identificaciön y guia de campo
de los Arctidos de la Peninsula iberica y Baleares [Identification Manual and Field
Guide to the Arctiids of the Iberian Peninsula and the Balearic Islands]. 290 pp., ca. 460
colour illustrations, soft cover. — Argania editio. Barcelona. — ISBN: 9788493440039.
Price 45 €. Available from www.entomopraxis.com. E-mail: entomopraxis@entomo-
praxis.com
This monographic work dedicated to the Tiger Moths and Lichen Moths (Arctiidae) of the
Iberian Peninsula and the Balearic Islands is a very useful and well-produced work which will
undoubtedly become a point of reference for those interested in this colourful and fascinating
group of moths.
The book covers all 65 arctiid species found in this south-western corner of Europe; among
these Eilema marcida (Mann, 1859), E. complana (Linnaeus, 1758), E. pseudocomplana (Da-
niel, 1939), Setina cantabrica de Freina & Witt, 1985, and Coscinia mariarosae Expösito, 1991
are considered to be valid species. The latter two species plus Eilema predotae (Schawerda,
1927), Coscinia benderi Marten, 1957, C. romeii Sagarra, 1924, Ocnogyna zoraida (de Graslin,
[1837]), Artimelia latreillei (Godart, [1823]) and Hyphoraia dejeani (Godart, 1822) are ende-
mic to this area. Two more, Eilema albicosta (Rogenhofer, 1894), endemic to the Canary is-
lands, and Maurica breveti (Oberthiir, 1882), only known from Morocco and Algeria, have
been collected only once from Spain in 1958 and 1991 respectively, and although included in
the guide the authors believe they are likely to be accidental introductions. Old references to
Setina aurita (Esper, 1787), Arctia flavia (Fuessly, 1779), Ocnogyna advena (Fabricius, 1787)
and O. pudens (H. Lucas, 1853) are considered to be either misidentifications or the result of
mislabellings and therefore excluded from the guide.
All 65 arctiid species are treated individually. The contents are organized in sections: A pho-
tographic illustration of a set male and female is provided together with data on wingspan and
sexual dimorphism; in many cases live adults, larvae and pupae are also pictured. Similar spe-
cies are noted, briefly giving distinguishing traits; there are also well-drawn figures of the male
genitalia. A diagnostic key (Appendix 1) helps in the identification of the 17 species of the
genus Filema present in this region. For each arctiid species, those subspecies and forms oc-
curring within the Ibero-balearican region, described either from the region or from elsewhere,
are mentioned. Seasonality, voltinism, type of habitats (with illustration), adult behaviour and
larval food plants comprise the biology section. Useful comments accompany an updated dis-
tribution map, which uses dots and/or shaded areas to show occurrence. Where needed, taxo-
nomic comments are also included. The last section deals with the conservation status of each
species, their listing in Red Books, threats and possible conservation measures. Appendix
2 comprises four plates showing set specimens from all species covered in the book; Appendix
3 includes useful comments on the rearing of arctiid caterpillars based on the authors’ experi-
ence.
This work is the most complete field guide ever produced on the arctiids of the Iberian
Peninsula and the Balearic Islands. A scientific editor might have helped with the finishing
touches (the authors edited the book themselves) and a bilingual Spanish/English text or at
least some summary text in English would have enhanced the value of the work. Despite this
minor criticism, the book is rigorous but also useful, colourful and practical, using terms un-
derstandable to any amateur. It is the kind of lovely book that helps young people to become
lepidopterists.
VicTOR SARTO I MONTEYS
Nota lepid. 33 (2): 271-283 2741
Teleiopsis laetitiae sp. n. and Teleiopsis lindae sp. n.,
two hitherto overlooked mountainous European species
(Gelechiidae: Teleiodini)
JURG SCHMID
Poststrasse 3, 7130 Ilanz, Switzerland; [email protected]
Abstract. Teleiopsis laetitiae sp. n. is described based on nine males and two females collected in the Alps
of Grisons, Switzerland. Wing pattern and genital characteristics are described and illustrated. Further
specimens originating from Austria, Italy, Macedonia, Greece and Turkey were identified in museum col-
lections. Teleiopsis lindae sp. n. is described and characterized based on specimens collected in Spain and
Portugal. Differential diagnosis is provided for these and related species.
Zusammenfassung. Teleiopsis laetitiae sp. n. wird basierend auf neun Männchen und zwei Weibchen
beschrieben, welche in der Bündner Val Tujetsch, Schweiz, gesammelt wurden. Die Beschreibung umfasst
Flügelzeichnung, Genitalstrukturen und Habitatansprüche. Weitere Exemplare aus Österreich, Italien, Ma-
zedonien, Griechenland und der Türkei wurden in Museumssammlungen gefunden. Teleiopsis lindae sp.n.
wird beschrieben und abgebildet basierend auf Tieren aus Portugal und Spanien. Differentialdiagnostische
Merkmale dieser und verwandter Arten werden dargestellt.
Resumaziun. Ina nova specia da tschitta, Teleiopsis laetitiae, sp.n. vegn descretta ord la Val Tujetsch,
Grischun, Svizra. Igl aspect exteriur, la fuorma dallas genitalias sco era il biotop vegnan caracterisai e
cumparegliai. Sco exemplars en collecziuns da museums muossan, exista quella specia era ell’Austria,
ell’Italia, en Macedonia, en Grecia ed ella Turkia. Teleiopsis lindae sp. n. vegn descretta sebasond sin anı-
mals dalla Spagna e da Portugal. Atgnadads da quellas specias e da specias semegliontas vegnan muossadas
sı e discutadas.
Introduction
Teleiopsis bagriotella (Duponchel, 1840) occurs ın the mountain regions of Europe,
from Portugal to Greece and in Turkey (Huemer & Karsholt, 1999). It was described
from France as Anacampsis bagriotella. The detailed description mentions a greyish-
reddish ground colour, tinted wıth brown and a white band at the periphery of the
forewings. A rather schematic drawing accompanies the description (Godart & Dupon-
chel, 1838, p. 608, fig. 312) (Fig. 1). Herrich-Schäffer decribes Gelechia elatella (Her-
rich-Schäffer, 1853) (Fig. 2) and the very careful and detailed figure 499 reveals
beyond doubt that ,,e/atella“ is a synonym of A. bagriotella Duponchel, an opinion
first expressed by Joannis in 1915 and consequently embraced by the modern literature
(Karsholt & Razowski 1996; Huemer & Karsholt 1999). Pitkin (1988) designated a
lectotype from Vaugirard (France).
In a modern revision of the Gelechiidae family (Huemer & Karsholt, 1999) as well as
in a Guide to the Microlepidoptera of Europe (Parenti, 2000), specimens showing a
much more uniform dark coloring without the typical white banding of the forewing
are illustrated apart from the „typical“ bagriotella phenotype. Linda Pitkin (1988) in
a meticulous revision of the Genus Teleiopsis, had already observed that such dark
phenotypes exist which she grouped into two “forms”: “southeastern” , occurring from
Austria to Turkey and “southwestern” from the Pyrenees, Spain and Portugal. She also
observed particular features in the genital apparatus of these “forms”. This material was
Nota lepidopterologica, 24.01.2011, ISSN 0342-7536
212 ScHMiD: New Teleiopsis species from Europe
however considered insufficient to justify the erection ofnew species. Huemer & Karsholt
(1999) mention that „this variation found in bagriotella seems, at least to some degree, to
be geographical, and it may also be correlated with the geology of its localities“.
Abbreviations
BNM Biindner Naturmuseum, Chur, Switzerland
TLMF Tiroler Landesmuseum Ferdinandeum, Innsbruck, Austria
ZMUC Zoologisk Museum, Natural History Museum of Denmark, Copenhagen
Material and Methods
In recent years, a total of 24 „bagriotella“ specimens have been collected at various
localities in the Alps of Grisons, Switzerland. While the “typical” phenotype is widely
distributed in this area, so far only the region of the Tujetsch valley situated in north-
western Grisons harbours the “dark” phenotype in addition to the “typical” form. In total,
eleven “dark” phenotypes from Tujetsch valley and 13 “typical” phenotypes from all over
Grisons, six of which originated also from the Tujetsch valley, were available for study.
From this material, five male and two female genital preparations of “dark phenotype”
specimens were made according to standard procedures. They were embedded in water-
soluble medium (Disney & Henshaw, 1988) between two transparent acetate foils and
attached to the pin of the respective specimen. As controls five male and two female
specimens of the “typical” phenotype, some originating from the same valley were
examined.
Two additional “dark” phenotypes from Austria and Italy were identified by external
appearance in the TLMF (courtesy Dr. P. Huemer). Genital slides, male and female, were
prepared and compared to “typical” specimens. From ZMUC (courtesy O. Karsholt), a
total of 14 specimens from Italy, Greece and Turkey including some of the specimens
determined by Pitkin as “southeastern form” of 7: bagriotella were examined, partly
dissected and analyzed.
Results
Analyzing field data and sampled specimens, the following observations were made: In
the Tujetsch valley, the two phenotypes occur sympatrically but not strictly syntopically.
They seem to occupy different microhabitats, which in some instances were situated
close to each other at a distance less than 1 km (Fig. 5). No phenotypically intermediate
specimens were observed. Careful examination of male and female genitalia revealed
several constant major differences in both sexes between the two phenotypes. These
characteristics were also present with remarkably little variation in the “dark “ phenotype
specimens from Italy to Turkey. These various findings, taken together, support the
concept of two distinct species being involved. The “dark” phenotype of T bagriotella
is hereby described as new species.
|
Nota lepid. 33 (2): 271-283 273
77
a a en
Figs 1-2. Figures of original descriptions. 1. Anacampsis bagriotella (Duponchel). 2. Gelechia elatella
(Herrich-Schäffer).
Figs 3-4. Habitus of phenotypes of Teleiopsis spp. All specimens collected in Grisons, Switzerland.
3. T. laetitiae, “dark” phenotype. 4. T. bagriotella, “typical” phenotype.
Teleiopsis laetitiae sp. n.
Material. Switzerland: Holotype: ©, ”CH [Switzerland]-Sedrun GR[Grisons] | Spinatscha, 1450 m
| 26.vii.[20]05 LF | leg. Jürg Schmid“, gen. prep. Schmid, BNM Chur. — Paratypes: 10°, 29 same data as
holotype, gen. prep. Schmid; 40° Tujetsch Grisons, Surrein, Sum, LF, 1440 m, 17.vii.2006, leg. Schmid,
(29 gen. prep. Schmid); 20° Tujetsch, Grisons, Val Nalps, Sax, Laserp. halleri Biot., 1480 m, 15.viii.2006,
leg. Schmid, 19 gen. prep. Schmid; 10° Tujetsch, Grisons, Selva, 1600 m, 28.vii.2005, leg. Schmid, gen.
prep. Schmid; coll. BNM, TLMF, ZMUC, coll. Schmid. Austria: © Tirol, Nauders, 1400 m, 21.vii.1955,
gen. prep. Schmid, TLMF. Italy: 19 Südtirol, Schnalstal, E.viii.1967, 800 m, leg. Ziirnbauer, gen. prep.
Schmid, TLMF; 19 Abruzzo, M. la Rocca, 1600-1950 m, 6 km SW. Pescasseroli, 13.—14.8.1972, leg.
274 ScHMip: New Teleiopsis species from Europe
R. Johansson, ZMUC, gen. prep. LMP no.111, Teleiopsis bagriotella (Duponchel) det. L. M. Pitkin, 1985
(southeastern form). 10° Macedonia, 20.vii.1982, Mavrovo, 1500 m, F. Schepler, gen. prep. Schmid,
ZMUC. Greece: 29 Greece, Epiros, Katara Pass, 1200 m, Metsovo, 25.v11.1985, M. u. E. Arenberger,
ZMUC; 20 Florina, 1 km NW Pisoderi, 14.vii.1998, 1600 m, B. Skule & D. Nilsson, ZMUC; 20 Hellas,
Ioannina, Katara Pass, 1600 m, 11.viii.1985, M. Fibiger, ZMUC, gen. prep. Hendriksen 2143; 10 Hellas,
Lakonia, Parnon Oros, 1700 m, 29.vi.1983, leg. B. Skule ZMUC, LMP genitalia slide 93, Teleiopsis
bagriotella (Duponchel) det. L.M. Pitkin, 1985 (southeastern form). 30° Turkey, Prov. Kayseri, 5 km
NW Ercios Dagh, 2000 m, 22.vii.1986, leg. Fibiger, 1 gen. prep. Schmid, ZMUC; 10 Turkey, 15 km S,
Erzurum, 3000 m, 20.vii.1989, leg. Fibiger & Esser, ZMUC; 1 Prov. Ankara, 20 km nw. Kizilcahamam,
1200 m, 24.v11.1986, leg. Fibiger, ZMUC.
Description. Wingspan,d:18.6-22mm(N = 19), mean: 20.1 mm. 9:19.2-20.3 mm
(N=3) mean: 19.7 mm. Some of the above mentioned specimens were not suitable for
wingspan measurements as the wings were not suitably positioned.
Male, female (Fig. 6): Head greyish brown, mottled, frons lighter. Third segment of
labial palpi with two dark brown or black bands, tip grey. Thorax and tegulae greyish
mottled. At posterior half of thorax a brown transverse band of raised scales. Ground
colour of forewing greyish brown predominantly composed of light brown serrate
scales with white tips. A pronounced black or dark brown band of raised scales at basal
third extending obliquely from costa to dorsum. Band lined medially and distally by
ferruginous raised scales. At mid forewing one or two irregular longitudinal patches
of black raised scales, heavily lined ferruginous. Distal third of forewing beginning
with a narrow dark transverse patch or band of raised scales, lined heavily ferruginous.
Towards apex transverse zone of lighter scales. At costa, rarely a trace of pinkish scales.
Near apex at mid wing, two thin longitudinal streaks of black scales, sometimes barely
visible. Apical fringes mottled by white-tipped scales. Hindwings light grey.
Male genitalia (Fig. 7): Uncus narrow, tapered, pointed, always clearly extending
beyond gnathos. Base of valva flush with or slightly posterior of sclerotized area of
tegumen. Sacculus only slightly longer than apex of costa. Phallus slender, curved.
Lamina of ductus ejaculatorius very long, longer than length of phallus. Posterior lobe
of eighth tergite not reaching tip of choremata. Chorematal spine with a pointed, barbed
hook end (Figs 26, 29).
Female genitalia (Figs 8-9): Similar to T bagriotella and T. diffinis. Postero-
dorsal emargination of antrum broader than in bagriotella. Subposterior pouch more
anterior. Sclerotized longitudinal fold not reaching subposterior pouch and distinctly
less developed than in bagriotella. Signum serrate, lobes tapered, one almost pointed,
longer than width of base.
Derivatio nominis. The species is named in memory of Laetitia Schmid-Ca-
peder.
Differential diagnosis (Figs 10-11). 7: /aetitiae may easily be separated from 7. ba-
griotella by the wing pattern and coloration. The white band at the distal part of for-
wing and a white patch at dorsum are always noticeable in bagriotella, in fresh as well
as in worn specimens. 7: /aetitiae has a strongly marked blackish oblique band at the
proximal half of forewing. In the male genitalia, sacculus is only slightly longer than
costa in /aetitiae, whereas in bagriotella it reaches considerably beyond costa. This
feature is very constant. Lamina of ductus ejaculatorius is longer than the length of
Nota lepid. 33 (2): 271-283 275
e@ = 7. bagriotella
* =T. laetitiae sp.n.
Fig. 5. Tujetsch valley, the westernmost
part of Grisons, Switzerland. Distribution
of 7. bagriotella and T. laetitiae sp. n.
phallus in /aetitiae but much shorter in bagriotella. Choremata reach beyond posterior
lobe of eighth tergite in /aetitiae, while in bagriotella, they are shorter than or as long
as posterior lobe. Chorematal spine is of complex shape and often in duplicate in
bagriotella. In laetitiae the single spine has the form of a barbed hook (Figs 27, 29).
In the female, the modest sclerotized fold and the smaller emargination of antrum in
T. laetitiae distinguishes this species from 7! bagriotella.
Biology. In Switzerland, both sexes of T. /aetitiae were attracted to light at four
different sites between 17.vıı and 15.viil. These biotopes are south exposed, siliceous
rocky slopes extending from 1440 m to 1600 m and characterized by xeromontane
vegetation of which Laserpitium halleri (Apiaceae) was a regular element (although it
is propably not the host-plant). 7: /aetitiae is certainly a rather local species and more
restricted in distribution than 7. bagriotella, which seems to prefer more mesophilic
rocky habitats.
Distribution. The description of 7: /aetitiae was originally based on material collected
in a small area in the Central Alps of Switzerland. In the course of this study, further
Specimens were detected in museum collections originating from Austria, Italy,
Macedonia, Greece and Turkey. The “dark bagriotella” specimen from Greece
illustrated in Huemer & Karsholt, (1999, fig. 49 a) is now part of the paratype series
of T. laetitiae . A specimen from Valle d’ Aosta, Italy, illustrated by Parenti (2000)
certainly also represents 7! /aetitiae.
In the course of this study, alledged bagriotella-material from Spain and Portugal was
also examined. Some of these specimens have been included in the Teleiopsis-revision
by Pitkin (1988) and were then determined as “7: bagriotella, southwestern form”.
276 SCHMID: New Teleiopsis species from Europe
Examination of the genital structures confirmed the differences already observed by
Pitkin and since these were found also in additional material and proved to be very
constant, it was concluded that the Iberian “bagriotella” constitute a species of its own.
Teleiopsis lindae sp. n.
Material. Portugal: Holotype: © Portugal, BB | Serra de Estréla | Torre, 1950 m | 10.—11.vii.1986 |
O. Karsholt”, “Teleiopsis bagriotella (Duponchel) det. L.M. Pitkin, 1985“; gen. prep. Schmid, ZMUC. —
Paratypes: 20°, 19 same data as holotype, Teleiopsis bagriotella (Duponchel) det. L.M. Pitkin, 1985, 1©
gen. prep. Schmid, 19 L.M.P. Genitalia slide no. 126, ZMUC. Spain: 10 Hispania, 11.-22.1980, Sierra
de Gredos, 1800 m, Garganta de las Pozas, M. u. E. Arenberger, ZMUC, illustrated in Huemer & Karsholt,
1999, fig. 49b. 10 — Leon, Llenaves de la Reina, 12.—26.viii.1997, Wolschrijn, gen. prep. Schmid, ZMUC;
1Q Avila, Sierra de Gredos, 15 km S—SW Hoyos del Espinos, 1720 m, 27.—28.vii.1988, leg. M. Fibiger,
gen. prep. Schmid, ZMUC.
Description. Wingspan, &: 18-21 mm (N=6), mean: 19 mm. 9: 19 mm (N=1).
Male (Fig. 14), female: Head dark brown to greyish brown, mottled, frons lighter.
Third segment of labial palpi with two dark brown or black bands, tip pale. Thorax and
tegulae brown to greyish mottled. At posterior end of thorax two conspicuous bunches
of white scales. Ground colour of forewing dark brown with black elements: A black
or dark brown band of partly raised scales at basal third extending obliquely from
costa to dorsum. At mid forewing two irregular longitudinal patches of black raised
scales, sometimes lined by brown scales. Distally a thin broken longitudinal line of
white scales. Distal third of forewing beginning with two unconspicuous black patches.
Apically thereof, a transverse band of pale or light brown scales, being broadest at costa,
where pink scales predominate and gradually thinning towards dorsum. Near apex at
mid wing, two thin longitudinal streaks of black scales. Termen of apex consisting of
alternate black and white markings. Apical fringes fuscous and mottled by white-tipped
scales. Hindwings light grey.
Male genitalia (Fig. 15). Uncus narrow, tapered, pointed, extending beyond gna-
thos. Base of valva flush with or slightly posterior of sclerotized area of tegumen. Sac-
culus longer than apex of costa. Phallus slender, almost straight. Lamina ductus ejacu-
latorii long, longer than length of phallus. Posterior lobe of eighth tergite extending
beyond choremata. Chorematal spine ending in a hook (Fig. 28).
Female genitalia (Figs 16-17). Similar to /aetitiae. Posterodorsal emargination
of antrum broad. Sclerotized longitudinal fold reaching subposterior pouch and
distinctly more developed than in /aetitiae. Signum small, lobes serrate, longer than
width of base and conspicuously slender.
Derivatio nominis: In honor of Linda M. Pitkin who first discovered morpho-
logical differences in bagriotella-subpopulations.
Biology. In Portugal, T /indae was captured just after dusk in an open area with scattered
grassland, some herbs and small bushes and with patches of snow still in early July (O.
Karsholt, pers. comm.)
Distribution. 7. /indae was found in mountainous areas in Spain and Portugal at
altitudes from 1720 to 1950 m. Pitkin (1988) mentions material from the French
Pyrenees, which she attributed to the “southwestern form” of bagriotella 1.e T. lindae.
Nota lepid. 33 (2): 271-283 DIN
ha
2
U un
Du.
ee...
he Hg
7
7.
Figs 6-9. T. laetitiae sp. n. 6. Holotype. 7. Male genitalia. 8. Antrum. 9. Signum.
Differential diagnosis. While 7: bagriotella and T. laetitiae are easily separated by
external characters and male and female genitalia, T /indae lies somewhat in between
(Figs 18-20). The following criteria may be applied to unambiguously separate the
three species:
278 SCHMID: New Teleiopsis species from Europe
er nn Ss
Figs 10-13. Comparison of habitus and genital structures of T. laetitiae (10-11) and T. bagriotella
(12-13). Note the considerably longer sacculus in bagriotella and the shorter lamina ductus ejaculatorii
(arrows).
Valva: sacculus much longer than costa in bagriotella, clearly longer in /indae and
barely longer in /aetitiae (Figs 21-23).
Lamina ductus ejaculatorii: short in bagriotella, long in lindae and laetitiae (Figs
LW, 13; 15),
Coremata: slightly shorter or as long as lobe of tergite in bagriotella, shorter in
lindae and longer to much longer in /aetitiae (Figs 24—26).
Corematal spine: complex hook in bagriotella, rounded hook in /indae and acute
barbed hook in /aetitiae (Figs 27-29).
Antrum with small emargination in bagriotella, wide in lindae and laetitiae. Sub-
posterior pouch near posterior margin in bagriotella, more anterior in lindae
and /aetitiae. Sclerotized fold well developed and reaching subposterior pouch
Nota lepid. 33 (2): 271-283 279
U
7
+
x
Figs 14-17. Teleiopsis lindae sp. n. 14. Holotype. 15. Male genitalia. 16. Antrum. 17. Signum.
in bagriotella. In lindae, this fold is also well developed and reaches pouch also, but
since pouch is more anterior, fold is shorter. In /aetitiae, fold is modest and does not
reach pouch (Figs 30-32).
280 SCHMID: New Teleiopsis species from Europe
T. laetitiae
Figs 21-23. Valvae of Teleiopsis spp. 21. T. bagriotella. 22. T. lindae. 23. T. laetitiae.
Signum square in bagriotella, with more tapering arms in /aetitiae and with long
and slender arms in /indae (Figs 34-36).
T. laetitiae and T. lindae are externally very similar to Teleiodes diffinis (Haworth,
1828). Although the latter is generally easily separated from T. laetitiae and T. lindae
by its considerably smaller wingspan (T. diffinis: 13-18 mm, laetitiae: 19—22 mm,
lindae: 18-21 mm), single specimens of 7: diffinis may exceptionally reach almost
the size of T. laetitiae. In these cases, identification may only be achieved by genital
dissection. In the male, the rounded tip of uncus separates 7. diffinis from T. lindae and
T. laetitiae; in sacculus, there is a conspicuous bulgy dilatation in diffinis (Fig. 39). In
the female, the antrum presents distally with a circular, lid-like structure below the
distal emargination (Fig. 33).
Nota lepid. 33 (2): 271-283 281
. \
N S S
u Ss
N x
D. N
Figs 27-29. Corematal spine. 27. T. bagriotella. 28. T. lindae. 29. T. laetitiae.
Another species superficially very similar to T. /aetitiae is Teleiopsis latisacculus Pitkin,
1988, recorded from Macedonia, Turkey and Egypt. Apart from its smaller wingspan, it
may also be identified by genital dissection (see Huemer & Karsholt, 1999).
Discussion
The fact that the sympatrically occurring T. bagriotella and T. laetitiae differ not only
in external appearance but also show constant differences in their genital structures
of both sexes justifies their taxonomic rank as separate species. The occurrence of
T. bagriotella has been verified in light of these findings anew and thus ascertained
as occurring in the French Alps (e.g.: Col de la Boira, Col du Galibier, Col de la
Lombarde, Col d’ Izoard, Col des Seigneurs [all in TLMF]), in Italy (e.g. Sella-Gruppe,
Schnalstal [in TLMF]), in Switzerland (e.g. Graubünden [coll. Schmid and TLMF]), in
Austria (e.g. Salzburg, Venedigergruppe, Tirol [in TLMF]), in Montenegro (Durmitor
[in TLMF]) and in Macedonia [in TLMF]. Thus in many parts of Europe both species
may occur in sympatry.
The case of T. lindae is not so straightforward: this taxon occurs in a region where
both 7. bagriotella and T: laetitiae are absent. By external appearance and some
282 SCHMID: New Teleiopsis species from Europe
Figs 34-37. Signa of Teleiopsis spp. 34. T. bagriotella. 35. T. lindae. 36. T. laetitiae. 37. T. diffinis.
genital characters, this species resembles /aetitiae rather than bagriotella. Hence, the
possibility that 7. /indae is a western subspecies of /aetitiae cannot entirely be discarded.
However, the genital differences in both sexes as already observed by Pitkin (1988)
were confirmed and validated by additional material in this study. It seems reasonable
therefore to consider T. lindae a distinct species. It remains to be seen whether or not
molecular data will confirm this interpretation in the future.
Acknowledgements
The author is much indebted to Dr. Peter Huemer, TLMF Innsbruck, Austria, for stimulating discussions,
literature, loan of material and professional support. Ole Karsholt, ZMUC, Copenhagen, Denmark has
kindly provided most valuable material and field data.
Nota lepid. 33 (2): 271-283 263
N
Fig. 38. 7: diffinis (top) and T. laetitiae (below). Fig. 39. Uncus, gnathos and sacculus of 7: diffinis (right).
References
Disney, R. H. L. & D. H. de C. Henshaw 1988. Berlese Fluid for Slide-Mounting Insects. — Antenna 12:
106-107.
Elsner, G. P. Huemer & Z. Tokar 1999. Die Palpenmotten (Lepidoptera, Gelechiidae) Mitteleuropas. Be-
stimmung — Verbreitung — Flugstandort. Lebensweise der Raupen. — Bratislava, Slamka, 208 pp.
Godart, J.-B. & M. P.-A.-J. Duponchel 1838. Histoire naturelle des Lépidoptères ou Papillons de France.
Tome VIII, nocturnes. — Paris: Méquignon-Marvis.
Herrich-Schäffer, G. A. W. 1853-1855. Systematische Bearbeitung der Schmetterlinge von Europa zu-
gleich als Text, Revision und Supplement zu Jakob Hübner’s Sammlung europäischer Schmetterlinge.
Band 5. Die Schaben und Federmotten. — Regensburg, Manz.
Huemer, P. & O. Karsholt 1999. Gelechiidae I (Gelechiinae: Teleiodini, Gelechiini) in: Huemer P, Karsholt
O. & Lyneborg L. (eds.) Microlepidoptera of Europe, vol 3. — Apollo Books, Stenstrup, 356 pp.
Joannis, J. de 1915. Etude synonymique des espèces de Microlépidoptères décrites comme nouvelles par
Duponchel. — Annales de la Société Entomologique de France 84: 62-164.
Parenti, U. 2000. A Guide to the Microlepidoptera of Europe. — Museo Regionale di Scienze Naturali To-
rino. 426 pp.
Pitkin, L. M. 1988. The Holarctic genus Teleiopsis: host-plants, biogeography and cladistics (Lepidoptera:
Gelechiidae). — Entomologica scandinavica 19: 143-191.
—————
fe
#
re
Nota lepid. 33 (2): 285-300 285
A preliminary study of everted vesicae of several leafrollers
(Tortricidae)
BOYAN ZLATKOV
Sofia University, Faculty of Biology, Department of Zoology and Anthropology,
8, Dragan Tsankov Blvd., 1164 Sofia, Bulgaria; [email protected]
Abstract. In this study the everted vesicae of 23 tortricid species belonging to all European tribes with the
exception of Euliini (Tortricini, Cochylini, Cnephasiini, Archipini, Sparganothini, Polyorthini, Bactrini,
Olethreutini, Enarmoniini, Eucosmini, and Grapholitini) are described. In all investigated species, the vesica
is tubular with the gonopore located terminally or subterminally, with the exception of the representatives of
Cochylini, in which the diameter of the vesica vastly exceeds the diameter of the phallus and the gonopore
is located laterally. The vesica appears to be non-eversible in many Eucosmini. Two main types of cornuti
are observed: 1) special sclerotised projections of the vesica typical for examined Cochylini, and 2) modified
deciduous or non-deciduous (fixed) setae in Archipini, Enarmoniini, Eucosmini and Grapholitini. Several
modifications improving the injection eversion technique of Dang (1993) are described.
Introduction
The taxonomic significance of the morphology of everted vesica (endophallus) is well
known. It is used for taxonomic purposes in many lepidopterous families (Matthews,
1998). Recently, examination of this structure has been applied to resolve some taxo-
nomic problems and to complement descriptions in some microlepidopterous families
such as the Pyraloidea (e. g. Ferris 2004; Ferris & Nordin 2004). The first attempts at
studying the everted vesica of Microlepidoptera were implemented by Dang (1993). He
successfully everted vesicae of 12 species in four families (Tortricidae, Oecophoridae,
Gelechiidae, and Nepticulidae) introducing two original techniques. The author de-
scribed the vesicae of 9 tortricid species. Scattered illustrations of vesicae can be found
in other works, e.g. Baixeras (1992, 2002). Later, Brown (2003) illustrated vesicae of
10 species of genus Orthocomotis. In his work the vesicae were everted but not inflated,
and the three-dimensional structure is not visible. With the exception of the Dang’s
work (op. cit.), no special investigations on the three-dimensional structure of the tort-
ricid vesica have been attempted. In the present study the vesicae of 23 representatives
of all European tribes except the Euliini are described and illustrated. Although the
number of examined species is insufficient to draw general conclusions, some aspects
of the morphology of the tortricid vesica are discussed. They may serve as basis of
further studies.
Material and methods
Materials from the following collections were dissected: collection of the author, pre-
served in the Department of Zoology and Anthropology, Sofia University “St. Kliment
Ohridski” (all species except Pelatea klugiana); National Natural History Museum,
Sofia (P. klugiana only).
In this study the classification of Razowski (2002, 2003) is used.
Nota lepidopterologica, 24.01.2011, ISSN 0342-7536
286 ZLATKOV: Everted vesicae of leafrollers
For vesica eversion a modified version of the injection method of Dang (1993) was ap-
plied. Dang’s method requires a tiny hypodermic needle with a modified tip. Instead of
metal needles, self-made glass needles (capillaries) were used. The main advantage of
the capillary is that its diameter can be accurately adjusted to the diameter of the phal-
lus. Moreover, a separate capillary for each individual phallus may be prepared very
easily.
Preparing of capillary. The glass capillaries are made from an ordinary
glass tube (diameter 3—4 mm) by heating it with a spirit-lamp flame and pulling in
opposite directions. The glass tube should not be made from fireproof glass, otherwise
pulling is very difficult. After the first pulling, the diameter of the capillary usually is
about 0,5—1 mm. In order to achieve a smaller diameter the capillary should be heated
and pulled again. In this way, a very fine capillary (0,05 mm or even narrower) can be
obtained (Fig. 1). The wide part of glass tube should not exceed 3-4 cm in length, so if
necessary it should be shortened by using a glass cutter. The cutting edge of the tube is
heated in a flame until it becomes round. The diameter of capillary varies in length and
it can be cut by scissors (under water to protect eyes from small glass fragments!) at a
point where the diameter is as desired. The diameter of capillary should be only a little
smaller than the diameter of the phallus to be examined.
The prepared capillary is attached to a syringe (5-10 ml) by plastic female luer with
hose (Fig. 2). Instead of syringe, a special device may be used (see Lange 1963), but it
is very difficult to prepare this without special knowledge.
Technique of eversion. As previously mentioned, the technique of Dang
(1993) was used but with several modifications. The genitalia are extracted by standard
procedure: the abdominal segments are macerated in boiling 10% KOH and cleaned.
To avoid repeating Dang’s methodology only differences in the technique are men-
tioned here.
After neutralization with glacial acetic acid, the phallus is transferred to a solution of
Chlorazol black (0,03% in 70% ethanol). After 2—5 min the phallus is transferred to
70% ethanol for | minute. Immersion in the 70% ethanol bath is repeated to remove
the staining solution. The phallus is then transferred to 5% ethanol for 1 minute. This
procedure fully restores the softness of the vesica. Whilst the phallus is still submerged
in 5% ethanol, the capillary, filled with absolute ethanol, is inserted into the phallus.
Slight pressure 1s applied on the syringe. The syringe is then removed, together with the
phallus and maximal pressure immediately applied to the syringe to inflate the vesica.
The sudden pressure might eject the phallus, so this step should be carried out over a
dish containing absolute ethanol. A continuous flow of alcohol is maintained for a few
seconds to harden the vesica. The the phallus is then removed from the capillary and
put it in absolute ethanol for a few seconds. Finally, the phallus is transferred to isopro-
panol. If necessary, the inflation is repeated, but this time with isopropanol.
The next step follows Dang’s method.
The everted vesica is embedded in a drop of Euparal and placed in a self-made hemi-
spherical plastic container (Fig. 3) pinned underneath the specimen. In this way the
vesica 1s enclosed in permanent medium without deformation. The other genital parts
are preserved in the same way.
Nota lepid. 33 (2): 285-300 287
|
— 1
NT
RO
im
SEEN
aS
Figs 1—4. Equipment for vesica evertion. 1. Self-made glass capillary. 2. Capillary with plastic female luer
and syringe. 3. Plastic containers with genitalia. 4. Slide for photography.
By experiment, I have found that in many species eversion is often only possible dur-
ing the first 3-5 min after maceration of the genitalia. In many cases, 10 min after the
transfer from KOH solution into 5% ethanol the vesica becomes non-eversible, espe-
cially in small specimens. Even if the vesica is successfully everted with 5% ethanol,
it may remain flattened if it is not treated with absolute alcohol immediately after ever-
sion. One possible reason for this phenomenon could be changes of the proteins in the
thin cuticle of the vesica caused by a change in alkalinity. In addition, vesica eversion
of old museum specimens is much more difficult than eversion of fresh specimens.
Drawing of illustrations. The drawings were prepared from photographs
taken by a digital camera mounted on transmitted light microscope. Inflated vesicae
taken from the isopropanol were embedded into a thick layer of Euparal on a special
slide (Fig. 4) and photographed immediately. The contours of photographed objects
288 ZLATKOV: Everted vesicae of leafrollers
Figs 5-8. Everted vesicae of Tortricidae. 5. Tortrix viridana. a. Right view. b. Detail of diverticulum.
6. Acleris boscanoides. a. Right view. b. Dorsal view. 7. Obraztsoviana maculosana. a. Left view. b. Dorsal
view. 8. Aethes tornella. a. Left view. b. Dorsal view. Scale = 0.5 mm.
were copied onto tracing paper in pencil and then the detailed structure was drawn from
direct observation. Completed pencil drawings were digitalized and edited using Adobe
Photoshop CS software.
Everted vesicae are drawn mainly in two aspects: lateral (left) and dorsal. In a few
cases, the vesica is illustrated in right or ventral aspect in order to get a better view of
some important characters.
Results
Descriptions of everted vesicae
Two important measurements are used for description: length of phallus (Lph) and
length of vesica (Lv). Lph is the length of the sclerotised part of the phallus which is
non-invertible (in some species there is a sclerotised part which is inverted, but eversi-
Nota lepid. 33 (2): 285-300 289
ble!). Lv is the distance between the distal part of the phallus and the most distal part of
the vesica, including diverticula. These measurements are only tentative and should not
be treated as absolute. Often the vesica merges into the ductus ejaculatorius without a
distinct boundary. In these cases, the length is defined approximately. Usually the duc-
tus takes up the stain more readily than the vesica and so 1s more intensively coloured,
or it is a little narrower than the vesica; these two factors may be helpful in determining
the junction between them. In most cases more than one specimen from a species was
examined; where it was possible only to look at a single example, this is noted.
In this paper the term “diverticulum” is used to designate the bag-like expansions of
the vesica. Kristensen (2003) refers to these structures as the “outpocketings”, but the
first term is very common in taxonomic literature for Macrolepidoptera (especially
Noctuidae) and is preferred here.
Tortrix viridana Linnaeus, 1758 Fig. 5
Lph = 0,87 mm, Lv ~ 1 mm. Phallus curved, with large coecum; vesica large, wider
than the phallus, cylindrical, apically narrowed. Vesica bearing a large, bag-like di-
verticulum on right side near middle; right side of diverticulum with 6 cornuti in two
regular and parallel rows. The cornuti are stout, heavily sclerotised non-deciduous and
conical, with large bases (sockets) and no neck (neck is a constriction at base). The
proximal cornuti are almost half the length of the distal ones.
Acleris boscanoides Razowski, 1959 Fig. 6
Lph = 0,42 mm, Lv ~ 0,28 mm. Phallus cylindrical, slightly ventrally curved, with a
long semi-membranous area which is is part of the vesica when everted, on the ventral
side and a relatively large, ventrally-pointed coecum; vesica is also cylindrical, shorter
than the phallus and bears a large diverticulum beginning subdorsally from the right
side; diverticulum heart-shaped in lateral view with two groups of long, stout, non-
deciduous cornuti similar to these in 7! viridana. The dorsal group consists of four and
the lateral of two cornuti. A single cornutus is located ventrally on the vesica between
the phallus and diverticulum.
Obraztsoviana maculosana (Haworth, 1811) Fig. 7
Lph = 0,63 mm, Lv = 0,26 mm. The phallus with long coecum (1/3 of the phallus’
length), the opening is dorsally located. The distal half is dorsally membranous and
formed by the vesica. The vesica has numerous hollow cornuti divided into three
groups. The proximal group consists of 13 on the dorsal base of the vesica, mostly
laterally, on both sides. The medial group consists of 4 cornuti one of which is the larg-
est on the vesica. The distal group is formed from numerous relatively small cornuti.
Vesica is bulbous in the medial area and cylindrical in the distal part. The bulbous part
bears the longest cornutus, located dorsally. The distal half is curved to the right and
290 ZLATKOV: Everted vesicae of leafrollers
then anterad so that the apical part is anteriorly directed. The gonopore is narrow and
located on the left side of the bulbous part of the vesica.
Aethes tornella (Walsingham, 1898) Fig. 8
Only one specimen was examined. Lph = 0,6 mm, Lv ~ 0,5 mm. Phallus tubular, ven-
trally curved, with a relatively long coecum. A slightly sclerotised plate covers the
distal half of the dorsal part of the vesica when it is inverted within the phallus. After
eversion this plate is located on the right side. Phallus with spoon-like apex ventrally.
Vesica huge compared to the phallus and has a complicated structure. It is divided into
two large sections. The right section is dorso-laterally directed and bears three short
and wide diverticula, one lateral and two medial, positioned one under another. The left
section is directed laterally and bears two diverticula. The gonopore is located on the
upper surface of the left section. There is a small slightly sclerotised process nearby.
The whole surface of the vesica, with exception of the basal part, is covered with small
weak spine-like processes (spinulae) which are smaller in size and denser on the left
section.
Cochylidia implicitana (Wocke, 1856) Fig. 9
Lph = 0,5 mm. Boundary between the phallus and vesica indistinct, so Lv was not
measured. Phallus curved ventrally, with a very short coecum and a narrow terminally
located opening. Coecum with two hemispherical prominences laterally. The distal part
of the phallus bears a sharp, conical spine. The dorsal half is mostly membranous,
cup-shaped, without a distinct border with the vesica. The basal region of the vesica
is dorsally sclerotised and near to this region bears 10 hard, hollow cornuti, which are
actually sclerotised projections of vesica. The next part of the vesica is directed at first
to the right and then to the left. The surface of the distal half is covered with small non-
sclerotised spinulae that are denser in the apical area. The apical area ends with a stro-
bile-shaped structure on the left side consisting of numerous, dense weakly-sclerotised
spines. The location of the gonopore is undefined.
Eana canescana (Guenée, 1845) Fig. 10
Lph = 0,95 mm, Lv ~ 0,3 mm. Phallus tubular, slightly ventrally curved; vesica rela-
tively simple, S-shaped (curved first dorsally then ventrally) bearing large conical di-
verticulum located dorsolaterally and directed to the right.
Cnephasia cupressivorana (Staudinger, 1871) Fig. 11
Lph = 0,68 mm, Lv ~ 0,20 mm. Phallus long and narrow (only 0,03 mm in the narrow-
est part), widened at the basal half near the dorsally located opening; coecum relatively
Nota lepid. 33 (2): 285-300 291
Figs 9-12. Everted vesicae of Tortricidae. 9. Cochylidia implicitana. a. Left view. b. Dorsal view. 10. Eana
canescana. a. Left view. b. Dorsal view. 11. Cnephasia cupressivorana. a. Left view. b. Dorsal view.
12. Ptycholoma lecheana. Left view. Scale = 0.5 mm.
short and ventrally curved. The distal half of the right wall is mainly membranous with
the exception of its medial region, which is well-sclerotised and has a small tooth near
the end; vesica extremely simple, short and cylindrical, with small bulbous extension
near the base.
Ptycholoma lecheana (Linnaeus, 1758) Fig. 12
Lph = 1,3 mm, Lv ~ 0,6 mm. Phallus fairly straight and laterally flattened; coecum with
a large flat sclerotised envelope. The end of the phallus bears a larger ventro-terminal
process and a smaller dorsal spine; vesica relatively short, small, with two diverticula
on the left side. Dorsal diverticulum shorter and almost conical, directed anteriorly;
ventral diverticulum finger-like, with 4 short cornuti (deciduous?) at its apex.
Aphelia ferugana (Hübner, 1793) Fig. 13
Lph = 0,76 mm, Lv ~ 0,4 mm. Phallus cylindrical, base ventrally bent, with short co-
ecum, apex with short sharp ventral process; vesica also cylindrical, with constriction
at the base, bearing two diverticula on the left side, one short and one long. The shorter
one is directed antero-dorsally, and the longer one is directed postero-ventrally. The
longer diverticulum ends with two long, deciduous, sword-shaped cornuti, ca. 0,36 mm
long. The gonopore is located terminally.
292 ZLATKOV: Everted vesicae of leafrollers
Figs 13-16. Everted vesicae of Tortricidae. 13. Aphelia ferugana. a. Left view. b. Dorsal view. 14. Spar-
ganothis pilleriana. a. Left view. b. Dorsal view. 15. Olindia schumacherana. a. Left view. b. Dorsal view.
16. Bactra robustana. a. Left view. b. Dorsal view. Scale = 0.5 mm.
Sparganothis pilleriana (Denis & Schiffermüller, 1775) Fig. 14
Only one specimen was examined. Lph = 0,7 mm, Lv - 0,6 mm. Phallus tubular,
slightly laterally flattened and ventrally curved; opening wide, located ventrally. In
this region the phallus forms a dome-like prominence on the right side. A weakly scle-
rotised plate is present at the distal end of phallus in its dorsal part. Vesica tubular,
apically narrowed, with bulbous expansion at the distal third; bulbous expansion with
eight sword-shaped deciduous cornuti, each ca. 0,43 mm long. The point of attachment
of each cornutus is laterally located and divides the cornutus into two unequal parts.
The shorter part posteriorly directed and curved at the end and longer (proximal) part
almost straight. The attachment points of the cornuti are arranged alternatively, into
two annular rows.
Olindia schumacherana (Fabricius, 1787) Fig. 15
Only one specimen was examined. Lph = 0,75 mm, Lv = 0,30 mm. Phallus tubular,
slightly ventrally curved with two small,lateral claw-like processes at apex; coecum
Nota lepid. 33 (2): 285-300 293
Figs 17-20. Everted vesicae of Tortricidae. 17. Endothenia marginana. a. Left view. b. Dorsal view.
c. Detail of cornuti. 18. Lobesia indusiana. Left view. 19. Orthotaenia undulana. a. Left view. b. Ventral
view. 20. Olethreutes arcuellus. a. Left view. b. Dorsal view. Scale = 0.5 mm.
short with sclerotised basal apodemes; vesica very simple, without any sclerotised
structures, tubular at the proximal part and widening at the distal part, with two short,
wide diverticula dorsally and ventrally; ventral diverticulum larger than dorsal.
Bactra robustana (Christoph, 1872) Fig. 16
Lph ~ 0,23 mm. Phallus curved downwards and then bent to the left; coecum absent;
vesica directed to the right, reduced and indistinguishable from the ductus ejaculato-
rius. There are two eversible sclerotised plates on the vesica: dorsal and left, divided by
the membranous parts of the vesica. Three annular structures are visible on the ductus
(possibly an artifact?).
Endothenia marginana (Haworth, 1811) Fig. 17
Only one specimen was examined. Lph = 0,50 mm, Lv = 0,25 mm. Phallus ventrally
bent with a ventrally located, anterior opening; dorsally bearing a well sclerotised
294 ZLATKOV: Everted vesicae of leafrollers
carina; coecum short; diameter of vesica almost equal to the diameter of the phal-
lus. The vesica has 7 fixed, dorso-lateral cornuti on the left side arranged into lon-
gitudinal rows; distal cornuti shorter than proximal cornuti. A collar-like, slightly
sclerotised extension is present at the end of the vesica, around the gonopore. The
extension forms very indistinct diverticula at left and at right. The cornuti are stout,
each with a bulbous base set in a shallow pit and with an indistinct neck. Ductus
relatively wide.
Lobesia indusiana (Zeller, 1847) Fig. 18
Lph = 0,7 mm. Phallus heavily sclerotised, apically pointed, slightly ventrally bent,
with a short carina on the ventral aspect; distal half dorsally membranous. Vesica al-
most completely reduced, conical and directed anteriorly, without any specific struc-
tures. Although many specimens were examined, the location of the primary gonopore
remains undefined.
Orthotaenia undulana (Denis & Schiffermiiller, 1775) Fig. 19
Dang (1993) described the vesica of this species for the first time. Lph = 0,63 mm,
Lv ~ 0,55 mm. Phallus slightly flattened laterally and ventrally curved, without a co-
ecum and with two membranous sections: dorsal and ventral. There is an extension of
the wall of the phallus starting venterolaterally from the left side and ending on the
ventral side of the vesica. A stout cornutus with socketed base present at the end of this
sclerotised band. Vesica cylindrical, bent to the left; gonopore sunk between two short
and wide, indistinct diverticula.
Olethreutes arcuellus (Clerck, 1759) Fig. 20
Lph = 0,59 mm, Lv ~ 0,38 mm. Phallus slightly ventrally and laterally (at right) curved
and lacking a coecum; dorsal and right side of the distal half membranous; vesica al-
most cylindrical, wider than the phallus and curved to the right. The ductus ejaculato-
rius is much narrower than vesica, which bears two groups of non-deciduous cornuti.
Proximal group subdorsally located consisting of four long spines arranged in a row in
line with the long axis. Distal group dorsolaterally located, on the left side comprising
seven shorter cornuti arranged in two longitudinal rows.
Pelatea klugiana (Freyer, 1836) Fig. 21
Only one specimen was examined. Lph = 0,5 mm, Lv ~ 0,18 mm. Phallus cylindri-
cal and slightly ventrally curved; distal third membranous dorsally; vesica very short,
spherical bearing two tiny, indistinct prominences located dorsolaterally and a large,
short and spherical ventral diverticulum.
Nota lepid. 33 (2): 285-300 295
Figs 21—24. Everted vesicae of Tortricidae. 21. Pelatea klugiana. a. Left view. b. Dorsal view. 22. Ancylis
achatana. a. Left view. b. Dorsal view. c. Bundle of cornuti. d. Single cornutus. 23. Thiodia citrana. a. Left
view. b. Dorsal view. 24. Epinotia abbreviana. a. Left view. b. Dorsal view. Scale = 0.5 mm (except Fig. 22d).
Ancylis achatana (Denis & Schiffermiiller, 1775) Fig. 22
Lph = 0,62 mm, Lv = 0,37 mm. Phallus almost straight, narrow and cylindrical, with a
very short coecum; distal third with membranous areas on both sides; vesica with two
very indistinct diverticula located dorsolaterally on both sides. The cornuti are remark-
able, numbering between 55 and 60, located on the right side, forming a compact group.
They are deciduous and during eversion all of them were separated from the vesica as a
compact formation. Their main part is cylindrical, sharp at the distal end and curved in
the direction of vesica. In the basal half they have two flat lateral prominences. There
is a group of several spicules located almost in the middle of each cornutus, located on
side which is opposite to the vesica; each cornutus attached by a thin fragile slightly
curved and terminally located neck (Fig. 31).
Thiodia citrana (Hübner, 1796-99) Fig. 23
Lph = 0,90 mm, Lv - 0,50 mm. Phallus dorsally curved and slightly narrowed apically;
coecum very short. Only the proximal third of the right side is sclerotised; the remain-
ing part is membranous and merges into the vesica. A large prominence is present at
296 ZLATKOV: Everted vesicae of leafrollers
the left side near the apex, covered by several blunt spines. The vesica is relatively
short, cylindrical, bearing ca. 10 long, flat, lanceolate, deciduous cornuti located at the
left side and pointed anteriorly. These are indistinctly S-shaped and joined by a small
neck in their sub-apical region to the vesica. On the opposite side, the vesica has a
slightly sclerotised plate and in non-everted vesica this plate envelops the cornuti as a
semi-cylinder.
Epinotia abbreviana (Fabricius, 1794) Fig. 24
Lph = 0,50 mm, Lv ~ 0,40 mm. Phallus cylindrical and almost straight; opening locat-
ed slightly laterally (on the right); coecum absent. Vesica cylindrical without any spe-
cific characters apart from 16 deciduous cornuti, ca. 0,35 mm long. These are S-shaped,
flat, lanceolate and located on the dorsal side in a compact group directed anteriorly.
Basal part relatively narrow, apical part wider, curved ventrally and tapering at the end.
Each cornutus is joined to the vesica by a typical setal base, located subapically on the
ventral side of the cornutus.
Cydia amplana (Hübner, 1796-99) Fig. 25
Lph = 0,90 mm, Lv ~ 0,40 mm. Phallus sinuate, the proximal part dorsoventrally flat-
tened, wide and the distal part laterally flattened; opening terminally located, coecum
absent. A short dentate crest on the left side of the apical part. Vesica short, membra-
nous, dorsally directed to the right. The short and tubular base is followed by a wider
and bulbous section with numerous longitudinal folds covered by very short fingerlike
processes. This part is followed by the ductus ejaculatorius without any distinct bound-
ary evident between them.
Grapholita lunulana (Denis & Schiffermüller, 1775) Fig. 26
Lph = 0,58 mm, Lv ~ 0,3 mm. Phallus well sclerotised, distally narrowed, without a
coecum; distal part slightly curved to the left; ventral and left surfaces with spicules;
vesica relatively wide, dorsolaterally directed consisting of two parts: proximal section
more or less spherical and almost twice as wide as the narrowest part of the phallus;
distal section narrower, bulbous bearing a compact bundle of 13—15 anteriorly directed
deciduous cornuti, similar to those found in Epinotia and Thiodia. Cornuti lanceolate,
flat and wide, slightly sinuate; point of attachment subbasally located.
Pammene splendidulana (Guenée, 1845) Fig. 27
Lph = 0,57 mm, Lv ~ 0,35 mm. Phallus cylindrical, slightly dorsally bent, with a big
fingerlike process on the ventral side of the apical part; opening terminally located,
coecum missing. Basal part of vesica narrow, cylindrical, followed by a much wider,
Nota lepid. 33 (2): 285-300 297
Figs 25-28. Everted vesicae of Tortricidae. 25. Cydia amplana. a. Left view. b. Dorsal view. c. Detail of
vesica. 26. Grapholita lunulana. a. Right view. b. Dorsal view. 27. Pammene splendidulana. Left view.
28. Gypsonoma minutana. a. Left view, vesica inverted. b. Dorsal view, vesica inverted, without cornuti.
c. Single cornutus, ventral and lateral view. Scale = 0.5 mm.
dorsally-pointed bulbous part. There are two fixed, cylindrical, well-sclerotised cornuti
on the ventral side, with bases socketed and similar to those of E. marginana, but a
neck is absent.
Discussion
Tortricid vesicae are rather variable but, with the exception of Cochylini, the main form
is cylindrical. The vesica in the Tortricinae is usually longer and more variable when
compared with the Olethreutinae. Both representatives of Tortricini (Tortrix viridana
and Acleris boscanoides) are characterized by a cylindrical vesica with a large diver-
ticulum at the right side bearing stout, socketed and fixed cornuti. The vesica is more
variable in the Cochylini, and in all examined species is rather voluminous. In contrast
to all other tribes, the gonopore is located laterally; the ductus ejaculatorius is much
narrower than the vesica. Cornuti (if present) are non-deciduous, but obviously differ-
298 ZLATKOV: Everted vesicae of leafrollers
cornuti
en,
sclerotized projections modified setae
of vesica (Cochylini)
deeidugns (Archipini,
Sparganothini,
Enarmonuni, Eucosmini
Grapholitini)
SF NF
non-deciduous (fixed) deciduous
non-deciduous
(Tortricini, some
Olethreutini)
>
Fig. 29. Types of cornuti observed in Tortricidae.
ent in comparison to the other tribes. Apparently the cornuti in all examined Cochylini
are sclerotised spiniform projections of the vesica. The vesica of Cnephasiini is rela-
tively narrow, corresponding to a narrow phallus, simple, with a short bubble-shaped
part. None of species studied possessed cornuti. The species of Archipini show several
common characters in the design of the vesica. It is cylindrical, with an apical gonopore
and deciduous or fixed cornuti are attached to the end of a diverticulum. Usually the
vesica has a second diverticulum, without cornuti, located near the first one (see also
Dang, op. cit.). Although only one representative of Sparganothini was examined, the
vesica shows similarity with some Olethreutine species: it is large, apically narrowed
and without a distinct boundary with the ductus. The cornuti are very long, as long as
the phallus, deciduous, numerous and attached to the vesica with sockets, in the same
way as in the Eucosmini and some Grapholitini — with a short neck located basolater-
ally on the cornutus. Moreover, the cornuti are slightly sinuate and directed anteriorly.
Only one species from Chlidanothinae was studied and no conclusions on the struc-
ture of the vesica could be made. The vesica of O. schumacherana is similar to the
Cnephasiini vesicae.
The vesica in the Olethreutinae is less varied, always with an apically located gonopore
and often shortened. In Bactra robustana (Bactrini), the vesica is very simple, like a
membranous extension of the phallus, very short, and without a distinct border with the
ductus. In the Olethreutini the vesica is relatively varied, sometimes reduced (Lobesia)
or shortened (Pelatea). The cornuti, if present, are non-deciduous, socketed, well scle-
rotised cylindrical spines. Ancylis achatana (Enarmoniini) has a long field with cornuti
on the vesica; this field is restricted in the tribes described below. The deciduous cornuti
are dorsoventrally flattened, similar to those in Eucosmini and Grapholitini, but the
basal neck is apically located. The vesicae of all studied Eucosmini show significant
similarity. They are tubular, relatively long and have a bundle of many (more than 10)
deciduous, socketed lanceolate, flat cornuti attached to the vesica by a short basolateral
neck, and always anteriorly directed. The other typical character is a sclerotised plate
on the vesica, opposite the cornuti. It is visible without eversion as a semi-cylindrical
Nota lepid. 33 (2): 285-300 299
Ne. NN N ns N '
cc’ aw 4 eer. 0,01 mm
N \ . VO x N N X x
NN SK _ LR"
ÿ N
Figs 30-32. Details of structures of phallı in Tortricidae. 30. Vesica with cornuti of Grapholita lunulana.
a. intact setal base of cornutus; b. socketed base, cornutus has broken off; c. basolateral neck of cornutus
broken off. 31. Basal part of cornutus of Ancylis achatana. The arrow shows terminal and slightly curved
fragile neck broken off. Phase contrast. 32. Basal part of cornutus of Gypsonoma minutana. The arrow
shows basolateral neck of the cornutus broken off. Phase contrast.
plate enveloping cornuti. In many cases thıs plate makes the vesica non-eversible (I did
not managed to evert vesica of Eucosma metzneriana (Treitschke, 1830), Gypsonoma
minutana (Hübner, 1796-99) (Fig. 28), Epiblema graphanum (Treitschke, 1835),
Notocelia uddmanniana (Linnaeus, 1758), or N. trimaculana (Haworth, 1811)). The
vesica of the Grapholitini is similar to that of the Eucosmini, but has a more prominent
bulbous part. Cornuti, if present, may be deciduous and flat (e. g. Grapholita) as in
Eucosmini or non-deciduous and cylindrical (e. g. Pammene) as in some Olethreutini.
Usually, cornuti in the Tortricidae are divided into two types: deciduous and non-decid-
uous, but this classification appears to be artificial because of different origin of these
types. I observed two further types of cornuti.
The first type includes sclerotised projections of the vesica. In fact they are non-decid-
uous. These cornuti are hollow and their cavities are not separated from the lumen of
the vesica. This is typical for some Cochylini.
The second type includes structures certainly derived from setae. They are very com-
mon among many representatives of the family. Setaceous cornuti could be non-de-
ciduous (fixed) or deciduous. Fixed cornuti are usually cylindrical, heavily sclerotised
(Tortricini, Olethreutini), sometimes with an indistinct neck at the base (Endothenia).
Deciduous cornuti are flat, tapered at both ends and have a basal (Archipini, Enarmoniini
(Fig. 31)) or basolateral (Sparganothini, Eucosmini (Figs 28c, 32), Grapholitini) thin
and fragile constriction (neck) which is broken during copulation (Fig. 30). Types of
cornuti observed in Tortricidae are shown on Fig. 29.
Conclusion
This modified eversion technique allows better inflation of the vesica for examination
of its three-dimensional structure. Some species have a non-eversible vesica due to
300 ZLATKOV: Everted vesicae of leafrollers
presence of a sclerotised plate enveloping the cornuti. Usually the vesica in examined
species is cylindrical and slightly wider than the distal end of the phallus. The gonopore
is located terminally. In most cases the diameter of the vesica does not significantly
exceed the diameter of ductus ejaculatorius. An exception to this rule is seen within
the tribe Cochylini in which there is a very wide, voluminous vesica and a laterally
located, narrow gonopore, respectively ductus ejaculatorius. It is most probable that the
structure of the everted vesica could be used for resolving taxonomic problems in many
genera. However, significant similarity in combination with simplicity of the vesicae in
Eucosmini and Grapholitini may limit its usefulness. A careful study of specific charac-
ters (including number, position and morphology of cornuti, dimensions of vesica etc.)
is likely to be useful for distinguishing closely related species.
Acknowledgements
I would like to thank Colin W. Plant (Bishops Stortford, England) and Paul Sokoloff (Kent, U. K.) for the
help with the English language, Joaquin Baixeras (Spain) for providing literature, and the Editor and the
reviewers for precious comments that improved the earlier version of the manuscript.
References
Baixeras, J. & M. Dominguez 1992. Remarks on two species of Tortricidae new to Spain (Lepidoptera). —
Nota lepidopterologica, suppl. 4: 97—102.
Baixeras, J. 2002. An Overview of Genus-Level Taxonomic Problems Surrounding Argyroploce Hübner
(Lepidoptera: Tortricidae), with Description of a New Species. — Annals of the Entomological Society
of America 95 (4): 422—431.
Brown, J. W. 2003. An illustrated guide to the Orthocomotis Dongin (Tortricidae) of Costa Rica, with
summaries of their spatial and temporal distribution. — Journal of Lepidopterological Society 57 (4)
253-269.
Dang, P. T. 1993. Vesicas of selected tortricid and small lepidopterous species, with descriptions of new
techniques of vesica eversion (Lepidoptera: Tortricidae, Oecophoridae, Gelechiidae, and Nepticuli-
dae). — The Canadian Entomologist 125: 785-789.
Ferris, C. D. 2004. Anew species of Passadenoides Neunzig from Wyoming and New Mexico (Lepidoptera:
Pyralidae: Phycitinae). — Zootaxa 705: 1-8.
Ferris, C. D. & J. S. Nordin 2004. Taxonomic note on Sareta tephrella (Lepidoptera: Pyraloidea: Pyralidae:
Phycitinae). — Zootaxa 569: 1-7.
Kristensen, N. P. 2003. Skeleton and muscles: adults. Pp. 39-131. — Jn: N.P. Kristensen, Lepidoptera,
moths and butterflies. Vol. 2, Morphology, physiology, and development. — Part 36. — Jn: M. Fischer,
Handbook of Zoology. Vol. IV, Arthropoda: Insecta. — x11 + 564 pp., Berlin, New York.
Lange, A. B. 1963. Some microsurgical instruments and adjustments. — Zoologicheskiy zhurnal 42: 8
1257—1260 [In Russian, with English summary].
Matthews, M. 1998. The CSIRO vesica everter: a new apparatus to inflate and harden eversible and other
weakly sclerotised structures in insect genitalia. — Journal of Natural History 32: 317-327.
Razowski, J. 2002. Tortricidae of Europe. Vol. 1. Tortricinae and Chlidanothinae. — Slamka, Bratislava.
247 pp.
Razowski, J. 2003. Tortricidae of Europe. Vol. 2. Olethreutinae. — Slamka, Bratislava. 301 pp.
302 Reply
Reply of the author to the book review by V. V. Zolotuhin published in Nota lepi-
dopterologica 33(1): 173-175
I always eagerly await the next, new issue of Nota lepidopterologica. With the arrival the 1“
part of volume 33, much to my surprise I found on pages 173-175 an extensive review of
my book devoted to the African Thyretini (Thyretini of Africa. An Illustrated catalogue of the
Thyretini (Lepidoptera: Arctiidae: Syntominae) of the Afrotropical Region). My astonishment
was caused by the fact that I had not expected an extrapalaearctic topic to be included in the
scope of a journal focusing entirely on the Palaearctic Lepidoptera.
After publication of the book I was anticipating some constructive criticism and correction of
mistakes from my fellow lepidopterists through a book review.
The review written by Vadim V. Zolotuhin may well confuse readers of Nota lepidopterologica
since the leading critical argument is based on the fact that the reviewer wished to see an exten-
sive monograph rather than an “illustrated catalogue”. In general however, the review leaves
the reader with the impression that the book is poorly prepared, full of obscurities and, in what
is probably the core conclusion, does not deliver the content suggested by its title. I absolutely
do not agree with such an opinion and below I present some contra arguments to Zolotuhins’
Statements.
First of all I must refute the suggestion that the book was ever intended to be “a revision-mon-
ograph”. This term, in the sense of taxonomy, is widely understood as a comprehensive treat-
ment of a taxon. Extensive revisions (monographs) typically revise all known species within
a group, add any newly discovered species, and assemble and synthesize all available infor-
mation on the ecological associations, geographic distributions, and morphological variations
within the group (http://en.wikipedia.org/wiki/Monograph; http://www.e-taxonomy.eu). This
term was neither used in the book nor in any advertisements preceeding its publication. It was
only treated as such by the reviewer: “Thus, this monograph, by Dr Lukasz Przybytowicz from
Cracow, is particularly welcome”. Instead of being a revisionary monograph the book was re-
peatedly defined by me as “an Illustrated Catalogue”, “a comprehensive, illustrated catalogue”
or “present catalogue” as I was always aware it does not aspirate to be any kind of revisionary
monograph. This misunderstanding of the type of publication resulted in so numerous, critical
“wishes” of the reviewer. Before starting the work on the catalogue, I evaluated the present
state of knowledge of Thyretini and highlighted the most useful and feasible way to treat the
topic. Such pre-evaluation of the problems allowed me to formulate the statements which were
later elaborated in the book:
Preparation of the complete catalogue of the species-group taxa of the tribe Thyretini based
on the examination of all available primary types. I should say that the former catalogue of
Kiriakoff (1960) omitted several old taxa and naturally did not cover those described later.
It also did not give any data on the type locality and the deposition of the types. In order to
prepare such a catalogue I examined all of the 333 primary types except in a few cases (lost,
destroyed or inaccessible) and these are marked in the text. The quality of many of them (in-
cluding genital preparations) did not allow a detailed comparison to be made with similar taxa.
The real problem arose in that a large number of very similar species were described on the
basis of a single specimen (this is especially the case in the descriptions of Kiriakoff). The di-
agnostic characters presented in the original descriptions were very often so minor and obscure
or compared to more morphologically distant species. The lack of drawings of genital details
and photos of the habitus precluded any reliable taxonomic conclusions. The only solution to
this problem is indeed an extensive revision based on morphological and molecular characters
made on extensive material from a large area. As there is little chance of such an analysis in
Nota lepid. 33 (2): 179-186 303
the foreseeable future I decided to retain many the taxa in their present status, even though they
might be changed after future comprehensive studies. | am convinced that the synonymiza-
tions should be done on a solid base of data and knowledge, since implementing many new
synonyms would only make the systematics of theThyretini even more complicated and cum-
bersome. Faced with such a situation, I compiled the full list of all known species-group taxa
accompanied with taxonomic and nomenclatorial data as well as remarks. I hope I succeeded in
preparing a publication which summarizes all the information which can be useful as a basis for
a more detailed study of the Afrotropical Thyretini in the future.
Preparation of the iconography. I am very well aware that curators and collectors badly need
the images of the habitus of every species. I was willing to make the book more useful for a
broader audience of readers and therefore, I decided to illustrate each available species. This
was my second target while preparing the book. Here again I met the same problems of similar
species known only from unique specimens. As the book was always intended to be a scientific
catalogue and not an album, atlas or an illustrated field guide I decided to use the type speci-
mens rather than fresh specimens with higher quality. This approach ensured that the specimens
represented the proper, described species. The short, explanatory information is given on the
8" page of the catalogue. The same procedure was followed while preparing images of male
and female genitalic structures. Here again I was forced in numerous cases to show old, badly
preserved preparations. The quality of the slides was not good but I intended to present to the
reader how the particular taxon was described, based on slides of the type specimens. I am
proud and happy that I managed to gather on just a few plates almost ALL representatives of
Afrotropical Thyretini what in my opinion is really a great help for collectors and curators.
I noticed that in most cases Thyretini are usually left as unsorted material in collections.
Preparation of short descriptions. Having the catalogue and illustrations I decided to add some
short information on each species. Here again a large number of controversial taxa unfortu-
nately resulted in a number of unclear statements. Such a situation was, however unavoidable,
bearing in mind the poor taxonomic knowledge of the group and the lack of material from
poorly studied genera or species groups. I would like to add that in many cases, however, short
diagnoses accompanied by illustrations and the checklist of the group are helpful in identifying
even superficially similar species. The Reviewer’s comment on the lack of descriptions of lar-
val morphology and the biology of species is strange and groundless. It is a widely known truth
that the immature stages and biology of many groups of tropical moths are almost unknown.
While preparing the book I did what I could to find all published information dealing with all
aspects of Thyretini and ALL this information, even old and trifling, is presented under the rel-
evant species. However, I never intended, as the reviewer wished, to undertake the additional
study of chaetotaxy, morphology or developmental biology based on preserved material.
After assembling and analyzing all the original descriptions, and references dealing with any
kind of topic related to Thyretini, I realized that nothing more could be added with present
stage of knowledge without extensive and detailed studies. I also hoped and assumed that the
presentation of the main clusters of information on Afrotropical Thyretini (the catalogue, illus-
trations, short taxonomic and nomenclatorial notes on each species) in one book would be wel-
comed by the lepidopterists and would encourage both professionals and amateurs to undertake
more thorough and detailed studies on this fascinating group of tropical Arctiids.
I kindly ask the reader of Nota lepidopterologica to allow me to briefly respond to the critical
remarks of V. V. Zolotuchin. I shall follow the numeration presented in his review.
As it was stressed above the book is a catalogue and not a revision and its aim is certainly not
the in depth study of the entire range of all aspects of the species‘ variability. Let me leave
the comments on the layout as the subjective opinion of the reviewer. The implementation of
distribution maps in the catalogue, given the scarcity of data on the species distribution at the
moment, was never my intention.
Diagnostic characters are given as precisely as the accumulated material allowed. Furthermore,
I intentionally abbreviated them as this chapter is rather an addition to the catalogue. I repeat
again that the title of the book clearly indicates that it is a catalogue and not a comprehensive
morphological revision.
Identification keys are generally NEVER provided in the catalogues.
A detailed discussion on the complicated and /or controversial taxa based on such a small
amount of available material is not possible at the moment and this can be done only after
accumulating new information. I hope and believe that lepidopterists, including the reviewer
himself, will revise the genera or complexes of species of Arctiidae, and Afrotropical Thyretini
in particular.
“The author’s point of view” is exceptionally clear. The genus Pseudothyretes shows a very
strong sexual dimorphism and homogeneous habitus of each sex. The discovery of conspicuous
differences ın the male genitalia (depicted on plate 16) enables easy differentiation of species
within this genus based on males. The females are still a “black hole” and further taxonomic
speculations seem pointless. Again, I stress that my “short statements” are only remarks to the
catalogue and illustrations and they are not a revisional elaboration of the group under consid-
eration.
The final judgement on the usefullness and the helpfulness of the book will be made by its us-
ers. The book reflects the current stage of knowledge and it should be treated only as the start-
ing point for further study. It summarised all published data and indicates how much should be
still done to get a clearer picture on the diversity of Afrotropical Thyretini. So, it certainly is
“the first comprehensive tool facilitating the identification”. It is true that a lepidopterist having
this one book only is able now to identify the Afrotropical Thyretini specimens as far as it is
possible with the present state of knowledge.
Regretfully I should conclude that it would have been better that the reviewer had read more
attentively the title of the book he was reviewing. It is obvious that he confused two types of
publications — catalogues and revisions. It is also very regretful that the editorial board of Nota
lepidopterologica, consisting of outstanding European lepidopterists, allowed publication of
such an unfounded critical review in a journal not specialising in the Afrotropical region.
LUKASZ PRZYBYLOWICZ
Nota lepid. 33 (2): 305-307 305
Nota lepidopterologica index to volumen 33 by taxon and author names,
with publication dates.
Publication dates
No. 1: p. 1- 175: 15.05.2010; No. 2: p. 177— 307: 24.01.2011
Contents
Blackstein, H. & Karisch, T. 2011 (24.1.). Zur Wicklerfauna Tunesiens (Tortricidae). 33 2010 (2): 219-229.
Cupedo, F. 2010 (15.v.). A revision of the infraspecific structure of Erebia euryale (Esper, 1805) (Nym-
phalidae: Satyrinae). 33 (1): 85-106.
Dinc|, V., Kolev, Z. & Verovnik, R. 2010 (15.v.). The distribution, ecology and conservation status of the
Spinose Skipper Muschampia cribrellum (Eversmann, 1841) at the western limit of ist range in Europe
(Hesperiidae). 33 (1): 39-57.
Fibiger, M., Larsen, K. & Buchsbaum, U. 2011 (24.1.) Phauda bicolor sp. n. from North Sumatra (Indo-
nesia) (Zygaenidae: Phaudinae). 33 (2010) (2): 263-269.
Gaedike, R. 2010 (15.v.). New and poorly known Palaearctic Microlepidoptera (Tineidae, Acrolepiidae,
Douglasiidae, Epermeniidae). 33 (1): 9-24.
Gaedike, R. & Tokar, Z. 2010 (15.v.). Pelecystola fraudulentella (Zeller, 1852) discovered in Slovakia, a
third locality record (Tineidae). 33 (1): 25-29.
Hofmann, A. & Keil, T. 2011 (24.1.) Contribution to the knowledge of the genus Zygaena Fabricius, 1775,
in Iran (Zygaenidae). Part IX: On two newly discovered Mesembrynus taxa from the central and south-
ern Zagros range. 33 (2010) (2): 231—245.
Kallies, A. & Bartsch, D. 2010 (15.v.). Revision of some types of the genus Bembecia Hiibner, 1819 in the
Püngeler collection of the Museum for Natural History of the Humboldt University, Berlin (Sesiidae).
33 (1): 81-84.
King, G. E. & Viejo Montesinos, J. L. 2010 (15.v.). Geometrid larvae and their food-plants in the south of
Madrid (Central Spain)(Geometridae). 33 (1): 155-171.
Kolev, Z. 2010 (15.v.). A significant range extension for Pyrgus cacaliae (Rambur, 1839) with the first re-
cord from the western Balkan Peninsula (Hesperiidae). 33 (1): 107—113.
Koponen, S., Kullberg, J., Kaila, L. & Kozlov, M. 2011 (24.1.) Obituary for Jukka Jalava (1950-2005). 33
(2010) (2): 187-189.
Kristensen, N. P. & Gaedike, R. 2010 (15.v.) Extraordinary moths and an extraoredinary moth researcher:
An essay review of G. S. Robinson’s Biology, distribution and diversity of tineid moths. 33 (1): 3-8.
Langmaid, J. R., Sattler, K. & Lopez-Vaamonde, C. 2011 (24.1.) Morphology and DNA barcodes show that
Calybites hauderi does not occur in the British Isles (Gracillariidae). 33 (2010) (2): 191-197.
Lehmann, L. 2011 (24.1.) Lithostege stadiei sp.n. from North Iran (Geometridae: Larentiinae). 33 (2010)
(2): 249-251.
Nuss, M. 2011 (24.1.) Obituary for Yuri P. Nekrutenko (1936-2010). 33 (2010) (2): 179-186.
Przybylowicz, L. 2011 (24.1.) Reply: 33 (2011) (2): 302-304.
Przybylowicz, L. & Sammut, P. 2011 (24.1.) Eilema marcida (Mann, 1859) — A new species for Malta with
remarks on the other members of Maltese Lithosiinae (Arctiidae). 33 (2010) (2): 253-259.
Räkosy, L., Tartaly, A., Goia, M., Mihali, C. & Varga, Z. 2010 (15.v.). The Dusky Large Blue — Maculinea
nausithous kijevensis (Sheljuzhko, 1928) in the Transylvanian basin: New data on taxonomy and eco-
logy. 33 (1): 31-37.
Schmid, J. 2011 (24.1.) Teleiopsis laetitiae sp. n. and Teleiopsis lindae sp. n., two hitherto overlooked moun-
tainous European species (Gelechiidae: Teleiodini)). 33 (2010) (2): 271-283.
Segerer, A. H., Haslberger, A. & Grünewald, T. 2011 (24.1.) Occurrence of Olethreutes subtilana (Falko-
vitsh, 1959) in Central Europe uncovered by DNA barcoding (Tortricidae: Olethreutinae). 33 (2010)
(2): 209-218
Shovkoon, D. F. 2010 (15.v.). A new subspecies of Hyles siehei (Püngeler) from the deserts of Central Asia
(Sphingidae). 33 (1): 67-79.
Nota lepidopterologica, 24.01.2011, ISSN 0342-7536
306 Index to volume 33 by taxon and author names, with publication dates
Shovkoon, D. F. 2010 (15.v.). New and little-known Ethmiidae (Gelechioidea) from Central Asia. 33 (1):
135-154.
Solovyev, A. V. 2010 (15.v.). Review of the genus Flavinarosa Holloway (Zygaenoidea: Limacodidae)
with description of four new species. 33 (1): 115-126.
Stefanescu, C. & Päramo, F. 2010 (15.v.). Frogs eat butterflies: temporary prey-specialization on the Painted
Ladey butterfly, Vanessa cardui, by Sahara frog, Pelophylax saharicus, in the Moroccan Anti Atlas.
33 (1): 127-131.
Toth, J. P., Bereczki, J., Spring, N. & Varga, Z. 2011 (24.1.) Dispersal ability and habitat selection in Me-
litaea telona kovacsi Varga, 1967 and M. phoebe (Denis & Schiffermiiller, 1775) (Nymphalidae) in
steppe grassland. 33 (2010) (2): 199-207
Tränkner, A. & Nuss, M. 2010 (15.v.). Anania ochrofascialis (Christoph) comb. n. and A. murcialis Ra-
gonot) comb. n. — two vicarious species from the western Palaearctic region (Pyraloidea: Crambidae:
Pyraustinae). 33 (1): 59-65.
Vis, R. 2010 (15.v.). Recent geographic range expansion of Brephidium exilis (Baoisduval, 1852) (Lycae-
nidae) in Oman, Arabian Peninsula. 33 (1): 133-134.
Zlatkov, B. 2011 (24.1.). A preliminary study of everted vesicae of several leafrollers (Tortricidae). 33 (2010)
(2): 285-300.
Book reviews. 33 (1): 3-8, 30, 173; 33 (2011) (2): 246, 252, 260, 270.
Corrigenda: 33 (2011) (2): 178.
Nota lepidopterologica index to volumen 33 by taxon and author names, with publication dates (R. Gae-
dike): 33 (2010) (2): 305—307
Index of taxonomical changes
acantha sp. n. (Flavinarosa) — Solovyev, A. V. 2010 (15.v.): 33 (1): 121.
albolinella sp. n. (Ethmia) — Shovkoon, D. F. 2010 (15.v.): 33 (1): 146.
asymmetricum sp. n. (Tinagma) — Gaedike, R. 2010 (15.v.): 33 (1): 20.
auricaudata (Bartel, 1912)(Bembecia), stat. rev., not a synonym of Dipsosphecia viguraea (Pingeler,
1912) - Kallies, A. & Bartsch, D. 2010 (15.v.): 33 (1): 83.
bicolor sp. n. (Phauda) — Fibiger, M., Larsen, K. & Buchsbaum, U. 2011 (24.1.): 33 (2010) (2): 264.
corsica sp. n. (Infurcitinea) — Gaedike, R. 2010 (15.v.): 33 (1): 14.
falkovitshi sp. n. (Ethmia) — Shovkoon, D. F. 2010 (15.v.): 33 (1): 138.
hoppei sp. n. (Aethes) — Blackstein, H. & Karisch, T. 2011 (24.1.): 33 (2010) (2): 221.
iberica sp. n. (Infurcitinea) — Gaedike, R. 2010 (15.v.): 33 (1): 13.
kirghizstana Zagulajev, 2002 (Fermocelina), comb. n.; now: Ceratuncus — Gaedike, R. 2010 (15.v.): 33
(1): 16.
kozyavka sp. n. (Flavinarosa) — Solovyev, A. V. 2010 (15.v.): 33 (1): 121.
laetitiae sp. n. (Teleiopsis) — Schmid, J. 2011 (24.1.): 33 (2010) (2): 273.
lindae sp. n. (Teleiopsis) — Schmid, J. 2011 (24.1.): 33 (2010) (2): 276.
luna sp. n. (Flavinarosa) — Solovyev, A. V. 2010 (15.v.): 33 (1): 120.
macropodella Erschoff, 1874 (Tineola), LT, syn. n. of Pararhodobates syriacus (Lederer, 1857) — Gaedike,
R. 2010:.(15:v.): 33 (1): 10.
mirzayansi Sp. n. (Zygaena) - Hofmann, A. & Keil, T. 2011 (24.1.): 33 (2010) (2): 242.
murcialis Ragonot, 1895 (Botys (Phlyctaenia)), comb. n.; now: Anania — Tränkner & Nuss 2010 (15.v.):
33 (1): 62.
nykta sp. n. (Ethmia) — Shovkoon, D. F. 2010 (15.v.): 33 (1): 140.
ochrofascialis Christoph, 1882 (Metasia), comb. n.; now: Anania — Tränkner & Nuss 2010 (15.v.): 33
(1): 60.
pseudoadyte ssp. n. (Erebia euryale) — Cupedo, F. 2010 (15.v.): 33 (1): 98.
ptaha sp. n. (Flavinarosa) — Solovyev, A. V. 2010 (15.v.): 33 (1): 123.
Nota lepid. 33 (2): 305-307 307
romanica Cäpuse, 1966 (Infurcitinea) stat. rev. No synonym of /nfurcitinea olympica Petersen, 1958 —
Gaedike, R. 2010 (15.v.): 33 (1): 15.
stadiei sp. n. (Lithostege) — Lehmann, L. 2011 (24.1.): 33 (2010) (2): 249.
svetlana ssp. n. (Hyles siehei) — Shovkoon, D. F. 2010 (15.v.): 33 (1): 69.
tsvetajevi Gorbunov, 1992 (Bembecia), syn. n. of Bembecia polyzona (Püngeler, 1912) — Kallies, A. &
Bartsch, D. 2010 (15.v.): 33 (1): 83.
valii ssp. n. (Zygaena fredi) — Hofmann, A. & Keil, T. 2011 (24.1.): 33 (2010) (2): 238.
wagneri Püngeler, 1912 (Dipsosphecia), syn. n. of Bembecia viguraea (Püngeler, 1912) — Kallies, A. &
Bartsch, D. 2010 (15.v.): 33 (1): 83.
zelleri Zagulajev, 1992 (Reisserita), not Caradja, 1920 — Gaedike, R. 2010 (15.v.): 33 (1): 17.
=
SOCIETAS EUROPAEA LEPIDOPTEROLOGICA CV:
Nota lepidopterologica wird als wissenschaftliche Zeitschrift von der Societas Europaea
Lepidopterologica (SEL) herausgegeben und den Mitgliedern der SEL zugesandt. Autoren, die
Manuskripte für die Publikation in der Nota lepidopterologica einreichen möchten, finden die
jeweils gültigen Autorenrichtlinien auf der Homepage der SEL unter http://www.soceurlep.eu.
Der Verkauf von Einzelheften und älteren Jahrgängen von Nota lepidopterologica sowie der Ver-
kauf der Zeitschrift an Nichtmitglieder erfolgt durch Apollo Books, Kirkeby Sand 19, DK-5771
Stenstrup; e-mail: [email protected]. Die Mitgliedschaft bei der SEL steht Einzel-
personen und Vereinen nach Maßgabe der Satzung offen. Der Aufnahmeantrag ist an den
Mitgliedssekretär Willy De Prins, Dorpstraat 401 B, B-3061 Leefdaal, Belgien; e-mail:
[email protected] zu richten. Das Antragsformular ist im Internet auf der Homepage der
SEL erhältlich. Der Mitgliedsbeitrag ist jährlich am Jahresanfang zu entrichten. Er beträgt für
Einzelpersonen € 35,00 bzw. für Vereine € 45,00. Die Aufnahmegebühr beträgt € 2,50. Die
Zahlung wird auf das SEL-Konto 19 56 50 507 beı der Postbank Köln (BLZ 370 100 50) erbeten
(IBAN: DE63 3701 0050 0195 6505 07; BIC: PBNKDEFF). Mitteilungen in Beitragsangelegen-
heiten werden an den Schatzmeister Dr. Robert Trusch, Staatliches Museum für Naturkunde,
Erbprinzenstr. 13, 76133 Karlsruhe, Germany; e-mail: [email protected] erbeten. Adressenände-
rungen sollten umgehend dem Mitgliedssekretär oder dem Schatzmeister mitgeteilt werden.
Published by the Societas Europaea Lepidopterologica (SEL), Nota lepidopterologica is a scientific
journal that members of SEL receive as part of their membership. Authors who would like to submit
papers for publication in Nota lepidopterologica are asked to take into consideration the relevant
instructions for authors available on the SEL homepage at http://www.soceurlep.eu. The sales
of single and back issues of Nota lepidopterologica as well as sales to non-members of SEL are
under the responsibility of Apollo Books, Kirkeby Sand 19, DK-5771 Stenstrup; e-mail: apollo-
[email protected]. The membership is open to individuals and associations as provided for by
the statutes of SEL. Applications for membership are to be addressed to the Membership Secretary
Willy De Prins, Dorpstraat 401 B, B-3061 Leefdaal, Belgium; e-mail: [email protected].
The application form is available on the SEL homepage. The annual subscription is to be paid at
the beginning of the year. It is 35.00 € for individuals or 45.00 € for associations. The admission
fee is 2.50 €. Dues should be paid to SEL account no. 19 56 50 507 at Postbank Köln [Cologne]
(bank code 370 100 50; IBAN: DE63 3701 0050 0195 6505 07; BIC: PBNKDEFF) or to local
treasures as mentioned on the website. Communications related to membership contributions
should be sent to the Treasurer Dr Robert Trusch, Staatliches Museum fiir Naturkunde,
Erbprinzenstr. 13, 76133 Karlsruhe, Germany; e-mail: [email protected]. Changes of addresses
should be immediately communicated to the Membership Secretary or the Treasurer.
Publié par la Societas Europaea Lepidopterologica (SEL), Nota lepidopterologica est un périodique
scientifique envoyé a tous les membres de la SEL. Les auteurs qui désirent publier des manuscrits
dans la revue sont priés de tenir compte des Instructions aux auteurs disponibles sur le site Web de
la SEL: http://www.soceurlep.eu. Les ventes de numéros supplémentaires ou d'anciens numéros
de Nota lepidopterologica, ainsi que les ventes de numéros aux personnes n'étant pas membres
de la SEL sont sous la responsabilité de Apollo Books, Kirkeby Sand 19, DK-5771 Stenstrup;
courriel: [email protected]. Tel que prévu dans ses statuts, les individus de méme que
les associations peuvent devenir membres de la SEL. Les demandes d'adhésion doivent être
envoyées au Secrétaire responsable des adhésions, Willy De Prins, Dorpstraat 401 B, B-3061
Leefdaal, Belgique; courriel: [email protected]. Le formulaire d'adhésion est disponible sur
le site Web de la SEL. L'adhésion se paie au début de l'année. Elle est de 35 € pour les
individus et de 45 € pour les associations. Les frais d'admission sont de 2,50 €. Les paiements
peuvent être envoyés au compte de la SEL: no. 19 56 50 507, Postbank Köln [Cologne] (code
bancaire 370 100 50; IBAN: DE63 3701 0050 0195 6505 07; BIC: PBNKDEFF) ou au trésorier
local tel que mentionné sur le site Web.. Toute question en rapport avec l'adhésion doit être envoyée
au Trésorier, Dr. Robert Trusch, Staatliches Museum fiir Naturkunde, Erbprinzenstr. 13, 76133
Karlsruhe, Germany; courriel: [email protected]. Tout changement d'adresse doit être mentionné
immédiatement au Secrétaire responsable des adhésions ou au Trésorier.
wii