Volume 11 Number 3 2 October 2023
The Taxonomic Report
OF THE INTERNATIONAL LEPIDOPTERA SURVEY
ISSN 2643-4776 (print) / ISSN 2643-4806 (online)
Butterfly classification and species discovery using genomics
Jing Zhang'**, Qian Cong', Jinhui Shen'”, Leina Song'”, and Nick V. Grishin’
Departments of 'Biophysics, 7Biochemistry, and 7Eugene McDermott Center For Human Growth & Development,
University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390-9050, USA;
“Corresponding author: [email protected]
ABSTRACT. Genomic sequencing of worldwide butterfly fauna followed by phylogenetic analysis of protein-coding
genes informs butterfly classification throughout the taxonomic hierarchy, from families to species. As a rule, we attribute the
same taxonomic rank to more prominent clades of comparable divergence (i.e., at the same level in the tree). For species
delimitation, we use criteria based on relative genetic differentiation and the extent of gene exchange between populations. We
analyze the current taxonomic classification of butterflies in the light of genomic phylogenies and encounter clades that
correspond to yet unnamed taxa. As a result, 11 tribes, 33 subtribes, 2 genera, 11 subgenera, and 12 species are proposed as
new. New tribes are: in family Nymphalidae Rafinesque, 1815: in subfamily Heliconiinae Swainson, 1822: Vindulini Grishin,
trib. n. (type genus Vindula Hemming, 1934) and Algiini Grishin, trib. n. (type genus A/gia Herrich-Schaffer, 1864),
Lebadeini Grishin, trib. n. (type genus Lebadea C. Felder, 1861, in subfamily Limenitidinae Behr, 1864), and Amnosiini
Grishin, trib. n. (type genus Amnosia E. Doubleday, 1849, in subfamily Pseudergolinae Jordan, 1898) and in family
Lycaenidae [Leach], [1815]: in subfamily Aphnaeinae Distant, 1884: Cigaritini Grishin, trib. n. (type genus Cigaritis Donzel,
1848) and Axiocersini Grishin, trib. n. (type genus Axiocerses Hubner, [1819]) and in subfamily Theclinae: Drinini Grishin,
trib. n. (type genus Drina Nicéville, 1890), Hypochrysopini Grishin, trib. n. (type genus Hypochrysops C. Felder & R. Felder,
1860), Jalmenini Grishin, trib. n. (type genus Ja/menus Hubner, 1818), Pseudalmenini Grishin, trib. n. (type genus
Pseudalmenus H. H. Druce, 1902), and Rapalini Grishin, trib. n. (type genus Rapala F. Moore, 1881). New subtribes are: in
Papilionidae Latreille, [1802], Meandrusina Grishin, subtrib. n. (type genus Meandrusa F. Moore, 1888, in Papilionini
Latreille, [1802]); in Pieridae Swainson, 1820: Gandacina Grishin, subtrib. n. (type genus Gandaca F. Moore, 1906, in
Coliadini Swainson, 1821), Hebomoiina Grishin, subtrib. n. (type genus Hebomoia Hubner, [1819], in Anthocharidini
Scudder, 1889), and Pseudopierina Grishin, subtrib. n. (type genus Pseudopieris Godman & Salvin, 1890, in Dismorphiini
Schatz, 1886); in Nymphalidae: Lachnopterina Grishin, subtrib. n. (type genus Lachnoptera E. Doubleday, 1847, in Algiini
Grishin, trib. n.), in Vagrantini Pinratana & Eliot, 1996: Terinosina Grishin, subtrib. n. (type genus Terinos Boisduval, 1836)
and Smerinina Grishin, subtrib. n. (type genus Smerina Hewitson, 1874), in Adoliadini Doubleday, 1845: Evenaina Grishin,
subtrib. n. (type genus Evena Westwood, 1850) and Pseudathymina Grishin, subtrib. n. (type genus Pseudathyma Staudinger,
1891), and Kumothalina Grishin, subtrib. n. (type genus Kumothales Overlaet, 1940, in Cymothoini Dhungel & Wahlberg,
2018); in Riodinidae Grote, 1895 (1827): Teratophthalmina Grishin, subtrib. n. (type genus Teratophthalma Stichel, 1909, in
Mesosemiini Bates, 1859), Argyrogrammanina Grishin, subtrib. n. (type genus Argyrogrammana Strand, 1932, in
Symmachiini Reuter, 1896), in the tribe Calydnini Seraphim, Freitas & Kaminski, 2018: Echenaidina Grishin, subtrib. n. (type
genus Echenais Hubner, [1819]) and Echydnina Grishin, subtrib. n. (type genus Echydna J. Hall, 2002), and Cariina Grishin,
subtrib. n. (type genus Caria Hubner, 1823, in Riodinini Grote, 1895 (1827); in Lycaenidae: Megalopalpina Grishin, subtrib.
n. (type genus Megalopalpus Rober, 1886, in Miletini Reuter, 1896), Pseudaletidina Grishin, subtrib. n. (type genus
Pseudaletis H. H. Druce, 1888, in Cigaritini Grishin, trib. n.), in Aphnaeini Distant, 1884: Aloeidina Grishin, subtrib. n. (type
genus Aloeides Hubner, [1819]) and Phasisina Grishin, subtrib. n. (type genus Phasis Hubner, [1819]), Pilodeudorigina
Grishin, subtrib. n. (type genus Pilodeudorix H. H. Druce, 1891, in Rapalini Grishin, trib. n.), Hemiolaina Grishin, subtrib. n.
(type genus Hemiolaus Aurivillius, 1922, in Oxylidini Eliot, 1973), Cupidopsina Grishin, subtrib. n. (type genus Cupidopsis
Karsch, 1895, in Hypotheclini Eliot, 1973), and in tribe Polyommatini Swainson, 1827: Theclinesthina Grishin, subtrib. n.
(type genus Theclinesthes Rober, 1891), Azanina Grishin, subtrib. n. (type genus Azanus F. Moore, 1881), Unina Grishin,
subtrib. n. (type genus Una Nicéville, 1890), Ionolycina Grishin, subtrib. n. (type genus Jonolyce Toxopeus, 1929),
Pithecopina Grishin, subtrib. n. (type genus Pithecops Horsfield, 1828), Zizulina Grishin, subtrib. n. (type genus Zizula
Chapman, 1910), Jamidina Grishin, subtrib. n. (type genus Jamides Hubner, [1819]), Fameganina Grishin, subtrib. n. (type
genus Famegana Eliot, 1973), Oboroniina Grishin, subtrib. n. (type genus Oboronia Karsch, 1893), and Uranothaumatina
Grishin, subtrib. n. (type genus Uranothauma Butler, 1895); and in Hesperiidae Latreille, 1809, Cupithina Grishin, subtrib. n.
(type genus Cupitha F. Moore, 1884, in Astictopterini Swinhoe, 1912). The new genera are Balenga Grishin, gen. n. (type
1
species Proteides balenge Holland, 1891, in Gretnini Grishin, 2019) and Tulsia Grishin, gen. n. (type species Parnara tulsi
Nicéville, 1884, in Baorini Doherty, 1886). New subgenera are: in Pieridae, Lirinia Grishin, subgen. n. (type species Terias
lirina H. Bates, 1861, in genus Pyrisitia A. Butler, 1870); in Nymphalidae: Hyperanartia Grishin, subgen. n. (type species
Vanessa dione Latreille, [1813], in genus Hypanartia Hubner, [1821]) and Paranartia Grishin, subgen. n. (type species
Hypanartia hippomene Hubner, [1823], in genus Vanessa [Fabricius], 1807); in Lycaenidae, Auricirrus Grishin, subgen. n.
(type species Papilio thysbe Linnaeus, 1764, in genus Chrysoritis Butler, 1898); and in Hesperiidae: /soc/eros Grishin, subgen.
n. (type species Pamphila (?) mackenii Trimen, 1868, in genus Acleros Mabille, 1885), Mesna Grishin, subgen. n. (type
species Parnara leucophaea Holland, 1894, in genus Fresna Evans, 1937), Lippina Grishin, subgen. n. (type species Carystus
telesinus Mabille, 1878, in genus Xanthoneura Eliot, 1978), Ganda Grishin, subgen. n. (type species Zophopetes ganda Evans,
1937, in genus Leona Evans, 1937), Zarida Grishin, subgen. n. (type species Hesperia lacida Hewitson, 1876, in genus Gretna
Evans, 1937), and in genus Gegenes Hiibner, 1819: Flanga Grishin, subgen. n. (type species Parnara perobscura H. H. Druce,
1912), and Havea Grishin, subgen. n. (type species Hesperia havei Boisduval, 1833). New species are: in Nymphalidae:
Microtia elvira Grishin, sp. n. (type locality in the USA: AZ, Pima/Santa Cruz Cos.) and Cyllopsis brocki sp. n. (type locality
in Mexico: Sonora, Yécora), in Riodinidae, Argyrogrammana astuta Grishin, sp. n. (type locality in Peru: Madre de Dios), in
Hesperiidae: Cecropterus (Thorybes) rockiensis Grishin, sp. n. (type locality in USA: CO, Jefferson Co.), Cecropterus
(Thorybes) floridianus Grishin, sp. n. (type locality in USA: FL, Volusia Co.), Cecropterus (Thorybes) oaxacensis Grishin, sp.
n. (type locality in Mexico: Oaxaca), Nascus (Bron) lux Grishin, sp. n. (type locality in Brazil: Amapa), Cogia chiagua
Grishin, sp. n. (type locality in Guatemala), Celotes sabinus Grishin, sp. n. (type locality in USA: AZ, Pima Co.), Acleros togo
Grishin, sp. n. (type locality in Togo), Ceratrichia notata Grishin, sp. n. (type locality in Central African Republic), and
Semalea malawi Grishin, sp. n. (type locality in Malawi). Furthermore, we elevate a tribe to subfamily, resurrect 3 tribes, 3
subtribes, 5 genera (and confirm 1), 3 subgenera, change the rank of 5 currently recognized tribes to subtribes (and confirm 1),
10 genera to subgenera, synonymize 4 genera, and present evidence to support 21 taxa as species instead of subspecies and 3
taxa as subspecies instead of synonyms. Namely, we reinstate Liphyrinae Doherty, 1889 as a subfamily (was a tribe of
Miletinae Reuter, 1896), treat the following as tribes: Leptidiini Grote,1897 (in Dismorphiinae Schatz, 1886) and in Theclinae
Swainson, 1830: Surendrini Kogak & Seven, 1997 (not a subtribe of Arhopalini Bingham, 1907) and Myrinini Toxopeus, 1929
(not a synonym of Amblypodiini Doherty, 1886), and subtribes: Callidryina Kirby, 1896 and Gonepterygina Verity, 1920 (in
Coliadini Swainson, 1821), Abrotina Hemming, 1960 and Bebearitna Hemming, 1960 (in Adoliadini Doubleday, 1845), and
Sarotina Bridges, 1988 (in Helicopini Stichel, 1928). We confirm Libytheana Michener, 1943 as a valid genus, not a junior
subjective synonym of Prolibythea Scudder, 1889 and resurrect from synonymy the following genera: Pseudanaphaeis
Bernardi, 1953 (not Be/enois Hubner, [1819]), Charmion Nicéville, 1894 (not Celaenorrhinus Hubner, [1819]), Sape Mabille,
1891 (not Sarangesa F. Moore, [1881]), Milena Evans, 1912 (not Caltoris Swinhoe, 1893) and subgenera: Neofieldia
Ozdikmen, 2008 and Bassaris Hubner, [1821] of Vanessa [Fabricius], 1807 and Spindasis Wallengren, 1857 of Cigaritis
Donzel, 1848. We change the status of the following taxa from tribes to subtribes: Nathalina Balint, 2022 and Kricogonina
Balint, 2022 of Euremini Grote, 1898, Tarakina Eliot, 1973 of Spalgini, 1929, Horagina Swinhoe, 1910 and Loxurina Swinhoe,
1910 of Cheritrini Swinhoe, 1910, and Niphandina Sibatani & Ito, 1942 of Polyommatini; from genus to subgenus: Leucidia E.
Doubleday, 1847 of Abaeis Hubner, [1819], Cesa Seven, 1997 of Crudaria Wallengren, 1875, Paralycaeides Nabokov, 1945
of /tylos Draudt, 1921, Eldoradina Balletto, 1993 of Nabokovia Hemming, 1960, Pyrrhochalcia Mabille, 1904 of Coeliades
Hubner, 1818, Paracleros Berger, 1978 of Acleros Mabille, 1885, Mopala Evans, 1937 of Leona Evans, 1937, Afrogegenes
Jong & Coutsis, 2017 and Torbenlarsenia Kemal & Kocgak, 2020 of Gegenes Htibner, 1819, and Zenonoida Fan & Chiba, 2016
of Zenonia Evans, 1935; and from genus to junior subjective synonym: Vansomerenia Heath, 1997 of Chloroselas Butler,
1886, Ceratricula Larsen, 2013 of Paronymus Aurivillius, 1925, Xanthodisca Aurivillius, 1925 of Semalea Holland, 1896,
Perrotia Oberthtr, 1916 of Galerga Mabille, 1898. The following taxa are species, not subspecies or synonyms: Pyrisitia
mayobanex (M. Bates, 1939), stat. nov. and Pyrisitia memulus (A. Butler, 1871), stat. rest. (not Pyrisitia dina (Poey, 1832)),
Abaeis gratiosa (E. Doubleday, 1847), stat. rest. and Abaeis angulata (Wallengren, 1860), stat. rest. (not Abaeis arbela
(Geyer, 1832)), Teriocolias doris (Rober, 1909), stat. rest. (not Teriocolias deva (E. Doubleday, 1847)), Vanessa
madegassorum (Aurivillius, 1899), stat. nov. (not Vanessa hippomene (Hubner, 1823)), Eresia (Anthanassa) seminole Skinner,
1911, stat. rev. (not Eresia (Anthanassa) texana (W. H. Edwards, 1863)), Cecropterus (Thorybes) albosuffusa (H. Freeman,
1943), stat. nov. and Cecropterus (Thorybes) indistinctus (Austin & J. Emmel, 1998), stat. nov. (not Cecropterus (Thorybes)
pylades (Scudder, 1870)), Cogia hiska Evans, 1953, stat. nov. (not Cogia hippalus (W. H. Edwards, 1882)), Cogia moschus
(W. H. Edwards, 1882), stat. rest. (not Cogia caicus (Herrich-Schaffer, 1869)), Pholisora albicirrus Glassberg 2023, stat.
nov. (not Pholisora catullus (Fabricius, 1793)), Acleros (Isocleros) instabilis Mabille, 1889, stat. rest. and Ac/eros (Isocleros)
olaus (Pl6tz, 1884), stat. rest. (not Acleros ([socleros) mackenii (Trimen, 1868)), Fresna (Mesna) bassa (Lindsey & L. Miller,
1965), stat. nov., comb. nov. (not Meza leucophaea (Holland, 1894)), Paronymus volta (L. Miller, 1971), stat. nov., comb.
nov. (not Meza cybeutes (Holland, 1894)), Paronymus indeterminabilis (Strand, 1912), stat. rest., comb. nov. and Paronymus
congdoni (Larsen, 2013), stat. nov., comb. nov. (not Ceratricula semilutea (Mabille, 1891)), Semalea corvinus (Mabille,
1890), stat. rest. (not Semalea sextilis (Plotz, 1886)), Xanthoneura patmapana (Fruhstorfer, 1911), stat. nov. (not
Xanthoneura corissa (Hewitson, 1876)), Gretna capra Evans, 1937, stat. nov. (not Gretna carmen Evans, 1937), and Lerodea
dysaules Godman, 1900, stat. rest. (not a synonym of Lerodea arabus (W. H. Edwards, 1882)), while Vernia verna sequoyah
(H. Freeman, 1942), stat. rest. (not a synonym of Vernia verna W. H. Edwards, 1862) and Euphyes vestris osceola (Lintner,
1878), stat. rev. (not a synonym of Euphyes vestris vestris (Boisduval, 1852)) are subspecies. In addition, we propose new
genus-species combinations: Pyrisitia amelia (Poey, [1852]), Pyrisitia lirina (H. Bates, 1861), Abaeis paulina (H. Bates,
2
1861), Abaeis xantochlora (Kollar, 1850), Abaeis fabiola (C. Felder & R. Felder, 1861), Abaeis tupuntenem (Lichy, 1976), and
Abaeis adamsi (Lathy, 1898) (not Eurema Hubner, [1819]), Shijimia potanini (Alphéraky, 1889) (not Tongeia Tutt, 1908),
Fresna (Mesna) larea (Neave, 1910), Fresna (Mesna) leucophaea (Holland, 1894), Fresna (Mesna) mabea (Holland, 1894),
Paronymus banda (Evans, 1937), Paronymus cybeutes (Holland, 1894), Paronymus elba (Evans, 1937), Paronymus gardineri
(Collins & Larsen, 2008), Paronymus indusiate (Mabille, 1891), and Paronymus mabillei (Holland, 1893) (not Meza
Hemming, 1939), Paronymus punctata (Holland, 1896) (not Ceratrichia Butler, 1870), Galerga ariel (Mabille, 1878) (not
Xanthodisca Aurivillius, 1925), I[soteinon anomoeus (Pl6tz, 1879), Isoteinon bruno (Evans, 1937), Isoteinon inornatus
(Trimen, 1864), and /soteinon punctulata (A. Butler, 1895) (not Astictopterus C. Felder & R. Felder, 1860), Borbo gemella
(Mabille, 1884) (not Torbenlarsenia Kemal & Kogak, 2020), and Gegenes (Torbenlarsenia) cottrelli (Larsen, 2013), Gegenes
(Torbenlarsenia) fallax (Gaede, 1916), Gegenes (Torbenlarsenia) fanta (Evans, 1937), Gegenes (Torbenlarsenia) micans
(Holland, 1896), and Gegenes (Torbenlarsenia) sirena (Evans, 1937) (not Borbo Evans, 1949); and a new species-subspecies
combination Cogia hiska hester Evans, 1953 (not Cogia hippalus). Acleros nyassicola Strand, 1921 is a junior subjective
synonym of Acleros (Isocleros) olaus (Pl6tz, 1884), not of Acleros (Isocleros) mackenii (Trimen, 1868). We transferred the
tribes Oxylidini Eliot, 1973, Remelanini Eliot, 1973, and Hypolycaenini Swinhoe, 1910 from Theclinae Swainson, 1831 to
Polyommatinae Swainson, 1827. We conclude that [No genus] osibius Draudt, 1924 is an unavailable name. The lectotype is
designated for Eudamus caicus Herrich-Schaffer, 1869 (type locality likely in Mexico: Oaxaca, as deduced by sequence
comparison), and the neotype is designated for Telemiades solon P\6tz, 1882 (type locality becomes Brazil: Bahia). The type
localities of Ceratrichia punctata Holland, 1896 and Osmodes staudingeri Holland, 1896 are Sierra Leone: Freetown and
Cameroon: Efoulan, respectively, as determined from the locality labels of primary type specimens. Finally, we provide
taxonomic lists for Euremini (to worldwide subgenera and American species) and Lycaenidae (to subtribes).
Additional keywords: taxonomy, classification, genomics, phylogeny, biodiversity.
ZooBank registration: http://zoobank.org/I9CAA87E5-B1FE-4948-BD3B-EFAA9B95575D
INTRODUCTION, CONCEPTS, AND METHODS
This work continues a series of studies derived from genomic sequencing of butterflies and uses the same
principles and methods (Cong et al. 2019a, b; Li et al. 2019; Zhang et al. 2019a—d; Cong et al. 2020;
Zhang et al. 2020; Cong et al. 2021; Zhang et al. 2021; Robbins et al. 2022; Zhang et al. 2022b, c; Zhang
et al. 2023c,e). The goal is to improve butterfly classification through genomic data analyses. The
approach is that of screening. Specimens of various taxa throughout the butterfly phylogeny worldwide
are selected. The emphasis is placed on species recorded from the United States, and specimens across the
range are taken for each species. Most specimens come from collections, both museum and private (see
acknowledgments section for their list); specimen age varies from ~250 years to recently collected.
Whenever possible, we sequence primary type specimens to have an objective reference for the name
(Zhang et al. 2022a). Primarily, legs are used for DNA extraction. Our protocol is non-destructive, and
legs are preserved. Extracted DNA is fragmented (unless a specimen is old and its DNA is already short)
and sequenced at 150 bp on Illumina next-generation sequencing platform. We do not rely on the
amplification of specific genes or segments, and every extracted DNA piece is sequenced. Therefore, the
protocol succeeds with very old specimens, in which DNA may be fragmented into 30—50 bp segments.
Sequence data (1.e., sequence segments of 150 bp or shorter) of each specimen are used to
assemble exons of protein-coding genes as guided by a reference genome available for the
phylogenetically closest species. These protein-coding genes are used for phylogeny reconstruction. Three
trees are constructed using IQtree v1.6.12 under the GTR+GAMMA model (Nguyen et al. 2015): from
autosomes in the nuclear genome, the gene predicted to be in the Z chromosome, and the mitochondrial
genome. To decrease computational load, 100,000 codons (resulting in 300,000 base pairs, about 2% of
the total) are randomly selected from the entire dataset to use for the nuclear trees. Statistical support for
branches is estimated from 100 replicates of 10,000 codons each, sampled from the total set of codons,
and trees are constructed from each replicate. Statistical support value (from 0 to 100) is simply the
number of replicates with a particular bipartition identical to the one in the 100,000-codon tree. For
further methods details, see our previous publications (Li et al. 2019; Zhang et al. 2022b).
The resulting trees were visualized, rotated, and colored in FigTree (Rambaut 2018). The current
taxonomic classification was overlaid on the trees to find non-monophyletic taxa and clades
corresponding to taxa without names. Genomic trees frequently reveal “levels,” 1.e., timepoints when
diversification occurred in several lineages independently (Zhang et al. 2021). These “synchronized”
3
diversifications result from geological events affecting all major lineages at the same time, offering an
opportunity to match taxonomic ranks (tribe, subtribe, genus, subgenus) to the levels in genomic trees,
which leads to a more objective and internally consistent classification tied to both genetic differentiation
and paleontological history. In classification decisions, we strongly rely on genomic trees and use
morphological considerations as secondary evidence to rationalize the results. This is because, contrary to
a small set of gene markers, genomes offer a comprehensive picture of an organism richer than the
morphology of adults typically used to classify butterflies. Genomes encode life histories, habitat and
mating preferences, and food sources. All this information is present in the genomic sequence. While we
lack the knowledge to extract it and predict phenotypes, we can use a genetic equivalent of this
information in an aggregate, in a way that the organism balances it in its genome (we select random
codons from all protein-coding genes), to deduce phylogenetically sound taxonomic classification.
Taxa we define are monophyletic groups in nuclear genome trees that correspond to prominent
clades. By “prominent,” we mean tree branches strongly supported statistically (typically by 100% of
replicates) and usually longer than neighboring branches. The length of a branch is proportional to the
number of base-pair substitutions along the branch. Not only are longer branches better supported
statistically, but the larger number of genetic changes along them likely leads to more pronounced
phenotypic changes that should be reflected in some morphological characters, not necessarily in adults,
but could be in immature stages or other aspects of the phenotype. Nevertheless, due to highly non-linear
relationships between the number of genetic changes and visually drastic phenotypic differences (Zhang
et al. 2019a), there are short tree branches that correspond to visually recognizable taxa, and each case
should be considered individually. It is unclear, however, if some drastic phenotypic change in adult
appearance that was caused by a small number of genetic changes (maybe even a single inversion of a
genomic segment) should be grounds for erection of a separate taxon for this lineage because all other
characters, e.g., those of caterpillars, would remain rather similar to the relatives of this lineage.
Generally, we prefer to avoid monotypic (or nearly monotypic, 1.e., consisting of very close relatives) taxa
unless they cannot be confidently assigned to other taxa of the same rank or show prominent genetic
differentiation from them at the level of the tree that corresponds to their rank. Furthermore, currently
employed taxonomy is considered, and currently used names and their taxonomic ranks serve, on average,
as a reference point to define levels in the trees and new taxa.
Tribes are defined as a prominent level in genomic trees between subfamilies and genera that
supports most tribes as they are currently circumscribed in each subfamily. Subtribes correspond to a
notable tree level between tribes and genera. Genera are defined as the most prominent level in genomic
trees between tribes and species that largely corresponds to the current classification into genera.
Subgenera correspond to a rather prominent level between genera and species. We attempt to define
secondary levels (subtribes and subgenera) in the classification whenever possible if we see noteworthy
clustering of genera or species into groups of relatives prominently differentiated from other such groups.
We find these subdivisions useful in taxonomic lists, even if for no other reason than to place closer
relatives close to each other in alphabetically sorted hierarchical lists.
Species are delineated by a combination of criteria that include genetic differentiation in the Z
chromosome measured by Fs (>0.20 usually corresponds to distinct species) and gene exchange Gmin
(<0.05 for distinct species) (Cong et al. 2019a), COI barcode difference (typically >2% for distinct
species) (Hebert et al. 2003) and its correlation with phenotypic differences (Lukhtanov et al. 2016), and
the prominence of species-level clades (Zhang et al. 2022c). However, COI barcodes (together with
mitochondria) frequently introgress between species (Bachtrog et al. 2006; Cong et al. 2017a), and some
distinct species may possess highly similar or identical barcodes (Burns et al. 2008; Zhang et al. 2023a).
See the “Species, subspecies, and genomics” section in Zhang et al. (2022a) for further discussion.
Sections below are arranged in the taxonomic order deduced from genome-scale phylogeny
complemented by phenotypic considerations. For most new taxa, in addition to brief phenotypic
diagnoses (genitalia terminology follows Carneiro et al. (2013), we use “harpe” for Evans’ “cuiller”
(Evans 1949)) frequently accompanied by references that discuss and illustrate morphological characters
4
in greater detail, we provide diagnostic DNA characters in the nuclear genome and/or (when meaningful)
in the COI barcode. DNA characters are found in nuclear protein-coding regions using our previously
developed procedure (see SI Appendix to Li et al. 2019). The logic behind the character selection was
described in Cong et al. (2019b) and is aimed at finding more robust characters likely to stand when
additional specimens and species are sequenced.
The character states are given in species diagnoses as abbreviations for one of the six reference
genomes: Pterourus glaucus (Linnaeus, 1758) (pg) (Cong et al. 2015), Pieris rapae (Linnaeus, 1758)
(pra) (Shen et al. 2016), Heliconius melpomene (Linnaeus, 1758) (hm) (Davey et al. 2016), Calephelis
nemesis (W. H. Edwards, 1871) (cne) (Cong et al. 2017b), Calycopis cecrops (Fabricius, 1793) (cce)
(Cong et al. 2016), or Cecropterus lyciades (Geyer, 1832) (aly, because this species was formerly in the
genus Achalarus Scudder, 1872) (Shen et al. 2017). E.g., aly728.44.1:G672C means position 672 in exon
1 of gene 44 from scaffold 728 of the Cecropterus lyciades (Geyer, 1832) (aly) reference genome (Shen et
al. 2017) is C, changed from G in the ancestor. When characters are given for the sister clade of the
diagnosed taxon, the following notation is used: aly5294.20.2:A548A (not C), which means that position
548 in exon 2 of gene 20 on scaffold 5294 is occupied by the ancestral base pair A, which was changed to
C in the sister clade (so it is not C in the diagnosed taxon). The same notation is used for COI barcode
characters but without a prefix ending with *:’. The sequences of exons from the reference genome with
the positions used as character states highlighted in green are in the supplemental file deposited at
< https://osf.10/7tngy/ >. This link to the DNA sequences accessible from this publication ensures that
DNA characters given in the diagnoses can be readily associated with actual sequences.
Whole genome shotgun datasets we obtained and used in this work are available from the NCBI
database < https://www.ncbi.nlm.nih.gov/ > as BioProject PRJNA1022154 and BioSample entries of the
project contain the locality and other collection data of the sequenced specimens shown in the trees. For
each specimen in tree figures, the following information is provided (separated by “|’’): taxon name with
comments in square brackets, DNA sample code, type status, general locality, and year of collection
(“old” if not dated and likely collected 100—150 years ago). Type status abbreviations are: HT holotype,
LT lectotype, ST syntype, T type (could be ST, LT, paralectotype, or HT, status not investigated), PT
paratype; and if a synonym name is given (in parenthesis, preceded by “=”, and in addition by “t” for
unavailable names), type status refers to the synonym. COI barcode sequences reported here have been
deposited in GenBank with accessions OR578710—OR578722 and OR589636—OR589640. Several
photographs shown in this work were taken from iNaturalist (2023). Links to observations by observation
number reported in figure legends are < https://www. inaturalist.org/observations/xxx >, where xxx is the
observation number. Abbreviations or acronyms for collections are listed in the acknowledgments section.
Family Papilionidae Latreille, [1802]
Meandrusina Grishin, new subtribe
http://zoobank. org/72EO085A2-EA04-4D25-8124-04A86D17F26B
Type genus. Veandrusa F. Moore, 1888.
Definition. Meandrusa (type species Papilio evan E. Doubleday, 1845 currently treated as a subspecies of
Papilio payeni Boisduval, 1836) was placed in the subtribe Teinopalpini Grote, 1899, but our genomic
trees show that it is not monophyletic with Teinopalpus Hope, 1843 (type species Teinopalpus imperialis
Hope, 1843) and instead is sister to Papilionini Latreille, [1802] with 100% support (Fig. 1). Genetic
differentiation of Meandrusa from Papilionini is approximately the same as of Battus Scopoli, 1777 (type
species Papilio polydamas Linnaeus, 1758) from other Troidini Talbot, 1939 (comparable distance from
the root, Fig. 1). Therefore, we consider that Meandrusa belongs to the tribe Papilionini. However, the
tree shows that Meandrusa is prominently separated from the rest of Papilionini and, therefore, belongs to
a distinct subtribe analogously to Battus. This subtribe does not have a name and is proposed as new. As
detailed by Miller (1987) for Meandrusa, the new subtribe is characterized by bifid tarsal claws and
differs from the rest of Papilionini by strongly incurved middle discocellular vein on the forewing, shorter
5
Baronia brevicornis|16105HO7|Mexico:Mor|1981
100 Bhutanitis lidderdalii]19116A07|India:Assam|1947
100 98 Archon apollinus|19116E10|Turkey|1988
Parnassius apollo|5528|Turkey|1991
Eurytides thyastes|15112E10|Peru|1982
Iphiclides podalirius|20055G12|Greece
i ; Teinopalpus imperialis|17113C07|Vietnam|2016
Battina 700 -Battus polydamas|17116E12|USA:TX,Hidalgo Co.|1972
Battus zetides|19116A03|Dominican Republic|1987
100] Troidina Pharmacophagus antenor|19083C01|Madagascar|2019
ie mo Cressida cressida|19126F07|Australia|1990
; Troides helena|9144|F|Vietnam|2016
Meandrusina we Meandrusa lachinus|17112F06|Thailand|2013
Meandrusa payeni|9315|M|China:Sichuan
ane Heraclides thoas|14081G01|Peru:Tingo Maria|1985
a Wes an Pterourus troilus|4262|USA:IN,Montgomery Co.|2015
Papilionina 7 Chilasa clytia|19083D04|no data
Alexanoria alexanor|14081C11|France|1994
100 Papilio anactus|19083B12|Australia
0.06 100 Papilio demodocus|19083D03|C. African Rep.
100 Papilio helenus|19116D07|Myanmar|2001
Papilio machaon|LADJOO000000|China:Sichuan
100 100
Fig. 1. The phylogenetic tree of selected Papilionidae inferred from protein-coding regions of the nuclear genome (autosomes).
Family-group names are shown above or below the corresponding branches. A new subtribe proposed in this work is shown in
red. Names of other subtribes are shown in black, and names of subfamilies and tribes are shown in shades of gray.
forewing discal cell (less than half of the wing), and scaled tibiae and tarsi, and from Teinopalpini by
scaled antennae and prodiscrimen (equivalent to the prosternum of other insects) with a spine. Visually,
species in the new subtribe are recognized by the distinct shape of curved forewings (especially in males)
with produced and somewhat hooked apex narrowing to a point (less prominently in Meandrusa sciron
(Leech, 1890)). A combination of the following nuclear genomic base pairs is diagnostic: pgl2854.3.1:
A400G, pgl827.10.7:G122A, pgl827.10.7:G138A, pgl1898.30.3:G202A, pgl1397.11.1: GI138A.
Genera included. Only the type genus.
Parent Taxon. Tribe Papilionini Latreille, [1802].
Family Pieridae Swainson, 1820
Lirinia Grishin, new subgenus
http://zoobank. org/A59BC65A-CEE7-4380-8D40-877A90B74CFD
Type species. 7erias lirina H. Bates, 1861.
Definition. Our genomic tree reveals that the 7. Jirina (type locality in Brazil: Para) lineage is mono-
phyletic with neither Abaeis Hiibner, [1819] (type species Papilio nicippe Cramer, 1779) nor Eurema
Hiibner, [1819] (type species Papilio delia Cramer, 1780, a junior homonym, valid name for this species
is Pieris daira Godart, 1819), and instead is a confident sister to all other Pyrisitia A. Butler, 1870 (type
species Papilio proterpia Fabricius, 1775), but is genetically differentiated from them at the level of a
subgenus (Fig. 2). Therefore, we transfer T. lirina to Pyrisitia forming a new combination Pyrisitia lirina
(H. Bates, 1861) and propose that its lineage represents a distinct subgenus of Pyrisitia. This new
subgenus differs from its relatives by the characters given and illustrated for Eurema furtadoi Casagrande
& O. Mielke, 1979 in its original description (Casagrade and Mielke 1979). In brief, wings rounded,
mostly white with black forewing apex, reminiscent of Abaeis albula (Cramer, 1775) (type locality in
Suriname), with which it was lumped in the past (Klots 1929), but with very different genitalia: in males,
uncus broader, with two shot side processes (absent in A. albula); saccus shorter, about the same length as
tegumen with uncus; aedeagus bow-shaped, broader and shorter, twice as long as saccus; valva shaped as
a half-circle, harpe with robust ventral tooth and much smaller vestigial dorsal tooth; in females, corpus
bursae smaller with much smaller signum and a small bubble-shaped appendix (instead of the appendix as
long as corpus). A combination of the following nuclear genomic base pairs is diagnostic: pse1181.9.1:
G68A, pse988.17.1:A57G, pse6193.9.1:G135T, pse5030.21.1:A392T, pse5030.21.1:T376G, pse907.3.2:
A270C, pse1899.1.7:G805A, pse1899.1.7:T806C, pse2087.5.1:C260T, pse102.3.4:C1026G.
6
Etymology. The name is a feminine noun in the nominative singular formed from the type species name.
Species included. Only the type species.
Parent taxon. Genus Pyrisitia A. Butler, 1870.
100
Tribes Subtribes Genera Subgenera
Nathalina Nathalis
=*132|Mya Kricogonia
100
: . 2M Prestoni
Kricogonina Mya resto
Maiva
100
Terias
100
Euremini Uictiai
100
“oo Aliya: Eurema
section
100
Eurema
100
100
Pyrisitia 16 Mya
100
Euremina Ro
Ua Pyrisitia we
100
Lirinia subgen. n.
Leucidia
Lucidia
Abaeis |__|
100 ne
100
Sphaenogona ne
0.04 100 aANya
Abaeis 100
section
Abaeis
100
100
Teriocolias
Nathalis iole|3572|USA:TX,Cameron Co.|2015
Nathalis plauta]19079D05|Colombia|1990
Kricogonia lyside|3423|USA:TX,Cameron Co.|2015
Kricogonia cabrerai|21096A11|HT|Cuba|1914
Prestonia clarki|16104H08|Mexico:0ax|1980
Terias brigitta]19067F02|Cameroon|1987
Terias laeta|19067F09|Myanmar|2001
Terias herla|19078G03|Australia|1968
Terias sari|19067FO7|Myanmar|2015
Terias sarilata|19078H04|Philippines,_Luzon|1985
Terias andersonii|19078F09|Myanmar|2001
Terias celebensis|19078F 12|Indonesia:Bangkei|1885
Terias laceola|19078G04|Javalold
Terias nicevillei|19078G08|Indonesia:Sumatra|1991
Terias puella|19078G11|Papua New Guinea|2011
Terias blanda|19067F08|China:Hong Kong|1988
Terias floricola|19078G06|Cameroon|1989
Terias senegalensis|19078H05|Cameroon|1989
Terias hecabe|20038H12|Thailand
Terias tecmessa|19078G12|Malaysia:Pahang|1990
Terias ada|19078F07|Indonesia:_Lombok|1990
Terias hapale|19078G02|Ethiopia|1957
Terias smilax|19078H01|Australia:NT|1992
Eurema priddyi|21076A09|Dominican Republic|1985
Eurema lucina|19078E11|Cubalold
Eurema daira|4872|USA:FL,Monroe Co.|2015
Eurema elathea|10279|Jamaica|2017
Eurema nigrocincta|19078E12|Ecuador:Loja|2002
Eurema agave|22084E02|Venezuela|1987
Eurema phiale|19078F02|Brazil:DF|1985
Pyrisitia proterpia|10506|Jamaica|2017
Pyrisitia westwoodii|20067E07|Mexico:Gro|1981
to eubai dina|5351|USA:FL,Miami-Dade Co.|2015
We yrisitia parvumbra|10554|Jamaica|2017
Pyrisitia leuce|19078H11|Venezuela|1985
Pyrisitia larae|22083G02|Cuba|1995
Pyrisitia venusta|19079A05|Guyana|2000
700 Pyrisitia chamberlaini|20129A07|Bahamas|1978
Pyrisitia nise]|5207|USA:TX,Starr Co.|2015
Pyrisitia lisa|4880|USA:FL,Monroe Co.|2015
Pyrisitia euterpiformis|19078H12|DR|1994
Pyrisitia amelia|19078E03|Cubal|old
joo Pyrisitia portoricensis|19079A02|Puerto Rico|old
100 Pyrisitia pyro|22084B02|Dominican Republic|2000
Pyrisitia messalina|10508|Jamaica|2017
Pyrisitia lirina|21075H04|Brazil:RO|1994
Abaeis brephos|19063C09|French Guiana|1999
Abaeis elvina|19067HO05|Brazil:RJ|1996
Abaeis albula|22086A07|Suriname|2002
jofibaeis paulina|22085D02|Brazil:RO|1991
Abaeis xantochlora|19078F06|Peru:Cuzco|2016
Abaeis fabiola|19078E10|Peru:Cuzco|2016
Abaeis salome|11922|Mexico:Tam|1972
Abaeis mexicana|6239|USA:TX,Wise Co.|2016
Abaeis boisduvaliana|3357|USA:TX,Hidalgo Co.|2015
Abaeis angulata|19078E05|Peru:Piura|2000
joo Abaeis gratiosa|22085C01|Venezuela:Zulia|1982
Abaeis arbela|19078E06|Brazil:RJ|1995
Abaeis adamsi|19078E01|Jamaica|1984
idpbaeis nicippe|8877|USA:NM, Santa Fe Co.|2017
Abaeis nicippiformis|21075G12|Dominican Republic|1988
Teriocolias deva|19063C07|Bolivia|2009
Teriocolias doris (=pseudomorpha)|20124D11|T|Bolivialold
Teriocolias zelia|19067HO8|Argentina: Tucuman|2013
Teriocolias reticulata|19078F03|Peru:Cuzco|2013
100
100
100
100
100
86
98
100
100
64
T00
100
16
100
100
100
100 100
100
100
100
100
Gonepteryx rhamni|15112H05|Finland|2003
a 100
Coliadini
94
100
Phoebis sennae eubule|3314|USA:TX,San Jacinto Co.|2015
Anteos maerula|10234|USA:TX,Cameron Co.|2017
Catopsilia crocale|19067E07|Taiwan|1973
Fig. 2. The phylogenetic tree of Euremini inferred from protein-coding regions of the nuclear genome (autosomes). Levels in
the tree that correspond to the taxonomic hierarchy are marked above as Tribes, Subtribes, Genera, and Subgenera. The
translucent vertical lime bar denotes the level approximately corresponding to genera. Family-group names (roman font) and
genus-group names (genera in bold italics and subgenera in italics) are shown by corresponding branches. Different genera of
Euremini are shown in different colors. Numbers in cyan on a yellow background followed by “Mya” placed on the right of
several tree nodes indicate the approximate ages of these nodes in million years (rounded) as estimated by Kawahara et al.
(2023); smaller numbers are statistical support values of the tree branches (in %, most are 100% implying high confidence).
The red asterisk denotes Euremini's arrival in the Old World from the New World, and the genus 7Jerias originated as a result.
7
Pyrisitia mayobanex (M. Bates, 1939) and Pyrisitia memulus (A. Butler, 1871)
are species-level taxa
As we previously concluded, Pyrisitia westwoodii (Boisduval, 1836) (type locality in Mexico) is a distinct
Species, not a subspecies of Pyrisitia dina (Poey, 1832) (type locality in Cuba) (Zhang et al. 2021).
Sequencing of additional specimens that included the nominal P. dina (Fig. 3 blue) confirms this
conclusion, also confirming Pyrisitia parvumbra (Kaye, 1925) (type locality in Jamaica) (Fig. 3 magenta)
as a distinct species (Turner and Turland 2017): Fst/Gmin between P. parvumbra and P. dina dina of
0.59/0.002 and the COI barcode difference of 2.7% (18 bp). Furthermore, we find prominent genetic
differentiation between P. dina and the taxon originally proposed as Eurema helios mayobanex M. Bates,
1939 (type locality in Haiti): Fs/Gmin of 0.39/0.00, COI difference of 1.8% (12 bp). Therefore, we propose
that Pyrisitia mayobanex (M. Bates, 1939), stat. nov. is a species-level taxon. Inspecting the genomic
trees, we see that Terias memulus Butler, 1871 (type locality in Haiti), currently regarded as a subspecies
of Pyrisitia leuce (Boisduval, 1836) (type locality in Brazil: Rio Grande do Sul), is most strongly
differentiated from it genetically: Fst/Gmin 0.60/0.00 and the COI barcode difference of 7.3% (48 bp) (Fig.
3 orange), while other P. /euce subspecies cluster closely together in the tree (Fig. 3 violet). Therefore, we
reinstate Pyrisitia memulus (A. Butler, 1871), stat. rest. as a species.
P. westwoodii|22079HO9|USA:AZ,Santa Cruz Co.|1989 b
Pyrisitia westwoodii|20067E07|Mexico:Gro|1981
Pyrisitia westwoodii|20067E08|Mexico:Mor|1981
Pyrisitia westwoodii|17116H10|Mexico:Roo|1979
Pyrisitia westwoodii|20061D04|Mexico:Chia|1988
Pyrisitia westwoodii|22083A02|Costa Rica|2006
32 Pyrisitia dina helios|5351|USA:FL,Miami-Dade Co.|2015
90 Pyrisitia dina helios|5358|USA:FL,Miami-Dade Co.|2015
» Pyrisitia dina helios|5357|USA:FL,Miami-Dade Co.|2015
Pyrisitia dina helios|22079H01|Bahamas|1990
Pyrisitia dina helios|22079H03|Bahamas|1988
Pyrisitia dina dina]22042D05|ST|Cuba|old
Pyrisitia dina dina|22079D01|Cuba:Havana|1993
Pyrisitia dina dina|22079C12|Cuba:GTMO|1994
Pyrisitia dina dina|22079C11|Cuba:Granma|1995
Pyrisitia dina dina|22079D03|Cuba:Baracoa|1994
Pyrisitia mayobanex [not dina]|22079H05|DR|1986
Pyrisitia mayobanex [not dina]|22079H06|DR|1986
Pyrisitia parvumbra|10554|Jamaica|2017
Pyrisitia parvumbra|10553|Jamaica|2017
Pyrisitia parvumbra|10398|Jamaica|2017
Pyrisitia parvumbra|22079HO7|Jamaica|1962
Pyrisitia memulus [not leuce]|22083H04|DR|1988
Pyrisitia memulus [not leuce]|22083H05|DR|1995
Pyrisitia memulus [not leuce]|22083H11|DR|1986
Pyrisitia leuce antillarum|22083H06|Nevis|1992
Pyrisitia leuce antillarum|22083HO7|VI:Tortola|1977
Pyrisitia leuce antillarum|22083H10|Guadeloupe|1992
Pyrisitia leuce flavilla (=hahneli)|21128F06|ST|Perulold
P. leuce athalia|22083G04|Panama|1998
Pyrisitia leuce leuce|22083H03|Paraguay|1984
P. leuce flavilla|22083H12|Brazil: AM|old
Pyrisitia leuce leuce|22083H01|Bolivia|1999
,P. westwoodii|22079H09|USA:AZ,Santa Cruz Co.|1989
rod yrisitia westwoodii|20067E07|Mexico:Gro|1981
Pyrisitia westwoodii|20067E08|Mexico:Mor|1981
2 2yrisitia westwoodii|17116H10|Mexico:Roo|1979
igyrisitia westwoodii|20061D04|Mexico:Chia|1988
Pyrisitia westwoodii|22083A02|Costa Rica|2006
Pyrisitia parvumbra|10554|Jamaica|2017
yrisitia parvumbra|22079H0O7|Jamaica|1962
Ryrisitia parvumbra|10398|Jamaica|2017
Pyrisitia parvumbra|10553|Jamaica|2017
yrisitia dina helios|5357|USA:FL,Miami-Dade Co.|2015
yrisitia dina helios|5358|USA:FL,Miami-Dade Co.|2015
Ryrisitia dina helios|5351|USA:FL,Miami-Dade Co.|2015
Pyrisitia dina helios|22079H01|Bahamas|1990
Pyrisitia dina helios|22079H03|Bahamas|1988
1 See dina dina|22042D05|ST|Cubalold
yrisitia dina dina]22079D01|Cuba:Havana|1993
Pyrisitia dina dina|22079C12|Cuba:GTMO|1994
iPyrisitia dina dina|22079D03|Cuba:Baracoa|1994
Pyrisitia dina dina|22079C11|Cuba:Granma|1995
Pyrisitia mayobanex [not dina]|22079HO5|DR|1986
Pyrisitia mayobanex [not dina]|22079H06|DR|1986
fe vicitie memulus|22083H05|DR|1995
—_______} yrisitia memulus|22083H04|DR|1988
Pyrisitia memulus|22083H11|DR|1986
Pyrisitia leuce antillarum|22083H0O7|VI:Tortola|1977
‘Pyrisitia leuce antillarum|22083H06|Nevis|1992
SPyrisitia leuce antillarum|22083H10|Guadeloupe|1992
so. leuce athalia|22083G04|Panama|1998
Pyrisitia leuce leuce|22083H01|Bolivia|1999
2Byrisitia leuce flavilla (=hahneli)|21128F06|ST|Perujold
P. leuce flavilla]22083H12|Brazil: AM|old
Pyrisitia leuce leuce|22083H03|Paraguay|1984
22
Fig. 3. Phylogenetic trees of Pyrisitia dina relatives inferred from protein-coding regions of a) the nuclear (autosomes) and b)
the mitochondrial genomes. Different species are shown in different colors: P. westwoodii (green), P. dina (blue), P.
mayobanex stat. nov. (red), P. parvumbra (magenta), P. memulus stat. rest. (orange), and P. /euce (violet).
Abaeis gratiosa (E. Doubleday, 1847) and Abaeis angulata (Wallengren, 1860)
are species-level taxa, not subspecies of Abaeis arbela (Geyer, 1832)
Genomic sequencing of taxa treated as subspecies of Eurema arbela Geyer, 1832 (type locality in “Java”,
possibly southern Brazil) in Lamas (2004), currently in the genus Abaeis Hiibner, [1819] (type species
Papilio nicippe Cramer, 1779) (Zhang et al. 2019b), confirms that Abaeis boisduvaliana (C. Felder & R.
Felder, 1865) (type locality in Mexico) is a distinct species due to its genetic differentiation from A.
arbela (Fig. 4 green and red). E.g., its COI barcode is 3.3% (22 bp) different. Moreover, we find that
Abaeis gratiosa (E. Doubleday, 1847), stat. rest. (type locality in Venezuela) and Abaeis angulata
(Wallengren, 1860), stat. rest. (type locality not given, likely in Ecuador) are prominently differentiated
genetically from A. arbela, A. boisduvaliana, and each other both in nuclear and mitochondrial genomes
(Fig. 4) and, therefore, are best treated as distinct species. Fst/Gmin/COI difference for the pairs of closest
(in nuclear genome) relatives are: A. gratiosa and A. arbela: 0.21/0.01/3.5% (23 bp) and A. angulata and
A. boisduvaliana: 0.64/0.001/3.6% (24 bp).
8
Abaeis boisduvaliana|10126|USA:TX,Cameron Co.|2017 b
Abaeis boisduvaliana|19012A04|Mexico:Tam|1970
Abaeis boisduvaliana|22085A07|USA:AZ,Pima Co.|2001
Abaeis boisduvaliana|22085B04|Mexico:Pue|1992
baeis boisduvaliana|19012A04|Mexico:Tam|1970
baeis boisduvaliana|22085B03|Mexico:Jal|1998
aeis boisduvaliana|22085B04|Mexico:Pue|1992
Abaeis boisduvaliana|22085A07|USA:AZ,Pima Co.|2001
Abaeis angulata|22085A05|Ecuador|1983
baeis angulata|22085A04|Ecuador|1998
Abaeis angulata|22085A06|Ecuador|1941
Abaeis angulata|19078E05|Peru:Piura|2000
Abaeis arbela arbela|22085C09|Peru:Cuzco|1980
nabae's arbela arbela|22085C08|Peru:MD|1981
seAbaeis arbela arbela]19078F04|Bolivia|2003
Abaeis arbela arbela|22085D01|Argentina|1986
Abaeis gratiosa|22085B08|Costa Rica|1987
baeis boisduvaliana|10126|USA:TX,Cameron Co.|2017
6
:
Abaeis boisduvaliana|22085B03|Mexico:Jal|1998
Abaeis angulata|22085A05|Ecuador|1983
Abaeis angulata|22085A04|Ecuador|1998
Abaeis angulata|22085A06|Ecuador|1941
Abaeis angulata|19078E05|Peru:Piura|2000
Abaeis gratiosa|22085B08|Costa Rica|1987
Abaeis gratiosa|19078E04|Panama|1976
Abaeis gratiosa|22085B12|Colombia|1977
Abaeis gratiosa|22085C01|Venezuela:Zulia|1982 4 100
Abaeis arbela arbela|]22085C08|Peru:MD|1981 g
Abaeis arbela arbela|22085C09|Peru:Cuzco|1980 “Abaeis gratiosa|19078E04|Panama|1976
Abaeis arbela arbela|19078F04|Bolivia|2003 Apaeis gratiosa|22085B12|Colombia|1977
Abaeis arbela arbela|22085D01|Argentina|1986 Abaeis gratiosa|22085C01|Venezuela:Zulia|1982
[a0 Abaeis adamsi|19078E01|Jamaica|1984 Abaeis adamsi|19078E01|Jamaica|1984
Abaeis adamsi|22084D07|Jamaica|1983 Abaeis adamsi|22084D07|Jamaica|1983
Fig. 4. Phylogenetic trees of Abaeis arbela species group (rooted with Abaeis adamsi comb. nov.) inferred from protein-
coding regions of a) the nuclear (autosomes) and b) the mitochondrial genomes. Different species are shown in different
colors: A. boisduvaliana (green), A. angulata (magenta), A. gratiosa (blue), and A. arbela (red).
Classification of the tribe Euremini Grote, 1898
The phylogenetic tree of the tribe Euremini Grote, 1898 (type genus Eurema Hiibner, [1819]) inferred
from protein-coding regions in the nuclear genome (autosomes only) reveals strong statistical support
(100% for most branches) and noticeable tree levels (resulting from coinciding diversifications in
different clades at about the same distance from the root) to aid its higher classification (Fig. 2). The level
closest to the origin of the tribe consists of three prominent clades that we treat as subtribes: Nathalina
Balint, 2022, stat. nov. (type genus Nathalis Boisduval, 1836), Kricogonina Balint, 2022, stat. nov. (type
genus Kricogonia Reakirt, 1864) and the nominotypical, Euremina. The former two were originally
proposed as tribes, but the early split of the subfamily Coliadinae Swainson, 1821 (type genus Colias
[Fabricius], 1807) into two prominent clades argues for treating these clades as tribes (Euremini and
Coliadini) rather than dividing them further. Therefore, further divisions would correspond to the
subtribal level. The monotypic genus Prestonia Schaus, 1920 (type species Prestonia clarki Schaus,
1920) placed in Euremini by Zhang et al. (2021) is sister to Kricogonia and diverged from it
approximately 27 million years ago (Mya), as estimated in Kawahara et al. (2023), which is close to the
split of the subtribe Euremina into two clades (25 Mya). Due to this similar level of genetic differentiation
between Kricogonia and Prestonia and between the two first clades of Euremina, Prestonia is placed in
the subtribe Kricogonina rather than in a subtribe of its own. Such classification emphasizes the sister
relationship of the two genera (Kricogonia and Prestonia) rather than the distinction between them.
While there is little doubt that the five known species in Nathalina and Kricogonina are best
classified into the three genera corresponding to the most prominent clades in the tree (Fig. 2), the
taxonomy of the subtribe Euremina is more complex. Traditionally, the entire subtribe has been treated as
a single genus Eurema Hibner, [1819] (type species Papilio delia Cramer, 1780, a junior homonym, valid
name for this species is Pieris daira Godart, 1819) (Klots 1933). However, early DNA work suggested
strong genetic differentiation within the subtribe (Pollock et al. 1998), formalized by Opler and Warren
(2002), who partitioned the US species into three genera: Eurema, Pyrisitia A. Butler, 1870 (type species
Papilio proterpia Fabricius, 1775), and Abaeis Hiibner, [1819] (type species Papilio nicippe Cramer,
1779). This split has been largely followed (Lamas 2004; Pelham 2008), although some species have been
reassigned between these genera (Zhang et al. 2019b). Our work (Zhang et al. 2019c; Zhang et al. 2019b)
and more recent publications (Kawahara et al. 2023) support the notion of strong genetic differentiation
within Euremina and date its diversification to approximately 25 Mya (Fig. 2). This level of
differentiation and age are too large for placing all Euremina in the single genus Eurema.
The subtribe Euremina splits into two prominent clades at approximately 25 Mya, as estimated by
Kawahara et al. (2023). These two clades can be taken to represent genera, and the subtribe can be
divided into two genera: Eurema and Abaeis. However, even this level of genetic differentiation and age
would be larger than for most genera of butterflies (Talavera et al. 2012; Li et al. 2019; Zhang et al.
2019a, c), and the ages between 15 and 20 Mya would be more consistent with the genus level. Even if
absolute values of age estimates are not particularly accurate due to various errors, their relative values
9
and the fact they are all estimated mainly with the same method and on similar datasets argue for the
validity of such comparisons of estimated ages between nodes. For these reasons, we regard the two
clades of Euremina as “sections”: the Eurema section and the Abaeis section, and take the next level in
the tree to define genera.
The next tree level, dating to approximately 20 Mya, consists of five clades, one of which is
entirely from the Old Word, the only Old Word group in the entire tribe Euremina (Fig. 2 marked with red
asterisk). We propose that these five clades represent genera in Euremina: Terias W. Swainson, 1821
(type species Papilio hecabe Linnaeus, 1758) and Eurema with its sister Pyrisitia A. Butler, 1870 (type
species Papilio proterpia Fabricius, 1775) belong to the Eurema section, and Abaeis with Teriocolias
Rober, 1909 (type species Terias atinas Hewitson, 1874, a junior subjective synonym of Terias zelia
Lucas, 1852) belong to the Abaeis section. This partitioning into genera is biogeographically significant
because it reflects the invasion of the only Euremini lineage from the New World, where the tribe likely
originated, into the Old World, giving rise to the genus Jerias, followed by its extensive diversification.
Genera of Euremina defined this way are analogous to Codatractus Lindsey, 1921 vs. Lobocla Moore,
1884, Heliopetes Billberg, 1820 vs. Pyrgus Htibner, [1819], and Oarisma Scudder, 1872 vs. Thymelicus
Hiibner, [1819] (in the latter two, pairs some species from the Old World genus returned to the New
World at a later time) and correspond to similar geological time-frame of the mid-Miocene climatic
optimum characterized by elevated biotic movement from America to Asia (Jiang et al. 2019).
The phylogenetic tree (Fig. 2) guides the assignment of species to genera, and we restore the
monophyly by proposing new genus-species combinations: Pyrisitia amelia (Poey, [1852]), comb. nov..,
Pyrisitia lirina (H. Bates, 1861), comb. nov., Abaeis paulina (H. Bates, 1861), comb. nov., Abaeis
xantochlora (Kollar, 1850), comb. nov., Abaeis fabiola (C. Felder & R. Felder, 1861), comb. nov.,
Abaeis tupuntenem (Lichy, 1976), comb. nov., Abaeis adamsi (Lathy, 1898), comb. nov., Abaeis brephos
(Hiibner, [1809]), comb. nov., and Abaeis elvina (Godart, 1819), comb. nov. The latter two combinations
reflect our treatment of Leucidia E. Doubleday, 1847, stat. nov. (type species Pieris elvina Godart, 1819)
as a subgenus of Abaeis despite its unique phenotype. Such treatment results in a more internally
consistent classification because an Abaeis that includes Leucidia corresponds to a more prominent clade
in the tree, and the Leucidia clade has split from the rest of Abaeis at the tree level corresponding to
subgenera (Fig. 2). This level allows us to define five subgenera in Euremina in addition to the five genera
(Fig. 2 and listed below). Finally, we note that Teriocolias doris (Rober, 1909), stat. rest. (type locality in
Bolivia), currently regarded as a subspecies of Teriocolias deva (E. Doubleday, 1847) (type locality in
French Guiana), is genetically very distant from it: e.g., COI barcodes differ by 7.6% (50 bp) and is a
distinct species.
Below is a proposed classification of the tribe Euremini. Only available genus-group names are
listed; subspecies names are not given and can be found on the Butterflies of America website (Warren et
al. 2023), and the Old Word species are not provided (all belong to the genus Terias, which consists only
of Old World species). Type genus (for family-group names) or type species (for genus-group names)
names are given in parenthesis; synonyms are preceded by = and all but subjective synonyms also by ¢
with a valid name of this species following the colon. New taxa and status changes are shown in red font.
Tribe Euremini Grote, 1898 (Eurema Hibner, [1819])
Subtribe Nathalina Balint, 2022, stat. nov. (Nathalis Boisduval, 1836)
Genus Nathalis Boisduval, 1836 (Nathalis iole Boisduval, 1836)
Nathalis iole Boisduval, 1836
Nathalis plauta E. Doubleday, 1847
Subtribe Kricogonina Balint, 2022, stat. nov. (Kricogonia Reakirt, 1864)
Genus Kricogonia Reakirt, 1863 (Colias lyside Godart, 1819)
Kricogonia lyside (Godart, 1819)
Kricogonia cabrerai Ramsden, 1920
Genus Prestonia Schaus, 1920 (Prestonia clarki Schaus, 1920)
Prestonia clarki Schaus, 1920
10
Subtribe Euremina Grote, 1898 (Eurema Hibner, [1819])
Eurema section
Genus Terias W. Swainson, 1821 (Papilio hecabe Linnaeus, 1758)
Consists of all Old World species of Euremini
Subgenus Maiva Grose-Smith & W.F. Kirby, 1893 (=M. sulphurea Gr-Sm. & Kirby: Papilio brigitta Stoll, 1780)
=Kibreeta F. Moore, 1906 (={Papilio libythea Fabricius, 1798: Terias brigitta rubella Wallace, 1867)
=Nirmula F. Moore, 1906 (=Terias venata F. Moore, 1858: Terias laeta Boisduval, 1836)
Subgenus Jerias W. Swainson, 1821 (Papilio hecabe Linnaeus, 1758)
Genus Eurema Hubner, [1819] (=tPapilio delia Cramer, 1780: Pieris daira Godart, 1819)
Eurema priddyi (Lathy, 1898)
Eurema lucina (Poey, [1852])
Eurema daira (Godart, 1819)
Eurema elathea (Cramer, 1777)
Eurema nigrocincta Dognin, 1889
Eurema agave (Cramer, 1775)
Eurema phiale (Cramer, 1775)
Genus Pyrisitia A. Butler, 1870 (Papilio proterpia Fabricius, 1775)
Subgenus Pyrisitia A. Butler, 1870 (Papilio proterpia Fabricius, 1775)
Pyrisitia proterpia (Fabricius, 1775)
Pyrisitia westwoodii (Boisduval, 1836)
Pyrisitia dina (Poey, 1832)
Pyrisitia mayobanex (M. Bates, 1939), stat. nov.
Pyrisitia parvumbra (Kaye, 1925)
Pyrisitia memulus (A. Butler, 1871), stat. rest.
Pyrisitia leuce (Boisduval, 1836)
Pyrisitia larae (Herrich-Schaffer, 1862)
Pyrisitia venusta (Boisduval, 1836)
Pyrisitia chamberlaini (A. Butler, 1898)
Pyrisitia nise (Cramer, 1775)
Pyrisitia lisa (Boisduval & Le Conte, [1830])
Pyrisitia euterpiformis (Munroe, 1947)
Pyrisitia amelia (Poey, [1852]), comb. nov.
Pyrisitia portoricensis (Dewitz, 1877)
Pyrisitia pyro (Godart, 1819)
Pyrisitia messalina (Fabricius, 1787)
Subgenus Lirinia Grishin, subgen. n.
Pyrisitia lirina (H. Bates, 1861), comb. nov.
Abaeis section
Genus Abaeis Hubner, [1819] (Papilio nicippe Cramer, 1779)
Subgenus Leucidia E. Doubleday, 1847 (Pieris elvina Godart, 1819), stat. nov.
Abaeis brephos (Hubner, [1809]), comb. nov.
Abaeis elvina (Godart, 1819), comb. nov.
Subgenus Lucidia Lacordaire, 1833 (Papilio albula Cramer, 1775)
Abaeis albula (Cramer, 1775)
Subgenus Sphaenogona Butler, 1870 (Terias bogotana C. & R. Felder, 1861: a ssp. of 7. mexicana Boisduval)
Abaeis paulina (H. Bates, 1861), comb. nov.
Abaeis xantochlora (Kollar, 1850), comb. nov.
Abaeis fabiola (C. Felder & R. Felder, 1861), comb. nov.
Abaeis tupuntenem (Lichy, 1976), comb. nov.
Abaeis salome (C. Felder & R. Felder, 1861)
Abaeis mexicana (Boisduval, 1836)
Abaeis boisduvaliana (C. Felder & R. Felder, 1865)
Abaeis angulata (Wallengren, 1860), stat. rest.
Abaeis gratiosa (E. Doubleday, 1847), stat. rest.
Abaeis arbela (Geyer, 1832)
Abaeis adamsi (Lathy, 1898), comb. nov.
Subgenus Abaeis Hubner, [1819] (Papilio nicippe Cramer, 1779)
Abaeis nicippe (Cramer, 1779)
Abaeis nicippiformis (Munroe, 1947)
Genus Teriocolias Rober, 1909 (=Terias atinas Hewitson, 1874: Terias zelia Lucas, 1852)
Teriocolias deva (E. Doubleday, 1847)
Teriocolias doris (Rober, 1909), stat. rest.
Teriocolias zelia (Lucas, 1852)
Teriocolias reticulata (A. Butler, 1871)
11
Subtribes in Coliadini Swainson, 1821
The genomic tree reveals four prominent clades in the tribe Coliadini Swainson, 1821 that are at
approximately the same distance from the root (Fig. 5). We propose treating these clades as subtribes.
Three of these subtribes have names: the nominotypical one, Callidryina Kirby, 1896, stat. nov., and
Gonepterygina Verity, 1920, stat. nov. The name Callidryina is formed from the genus Callidryas
Boisduval & Le Conte, 1830 (type species Papilio eubule Linnaeus, 1767), which is currently treated as a
junior subjective synonym of Phoebis Hiibner, [1819] (type species Phoebis cypris Hiibner, [1819], which
is an unjustified emendation of Papilio cipris Cramer, 1777, which is a junior subjective synonym of
Papilio argante Fabricius, 1775). Callidryina consists of two closely related genera, Phoebis (that
includes Rhabdodryas Godman & Salvin, 1889) and Aphrissa Butler, 1873. In addition to the type genus
Gonepteryx Leach, 1815, we place Dercas E. Doubleday, 1847 in Gonepterygina. The fourth subtribe
does not have a name. It is described below.
Gandacina Grishin, new subtribe
http://zoobank. org/EF448D21-E251-4ABA-9A22-22EBD93A8303
Type genus. Gandaca F. Moore, 1906.
Definition. Gandaca (type species Terias harina Horsfield, 1829) is sister to Gonepterygina Verity, 1920,
Ys Nathalis iole|3572|USA:TX,Cameron Co.|2015
100 Kricogonia lyside|3423|USA:TX,Cameron Co.|2015
3 Eurema daira|4872|USA:FL,Monroe Co.|2015
Gandacina 9 Gandaca harina|19067HO1|Myanmar|2003
Ab “a Gandaca butyrosa|19079A06|PT of cuneata|Indonesia:Seram|1919
5a Dercas verhuelli]19067F01|Malaysia|1991
RS F Gonepteryx rhamni|15112HO05|Finland|2003
100 Gonepterygina Anteos maerula|10234|USA:TX,Cameron Co.|2017
Coliadinal 746 Zerene cesonia|3980|USA:TX, Dallas Co.|2015
100 Colias hyale|19063E10|Croatia|1979
Catopsilia crocale|19067E07|Taiwan|1973
100 Aphrissa statira|16107D11|USA:TX,Nueces Co.|2013
a4 Phoebis argante|17116HO5|Mexico:QRoo|1979
=o 108 Phoebis trite]19063C12|Ecuador|1993
Callidryina Phoebis sennae eubule|3314|USA:TX,San Jacinto Co.|2015
Pieris brassicae|15112G01|Germany|1986
Ascia monuste|4148|USA:TX,Jefferson Co.|2015
Aporia crataegi|19068E09|Albania|1991
100
ly = Cepora nerissa|19068H06|Myanmar|2003
a 9) ©Belenois calypso|19068G08|Nigeria|1974
pt Too ~4Belenois raffrayi|19068H04|Ethiopia|1973
a oo— Belenois creona|19068G10|Zaire|1985
100 Belenois java|19068H02|Indonesia:_Lombok|1990
ae Pseudanaphaeis gidica [not Belenois]|19068G12|Zambia|1980
100 Dixeia charina|19069F05|South Africa|1965
a6 Aoa affinis|19068D07|Indonesia:Sulawesilold
52 Appias olferna|19068F08|Myanmar|2001
Elodina egnatia|21129C04|Indonesia:Wetar|1892
84 oe Leptosia nina] 19068C03|Indonesia: Balilold
—__—___________— _Calopieris eulimene|20033F04|Eritrea|1954
, Anthocharidina Anthocharis cardamines|17115H10|Spain|2005
aoe t Euchloe crameri|19068A01|Portugal|1978
Eroessa chiliensis|19067G10|Chile|1987
o Hesperocharis erota|19068A08|Brazil:RJ|1995
Hebomoiina ihe ue glaucippe|19068A05|Myanmar|2003
ebomoia leucippe|19083C05|Indonesia:Seram|2019
Nepheronia argia|19068D02|no data
Pareronia valeria|19068D05|Myanmar|2003
Colotis amata|19068H11|India:Assam|1971
Teracolus subfasciatus|19069E08|South Africa|1978
Leptidea sinapis|18017C07|Sweden|1971
ee Leptidea gigantea|19067G01|China|old
100 Pseudopierina 70 Pseudopieris viridula|22062G02|Peru:Cuzco|2017
Pseudopieris nehemia|7728|Peru:MD|2013
Moschoneura pinthous|19067G04|Peru:MD|2016
Dismorphia laja]19067H11|Guyana|1999
Enantia melite|19067H12|Guyana|1999
100
100
7 = 100
0.06 Dismorphiina 100
Fig. 5. The phylogenetic tree of selected Pieridae inferred from protein-coding regions of the nuclear genome (autosomes).
Family-group names are shown by corresponding branches, or an arrow points to the branch. Names, clades, and species of
new subtribes proposed in this work are shown in color, except that red indicates a reinstated genus Pseudanaphaeis (not a
synonym of Be/enois). Names of other subtribes are shown in black, and names of subfamilies and tribes are shown in shades
of gray. Note the extreme variation of base-pair substitution rate in Pieridae, where DNA of some taxa (e.g., Gonepteryx)
changes at least two times slower than others (e.g., Bel/enois), as evidenced by the distance from the root to these leaves.
Therefore, no vertical bars or lines can demarcate tribes and subtribes in this tree, where branch length corresponds to the
estimated number of base pair changes along the branch.
12
stat. nov. but is more distant from the members of this subtribe both genetically and phenotypically.
Furthermore, the statistical support for Gonepterygina to include Gandaca is lower than for most other
clades in the tree (88%) (Fig. 5). Therefore, the clade with Gandaca is defined as a subtribe. This new
subtribe is diagnosed by the following characters: in male genitalia, uncus pointed dorsad at the base, with
dorsal margin strongly arched and finely serrated, uncus shorter than in relatives and broader towards its
distal end in dorsal view; in female genitalia, corpus bursae nearly spherical with a ring-shaped signum at
its base and an appendix that is larger than the corpus itself; in facies, is more similar to Eurema Hiibner,
[1819] and relatives (tribe Euremini Grote, 1898) than to Gonepterygina: lemon-yellow wings without
central spots, hindwings plain or with dark margin by the apex and forewings with dark apex continuing
into thin marginal border. See Kaur et al. (2022) for illustrations. A combination of the following nuclear
genomic base pairs is diagnostic: pse19182.2.2:A3375G, pse1982.1.2:A51T, pse200.39.1:T1209C, pse1378.
26.1:G839A, pse200.29.1:C1534G.
Genera included. Only the type genus.
Parent Taxon. Tribe Coliadini Swainson, 1821.
Pseudanaphaeis Bernardi, 1953 is a genus distinct from Belenots Hiibner, [1819]
Currently considered a junior subjective synonym of Belenois Hitibner, [1819] (type species Papilio
calypso Drury, 1773, sequenced as NVG-19068G08), Pseudanaphaeis Bernardi, 1953 (type species
Pieris gidica Godart, 1819, sequenced as NVG-19068G12), is not monophyletic with it, and instead is
sister to Dixeia Talbot, 1932 (type species Pieris charina Boisduval, 1836, sequenced as NVG-19069F05)
(Fig. 5). Extensive genetic differentiation between Dixeia and Belenois precludes from considering them
congeneric. Therefore, we propose to treat Pseudanaphaeis Bernardi, 1953, stat. rest. as a distinct genus.
Hebomoiina Grishin, new subtribe
http://zoobank. org/71C79A DE-4BBF-4CC8-86B6-33 1BCD38863B
Type genus. Hebomoia Hiibner, [1819].
Definition. Hebomoia (type species Papilio glaucippe Linnaeus, 1758) belongs to the tribe
Anthocharidini Scudder, 1889, but is genetically differentiated from its other genera (Fig. 5). Phenoty-
pically, species in this lineage are characterized by a more robust appearance that the rest of the tribe.
Therefore, we propose that the clade with Hebomoia corresponds to a subtribe. This new subtribe is
diagnosed by a bifurcate uncus and bifurcate valva, forewing with five radial veins, two of which and M;
(not stalked with R) originate at the discal cell, larger size (forewing longer than 40 mm), and pointed
broadly orange apex of the forewing. See Klots (1933) for additional discussion and illustrations of these
characters given for Hebomoia. A combination of the following nuclear genomic base pairs is diagnostic:
pse123.37.1:A2228G, pse123.37.1:T1285A, pse9809.2.1:G1812A, pse657.5.2:A89G, pse5906.8.2:G3017A.
Genera included. Only the type genus.
Parent Taxon. Tribe Anthocharidini Scudder, 1889.
Tribes and subtribes in Dismorphiinae Schatz, 1886
The subfamily Dismorphiinae Schatz, 1886 splits into two prominent clades that we propose to treat as
tribes: the nominotypical and Leptidiini Grote,1897, stat. rev., which is monotypic (Fig. 5). The two
tribes are well-defined morphologically (Klots 1933) and biogeographically, with Leptidiini being the Old
World tribe and Dismorphiini restricted to the New World.
13
Pseudopierina Grishin, new subtribe
http://zoobank. org/253 17F65-DA92-4FD 1-88BB-ED275C6B46A 1
Type genus. Pseudopieris Godman & Salvin, 1890.
Definition. Pseudopieris (type species Pieris nehemia Boisduval, 1836) is sister to and is stronger
differentiated genetically from the rest of Dismorphiini Schatz, 1886 (Fig. 5). Therefore, combined with
phenotypic differences, we propose that the lineage with Pseudopieris corresponds to a subtribe. This new
subtribe is distinguished from the rest of Dismorphiini (and Dismorphiinae, for that matter) by much
broader wings that are more like in Pieris Schrank, 1801, rather than the elongated wings of
Dismorphiinae, the last abdominal segment with rounded lobes and a cleft, and Mi: stalked with R stem on
the forewing. See Klots (1933) for details and illustrations given for Pseudopieris. A combination of the
following base pairs in the nuclear genome is diagnostic: pse7986.9.2:A4048G, pse19182.2.2:T3830C,
pse165.20.1:A803T, pse578.3.2:C31A, pse578.3.2:A12G.
Genera included. Only the type genus.
Parent Taxon. Tribe Dismorphiini Schatz, 1886.
Family Nymphalidae Rafinesque, 1815
Libytheana Michener, 1943 is a genus distinct from Prolibythea Scudder, 1889
Considered synonyms in some publications (Kawahara 2009; Sohn et al. 2012), fossil Prolibythea
Scudder, 1889 (type species Prolibythea vagabunda Scudder, 1889) and contemporary Libytheana
Michener, 1943 (type species Libythea bachmanii Kirtland, 1851, which is regarded as a subspecies of
Papilio carinenta Cramer, 1777), both American, are separated by at least 30 million years according to
the age estimate of the fossil as late Priabonian (Sohn et al. 2012). The typical age of congeners is not
larger than 20 million years. Furthermore, the divergence between Libytheana and the Old World genus
Libythea [Fabricius], 1807 (type species Papilio celtis Laicharting, 1782) was dated to about 12 Mya
(Kawahara et al. 2023), which is more recent than 30 Mya. Thus, it is most likely that Prolibythea lived
before the divergence between Libytheana and Libythea. Therefore, if Libytheana and Libythea are
treated as separate genera, then Prolibythea is not congeneric with Libytheana to avoid paraphyly.
The tribe Vagrantini Pinratana & Eliot, 1996 as currently defined is paraphyletic
Currently, the tribe Vagrantini Pinratana & Eliot, 1996 consists of ten genera: Vagrans Hemming, 1934,
Cupha Billberg, 1820, Phalanta Horsfield, 1829, Smerina Hewitson, 1874, Terinos Boisduval, 1836,
Algia Herrich-Schaffer, 1864), Algiachroa Parsons, 1989, Cirrochroa E. Doubleday, 1847, Lachnoptera
E. Doubleday, 1847, and Vindula Hemming, 1934 (Wahlberg 2019). However, our genomic tree reveals
that Vagrantini, defined to include all ten genera, is paraphyletic with respect to Argynnini Swainson,
1833 with the highest support (Fig. 6). The first five genera listed above form a clade sister to Argynnini.
This clade includes Vagrans, which is the type genus of Vagrantini. Therefore, to restore monophyly, we
restrict Vagrantini to include only these five genera: Vagrans, Cupha, Phalanta, Smerina, and Terinos.
The remaining five genera previously included in Vagrantini form a clade sister to both Vagrantini and
Argynnini (Fig. 6) and, therefore, belong to other tribes. No published family-group names have been
formed from any of these five genera; hence, these other tribes are new. They are described below.
Vindulini Grishin, new tribe
http://zoobank. org/151AC163-E036-49BE-A49C-48D7B9F0108F
Type genus. Vindula Hemming, 1934.
14
Dryas iulia]|19094A02|Puerto Rico|1977
100 = Dione juno|17117B01|Mexico:SLP|1978
100 Cethosiina Heliconius charithonia|5097|USA:TX,Starr Co.|2015
Cethosia cydippe|19076HO7|Papua New Guinea|2011
Ar raci 100 Acraea horta|19077E10|South Africa
cea 100 Actinote thalia|19076H12|Surinamejold
Stephenia hypatia|19093H03|Mali|1982
Pardopsis punctatissima|19077D12|Madagascar|1983
Argynnina| |. Boloria napaea|19077D07|Austria|1968
ant ‘Ps Argynnis paphia|PAOE21|Germany|2017
98 ee Issoria lathonia|19077D05|France|2008
Euptoietina Yramea cytheris|19077D08|Chile|1998
Euptoieta claudia|3706|USA:TX,Dallas Co.|2015
Terinos clarissa|19076G09|Malaysia:Malaccalold
99 Vagrantina Cupha erymanthis|19076H0O1|Malaysia:Johor|1991
EA ee Vagrans egista sinha|19076H04|Indonesia:Sumatra|1991
100 *Sntetitina Phalanta phalantha|19076HO5|Myanmar|2001
Vindulini Smerina manoro|19076H02|Madagascar|old
Vindula arsinoe|19076G04|Papua New Guinea|1978
ne Alaiina a Algia satyrina|19076G07|Indonesia:Sulawesi|1891
Alaiini g TOO Algiachroa woodfordi|22029B04|PNG:Shortlands|old
700] Lachnopterina Cirrochroa aoris|19076G11|India|1972
Lachnoptera anticlia}19076G12|Cameroon|1987
Neptis sappho|19096G02|Myanmar|2001
100 Pantoporia hordonia|19096G09|Myanmar|2001
Limenitis populi|19077B06|China:Heilongjiang|1983
Athyma perius|19077F12|Myanmar|2001
Moduza procris|19077F02|Myanmar|2001
Neurosigma siva|19096F03|Myanmar|2003
Chalinga elwesi|19077B04|China:Yunnanlold
Lebadea martha|19096G01|Myanmar|2003
Pseudacraea eurytus|19096H03|Cameroon|1989
Abrota ganga|19096A01|no datalold
Hamanumida daedalus|19096B06|Rhodesia|1968
Cynandra opis|19096E08|Cameroon|1987
Bebearia brunhilda|19096A02|Uganda|1973
Euphaedra erasmus|19096B11|Cameroon|1987
Evena crithea|19096B05|Uganda|1973
Euthalia lubentina|19096A05|Myanmar|2000
Euthalia aconthea|19096A06|Singapore|1990
Pseudathyma neptidina|19096C02|PT of jacksoni|Kenya|1964
Pseudathyma plutonica|19096C03|Kenya|1964
: TT Cymothoe althea|19096C10|Cameroon|1973
Cymothoinar Harma theobene|19096D01|Cameroon|1987
rs Kumbtialina Bhagadatta austenia|SAMN18587126|LEP59475|Vietnam
Kumothales inexpectata|SAMN18673351|KA-18-123-ABRI|Congo
TT PSeudoneptis bugandensiS|SAMN18673582|FH-18-Z056| TOGO
Parthenos sylvia|19083C10|Malaysia:Pahang|2019
Nymphalis polychloros|19093E04|France|1976
100 Terinosina
92
100
100
100
100° Biblidinae C7. ———C(”*C“C-»rresttis thyornnieus|19095B06|Indonesia:Sulawesi|1978
Biblis hyperia|19094E05|British Virgin Islands|1984
14. _Apatura iris|19094C01|Slovakia|1966
100 aT Pseudergolis avesta|19094F03|Indonesia:Sulawesilold
Pseudergolis wedah|19094F04|Myanmar|2001
Dichorragia nesimachus|19094F05|Myanmar|2001
Stibochiona coresia|19094F06|Javalold
Amnosia decora|19094F02|Javalold 0.05
100
100 100
Amnosiini
Fig. 6. The phylogenetic tree of selected Nymphalidae inferred from protein-coding regions of the nuclear genome
(autosomes). Sequences of the three samples with numbers starting with “SAMN” were taken from the alignment provided in
Supplementary materials to Kawahara et al. (2023). Family-group names are shown above or below the corresponding
branches. Names, clades, and species of new tribes and subtribes proposed in this work are shown in color. Names of other
subtribes are shown in black, and names of subfamilies and tribes are shown in shades of gray. The translucent vertical lime
bar denotes a level in the tree approximately corresponding to subtribes; however, due to variation in base pair substitution
rates (1.e., not all tree leaves are at the same level), the correspondence may not be exact. E.g., DNA changes in Argynnini are
slower than in most other groups (many Argynnini leaves are closer to the left compared to most others); hence, the level is
shifted to the left, which also preserves the originally proposed (Simonsen 2006) division into two and not three subtribes.
Definition. Vindula (type species Papilio arsinoe Cramer, 1777) constitutes a lineage sister to four other
genera that were previously included in Vagrantini Pinratana & Eliot, 1996 but did not belong to this tribe
(see above). This lineage diverged from these other genera at about the same level as (if not earlier than)
Vagrantini from Argynnini Swainson, 1833, and therefore corresponds to a tribe (Fig. 6). This new tribe
is distinguished from its relatives by sclerotized subpapillary glands in females and forked humeral vein
(Penz and Peggie 2003). A combination of the following nuclear genomic base pairs is diagnostic:
hm2013347-RA.4:T162C, hm2013540-RA.5:G265A, hm2015146-RA.7:G80A, hm2015146-RA.7:G79A,
hm2013347-RA.4:A220C.
Genera included. Only the type genus.
Parent Taxon. Subfamily Heliconiinae Swainson, 1822.
15
Algiini Grishin, new tribe
http://zoobank.org/AE49C6E7-8E5 1-4E4E-9947-151B37A467E8
Type genus. A/gia Herrich-Schaffer, 1864.
Definition. This tribe corresponds to the second major subclade in the clade that is sister to both
Argynnini Swainson, 1833 and Vagrantini Pinratana & Eliot, 1996. This subclade is sister to Vindulini
trib. n., diverging from it at about the same level as (if not earlier than) Argynnini from Vagrantini (Fig.
6). Due to this prominent genetic differentiation, it is defined as a tribe. This new tribe is distinguished
from its relatives by unsclerotized subpapillary glands in females, forked humeral vein, and/or smooth
eyes and undifferentiated androconial scales, or by an oval patch of androconial scales in males in the
apical area of dorsal hindwing covering 1/7—1/6 of its surface (Penz and Peggie 2003). A combination of
the following nuclear genomic base pairs is diagnostic: hm2000037-RA.1:C698G, hm2008858-RA. 12:
T1021C, hm2008858-RA.12:C1022T, hm2016824-RA.4:C154A, hm2017493-RA.1:A2480G.
Genera included. The type genus (1.e., A/gia Herrich-Schaffer, 1864), Algiachroa Parsons, 1989,
Cirrochroa E. Doubleday, 1847, and Lachnoptera E. Doubleday, 1847.
Parent Taxon. Subfamily Heliconiinae Swainson, 1822.
Lachnopterina Grishin, new subtribe
http://zoobank.org/8 BBABF 1F-145B-4A67-94F5-F498130FB857
Type genus. Lachnoptera E. Doubleday, 1847.
Definition. Lachnoptera (type species Papilio iole Fabricius, 1781) forms a lineage that splits from all
other Algiini trib. n. at the tree level of subtribes (Fig. 6), therefore representing a subtribe. This new
subtribe is distinguished from its relatives by unsclerotized subpapillary glands in females (Penz and
Peggie 2003) and an oval patch of androconial scales in males in the apical area of dorsal hindwing
covering 1/7—1/6 of its surface. A combination of the following nuclear genomic base pairs is diagnostic:
hm2008958-RA.5:T118G, hm2008958-RA.5:G1I19T, hm2006642-RA.2:A2275C, hm2006706-RA.1:A709T,
hm2006706-RA.1:A748T, hm2015589-RA.1:A1852A (not C), hm2014529-RA.4:A139A (not G), hm2012118-
RA.6:A79A (not G), hm2016492-RA.5:A1813A (not G), hm2016492-RA.5:C1831C (not A).
Genera included. Only the type genus.
Parent Taxon. Tribe Algiini Grishin, trib. n.
Terinosina Grishin, new subtribe
http://zoobank. org/3 IDFAAA5-EA63-43 1B-AC9D-BF686549FEC8
Type genus. Zerinos Boisduval, 1836.
Definition. Terinos (type species Terinos clarissa Boisduval, 1836) forms a deep-diverging lineage in the
tribe Vagrantini Pinratana & Eliot, 1996 at about the tree level corresponding to subtribes (Fig. 6) and,
therefore, represents a subtribe. This new subtribe is distinguished from its relatives by a combination of
the following characters: larval head with scoli, hindwing cell closed, a fold across the forewing between
R and M veins, vein R2 arising from discal cell, vein R4 arising at about the end of R2, humeral vein
simple and straight, gnathos arms not ventrally fused, valva with a long (about 2/3 of valva length)
projection off its base inside (Penz and Peggie 2003). A combination of the following base pairs in the
nuclear genome is diagnostic: hm2007153-RA.3:A305G, hm2014625-RA.4:T887A, hm2012596-RA. 1:
C853G, hm2011273-RA.1:T484G, hm2011273-RA.1:G486A.
Genera included. Only the type genus.
Parent Taxon. Tribe Vagrantini Pinratana & Eliot, 1996.
16
Smerinina Grishin, new subtribe
http://zoobank.org/O6DF6620-9B17-4522-9E4B-BD5342AC8DF5
Type genus. Smerina Hewitson, 1874.
Definition. Smerina (type species Smerina vindonissa Hewitson, 1874) forms a deep-diverging lineage in
the tribe Vagrantini Pinratana & Eliot, 1996 at about the tree level corresponding to subtribes (Fig. 6) and
therefore represents a subtribe. This new subtribe is distinguished from its relatives by a combination of
the following characters: papilla anales moderately retracted (not deeply) inside the body, aedeagus not
broadened at the tip in ventral view, costa of valva with one spiny process (Penz and Peggie 2003),
forewing apex more produced and hindwing margin evenly curved (not wavy, no tails). A combination of
the following base pairs in the nuclear genome is diagnostic: hm2015462-RA.1:T360C, hm2015689-RA.
5:T57C, hm2009280-RA.3:T94G, hm2010526-RA.2:A67G, hm2017391-RA.1:A139C.
Genera included. Only the type genus.
Parent Taxon. Tribe Vagrantini Pinratana & Eliot, 1996.
Lebadeini Grishin, new tribe
http://zoobank. org/F26F93 LE-9141-4329-92B6-6E86A9F369E9
Type genus. Lebadea C. Felder, 1861.
Definition. Lebadea (type species Limenitis ismene E. Doubleday, 1848, which is a junior subjective
synonym of Papilio martha Fabricius, 1787), currently in Neptini Newman, 1870 (Dhungel and Wahlberg
2018; Wahlberg 2019) is not monophyletic with it and instead is placed as sister to the clade of Chalingini
Hemming, 1960 and Limenitidini Behr, 1864 but with weak support; therefore, it is distinct from them
(Fig. 6). Thus, this lineage, currently consisting only of Lebadea, represents a tribe that does not have a
name. This new tribe is diagnosed by a combination of the following characters: tegumen and uncus are
smaller than typical for Limenitidini, uncus is more gracile, thus more similar to Neptis [Fabricius], 1807,
and differs from Neptis in having a well-defined and projecting anteriad lobe (not just a hump) on the
dorsal side of the segment A2 in the pupa (Willmott 2003). A combination of the following nuclear
genomic base pairs is diagnostic: hm2005025-RA.3:C373A, hm2006832-RA.2:C97A, hm2004700-RA. 1:
CS590A, hm2004700-RA.1:G351T, hm2005025-RA.3:G319A.
Genera included. Only the type genus.
Parent Taxon. Subfamily Limenitidinae Behr, 1864.
Comment. Using morphological analysis, Willmott (2003) has placed Lebadea in the “Limenitis group”
of genera away from Neptis, which seems to agree more with our genomic results.
Subtribes in Adoliadini Doubleday, 1845
Currently, no subtribes are in use for Adoliadini (Wahlberg 2019). However, our genomic tree reveals
five prominent clades in this tribe (Fig. 6), confirming the results reported by Dhungel and Wahlberg
(2018). We propose to treat these clades as subtribes. This subtribal arrangement will bring additional
order to the species-rich tribe Adoliadini. Three of these subtribes have names: the nominotypical one,
Abrotina Hemming, 1960, stat. nov., and Bebeariina Hemming, 1960, stat. nov. (the last two were
originally proposed as tribes), and two do not. They are described below.
Evenaina Grishin, new subtribe
http://zoobank.org/AB51B17D-4CB5-4909-8C7C-C76C81E84C4B
Type genus. Evena Westwood, 1850.
17
Definition. Evena (type species Papilio crithea Drury, 1773) forms a prominent phylogenetic lineage
within Adoliadini Doubleday, 1845 on par with other subtribes (Fig. 6) and therefore represents a new
subtribe. The new subtribe is diagnosed by genitalia and venation as described in detail and illustrated by
Chermock (1950) for the genus Catuna W. F. Kirby, 1871 (a junior objective synonym of Evena). In
brief, uniquely long and narrow saccus nearly as long as valva and R: vein arising before the end of the
discal cell, then fusing with Sc for some distance and diverging to meet costal margin are diagnostic.
Furthermore, the subtribe is recognized by the unique appearance of its species, somewhat resembling
Heliconiinae Swainson, 1822: with elongated forewings and shorter, rounded hindwings, spider-web
forewing pattern, and a pale frequently triangular area across the hindwing toward the apex, hidden from
view when the butterfly is sitting. A combination of the following nuclear genomic base pairs is
diagnostic: hm2005164-RA.2:C119T, hm2017194-RA.1:C92T, hm2017194-RA.1:G298A, hm2005515-RA.6:
C97G, hm2016751-RA.4:C44T, hm2007706-RA.6:G759G (not T), hm2009397-RA.1:A367A (not T),
hm2020285-RA.1:C553C (not A), hm2020285-RA.1:A554A (not G), hm2004293-RA.6:A149A (not G).
Genera included. Only the type genus.
Parent Taxon. Tribe Adoliadini Doubleday, 1845.
Comment. The name for the subtribe is formed by taking the entire name of the type genus as a root to
avoid homonymy with Evenina Faynel & Grishin, 2022 (type genus Evenus Hiibner, [1819], in Eumaeini
E. Doubleday, 1847).
Pseudathymina Grishin, new subtribe
http://zoobank.org/55581E3A-18C6-492F-BD1A-3B3F205896AF
Type genus. Pseudathyma Staudinger, 1891.
Definition. Pseudathyma (type species Pseudacraea sibyllina Staudinger, 1890) forms a prominent
phylogenetic lineage within Adoliadini Doubleday, 1845 on par with other subtribes (Fig. 6) and,
therefore, represents a new subtribe. This new subtribe is diagnosed by open discal cells of both wings, Ro
that originates slightly beyond, instead of before, the end of the discal cell, and the absence of the anal
lobe on the hindwing, per Chermock (1950), who gave these characters for Pseudathyma. In wing
patterns, members of this subtribe are more similar to Neptis [Fabricius], 1807 in having four generally
pale areas on the forewing (by the middle of the inner margin, in the discal area distad of the discal cell,
by the apex, and in the discal cell) than to most Adoliadini. A combination of the following nuclear
genomic base pairs is diagnostic: hm2007185-RA.1:A1149G, hm2007185-RA.1:C1150T, hm2017262-RA.1:
A935G, hm2018054-RA.1:TIS55C, hm2017807-RA.2:A68T.
Genera included. Only the type genus.
Parent Taxon. Tribe Adoliadini Doubleday, 1845.
Kumothalina Grishin, new subtribe
http://zoobank. org/101F0041-F957-4CD5-92F7-079A780A043D
Type genus. Kumothales Overlaet, 1940.
Definition. Wahlberg et al. (2020) placed Kumothales (type species Kumothales inexpectata Overlaet,
1940) in the tribe Cymothoini Dhungel & Wahlberg, 2018. Our analysis confirms this conclusion and
previously published phylogenies (Wahlberg et al. 2020; Kawahara et al. 2023) and places the
Kumothales \ineage as sister to all other Cymothoini that diverged from them before the divergence of
Adoliadini Doubleday, 1845 into subtribes (Fig. 6). This substantial genetic differentiation of Kumothales
is also the reason for the difficulty in finding the place for this genus in taxonomic hierarchy without
DNA analysis. Therefore, this lineage represents a subtribe. This new subtribe is distinguished from its
relatives by the details of wing venation as described for Kumothales by Overlaet (1940) and a
18
combination of the following characters: wings less rounded, forewing apex lobed, hindwing margin
wavy, wings without bands, with a unique submarginal wavy pattern consisting of dark inverted deep U
with a sharp tooth (narrow V) inserted into it in every cell. A combination of the following nuclear
genomic base pairs is diagnostic: hm2008200-RA.1:A517C, hm2006358-RA.1:C1I1IS51A, hm2009464-
RA.1:C128T, hm2010867-RA.7:G38C, hm2012380-RA.2:A48G, hm2012713-RA.1:T428T (not C),
hm2012713-RA.1:G946G (not A), hm2007718-RA.2:C205C (not A), hm2006845-RA.2:T1311T (not A),
hm2006845-RA.2:A1314A (not G).
Genera included. Only the type genus.
Parent Taxon. Tribe Cymothoini Dhungel & Wahlberg, 2018.
Amnosiini Grishin, new tribe
http://zoobank.org/AD32BD0A-6755-4650-AB24-3FD7A43DFA06
Type genus. Amnosia E. Doubleday, 1849.
Definition. Amnosia (type species Amnosia decora E. Doubleday, 1849) belongs to the subfamily
Pseudergolinae Jordan, 1898, but is more distant from and sister to the rest of the subfamily (Fig. 6).
Genetic differentiation of the Amnosia lineage from other Pseudergolinae is at the level of a tribe.
Therefore, we propose that the Amnosia lineage corresponds to a tribe. This new tribe is diagnosed by a
combination of the following characters: wings mostly dark in males, forewing with a pale stripe from
mid-costa to tornus, and hindwing with two pairs of larger submarginal eyespots beneath that are better
defined than in other Pseudergolinae. A combination of the following nuclear genomic base pairs is
diagnostic: hm2002290-RA.3:A49G, hm2013678-RA.4:A234C, hm2013678-RA.4:G246A, hm2013678-RA.4:
T294C, hm2006306-RA.3:G107C, hm2013835-RA.2:G178G (not A), hm2014102-RA.2:C115C (not T), hm2014102-
RA.2:A117A (not T), hm2009568-RA.1:T184T (not A), hm2009568-RA.1:C185C (not A).
Genera included. Only the type genus.
Parent Taxon. Subfamily Pseudergolinae Jordan, 1898.
Ayperanartia Grishin, new subgenus
http://zoobank.org/D264019C-2 106-4F29-9F 1F-7830321FAD68
Type species. Vanessa dione Latreille, [1813].
Definition. The genus Hypanartia Htibner, [1821] (type species Hypanartia demonica Hiibner, [1821],
which is a junior subjective synonym of Papilio lethe Fabricius, 1793) has been divided into two species
groups: the paullus group (includes the type species of Hypanartia) and the dione group (Willmott et al.
2001; Llorente et al. 2023). Our genomic tree shows this split (Fig. 7) and is consistent with the
cladogram constructed using morphological characters (Willmott et al. 2001). Here, the division of
Hypanartia into two clades is formalized, and the new subgenus is proposed to encompass the dione
group. This new subgenus is distinguished from the nominotypical subgenus by male genitalia: nearly
triangular in lateral view valvae, separated at the base in ventral view; vinculum broader near the base of
succus in lateral view; saccus with narrower anterior part (at least in lateral view); and gnathos
continuously sclerotized, joined. See Willmott, Hall, and Lamas (2001) for additional information and
illustrations. A combination of the following nuclear genomic base pairs is diagnostic: hm2021257-RA.1:
A261G, hm2002154-RA.32:T1114A, hm2013826-RA.2:G702A, hm2006214-RA.3:T888C, hm2005917-RA.
1:C3222G.
Etymology. The Latin prefix hypo- means “below”, “beneath”, and sometimes “less than”. Species of the
new subgenus are clearly more than that, and this prefix is replaced with hyper- (1.e., “above”, “high”,
“beyond”, “excessive”) for an exaggerated look of some of these butterflies: typically with more angular
wings, longer tails, and bolder white spots. The name is a feminine noun in the nominative singular.
19
Species included. The type species (1.e., Vanessa dione Latreille, [1813]), Hypanartia celestia Lamas,
Willmott & J. Hall, 2001, Eurema charon Hewitson, 1878, Hypanartia christophori Jasinski, 1998,
Hypanartia cinderella Lamas, Willmott & J. Hall, 2001, Hypanartia fassli Willmott, J. Hall & Lamas,
2001, Eurema kefersteini Doubleday, [1847], Eurema lindigii C. Felder & R. Felder, 1862, Hypanartia
splendida Rothschild, 1903, and Hypanartia trimaculata Willmott, J. Hall & Lamas, 2001 (including their
subspecies and synonyms).
Parent taxon. Genus Hypanartia Hubner, [1821].
Comments. In their genetic differentiation (Fig. 7), the two subgenera of Hypanartia are approximately
the same as some subgenera in Nymphalis Kluk, 1780 (type species Papilio polychlioros Linnaeus, 1758).
Therefore, they are phylogenetically equivalent to the two subgenera Nymphalis and Aglais Dalman, 1816
(type species Papilio urticae Linnaeus, 1758) (i.e., the same level in the tree), and are stronger
differentiated genetically than Nymphalis from Polygonia Hubner, [1819] (type species Papilio c-aureum
Linnaeus, 1758).
Genera Subgenera
Hypanartia lethe|17118C08|Mexico:Oax|1987
anartia godmanii|19123E07|Mexico:Oax|1988
Hypanartia bellaj[19122E06|Brazil:PR|1995
Hypanartia paullus|19122E07|Dominican Republic|1981
Hypanartia kefersteini[19122E08|Peru|2015
Hypanartia cinderella|19122E09|Peru|2015
Hypanartia trimaculata|19123E08|Mexico:Ver|1981
Hypanartia christophori|19122E11|Colombia|1982
Hypanartia lindigii|19122E12|Ecuador|2004
Hypanartia dione|22061F03|Peru:Cuzco|2019
Vanessa carye|19093E12|Bolivia|2009
Vanessa annabella|9614|USA:UT,Davis Co.|2017
Vanessa itea|19122A11|Australia|1972
Vanessa gonerilla|19122A12|New Zealand|1968
Vanessa terpsichore|19121H06|Chile|1979
1° Vanessa braziliensis|19121H11|Peru:Cuzco|2016
it Vanessa myrinna|19121H10|Brazil:PR|1995
se Vanessa altissima|22063B02|Peru:Cuzco|2019
Vanessa virginiensis|3866|USA:TX,Dallas Co.|2015
Vanessa cardui|8641|USA:TX,Dallas Co.|2017
Vanessa kershawi|19121HO9|New Zealand|1968
Vanessa tameamea|17115B02|USA:HI,Hawaii]1974
Vanessa atalanta|9826|USA:TX,Dallas Co.|2017
100 Vanessa indica|19121G11|Myanmar|2002
94 2 Vanessa dejeanii|19122A05|Java|old
46 Vanessa vulcania|19122A08|no data|old
Vanessa abyssinica|19122A09|Ethiopia|1963
Vanessa dimorphica|19122B09|Tanzania|1972
Vanessa hippomene|19122B10|South Africa|1978
Vanessa madegassorum [not hippomene]|19122B12|Madagascar|old
Antanartia delius|19093E01|Congo|1977
Antanartia schaeneia|19122B11|South Africa|1978
Nymphalis caschmirensis|19122B03|Pakistan,Murree|1961
Nymphalis ichnusa|22029A12|Italy|1965
i. 100
Hypanartia Hyp
100
100
Hypanartia
100 100
100
Hyperanartia
100 100
Neofieldia
100
Bassaris
Vanessa
10
100
100
98
Vanessa
100
100
Paranartia
100
Antanartia
100
84
98
Aglais
106
100
108
Nymphalis urticae|PAOE19|Germany|2017
Nymphalis ladakensis|19122B04|Tibet|1980
Nymphalis milberti/9460|USA:WY,Park Co.|2017
Nymphalis io|JPAOE20|Germany|2017
Inachis Nymphalis progne|17115B04|USA:SD,Roberts Co.|1981
Nymphalis oreas|17115B05|USA:OR, Yamhill Co.|1983
Nymphalis haroldii|17115B06|Mexico:Hid|1981
Nymphalis gracilis|]PAO246|USA:CO,Larimer Co.|2016
Nymphalis comma|17117D09|USA:TX,Polk Co.|1971
Nymphalis g-argenteum|19122B08|Mexico, Ver|1910
Nymphalis satyrus|PAO42|USA:CA,Monterey Co.|2016
Nymphalis interrogationis|6030|USA:TX,Dallas Co.|2016
Nymphalis egea|19122B05|Greece|1983
Nymphalis interposita|19122B06|Bhutan|1968
: Nymphalis undina|19122B07|China|1909
v4 Nymphalis c-album|PAOE08|Switzerland|2017
Ue Nymphalis faunus|PAO270|USA:CO,Larimer Co.|2016
Kaniska Nymphalis c-aureum|19093E05|Korea or Japan|1988
Roddia Nymphalis canace|19093E08|Myanmar|2001
Nymphalis l-album|17115B03|USA:MT,Lake Co.|1976
100 Nymphalis polychloros|19093E04|France|1976
Nymphalis californica|9635|USA:UT,Davis Co.|2017
a Nymphalis xanthomelas|19122B01|China|1983
re; Nymphalis cyanomelas|15101E02|Mexico:Ver|old
Nymphalis antiopa|8980|USA:NM, Otero Co.|2017
100
100
100
Nymphalis too”
100
Polygonia 52
100
O02 Nymphalis ak
Fig. 7. The phylogenetic tree of Nymphalis relatives inferred from protein-coding regions of the nuclear genome (autosomes).
Genus-group names are shown above or below corresponding branches. Names of genera are shown on the left and in a larger
font than names of subgenera. Names, clades, and species of new subgenera proposed in this work are shown in color, except
that magenta indicates a new status of Vanessa madegassorum (species, not a subspecies of Vanessa hippomene).
20
Vanessa madegassorum (Aurivillius, 1899) is a species distinct
from Vanessa hippomene (Hiibner, 1823)
Genomic sequencing reveals notable genetic differentiation between the nominotypical Vanessa
hippomene (Hiibner, 1823) (type locality not given, deduced by wing shape and patterns of a specimen
shown in the original illustration to be in South Africa) and Vanessa hippomene madegassorum
(Aurivillius, 1899) (type locality in Madagascar) (Fig. 7). The COI barcodes of the two taxa differ by
2.9% (19 bp). Phenotypically, V. h. madegassorum is characterized by more prominently scalloped (even
toothed at veins) wing margins, a longer and thinner major hindwing tail at the end of vein M3, a second,
shorter tail at the end of vein CuA2 (absent in the nominotypical V. hippomene), orange (rather than
yellower) forewing band, green scaling by the forewing apex beneath, and reduced pale scaling and spot
by mid-costa on the ventral hindwing (Fig. 8). Taken together, these observations suggest that Vanessa
madegassorum (Aurivillius, 1899), stat. nov. is a species distinct from Vanessa hippomene (Hiibner,
1823). Vanessa madegassorum stat. nov. is known only from Madagascar, with the last reported record
from 1976 (Lees et al. 2003), and may be of conservation concern, if not already extinct. The COI
barcode sequence of V. madegassorum stat. nov., sample NVG-19122B12, GenBank accession
OR578710, 658 base pairs, is:
TACTTTATATTTTATTTT Gece Teel ih cee an TAGTTGGAACTTCACTTAGTTTATTAATTCGAACTGAATTAGGAAAT CCAGGATCTTTAATTGGAGATGATCAAATTTATAATACA
ATTGTTACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGTTTTGGTAATTGATTAATTCCACTTATATTAGGAGCCCCTGATATAGCTTTTCCACGTA
TAAATAATATAAGATTTTGACTTTTACCCCCTTCATTAATATTATTAATT TCTAGTAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGC
TCATAGAGGATCTTCTGTAGATCTAGCAATTTTTTCATTACATTTAGCTGGAATTTCCTCTATTTTAGGAGCAATTAATTTTATTACTACTATTATTAATATACGAATTAATAGAATATCT
TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGTATTACAGCTTTACTTTTATTAATCTCTCTTCCTGTTTTAGCTGGAGCTATTACTATACTTCTAACAGAT CGAAATATTAATACAT
CATTTTTTGATCCTGCGGGAGGAGGAGACCCAATTCTTTATCAACATTTATTT
Ex ET ARR RSS SE
.A ft ¢ genitalia . DNA sample ID: bebidas
Lita Pe Sk D.P. NVG-19122B12
EdwTOwen 35__} c/o Nick V. Grishin 01602802
colléction
Fig. 8. Vanessa madegassorum stat. nov. male (dorsal: left, ventral: right) in USNM collection sequenced as NVG-19122B12
with its labels. All images are to scale.
Subgenera in Vanessa [Fabricius], 1807
The genus Vanessa |Fabricius], 1807 (type species Papilio atalanta Linnaeus, 1758) has been divided
into five species groups: the atalanta group (includes the type species of Vanessa), the cardui group
(Papilio cardui Linnaeus, 1758 is the type species of Cynthia [Fabricius], 1807), the carye group
(Hamadryas carye Hiibner, 1812 is the type species of Neofieldia Ozdikmen, 2008), the itea group
21
(Papilio itea Fabricius, 1775 is the type species of Bassaris Hiibner, [1821]), and the hippomene group
(Wahlberg and Rubinoff 2011). Because four of these groups are characterized by notable genetic
differentiation (Fig. 7), we propose to treat the two names as subgenera: Neofieldia Ozdikmen, 2008, stat.
rest. and Bassaris Hitbner, [1821], stat. rev. and leave Cynthia as a junior subjective synonym of
Vanessa. The hippomene species group does not have a name. It is described below.
Paranartia Grishin, new subgenus
http://zoobank. org/5760367D-44F8-48A F-B592-2B LAEE4CC755
Type species. Hypanartia hippomene Hibner, [1823].
Definition. Comprises the hippomene species group in Vanessa [Fabricius], 1807, as proposed by
Wahlberg and Rubinoff (2011), who inferred a comprehensive phylogeny of Vanessa and its relatives and
discovered the phylogenetic position of the hippomene group within Vanessa. This group is unusual
because its constituent species have been previously placed in Antanartia Rothschild & Jordan, 1903
(type species Papilio delius Drury, 1782) due to phenotypic similarities. We treat the hippomene group as
a new subgenus (Fig. 7). This subgenus is distinguished from Antanartia by genitalia: in males, aedeagus
without spines and projections (does not end in a “barb” like a fish hook end structure) and valva without
projections off costa, which is nearly straight; and in females, with developed signa in corpus bursae
(Howarth 1966), and from Vanessa by a sharp tooth-like tail at the vein M3 on hindwing. A combination
of the following nuclear genomic base pairs is diagnostic: hm2005743-RA.6:T48C, hm2002542-RA.3:
A237G, hm2017019-RA.1:T160C, hm2002154-RA.32:A1116G, hm2021745-RA.5: C862A.
Etymology. The prefix para- means “beside”, “beyond”, or “similar to”. Species of the new subgenus are
similar to and were previously placed in Antanartia, and the prefix para- is fused with the latter genus
name to form the new name. The name is a feminine noun in the nominative singular.
Species included. The type species (1.e., Hypanartia hippomene Hiibner, [1823]), Antanartia dimorphica
Howarth, 1966, and Hypanartia hippomene var. madegassorum Aurivillius, 1899, stat. nov. (including
their subspecies and synonyms).
Parent taxon. Genus Vanessa [Fabricius], 1807.
Comments. The four subgenera of Vanessa are more genetically distinct from each other than some
subgenera within Nymphalis Kluk, 1780 (type species Papilio polychloros Linnaeus, 1758) (Fig. 7), and
several of such Nymphalis subgenera are commonly treated as genera, e.g., Polygonia Hiibner, [1819]
(type species Papilio c-aureum Linnaeus, 1758).
Erestia (Anthanassa) seminole Skinner, 1911 is a species distinct
from Eresia (Anthanassa) texana (W. H. Edwards, 1863)
Currently in the subgenus Anthanassa
Eresia texana|21011G12|HT|USA:TX,Comal Co.|old
Scudder, 1875 (of Eresia Boisduval, 1836) Eresia texana|4378|F|USA:TX, Dallas Co.|2015
. . - Eresia texana|12316|USA:TX,Jeff Davis Co.|2019
and treated as a subspecies of its type species Eresia texana|3608|USA:TX, Starr Co.|2015
: o>, Eresia texana|5999|USA:AZ,Santa Cruz Co.|2016
Melitaea texana W. H. Edwards, 1863 (type Eresia tenana[8327|USA-AZ, Pinal Co|2017
: . Eresia texana|5819|USA:TX, Travis Co.|2016
locality USA: Texas, probably Comal Co., Eresia seminole|20125G05|ST|USA:GA, Decatur Co.|1910
New Braunfels), Eresia texana seminole ||» Ser rt eee oa
‘ 1 . 7 Eresia seminole|21026D02|USA:FL,Levy Co.|1980
Skinner, 1911 (type locality USA: Georgia, Eresia ptolyca|10631|Mexico:Tam|1986
Decatur Co Bainbridge) iS genetically Eresia ardys|10633|Mexico:San Luis Potosi|1980
3 9
differentiated from it (Fig. 9 blue vs. red) Fig. 9. Nuclear genome tree (autosomes) of Eresia texana (blue) and
; ; : Eresia seminole stat. rest. (red). Primary types are in magenta.
showing Fsi/Gmin in the Z chromosome of
0.39/0.01 and COI barcode difference of 3.6% (24 bp). Therefore, in agreement with Calhoun (1997), we
regard Eresia (Anthanassa) seminole Skinner, 1911, stat. rev. as a species-level taxon.
22
Microtia elvira Grishin, new species
http://zoobank.org/1 7FC3D08-DF04-487B-A IF 1-F536C01E624F
(Figs. 10 part, 11, 12a, b)
Definition and diagnosis. Genomic sequencing of Microtia H. Bates, 1864 (type species Microtia elva
H. Bates, 1864) specimens reveals a deep split within its type species (Fig. 10). The western clade (Fig.
10 red) is profoundly differentiated from the eastern clade (Fig. 10 blue) with the Z chromosome Fst/Gmin
of 0.60/0.006 and COI barcode difference of 4.7% (31 bp), which is more than expected from phenotypic
similarity. This scenario parallels that of Microtia perse (W. H. Edwards, 1882) (type locality in USA:
AZ, Graham Co.) vs. Microtia elada (Hewitson, 1868) (type locality in Mexico) (Fig. 10 green vs. violet).
Therefore, the two clades represent distinct species. Specimens from around the type locality (Guatemala)
belong to the eastern clade. Curiously, Microtia elva horni Rebel, 1906 (type locality in Mexico: Oaxaca)
and its junior subjective synonym Microtia elva form draudti Rober, [1914] (type locality in Mexico,
“Coatepec” on the label of a syntype) (Fig. 10 teal colored), which are also in the eastern clade but are
visually rather distinct in their much broader orange-yellow markings and nearly half of dorsal hindwing
orange-yellow, are not particularly different genetically from the nominotypical M. e/va. Thus, the
western clade does not have available names associated with it and represents a new species. This new
Species is most similar to M. elva, with which it was previously combined. Distinguished from M. e/va by
largely yellow or orange-yellow tibiae and frequently other leg parts (legs in M. elva are back).
Additionally, characterized by narrower orange-yellow bands and thinner, bar-like (particularly in males)
orange-yellow mark by the middle of the inner forewing margin (Figs. 11, 12a). In M. elva, this bar is
more rounded, larger, and can be nearly triangular and much broader at the base, widening both distad and
basad (Fig. 12c). The outer edge of the hindwing discal band (on both dorsal and ventral sides) is more
angled in the middle (Figs. 11, 12b), instead of straighter and more rounded edge in M. elva (Fig. 11d).
Due to variation in colors and patterns, most confident identification is provided by DNA. The following
combination of characters is diagnostic in the nuclear genome: hm2014195-RA.2:C190T, hm2014195-
RA.2:T201A, hm2016592-RA.17:G261A, hm2017493-RA.1:G240A, hm2008057-RA.6:TI71C and COI
barcode: G38A, C238C, 421C, A583T, T637C.
TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAATTGGAACATCTTTAAGACTTTTAAT TCGAACTGAATTAGGAAACCCAGGATCAT TAATTGGAGATGATCAAATTTATAATACT
ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAATTCCAT TAATATTAGGAGCTCCTGATATAGCTTTCCCCCGAA
TAAATAATATAAGATTTTGACTACTACCCCCATCACTTATATTATTAATT TCTAGAAGAATT GTAGAAAATGGAGCAGGAACAGGAT GAACAGTGTACCCCCCACTTTCTTCTAATATTGC
TCATAGAGGATCATCTGTTGATT TAGCAATTTTTTCACTACATCTAGCAGGAATTTCCTCAATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATATATCA
TTTGATCAAATACCTTTATTTGTTTGAGCAGTTGGTATTACAGCTCTTTTATTATTATTATCTTTACCAGTATTAGCAGGAGCTATTACTATACTCCTTACTGATCGAAATATTAATACAT
CATTTTTTGACCCAGCTGGAGGAGGGGATCCCATTTTATATCAACATCTATTT
a Microtia elvira|22096HO8|PT|Mexico:Son|1953 b ay tenor elvira|22096H10|HT|USA:AZ,Madera Cyn
Microtia elvira|22096G08|PT|Mexico:Son|1976 icrotia elvira]J22096G07|PT|Mexico:Son|1976
Microtia elvira]22097A04|PT|Mexico:Sin|1976 Merona elvira|21091A03|PT|USA:AZ,Santa Cruz Co.
Microtia elvira]J22096H10|HT|USA:AZ,Madera Cyn|1954 icrotia elvira|22096G08|PT|Mexico:Son|1976
Microtia elvira|21091A03|PT|USA:AZ,Santa Cruz Co.|2015 sMicrotia elvira|22097A04|PT|Mexico:Sin|1976
0.008 Microtia elvira|22096G07|PT|Mexico:Son|1976 ooMicrotia elvira]22096HO08|PT|Mexico:Son|1953
Microtia elvira]J22097A01|PT|Mexico:Nay|1946
Microtia elvira|22097A03|PT|Mexico:Nay|1946
Microtia elva elva|22096H09|Mexico:Yuc|1972
Microtia elva elva|22096G12|Mexico:Mor|1978
Microtia elva elva|22096H03|Mexico:Jal|1974
Microtia elva elva]22104A09|Mexico:Pue|1955
Microtia elva elva|22096G10|Costa Rica|1989
Microtia elva elva|22096H05|Panama|1969
Microtia elva elva|22104A08|Guatemala|1950
Microtia elva elva|10626|USA:TX,Cameron Co.|1973
Microtia elva elva|22096H02|Mexico:Ver|1980
Microtia elva elva|22096H04|Mexico:Tam|1981
Microtia elva elva|22096H11|Mexico:Tam|1985
Microtia elva elva|22097A08|Mexico:SLP|1982
Microtia elva horni]22097A07|Mexico:Oax|1980
Microtia elva horni|22096HO7|Mexico:Oax|1980
Microtia elva horni|22096H01|Mexico:Chia|1980
Microtia dymas dymas|21068C03|USA:TX,Starr Co.|2008
> Microtia perse|5947|M|USA:AZ,Pima Co.|2016
Microtia perse|21056B10|Mexico:Son|1998
Microtia elada ulrica|5155|USA:TX,Hidalgo Co.|2015
Microtia elada ulrica|7682|Mexico:Que|1980
Microtia coracara|18014G05|Mexico|1942
icrotia elvira|22097A01|PT|Mexico:Nay|1946
Microtia elvira]22097A03|PT|Mexico:Nay|1946
Microtia elva elva]22096H03|Mexico:Jal|1974
Microtia elva elva]22096HO9|Mexico:Yuc|1972
°Microtia elva elva|22096G12|Mexico:Mor|1978
1 Microtia elva elva|22096G10|Costa Rica|1989
Hicrotia elva elva|22096H05|Panama|1969
icrotia elva elva|22104A08|Guatemala|1950
Microtia elva elva]22104A09|Mexico:Pue|1955
icrotia elva elva]22096H11|Mexico:Tam|1985
Hicrotia elva elva|22096HO2|Mexico:Ver|1980
ae elva elva|22097A08|Mexico:SLP|1982
icrotia elva elva|22096H04|Mexico:Tam|1981
1Microtia elva elva|10626|USA:TX,Cameron Co.
8Microtia elva horni]22096HO1|Mexico:Chia|1980
%Microtia elva horni|22097A07|Mexico:Oax|1980
Microtia elva horni|22096HO7|Mexico:Oax|1980
Microtia coracara|18014G05|Mexico|1942
Aherote perse|5947|M|USA:AZ,Pima Co.|2016
Icrotia perse|21056B10|Mexico:Son|1998
Microtia elada ulrica|5155|USA:TX,Hidalgo Co.|2015
Microtia elada ulrica|7682|Mexico:Que|1980
Microtia dymas dymas|21068C03|USA:TX,Starr Co.|2008
Fig. 10. Phylogenetic trees of Microtia inferred from protein-coding regions of a) nuclear (autosomes) and b) mitochondrial
genomes: Microtia elvira sp. n. (red), M. e/va (blue with M. e. horni labeled in teal), M. perse (green), and M. elada (violet).
23
Fig. 11. Holotype of Microtia elvira sp. n. in dorsal (left) and ventral (right) views, data in text.
‘Microtia elva
Microtia elvira’sp. n.
a ie) . C
)
Ls ’
nf if i 3 = >
~ am 5 Pp
‘ nif
te i
Fig. 12. Microtia elvira sp. n. (a, b) and Microtia elva (c, d) iNaturalist observations: USA: AZ, Santa Cruz Co.: a) 144668453
Montosa Canyon, GPS 31.6727, —110.9406, 19-Aug-2016 © jmbearce; b) 141491956 Atascosa Mts., California Gulch, GPS 31.4220, —111.2404, 3-
Oct-2014 © Ken Kertell; and Mexico: Nuevo Leon, Monterrey: ¢) 4292755 Parque la Estanzuela, GPS 25.5507, —100.2707, 7-Oct-2016 © Roberto
Gonzalez; d) 171257635 Guadalupe, Contry Sol, GPS 25.6505, —100.2648, 5-Jul-2023 © Rodolfo Salinas Villarreal. Arrows in b) and d) point at the
legs to draw attention to their color difference. Images are color-corrected and rotated. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/
Type material. Holotype: & deposited in the Los Angeles County Museum of Natural History, Los
Angeles, CA, USA [LACM], illustrated in Fig. 11, bears three printed (number “12” handwritten) labels:
two white [ October 12, 1954 | Madera Canyon, Santa Rita Mt’s. | Southern Arizona. | W. Rees & H.
Reid |], [ DNA sample ID: | NVG-22096H10 | c/o Nick V. Grishin ], and one red [HOLOTYPE @ |
Microtia elvira | Grishin ]. Paratypes: 5¢0ch 299: 1h USA, Arizona, Santa Cruz Co., Sycamore canyon,
GPS 31.4213, —111.1942, 25-Sep-2015, Brian Banker leg. (NVG-21091A03); others at LACM, Mexico:
Sonora: 2¢'o% Rio Cuchujaqui, 8 rd. mi E of Alamos, el. 1000', 30-Aug-1976, J. P. & K. E. Donahue leg.
(NVG-22096G07 & G08); 12 Alamos, 25-Jul-7-Aug-1953, Fred S. Truxal leg. (NVG-22096H08); 1c
Sinaloa, 27.8 km S Culiacan, 30-Aug-1976, C. D. George & R. K. Snelling leg. (NVG-22097A04); 1c 1°
Nayarit, 5-10 mi N of Tepic, 2500'-3000', 13-Dec-1946 (NVG-22097A03 & A0O1).
Type locality. USA: Arizona, Pima/Santa Cruz Cos., Santa Rita Mountains, Madera Canyon.
Etymology. The meaning of the name Elvira is typically associated with traits such as truthful,
trustworthy, or pure, and also noble or elf-like. Formed from the name of its sister species, e/va, it
signifies our high confidence that this is a “trustworthy” species, i.e., strongly differentiated from M. elva
but is e/va- or elf-like. The name of this western counterpart of M. e/va is longer to mean that it takes a
long day from sunrise in the east to sunset in the west. The name is a feminine noun in apposition.
English name. Elfoid.
Distribution. Southeastern Arizona and western Mexico (confirmed from Sonora, Sinaloa, and Nayarit).
Comment. Both ™. elvira sp. n. and M. elva occur in the USA. Microtia elva strays into the lower Rio
Grande Valley of Texas, e.g., a male from Brownsville in Cameron County collected by William W. &
Nadine McGuire on 20-Jul-1971 [TAMU] that we sequenced as NVG-10626 (Fig. 10).
24
Cyllopsis brocki Grishin, new species
http://zoobank. org/3 EE47FD0-3 1 EF-4CE0-BE2 1-5 DC240F1FFEC
(Figs. 13 part, 14-16)
Definition and diagnosis. Inspection of nuclear genomic trees reveals that a single specimen from
Mexico, Sonora, initially identified as “Cyllopsis pertepida’, is confidently placed as sister to the clade
Cyllopsis pertepida|9714|USA:TX
Cyllopsis pyracmon|17115C10|AZ
Cyllopsis gemma|9181|USA:AR
Cyllopsis brocki|20112B02|HT
Cyllopsis hedemanni|19117F04
» Cyllopsis nayarit|22043A06|HT
Cyllopsis pephredo|22098C04
Cyllopsis clinas|21071B12|Mexico
Cyllopsis nelsoni|21071E05|ST
Cyllopsis argentella]22098B09|Pan
Cyllopsis gemma|9181|USA:AR, Scott Co.|2017 b
Cyllopsis pyracmon|17115C10|AZ,Santa Cruz Co.|1968
Cyllopsis pertepida|9714|USA:TX, Jeff Davis Co.|2017 ~ Ga
Cyllopsis brocki]20112B02|HT|Mexico:Son|1984
Cyllopsis hedemanni|19117F04|Honduras|1980
Cyllopsis nayarit|22043A06|HT|Mexico:Nay|1932
Cyllopsis pephredo|22098C04|Costa Rica|1983
Cyllopsis clinas|21071B12|Mexico:Gue|1981
Cyllopsis nelsoni|21071E05|ST|Guatemalalold
Cyllopsis argentella|22098B09|Panama|1982
Cyllopsis gemma|9181|USA Cc
Cyllopsis pyracmon|17115C10
Cyllopsis pertepida|9714|USA:TX
Cyllopsis brocki|20112BO02|HT
Cyllopsis hedemanni|19117F04
Cyllopsis nayarit|22043A06|HT
Cyllopsis pephredo|22098C04
Cyllopsis clinas|21071B12|Mexico
Cyllopsis nelsoni|21071E05|ST
Cyllopsis argentella|22098B09|Pan —>5,—
Fig. 13. Phylogenetic trees of selected Cyl/opsis species inferred from protein-coding regions of a) the nuclear genome
(autosomes), b) the Z chromosome, and c) the mitochondrial genome: C. brocki sp. n. (red) and its sister group (blue).
of three species: Cyllopsis gemma (Hiibner, 1808), Cyllopsis
pertepida (Dyar, 1912), and Cyllopsis pyracmon (A. Butler, 1867)
(Fig. 13a, b, red and blue), and therefore represents a species distinct
from them. In the mitochondrial genome tree, which has lower
Statistical support, this species is also in the same clade with the
three others but is sister to C. gemma (Fig. 13c). Because all other
described species of Cyllopsis R. Felder, 1869 (type species
Cyllopsis hedemanni R. Felder, 1869) belong to other clades (Fig.
13) and are phenotypically different (Miller 1974), this species is
new. It differs from its relatives by a combination of larger size |> —~ =. ae
(forewing length about 20 mm, while typically less than 18 mm in |. 2424 BNE oe OS
C. gemma), a large androconial patch (cut by veins) in the discal ae haste “s ite: pts Sy
area of the dorsal forewing (absent in C. gemma), postdiscal brown oe ane taaas ~108.8370, see oiee
line strongly toothed towards the margin at vein My and not |jmbearce. Brightened and color-corrected. CC BY-NC
reaching the costal margin (as in C. gemma and some C. pertepida, [4° Bps:(/creativecommons.org/licenses/by-nel4.0/
but not in C. pyracmon), more extensive and coarse mottling on the ventral side of wings, especially in
the basal part of the hindwing (as in some C. pyracmon but not in other species), and reduced rusty
overscaling dorsally: wings appear more brown than reddish (Figs. 14, 15). In male genitalia (Fig. 16),
diagnosed by broader valva with more convex costa-ampulla, valva more distinctively narrowing into
harpe in lateral view, harpe with broader and more angular distal end in dorsal view shaped like a
triangular plate rather than ending in a point. In DNA, a combination of the following characters is
25
diagnostic in the nuclear genome: hm2006469-RA.2:C61T, hm2003322-RA.2:G69A, hm2003322-RA.2:T106C,
hm2009012-RA.1:T408C, hm2009012-RA.1:G885T, hm2009732-RA.2:G72G (not A), hm2009355-RA.1:A261A (not G),
hm2009355-RA.1:G270G (not A), hm2013443-RA.4:T606T (not C), hm2013443-RA.4:T702T (not A) and COI barcode:
T235C, T283C, T379A, T451A, T544C, A631G. Due
to pronounced and frequently seasonal wing
pattern variation in Cy//opsis that is unexplored in
the new species, definitive identification is
possible by genitalia or DNA.
Barcode sequence of the holotype: Sample NVG-
20112B02, GenBank OR578712, 658 base pairs:
AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTTGGAACCTCCCTTAGTC
TATTATTCGAATAGAATTAGGTAATCCAGGATTTTTAATTGGAGATGATCAAATTT
TAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTAT
TATAATTGGTGGATT TGGGAACTGATTAGTTCCCCTTATATTAGGGGCCCCCGATAT
AGCTTTCCCCCGAATAAATAATATAAGATTTTGACTACTTCCCCCCTCATTAGTCCT
TTTAATTTCAAGAAGTATTGTAGAAAATGGAGCTGGRACAGGATGAACAGTTTACCC
CCCTCTTTCTTCTAATATTGCCCACAGAGGATCTTCAGTCGATTTAGCAATTTTTTC
TTTACATTTAGCTGGGATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAAT
TATTAACATACGAATTAATAATATAACGTATGATCAAATACCTCTATTTGTTTGAGC
AGT TGGAATTACAGCATTATTATTATTACTCTCTTTACCAGTATTAGCTGGAGCTAT
TACTATACTTTTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCTGGAGG
AGGGGACCCTATTTTATACCAACATTTATTT
Type material. Holotype: co deposited in the
McGuire Center for Lepidoptera and Biodiver- | Fig. 16. Genitalia of Cyllopsis brocki sp. n. holotype (data in
sity, Gainesville, FL, USA [MGCL], illustrated in text) in left lateral (top left), dorsal (right) and left ventrolateral
: y: : 2d ; ; (bottom left) views.
Fig. 14, bears four printed labels: three white [ 31
July 1984 | Trinidad-Yecora Rd. | 1-5 mi. e. Trinidad | Mine, Son., Mexico | leg. Jim P. Brock |, [ DNA
sample ID: | NVG-20112B02] c/o Nick V. Grishin ], [ genitalia vial | NVG230917-02 | Nick V. Grishin ],
and one red [| HOLOTYPE ¢& | Cyllopsis brocki | Grishin ].
Type locality. Mexico: Sonora, Yécora, E of Santa Rosa, Trinidad-Yecora Rd., 3—5mi E of Trinidad mine.
Etymology. The name honors Jim P. Brock, the collector of the holotype and one of the finest and most
knowledgeable Lepidopterists with a sixth sense for butterflies and caterpillars, finding them effortlessly
(or so it seems) where others fail. Jim’s significant contributions to butterfly knowledge delivered through
his many books, presentations, and nature tours can only be matched by his contagious excitement,
passion for sharing his expertise, and unsurpassed kindness. We deeply appreciate Jim's extensive support
of our projects throughout the years. The name is a singular noun in the genitive case.
Distribution. Known only from the holotype collected in Mexico: Sonora.
Comment. The type locality of this new species is near the type locality of Amblyscirtes brocki H
Freeman, 1992 (Hesperiidae), with its two paratypes collected on the same date and at approximately the
same place as the holotype of Cyllopsis brocki sp. n.
Family Riodinidae Grote, 1895 (1827)
Teratophthalmina Grishin, new subtribe
http://zoobank.org/8C3 50BD8-8094-472C-9C17-70A9C2023D20
Type genus. 7eratophthalma Stichel, 1909.
Definition. Currently placed in the subtribe Eunogyrina Grishin, 2021, Teratophthalma (type species
Mesosemia phelina C. Felder & R. Felder, 1862) is indeed sister to its type genus Eunogyra Westwood,
1851, but is rather distant from it both genetically (Fig. 17) and phenotypically, and therefore represents a
subtribe of its own. The description and diagnostic characters of this new subtribe are as those given for
Teratophthalma on pages 76—77 (illustrated in Fig. 11) by Stichel (1910). In brief, the subtribe belongs to
Mesosemiini (see Hall (2003) for Teratophthalma) and is diagnosed by the following combination of
characters: wings without multiple narrow bands, eyespots at the end of the forewing discal cell but not
along wing margins; genitalic valvae short (as long as tegumen) and triangular, simple with pointed apex,
26
pedicel unsclerotized in the middle or ventrally split (or both). A combination of the following nuclear
genomic base pairs is diagnostic: cnel792.4.2:T805C, cnel11317.11.9:A512G, cne12569.1.1:T2145C,
cne599.10.1:A4814T, cne1398.1.1:C838G.
Genera included. Only the type genus.
Parent Taxon. Tribe Mesosemiini Bates, 1859.
300 Hamearis lucina|7282|Austria|1981
Euselasia gelon|19035G06|French Guiana|1988
Eurybia halimede|18122H07|Peru|1989|USNM
Eunogyra satyrus|18121G02|Peru|1991
Eunogyra curupira|18121G03|French Guiana|1993|USNM
Hetatopithaline axilla|18121G04|Peru|2015|USNM
ool eratophthalma maenades|18121G05|Ecuador|1988|USNM
Teratophthalma phelina|18121G06|Ecuador|1969|USNM
Teratophthalma monochroma|21125A03|T|Ecuador|old
Endosemia ulrica|19037H05|Peru:MD|2014
Ectosemia eumene|19037H07|Guyana|2000
Mesosemia philocles|19037D02|Guyana|2001
Eucorna sanarita|18122C01|Brazil:RJ|1996
Cremna actoris|19038B01|Brazil:RO|1991
100 Napaea eucharila|18072F01|13-SRNP-1135|Costa Rica|2013
Dianesia carteri|18048D12|Bahamas|1978|USNM
Esthemopsis clonia|18072D08|07-SRNP-100096|Costa Rica|2007
Mesene phareus|18072E07|06-SRNP-103370|Costa Rica|2006
Symmachia probetor|19028B05|Ecuador|2008
7 10 Tigria xypete|19028E03|12-SRNP-70540|Costa Rica|2012
Symmachiina pa ers Pterographium sicora|19028F12|Brazil:ES|1972
yab Z fe vrgensals 5094011) BrazisRO Rrenen Guiana|1989
: 7 symma virgatula|1 1 razil: 1
a 5 Argyrogrammana stilbe|19029F02|Peru:MD|1990
iP Sarota chrysus|19028H08|Peru:Cusco|2012
100 Helicopis cupido|19028H05|Brazil:AM|1995
Helicopinal—} as Ourocnemis axiochus|21123F04|Brazil:SC|1896
: Anteros micon|18072D02|13-SRNP-65547|Costa Rica|2013
Echydnina Echydna chaseba|19029D02|Brazil:SC|1991
Echydna punctata|19029D03|Peru:MD|2016
Calydna calamisa|19029D04|French Guiana|1992
Calydna hiria|19029E11|Ecuador|2008
Fale*® sau wo ~Calydna cea|19029E03|Brazil:MG|1990
14 70 Calydna sturnula|19029E05|11-SRNP-55679|Costa Rica
100 Calydna carneia|19029E09|French Guiana|1988
7o0Calydna catana|19029E12|Ecuador:Sucumbios|2005
Calydna cabira|19029F01|Peru:Loreto|1993
; Calydna venusta|19029D08|Trinidad|1999
bcalydnina an i Calydna stolata|19029D09|French Guiana|1988
a 100 Calydna thersander|19029D12|Brazil:RO|1993
Calydna fissilisima|19029D11|Brazil:RJ|1971
Calydna caieta|19029D05|French Guiana|1988
Calydna charila|19029D07|French Guiana|1989
26 Echenaidina Echenais (Echenais) thelephus|19029H04|Peru:Loreto|1993
Too Echenais (Imelda) mycea|19029H01|Ecuador:Zamora|2003
Echenais (Imelda) aenetus|19029H02|Peru:Cusco|2013
Befrostia elegia|18052H02|ST|Brazil:RJ|old
_ Xanthosa xanthosa|18054D09|ST|no data|old
Sertania guttata|18053H05|ST|Argentinalold
72 Baeotis hisbon|19026H10|Guyana|2000
Astraeodes areuta|19029H03|Bolivia|2003
100 Pheles heliconides|18072G07|Guyana|1991|USNM
Inkana incoides|19023A09|ST|S Brazillold
he, 700 Chalodeta theodora|18048H05|Peru:Cusco|2015|USNM
34 Riodina lysippus]19026H04|Ecuador:Napo|1988
Calephelis virginiensis|4171|USA:TX,Hardin Co.|2015
Chamaelimnas tircis[18048G02|Brazil:RO|1991
Eunogyrina
100
100
Teratophthalmina
100
100 pe
Mesosemiina
100
100
100
ay Riodinina é
100 —— Barbicornis basilis]19026E11|Brazil:RGS|1956
0.04 Carii 100 Seco calagutis|19044G07|Ecuador|1914
ariina Caria plutargus|19026G11|Argentina:Misiones|2012
Callistium cleadas|19031A06|French Guiana|1991
24 a er 700 : Apodemia mormo|17107E02|USA:WA, Kittitas Co.|1990
Emesis cereus|18045C06|Brazil:RO|1993
Fig. 17. The phylogenetic tree of selected Riodinidae inferred from protein-coding regions of the nuclear genome (autosomes).
Family-group names are shown above or below the corresponding branches. Names, clades, and species of new subtribes
proposed in this work are shown in color. Names of other subtribes are shown in black, and names of subfamilies and tribes are
shown in shades of gray. Note the relatively constant rate of DNA change in Riodininae (1.e., molecular clock), as evidenced
by approximately the same distance from the root to each leaf. The translucent vertical lime bar denotes a level in the tree
approximately corresponding to subtribes.
Argyrogrammanina Grishin, new subtribe
http://zoobank.org/FA788 LEE-0382-4796-9C6B-A 1lOB4C08BOA 1
Type genus. Argyrogrammana Strand, 1932.
Definition. Argyrogrammana (type species Erycina stilbe Godart, 1824) is prominently differentiated
genetically from the rest of Symmachiini Reuter, 1896 (Fig. 17), and we propose that the lineage
containing Argyrogrammana is a subtribe. This new subtribe differs from other Symmachiini by a thin
submarginal line of (sometimes fused) metallic (golden or silvery-blue) spots on both wings above and
beneath and a dark medial stripe across the eyes (Hall and Willmott 1996). A combination of the
Zi)
following nuclear genomic base pairs is diagnostic: cne3461.2.10:G397A, cne2040.8.2:A100G, cne3461.
2.10:G382A, cne2478.7.10:C607A, cne6674.8.2:G397C.
Genera included. Only the type genus.
Parent Taxon. Tribe Symmachiini Reuter, 1896.
Argyrogrammana astuta Grishin, new species
http://zoobank.org/C3 B104C6-18F0-4FAE-8506-DD345ED63531
(Figs. 18, 19)
Definition and diagnosis. Genomic sequencing of the holotype of Argyrogrammana praestigiosa
(Stichel, 1929) (type locality not specified, likely the Guianas) (in MFNB, NVG-18077D12) reveals that a
sequenced specimen identified as A. praestigiosa from southeastern Peru (illustrated in Fig. 11 in Hall et
al. (2023)) is genetically distant from it with COI barcodes differing by 2.6% (17 bp). In the presence of
phenotypic differences, such as those in wing patterns discussed in detail by Hall et al. (2023), the
observed genetic differentiation suggests that the specimen from Peru is not A. praestigiosa but a distinct
species. This species is new, and its males (female is unknown) differ from superficially most similar A.
praestigiosa by the characters described for “west Amazonian males” in Hall et al. (2023), such as more
extensive orange coloration of dorsal wings, 1.e., basal area of forewing with three orange bands and in
some specimens an orange marginal streak near tornus, hindwing with more orange scaling by its apex,
ry Cc
: Ne eee Muntee eehd
Fig. 19. Argyrogrammana astuta sp. n. iNaturalist observations from Peru: Madre de Dios, Tambopata: a) 175878841 GPS —12.6060,
—69.0324, 27-Jul-2023 © danielblanco521; b) 67719625 Tambopata, GPS —12.0467, —69.6766, 29-Sep-2017, © Ken Kertell; c) 94229584 ventral of
b) © David Geale. Images are color-corrected and rotated. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/
28
ee
e.g., an orange band may cut through the brown patch to reach the costa (the apical area is mostly brown
in A. praestigiosa). Beneath, brown scaling is less extensive, pale bands are wider, with more orange
scales in them (particularly toward wing margins), and with sharper edges, especially towards the outer
margin; submarginal dark spots are more even, e.g., on hindwing spots in cells Mi-M2 and M2-M3 are not
particularly larger than others (they are larger and more pointed in A. praestigiosa). The dorsal side of the
abdomen with a brown central spot at the base of each segment (entirely orange in A. praestigiosa). Other
species of Argyrogrammana are more distant and different, e.g., the next closest species is A. glaucopis
(H. Bates, 1868), which is characterized by much less extensive orange coloration and additional blue
spots on the forewing, and A. caerulea J. Hall, 2023 has even more extensive blue forewing patches.
Barcode sequence of the holotype: Sample NVG-19029F 11, GenBank OR578713, 658 base pairs:
AACTTTATATTTTATTTTTGGAATTTGAGCT eee TAATTGGAACTTCTTTAAGTTTATTAATTCGTATAGAATTAGGTAATCCAAACTCATTAATTGGTAATGACCAAATTTATAATACA
ATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGGTTTGGAAATTGATTAATTCCTTTAATATTAGGGGCTCCTGATATAGCATTTCCACGAA
TAAATAACATAAGTTTTTGATTATTACCCCCCTCCTTAATTCTTTTAATT TCAAGAAGTATT GT TGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCCCCTCTTTCTTCTAATATTGC
TCATAGAGGCTCATCCGTTGATTTAGCCATTTTTTCTCTTCATTTAGCTGGGATTTCTTCCATTCTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGTATTAATAATATAGCT
TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCTCTTCTTTTATTATTATCATTACCAGTTTTAGCTGGAGCTATTACCATATTATTAACAGAT CGTAATTTAAATACAT
CATTTTTTGATCCTGCTGGAGGT GGAGATCCTATTTTATACCAACATTTATTT
Type material. Holotype: & deposited in the National Museum of Natural History, Washington, DC,
USA [USNM], illustrated in Fig. 18 (and Fig. 11 in Hall et al. (2023) left-right inverted—i.e., mirror
image of the specimen—and with imperfections edited out), bears four printed labels: three white
| PERU, Madre de Dios | Tambopata Reserve | 12° 50’S 69° 17°W, 300m | 28 Oct 1991 | Leg. R
Robbins ], [ DNA sample ID: | NVG-19029F11 | c/o Nick V. Grishin |], [USNMENT | {QR Code} |
01544363 |, and one red [ HOLOTYPE oc | Argyrogrammana | astuta Grishin ].
Type locality. Peru: Madre de Dios, Tambopata National Reserve, elevation 300 m, GPS —12.83, —69.28.
Etymology. In Latin, astutus is astute, cunning, clever, sly, and artful, and praestigiosus is deceptive and
misleading. This new species was skillfully hiding among the deceitful A. praestigiosa until genomic
sequencing revealed its distinction. The name is a feminine adjective.
Distribution. This species is genetically confirmed only from the holotype collected in southeastern Peru;
however, it is expected at least in the southwestern Amazonian Basin (Fig. 19).
Comments. Hall et al. (2023) described in detail wing pattern differences between populations of A.
praestigiosa, concluding that they represent intraspecific variation due to the lack of apparent differences
in genitalia and citing phenotypic intermediates. Argyrogrammana astuta sp. n. corresponds to the “west
Amazonian” A. praestigiosa of Hall et al. (2023). It is possible that A. praestigiosa is even more deceitful,
and additional variation described by Hall et al. (2023) may refer to additional species in this complex.
Subtribes in Helicopini Stichel, 1928
Inspection of the genomic tree reveals that Sarota Westwood, 1851 (type species Papilio chrysus Stoll,
1782), which is confidently placed in the tribe Helicopini Stichel, 1928 (Fig. 17), diverges from other
members of the tribe at the tree level corresponding to subtribes (left of the lime bar in Fig. 17).
Therefore, this lineage represents a valid subtribe. As a result, we propose to split Helicopini into two
subtribes: the nominotypical and Sarotina Bridges, 1988, stat. rest.
Echenaidina Grishin, new subtribe
http://zoobank.org/3 BAD20C2-92C3-4F44-A 713-583D7B3932E2
Type genus. Echenais Hiibner, [1819].
Definition. Two subgenera, Echenais (type species Lemonias alphaea Hubner, 1808, which is a junior
subjective synonym of Papilio thelephus Cramer, 1775) and Imelda Hewitson, 1870 (type species /melda
glaucosmia Hewitson, 1870), show prominent genetic differentiation from other taxa in the tribe
Calydnini Seraphim, Freitas & Kaminski, 2018 and, therefore, constitute a subtribe (Fig. 17). This new
subtribe differs from other Calydnini by a submarginal (not marginal) continuous yellow, blue, or metallic
29
line or band on dorsal sides of both wings and/or largely white, yellow, orange, or blue (but not mostly
black or dark brown) hindwing above, or orange patch in the middle of the hindwing. A combination of
the following nuclear genomic base pairs is diagnostic: cne2872.1.1:A361C, cne12666.5.7:A497G,
cne2222.10.1:A431T, cne2483.2.1:A1667G, cne254274.1.1:T198C.
Genera included. Only the type genus (including subgenus /melda Hewitson, 1870).
Parent Taxon. Tribe Calydnini Seraphim, Freitas & Kaminski, 2018.
Echydnina Grishin, new subtribe
http://zoobank.org/7E98DF54-98E3-41D7-BC19-3528A548CD96
Type genus. Echydna J. Hall, 2002.
Definition. Echydna (type species Calydna chaseba Hewitson, 1854) is genetically differentiated from
other Calydnini genera at the tree level similar to that of Echenaidina subtrib. n. and therefore represents
a distinct subtribe (Fig. 17). Diagnostic characters for this subtribe are as those given in detail and
illustrated by Hall (2002) for Echydna. In brief, it is diagnosed by a combination of setose eyes and black
frons; in male genitalia, unique cornuti of three elements: a narrow unspined plate anteriad of an
unsclerotized sack with small spines and sclerotized ovoid with larger spines; and in female genitalia,
small signa without surface sculpturing. A combination of the following nuclear genomic base pairs is
diagnostic: cne2156.9.5:A3355G, cne5645.4.3:G360A, cne16213.4.1:A205G, cne16034.2.1:T643G, cne5785.
9.3:G454A.
Genera included. Only the type genus.
Parent Taxon. Tribe Calydnini Seraphim, Freitas & Kaminski, 2018.
Cariina Grishin, new subtribe
http://zoobank. org/6D9F6CE6-E393-4484-8 124-963 E2C60DE55
Type genus. Caria Hubner, 1823.
Definition. The tribe Riodinini Grote, 1895 (1827) splits into two prominent clades: the larger includes
the type genus, and the smaller consists of genera not previously used for family-group names (Fig. 17).
We propose that these two clades represent two subtribes, one of which is new. This new subtribe is
diagnosed by a combination of the following characters: eyes bare, palpi short, not visible above, both
sides of all wings either with submarginal row of metallic (silver, green) spots usually connected into a
band, or dark and with yellow bands or spots, or pale veins. In Barbicornis, hindwings unique, shovel-
shaped with a tail in the middle nearly equal to the hindwing length; in Chamaelimnas, forewings
elongated and with a yellow band, either diagonal (from mid-costa to tornus) or longitudinal (from base
towards outer margin); in Caria and Seco, forewing costal margin typically at least slightly convex. Male
genitalia with terminally bilobed valvae; in Chamaelimnas, boomerang-shaped, ventral lobe vestigial.
Best identified by DNA, and a combination of the following nuclear genomic base pairs is diagnostic:
cne1302.2.1:A1473G, cne1302.2.1:A2614C, cne1143.5.1:A883G, cnel143.5.1:A884C, cne8241.4.4:A67C.
Genera included. The type genus (Caria Hiibner, 1823), Barbicornis Godart, 1824, Chamaelimnas C.
Felder & R. Felder, 1865, and Seco J. Hall & Harvey, 2002.
Parent Taxon. Tribe Riodinini Grote, 1895 (1827).
Family Lycaenidae [Leach], [1815]
Liphyrinae Doherty, 1889 is a subfamily
Currently treated as a tribe within subfamily Miletinae Reuter, 1896, Liphyrinit Doherty, 1889 show
30
prominent genetic differentiation from the rest of Miletinae and are at the level in the genomic tree that
corresponds to subfamilies (Fig. 20). Therefore, we return this morphologically unique group to the status
of a subfamily as originally proposed: Liphyrinae Doherty, 1889, stat. rest.
Megalopalpina Grishin, new subtribe
http://zoobank.org/2A22A FFB-346D-4DCF-B256-C59DA7FCEFB1
Type genus. Megalopalpus Rober, 1886.
Definition. Megalopalpus Rober, 1886 (type species Megalopalpus simplex R6ber, 1886) forms a lineage
sister to all other Miletini Reuter, 1896 and is more prominently separated from them than they are from
each other (Figs. 20, 21). Therefore, we propose that this lineage represents a subtribe. This new subtribe
is diagnosed by a combination of the following characters, as given for the Megalopalpus section by Eliot
(1973): uncus with tegumen plates triangular, with a unique for this group broad lobe-like triangular
ventrally-pointed process, falces strongly curved, males lack secondary sexual characters, hindwing with
precostal vein. A combination of the following nuclear genomic base pairs is diagnostic: cce64.1.4:G152C,
cce5960.3.7:A41T, cce7884.1.3:A388A (not C), cce28693.2.4:G109G (not A), cce9880.2.2:A83A (not C),
cce49.4.1:C595C (not T), ccel16970.13.7:T187T (not G).
Genera included. Only the type genus.
Parent Taxon. Tribe Miletini Reuter, 1896.
Tarakina Eliot, 1973 is a subtribe
Currently treated as a tribe in the subfamily Miletinae Reuter, 1896, Tarakini Eliot, 1973 is sister to
Spalgini Toxopeus, 1929 and shows less extensive genetic differentiation from them than typical for the
tribal level (Fig. 21). The Taraka Doherty, 1889 lineage has split from Spalgini at the same tree level as
Megalopalpina subtrib. n. has split from Miletina Reuter, 1896. Therefore, we place Tarakina Eliot,
1973, stat. rev. as a subtribe in the tribe Spalgini, 1929.
Cesa Seven, 1997 is a subgenus of Crudaria Wallengren, 1875
The monotypic genus Cesa Seven, 1997 (type species Spindasis waggae Sharpe, 1898) is closely related
to Crudaria Wallengren, 1875 (type species Arhopala ? leroma Wallengren, 1857): the COI barcodes of
the type and the only species of Cesa (GenBank JN286116) and the type species of Crudaria (NVG-
22012H12) differ by 5.5% (36 bp). For comparison, the COI barcode difference between the type species
of sister genera (according to Boyle et al. (2015)) Crudaria and Cigaritis Donzel, 1848 (type species
Cigaritis zohra Donzel, 1848, NVG-22012H05) is 9.6% (63 bp), which is nearly twice as large and does
not preclude genus-level genetic differentiation between Crudaria and Cigaritis. Therefore, Cesa does not
represent a significant deviation from Crudaria to warrant its monotypic status as a genus and may be
placed in this genus with its close relatives. Acknowledging some morphological distinction of Spindasis
waggae, we propose to treat Cesa Seven, 1997, stat. nov. as a subgenus of Crudaria Wallengren, 1875.
Vansomerenia Heath, 1997 is a junior subjective synonym of Chloroselas Butler, 1886
The monotypic genus Vansomerenia Heath, 1997 (type species Desmolycaena rogersi Riley, 1932)
originates within the genus Chloroselas Butler, 1886 (type species Chloroselas esmeralda Butler, 1886),
rendering it paraphyletic (Fig. 21). The difference between their COI barcodes is 6.2% (41 bp), which is
typical for congeners. To restore monophyly and place close relatives in a single genus, we propose that
Vansomerenia Heath, 1997, syn. nov. is a junior subjective synonym of Chloroselas Butler, 1886.
31
94
ae Ps
a8 Miletina 105
100
‘ids Megalopalpina
100
Liptenina
its 7ooLPentilina
78
Axiocersini
bes 100
Pseudaletidina
Cigaritini
100 100
Cigaritina
86
Aloeidina
100
Liphyra brassolis|18017C11|Australia|old
Lachnocnema bibulus|19114D07|Natal|1945
Allotinus fallax]19114E05|Philippines:Luzon|1987
Logania malayica|19114E07|Thailand|old
Miletus symethus|19114E09|Singapore|1989
Megalopalpus simplex|19114E08|Uganda|1960
Spalgis epeus|19114E11|Pahang]1990
Feniseca tarquinius|4334|USA:IN,Newton Co.|2015
Liptena undularis|19118G12|Congo|1962
Pentila tropicalis|19118H09|South Africa|1948
Poritia hewitsoni|19119A01|Myanmar|2001
Axiocerses harpax|20127CO6|HT of efulena|Cameroon|1926
Zeritis pulcherrima|22012H09|Sudan|1916
Pseudaletis nigra|20128C03|HT|Cameroonjold
Pseudaletis agrippina|21015H01|Cameroon|1924
Cigaritis epargyros|20039C10|Central Asia|2004
Chloroselas mazoensis|22037C07|Africa|1943
Chrysoritis dicksoni|21015G03|South Africa|1948
Chrysoritis thysbe|21016A09|South Africa|1951
100
80 A
ae Phasisina
Aphnaeina
Aloeides thyra|20062B01|South Africa|1933
Trimenia wallengrenii|22037C09|South Africa|1941
Phasis thero|21015G01|South Africalold
Aphnaeus asterius|20127C01|HT of ilogo|Gabon|old
Aphnaeus orcas|22012G12|Cameroonlold
Boldenaria boldenarum|19079D11|New Zealand|1979
Lycaena phlaeas|PAOE01|France|2017
Hypaurotis crysalus|17117A05|USA:CO,Douglas Co.|1993
100 Thecla betulae|21018A01|Manchuria|old
100
74
58
Surendra quercetorum|21018F07|India:Sikkim|old
Semanga superba|22012G06|Malaysia:Borneolold
ay Arhopala thamyras|21018F09|Papua|1932
100 Mahathala ameria|22012G03|Nepal|1967
————— Neomyrina nivea hiemalis|21019A10|Vietnam|old
Drina donina|21019A04|Myanmar|1889
Candalides xanthospilos|19114F01|Austalia|1966
“ Erina erinus|19114F02|Solomons|1921
we Hypochrysops polycletus|21019D11|Indonesia:Seram|1990
Hypochrysopini — {6 Titea sublutea|22037F03|New Guinea:Wau|1972
a Philiris ilias|22012C03|Arulold
100
60
Jalmenini
68 oF
16 Pseudalmenini
42
100
100 48 Cheritrina
3 100
Horagina
100 100-
Loxurina
100
46
100
72 100
Rapalina
Rapalini
70
Pilodeudorigina
26
100
0.05
100
Paralucia pyrodiscus|21018E01|Australia|1944
Ogyris abrota|21018F06|Australia:Victoria|1952
Jalmenus evagoras|21019C06|Australia|1947
Jalmenus ictinus|21019C08|Australia|1948
Pseudalmenus chlorinda|21019C09|Australia|1945
Amblypodia narada|19119A05|Philippines:Luzon|1987
Iraota timoleon|19119A06|Bhutan|1891
Myrina silenus|19119A07|Nairobi]1968
Drupadia ravindra|21016D08|Indonesia:Belitung|1999
Cheritra frejaJ21019B07|Javajold
Thamala marciana|21019A03|Myanmar:Mergui|1889
Horaga onyx|22012G07|India:Assaml|old
Eooxylides tharis|21019B05|Malaysia:Borneo|1916
lolaus eurisus|21019F02|Liberia|1956
Britomartis cleoboides|22025C10|Sumatra|1894
Catapaecilma elegans|21018H11|India:Sikkim|old
Zesius chrysomallus|21019C04|Travancore|1891
Dapidodigma hymen|22012G10|Sierra Leone|old
Tomares ballus|18106H09|Tunis|1981
Tomares fedtschenkoi|20039A12|USSR|1972
Rapala arata|20062A12|Japan|1956
a Rapala varuna|21019D10|Australia|1946
Rapala iarbus|22025E04|India:Sikkim|1895
Pilodeudorix camerona|20127G12|T of barbatus|Sierra Leonelold
Paradeudorix ituri|22037C01|Congo|1962
Hypomyrina nomenia|22025D09|Congolold
Artipe eryx|21016E08|Malaysia:Pahang|2004
Capys alpheus|22037C03|South Africa|1945
Deudorix epijarbas|21019C11|Indialold
Bindahara phocides|21019B11|Indialold
Sinthusa nasaka|21018H03|Malaysia:Borneo|1916
Araotes lapithis|21018H0O5|Myanmar|1889
Eumaeus minyas|17074H03|Ecuador|USNM
Calycopis cecrops|3306|USA:LA,Natchitoches Pa.|2015
Callophrys rubi]20037H06|Spain|1974
Satyrium fuliginosa|20068G06|USA:CA,Plumas Co.|2012
84
Fig. 20. The phylogenetic tree of selected Lycaenidae (Polyommatinae are shown in Fig. 22 below) inferred from protein-
coding regions of the nuclear genome (autosomes). Family-group names are shown above or below the corresponding
branches. Not all subtribes are shown and/or labeled (see the subtribal classification list of Lycaenidae below). Names, clades,
and species of new tribes and subtribes proposed in this work are shown in color. Names of other subtribes are shown in black,
and names of subfamilies and tribes are shown in shades of gray.
32
Lachnocnema bibulus|19114D07|Natal|1945
Allotinus fallax|19114E05|Philippines:Luzon|1987
Allotinus taras|20128F01|ST|Myanmar|1889
100
Miletina Tao Logania malayica|19114E07|Thailand|old
nee 100 Logania obscurus|20128F06|Celebes|1887
=e a0b Miletus symethus|19114E09|Singapore|1989
Megalopalpina * Miletus croton|19114E10|Myanmar|2003
es ; Megalopalpus simplex|19114E08|Uganda|1960
Spalgina mA Spalgis epius|7272|Myanmar|2002
100 Feniseca tarquinius|4334|USA:IN,Newton Co.|2015
Tarakina Ve Taraka hamada|20061HO07|Japan|1955
bs Taraka shiloi]23021A01|China:Shaanxi
96 700 Axiocerses harpax|20127CO6|HT of efulena|Cameroon|1926
or Zeritis pulcherrima|22012H10|Angola|old
Pseudaletidina * Pseudaletis nigra|20128C03|HT|Cameroon|old
Pseudaletis agrippina|21015H0O1|Cameroon|1924
Cigaritis epargyros|20039C10|Central Asia|2004
Cigaritis 100 Cigaritis myrmecophila|21016D04|PT|Tunisia|old
100 Cigaritis zohra|22012H05|Algeria|1930
100 Cigaritis takanonis|21016D03|PT of morinis|Japan|1952
100 a Cigaritis crustaria|20127C04|HT of mysteriosa|Fr. Guinea|1952
i Spindasis Cigaritis natalensis|22012H07|South Africalold
7 Chloroselas pseudozeritis|20127C05|South Africalold
100 Chloroselas rogersi [=Vansomerenia]|22037C08|Kenya|1960
76 Chloroselas mazoensis|22037C07|Africa|1943
100 Crudaria leroma|22012H12|Zimbabwe|1966
Cigaritina Chrysoritis —— Chrysoritis dicksoni|21015G03|South Africa|1948
Chrysoritis chrysaor|21016A01|South Africajold
Chrysoritis felthami|21015H12|South Africa|1948
66 100 Chrysoritis pyroeis|21016A04|South Africa|1962
100 3 Chrysoritis palmus|21016A07|South Africa|1948
too Chrysoritis thysbe|]21016A09|South Africa|1951
Auricirrus * Re Chrysoritis nigricans|21016A11|South Africa|1948
Chrysoritis zeuxo|21016A05|South Africa|1947
Chrysoritis zonarius|21016A06|South Africa|1948
Aloeides thyra|20062B01|South Africa|1933
100
sage
EHOPIGINAT Tic — Aloeides pierus|21015G02|South Africalold
mae **! Phasisina * Trimenia wallengrenii|22037C09|South Africa|1941
100 : Phasis thero|21015G01|South Africa|old
Aphnaeina Aphnaeus asterius|20127C01|HT of ilogo|Gabon|old
100
Aphnaeus orcas|22012H01|Cameroon|1971
Fig. 21. The phylogenetic tree of Miletinae and Aphnaeinae inferred from protein-coding regions of the nuclear genome
(autosomes). Names are shown by corresponding branches: family-group in roman font and subgenera in italics. Names
proposed in this work are marked with red asterisks. Names, clades, and species of taxa referring to this figure from the text are
colored: Tarakina stat. nov. (green), Spindasis stat. rest. (magenta), Vansomerenia syn. nov. (orange), and Auricirrus subgen.
n. (blue). Other names of subtribes are shown in black, and names of subfamilies and tribes are shown in shades of gray.
Auricirrus Grishin, new subgenus
http://zoobank.org/B527E473-8675-489E-B979-EAFF56996F4B
Type species. Papilio thysbe Linnaeus, 1764.
Definition. African genus Chrysoritis Butler, 1898 (type species Zeritis oreas Trimen, 1891) has been
divided into two clades: the eastern (chrysaor clade) and the western (includes the thysbe clade) (Talavera
et al. 2020) (Fig. 21). Strong genetic differentiation between these clades warrants their recognition at
least as subgenera: estimated divergence time between them is about 17 Mya (Talavera et al. 2020),
comparable to that of some genera. Among all Chrysoritis species, the type species of available genus-
group names belong to the eastern clade (Talavera et al. 2020): Zeritis oreas Trimen, 1891 (of
Chrysoritis), Zeritis lycegenes Trimen, 1874, which is a subspecies of Zeritis lyncurium Trimen, 1868 (of
Poecilmitis Butler, 1899), Zeritis phosphor Trimen, 1864 (of Bowkeria Quickelberge, 1972), and Phasis
dicksoni Gabriel, 1947 (of Oxychaeta Tite & Dickson, 1973). This eastern clade represents the
nominotypical subgenus. However, the western clade remains without a name and represents a new
subgenus. This subgenus differs from the nominal by the absence of tibial spicules (Heath 1997),
produced (but not tailed) hindwing tornus and/or blue or violet scaling on dorsal surface of wings in some
species (lacking in the nominotypical subgenus), and in species with more rounded tornus, spots on
ventral forewing—especially at the end of discal cell—are with more extensive silvery scaling. A
combination of the following nuclear genomic base pairs is diagnostic: cce3229.3.2:A633G, cce2784.3.3:
C85G, cce2423.1.2:A2767T, cce7537.1.5:C57T, cce5689.1.7:A744G.
Etymology. The name Chrysoritis may have been derived from the Greek "chryso" (gold) and "ritis" (hair
or curl). Their Latin equivalents are "aurum" (gold) and “cirrus” (lock or curl of hair), connected with a
33
vowel 7 to form the name of the subgenus. The name is a masculine noun in the nominative singular.
Species included. The type species (i.e., Papilio thysbe Linnaeus, 1764) and 41 others, names given in
their original combinations: Poecilmitis adonis Pennington, 1962, Poecilmitis turneri amatola Dickson &
McMaster, 1967, Chrysoritis adonis aridimontis Heath & Pringle, 2007, Poecilmitis aridus Pennington,
1953, Poecilmitis azurius Swanepoel, 1975, Poecilmitis beaufortia Dickson, 1966, Poecilmitis beulah
Quickelberge, 1966, Poecilmitis blencathrae Heath & Ball, 1992, Poecilmitis braueri Pennington, 1967,
Poecilmitis thysbe brooksi Riley, 1938, Zeritis chrysantas Trimen, 1868, Poecilmitis (Poecilmitis) daphne
Dickson, 1975, Poecilmitis endymion Pennington, 1962, Zeritis felthami Trimen, 1904, Poecilmitis irene
Pennington, 1968, Poecilmitis lyndseyae Henning, 1979, Poecilmitis lysander Pennington, 1962,
Poecilmitis mithras Pringle, 1994, Phasis thysbe var. nigricans Aurivillius, 1924, Poecilmitis orientalis
Swanepoel, 1976, Papilio palmus Stoll, 1781, Poecilmitis pan Pennington, 1962, Poecilmitis pelion
Pennington, 1953, Poecilmitis penningtoni Riley, 1938, Poecilmitis perseus Henning, 1977, Poecilmitis
plutus Pennington, 1967, Poecilmitis pyramus Pennington, 1953, Zeritis pyroeis Trimen, 1864,
Poecilmitis rileyi Dickson, 1966, Poecilmitis stepheni Dickson, 1978, Poecilmitis swanepoeli Dickson,
1965, Poecilmitis thysbe trimeni Riley, 1938, Poecilmitis turneri Riley, 1938, Poecilmitis uranus
Pennington, 1962, Poecilmitis violescens Dickson, 1971, Poecilmitis whitei Dickson, 1994, Poecilmitis
williami Heath, 1997, Poecilmitis wykehami Dickson, 1980, Papilio zeuxo Linnaeus, 1764, Phasis zeuxo
zonarius Riley, 1938, Poecilmitis nigricans zwartbergae Dickson, 1982 (including their subspecies and
synonyms). Species taxonomy follows Heath (2023) and Williams (2023c).
Parent taxon. Genus Chrysoritis Butler, 1898.
Spindasis Wallengren, 1857 is a subgenus of Cigaritis Donzel, 1848
Phylogenetic analysis of Aphnaeinae Distant, 1884 revealed that the genus Cigaritis Donzel, 1848 (type
Species Cigaritis zohra Donzel, 1848) splits into two prominent clades: mostly Oriental (hindwing tornal
lobe not well developed or lacking, at least one hindwing tail short, < 2 mm) and African (hindwing tornal
lobe well developed, both hindwing tails long) (Riley 1925) with genetic differentiation between them
similar to that of the two subgenera in Chrysoritis Butler, 1898 (type species Zeritis oreas Trimen, 1891)
(Boyle et al. 2015) (Fig. 21). Therefore, the two clades of Cigaritis correspond to subgenera. The (mostly)
Oriental clade is the nominal subgenus because the type species of Cigaritis (from NW Africa) belongs to
this clade. Two additional genus-group names have type species currently placed in Cigaritis: Spindasis
Wallengren, 1857 (type species Spindasis masilikazi Wallengren, 1857, which is a junior subjective
synonym of Aphnaeus natalensis Westwood, [1851]) and Apharitis Riley, 1925 (type species
Polyommatus epargyros Eversmann, 1855). The latter is in the Asian clade and, therefore, remains a
junior subjective synonym of Cigaritis. The former belongs to the African clade and, therefore, this clade
corresponds to the subgenus Spindasis Wallengren, 1857, stat. rest., which we propose to treat as a valid
subgenus instead of a synonym.
Tribes in Aphnaeinae Distant, 1884
Inspection of the genomic tree reveals three strongly supported clades in the subfamily Aphnaeinae
Distant, 1884 that we define as tribes (Figs. 20, 21): nominotypical, “Apharitini” Chou et al., 1994, and
the third one that does not have a name and is described below. The name “Apharitini” was published in
Chou et al. (1994) in an informal way without description, definition, or references to them (fails ICZN
Art. 13.) and is a nomen nudum. The name for this tribe that satisfies the requirements of the ICZN Code
is proposed below. We define three tribes and not two because the phylogenetic affinities of the unnamed
tribes with the nominotypical one are not particularly strong (86%), and combining their clades may not
result in a monophyletic taxon if this topology is incorrect. The three clades are the same in the recently
published large-scale tree (Kawahara et al. 2023), but the topology is different in a tree based on a more
limited set of gene markers (but a larger set of taxa) (Boyle et al. 2015).
34
Cigaritini Grishin, new tribe
http://zoobank. org/E44D983 1-7137-4120-86CB-700DBCC8D752
Type genus. Cigaritis Donzel, 1848.
Definition. The clade with Cigaritis (type species Cigaritis zohra Donzel, 1848) and related genera is
genetically differentiated from other clades and is at the tree level of a tribe (Figs. 20, 21). This new tribe
is morphologically diverse and can be distinguished from other members of the subfamily Aphnaeinae
Distant, 1884 by the shape of uncus, which is highly variable, but nevertheless bilobed or divided, with
centrally concave distal margin (see Stempffer (1967) for illustrations and more detailed descriptions): in
Lipaphnaeus Aurivillius, 1916, subtriangular uncus is deeply divided with narrow, tooth-like pointed
lobes; in Chloroselas Butler, 1886, the lobes are small and subtriangular uncus is with a central notch
separating finely serrated lobes; in Cigaritis Donzel, 1848, uncus is broader than long, nearly rectangular
or trapezoidal in dorsal view (sometimes nearly vestigial), lobes widely separated, uncus mostly concave
(may be with irregularities) between the lobes; in Chrysoritis Butler, 1898 and Crudaria Wallengren,
1875, uncus is similar, trapezoidal or heart-shaped, but less broad, with rounded lobes and convex margin
between them; in Pseudaletis H. H. Druce, 1888, uncus is divided for nearly its entire length with finger-
like terminally rounded lobes. In other Aphnaeinae tribes, uncus in undivided and not strongly bilobed:
typically, from almost square to broadly rectangular, with nearly flat (with some irregularities) distal
margin, or dome-shaped with convex distal margin, which is only slightly concave in Trimenia Tite &
Dickson, 1973 (type species Zeritis wallengrenii Trimen, 1887), thus resembling Chrysoritis, but uncus is
narrower and without clearly defined lobes expanded laterally (as in Chrysoritis and Crudaria).
Furthermore, 7rimenia has saccus, which is not developed in Chrysoritis. A combination of the following
nuclear genomic base pairs is diagnostic: cce332.12.5:A61T, cce1232.20.1:A596G, cce1351.40.3:A349T,
cce5072.9.1:A67C, cce2368.14.7:G95T.
Genera included. The type genus (1.e., Cigaritis Donzel, 1848), Chloroselas Butler, 1886, Chrysoritis
Butler, 1898, Crudaria Wallengren, 1875, Lipaphnaeus Aurivillius, 1916, and Pseudaletis H. H. Druce,
1888, including their subgenera and synonyms (e.g., Cesa Seven, 1997, Vansomerenia Heath, 1997, and
Apharitis Riley, 1925).
Parent Taxon. Subfamily Aphnaeinae Distant, 1884.
Comment. This tribe corresponds to “Apharitini” of Chou et al. (1994), published without description,
definition, or references to them: a nomen nudum (fails ICZN Art. 13.). Apharitis Riley, 1925 (type
species Polyommatus epargyros Eversmann, 1855) is a junior subjective synonym of Cigaritis.
Pseudaletidina Grishin, new subtribe
http://zoobank. org/D8A065B1-FOCF-4A7F-BADA-FO6FDEECA919
Type genus. Pseudaletis H. H. Druce, 1888.
Definition. Pseudaletis (type species Pseudaletis agrippina H. H. Druce, 1888) is in the lineage that is
sister to all other Cigaritini Grishin, trib. n. and is genetically differentiated from them at the subtribal
level (Figs. 20,21). Therefore, we propose to treat this lineage as a subtribe. This new subtribe is
diagnosed by a combination of the following characters, as given for the Pseudaletis section by Eliot
(1973): palpi short—much less than half of the head length—covered in appressed scales, proboscis very
short (but functional), forewing appears disproportionately large comparatively to hindwing; uncus
divided for nearly its entire length with finger-like terminally rounded lobes, falces rudimentary, pointed
processes inflexibly fused to tegumen; female abdomen with a prominent tuft of specialized scales, which
are spoon-shaped with long “handles”. A combination of the following nuclear genomic base pairs is
diagnostic: cce1853.23.8:T1384A, cce133.4.1:A287G, cce4260.4.1:G34A, cce1367.9.3:G1252A, ccel17940.6.2:C71A.
Genera included. Only the type genus.
Parent Taxon. Tribe Cigaritini Grishin, trib. n.
35
Axiocersini Grishin, new tribe
http://zoobank. org/I BBFE9EC-A B8B-4709-A250-4DA082ED2B4E
Type genus. Axiocerses Hiibner, [1819].
Definition. Axiocerses (type species Papilio perion Stoll, 1782, which is a junior subjective synonym of
Papilio harpax Fabricius, 1775) and Zeritis Boisduval, 1836 (type species Zeritis neriene Boisduval,
1836) are confident sisters in the genomic tree (Figs. 20, 21), consistently with similarities in their
morphology reported previously (Stempffer 1967). The two genera form a clade that originates early in
the radiation of the subfamily Aphnaeinae Distant, 1884, and, therefore, it corresponds to a tribe. This
new tribe is distinguished from the relatives by a combination of the following characters: uncus very
broad and short, distal margin straight or convex, lobes nearly triangular or rounded, falces thick at the
base, then strongly angled with free branch long and slender, ventral side with apophysis, tegumen with
uncus hood-shaped, tegumen with convex anterior margin; palpi short, not extending or slightly extending
beyond the fronts, 2" segment of palpi with long scales and hairs; tarsus unsegmented, with spines below;
forewing with only 10 veins (Stempffer 1967; Henning and Henning 1996). The similarity in uncus,
falces, and tegumen unifies Axiocerses and Zeritis Boisduval, 1836 (Stempffer 1967). A combination of
the following nuclear genomic base pairs is diagnostic: cce243.9.9:A1417C, cce15587.11.3:G103A,
cce127.4.3:A149T, cce980.22.7:C902T, cce2423.1.2:T23 15C.
Genera included. The type genus (1.e., Axiocerses Hitibner, [1819]) and Zeritis Boisduval, 1836.
Parent Taxon. Subfamily Aphnaeinae Distant, 1884.
Aloeidina Grishin, new subtribe
http://zoobank. org/A32E LEE2-A06D-4100-AFD9-3214F38A2C93
Type genus. A/oeides Hubner, [1819].
Definition. Within Aphnaeini Distant, 1884, the clade of several genera that includes Aloeides (type
species Papilio pierus Cramer, 1779) corresponds to the subtribal level in the tree (Figs. 20, 21). This new
subtribe is distinguished from its relatives by a combination of these characters, as discussed and
illustrated by Stempffer (1967), Tite & Dickson (1973), and Eliot (1973): foreleg and midleg tibiae with
apical spurs, palpi smooth, with equal length scales (in several species with some scattered long ribbon-
shaped blunt scales), or with uniquely long and bristly white scales (in Erikssonia Trimen, 1891),
forewing vein R4+s originates at or beyond the junction of the discocellular vein and vein Mj, vein Ro
originates next to the origin of vein R4+s. A combination of the following nuclear genomic base pairs is
diagnostic: cce5760.10.2:C484T, cce2790.13.2:T63C, cce2790.13.2:A183G, cce1354.3.7:A61T, cce1354.3.7:
T1903A.
Genera included. The type genus (i.e., A/oeides Hiibner, [1819]), Argyraspodes Tite & Dickson, 1973,
Erikssonia Trimen, 1891, and Trimenia Tite & Dickson, 1973.
Parent Taxon. Tribe Aphnaeini Distant, 1884.
Phasisina Grishin, new subtribe
http://zoobank. org/B6D8239D-DAF0-4865-9F3E-18677ABDEA6F
Type genus. Phasis Hubner, [1819].
Definition. Within Aphnaeini Distant, 1884, the clade of several genera that includes Phasis (type species
Papilio salmoneus Stoll, 1781, which is a junior subjective synonym of Papilio thero Linnaeus, 1764)
corresponds to the subtribal level in the tree (Figs. 20, 21). This new subtribe is distinguished from its
relatives by a combination of the following characters, as discussed and illustrated by Tite & Dickson
(1973): tibia of all legs without apical spurs, forewing vein M2 originates much closer to the origin of vein
36
M, than to the origin of vein M3, vein R2 originates at a distance from vein R4+s, size larger with forewing
longer than 16 mm. A combination of the following nuclear genomic base pairs is diagnostic: cce288.3.2:
AT9C, cce33.3.3:A234G, cce2859.6.1:T729C, cce511.6.1:A54G, cce14215.5.1:T850C, cce33280.1.7:T944T
(not A), cce3467.4.4:A374A (not G), cce7428.5.1:G156G (not A), cce4435.12.1:C616C (not A), ccel239.1.
3:T235T (not G).
Genera included. The type genus (1.e., Phasis Hiibner, [1819]) and 7ylopaedia Tite & Dickson, 1973.
Parent Taxon. Tribe Aphnaeini Distant, 1884.
Surendrini Kocak & Seven, 1997 is a tribe
Currently placed in the tribe Arhopalini Bingham, 1907, Surendrina Kocgak & Seven, 1997 is not
monophyletic with it and instead is sister to Theclini Swainson, 1830 (Fig. 20). It is conceivable to place
Surendrina in Theclini, but the two groups are more distinct from each other than subtribes and are at the
tree level of tribes. Therefore, we propose to treat the former taxon as a tribe Surendrini Kogak & Seven,
1997, stat. nov.
Drinini Grishin, new tribe
http://zoobank. org/200 LE28A-4C8C-45D9-B228-E34D99B26E85
Type genus. Drina Nicéville, 1890.
Definition. Currently in Loxurini Swinhoe, 1910, Drina (type species Myrina donina Hewitson, 1865) is
not monophyletic with it and is not closely related to that tribe, instead forming a separate lineage
originating early in the diversification of Theclinae Swainson, 1831 (Fig. 20). Therefore, we propose that
this lineage corresponds to a tribe. This new tribe is diagnosed by a combination of the following
characters, as given for the Drina section by Eliot (1973): male genitalia with significantly reduced
(nearly vestigial) tegumen (not wider than valva in lateral view), uncus, and falces, and long and narrow
vinculum; forewing with 11 veins, the three M veins are nearly at the same distance from each other,
hindwing with a single tail at vein CuA2. A combination of the following nuclear genomic base pairs is
diagnostic: cce305.14.6:G130A, cce305.14.6:TI31C, ccel1105.7.5:G93A, cce144.8.2:G223A, cce204.17.10:
C49A, cce3081.9.2:G97G (not T), cce2598.5.13:G484G (not C), cce2598.5.13:C485C (not A), cce948.2.2:
T73T (not A), cce948.2.2: A139A (not G).
Genera included. Only the type genus.
Parent Taxon. Subfamily Theclinae Swainson, 1831.
Hypochrysopini Grishin, new tribe
http://zoobank.org/713 1748 1-COFE-4839-97E2-341444327DD7
Type genus. Hypochrysops C. Felder & R. Felder, 1860.
Definition. Currently placed in Luctini Waterhouse & Lyell, 1914, Hypochrysops (type species Papilio
polycletus Linnaeus, 1758) and related genera are not monophyletic with it and instead form a distinct
clade within Theclinae Swainson, 1831 not confidently associated with any other subtribe (Fig. 20).
Therefore, this clade represents a subtribe. This new tribe is diagnosed by a combination of the following
characters, as given for the Hypochrysops section by Eliot (1973): uncus not produced, rounded, falces
prominent, strongly curved, juxta absent or vestigial, aedeagus very thick, just slightly narrower than
valva, valva rhomboidal, saccus not developed; ventral wing surface typically with obsolete or distorted
patterns with metallic silver or green spots and bands and red blotches. A combination of the following
nuclear genomic base pairs is diagnostic: cce3313.6.1:G1784C, cce3313.6.1:G2131C, cce67043.1.6:C55G,
cce67043.1.6:A56T, ccel184.15.22:G142C.
37
Genera included. The type genus (i.e., Hypochrysops C. Felder & R. Felder, 1860), Philiris R6ber, 1891,
and Titea Eliot, 1973.
Parent Taxon. Subfamily Theclinae Swainson, 1831.
Jalmenini Grishin, new tribe
http://zoobank. org/D58DOD0A-382D-4E6D-B879-75D3DE7A3670
Type genus. Ja/menus Hubner, 1818.
Definition. Currently in Zesiusinae Swinhoe, 1912, Jalmenus (type species Jalmenus evagoras Hiibner,
1818, which is a junior homonym of Papilio evagoras Donovan, 1805) is far removed from the genus
Zesius Hiibner, [1819] (type species Zesius chrysomallus Hiibner, 1823) in the genomic tree, and instead
forms a distinct lineage within Theclinae Swainson, 1831 not confidently associated with other genera
(Fig. 20). Therefore, this lineage represents a tribe. This new tribe is diagnosed by a combination of the
following characters, as given for the Ja/menus section (excluding Pseudalmenus H. H. Druce, 1902) by
Eliot (1973): uncus and tegumen narrower in lateral view, longer than in relatives, ventral side not
expanded, falces smaller, tegumen not expanded anteriad, valva without costal process, simple and
rounded; palpi with 3' segment very long, 2" segment with bristle-like scales. A combination of the
following nuclear genomic base pairs 1s diagnostic: cce9330.11.2:G69A, cce7486.3.3:T58G, cce9657.10.
14:T3166C, cce10680.1.1:T28C, cce4529.2.2:A67G.
Genera included. Only the type genus.
Parent Taxon. Subfamily Theclinae Swainson, 1831.
Pseudalmenini Grishin, new tribe
http://zoobank. org/BB6B6C59-EA D7-42B4-B7E6-CA95E94A4 19D
Type genus. Pseudalmenus H. H. Druce, 1902.
Definition. In the genomic tree, Pseudalmenus (type species Jalmenus myrsilus Westwood, 1851, which
is a subspecies of Thecla chlorinda Blanchard, 1848) is a weakly supported (54%) sister of Jalmenus
Hiibner, 1818, and therefore may not be monophyletic with it (Fig. 20). Hence, we propose that this
lineage represents a tribe. This new tribe was included in the Ja/menus section by Eliot (1973) and is
diagnosed by a combination of the following characters: 3 segment of palpi shorter than in Jalmenini
trib. n., 2"? segment hairy; uncus with ventral portion expanded, protruding posteriad of the dorsal
margin, falces long and strongly curved, tegumen well-developed, expanded anteriad, valva with the
curved costal process giving it a crab claw-like appearance. A combination of the following nuclear
genomic base pairs is diagnostic: ccel0780.3.1:G247A, ccel122.11.2:C1079G, ccel1670.2.2:C750T,
cce24738.4.8:A1793G, ccel0780.2.2:A2954G.
Genera included. Only the type genus.
Parent Taxon. Subfamily Theclinae Swainson, 1831.
Myrinini Toxopeus, 1929 is a tribe
Currently in Amblypodiini Doherty, 1886, close relatives Myrina [Fabricius], 1807 (type species Papilio
alcides Cramer, 1776) and Jraota F. Moore, 1881 (type species Hesperia maecenas Fabricius, 1793) are
distantly related to Amblypodia Horsfield, 1829 (type species Thecla narada Horsfield, 1828). The clade
of these three genera is not strongly supported (42%) in our tree (Fig. 20), and their union is not
monophyletic in a global phylogeny of butterflies (Kawahara et al. 2023). Therefore, we propose a status
of a tribe for Myrinini Toxopeus, 1929, stat. nov., which consists of two genera (Myrina and Iraota).
38
Horagina Swinhoe, 1910 and Loxurina Swinhoe, 1910 are
subtribes of Cheritrini Swinhoe, 1910
Currently regarded as distinct tribes, Cheritrini Swinhoe, 1910, Horagini Swinhoe, 1910, and Loxurini
Swinhoe, 1910 (Eliot 1973) are closely related to each other and are at the tree level of subtribes (Fig. 20).
Being combined, all three constitute one tribe. The priority of these names could not be determined
because they were proposed (as subfamilies) on the same page of the same work (1.e., issued on the same
date). As the first revisers, we give priority to Cheritrini Swinhoe, 1910, because this group includes more
genera and species than the other two. As a result, we propose that Horagina Swinhoe, 1910, stat. nov.
and Loxurina Swinhoe, 1910, stat. nov. are subtribes of Cheritrini Swinhoe, 1910.
Rapalini Grishin, new tribe
http://zoobank.org/6B76C64C- 1C57-4CC8-BBA2-925D4AFBCF7D
Type genus. Rapala F. Moore, 1881.
Definition. Currently, in Deudorigini Doherty, 1886, several genera, including Rapala (type species
Thecla varuna Horsfield, 1829), form a clade that is not confidently monophyletic with it: only 26%
partitions in the genomic tree support their grouping with Deudorigini. Low support values indicate a
more distant relationship and a possibility of incomplete lineage sorting or gene exchange around the time
of origin of these clades. The clade consisting of Rapala (mostly Oriental) and three Afrotropical genera
closely related to Pilodeudorix H. H. Druce, 1891 (type species Pilodeudorix barbatus H. H. Druce,
1891) is most confidently supported (100%) and corresponds to the level of a tribe in the tree (Fig. 20).
This new tribe differs from relatives by male genitalia having conjoined valvae that evenly taper to
narrow rounded or pointed apices, uncus and tegumen broad, two lobes of uncus with a concave margin
between them, hood-shaped; secondary sexual characters in males: an oval brand of small androconia
near the base of cell Sc+Ri-RS (at least in non-African species), and typically a hair tuft on ventral
forewing near inner margin to complement the brand, sometimes with other brands, including those on
abdomen; hindwing tailed, forewing veins R4+s and Mi originate separately, although may be very
narrowly separated at their origins (Eliot 1973). Most confidently distinguished by DNA and a
combination of the following base pairs in the nuclear genome is diagnostic: cce303273.1.1:G197A,
cece 1093.2.1:A4672C, cce3516.7.1:A173T, cce12299.7.3:G134A, cce4160.2.2:A207G.
Genera included. The type genus (i.e., Rapala F. Moore, 1881), Pilodeudorix H. H. Druce, 1891,
Hypomyrina H. H. Druce, 1891, and Paradeudorix Libert, 2004.
Parent Taxon. Subfamily Theclinae Swainson, 1831.
Pilodeudorigina Grishin, new subtribe
http://zoobank. org/5826F9A8-6834-487C-B207-DC883CE19307
Type genus. Pilodeudorix H. H. Druce, 1891.
Definition. Afrotropical clade of Rapalini trib. n. that includes Pilodeudorix (type species Pilodeudorix
barbatus H. H. Druce, 1891, which is a junior subjective synonym of Sithon camerona Plétz, 1880) is
genetically differentiated from non-Arican (mostly Oriental) species at the tree level of a subtribe (Fig.
20). This new subtribe is diagnosed by a combination of the following characters: abdomen frequently
with scent brands and hindwings with hair tufts; aedeagus shorter and less gracile that in the
nominotypical tribe, frequently expanded terminally, vesica with many small cornuti and usually with
large cuneus; basally fused valvae with a rectangular gap between them in many species, in others, each
valva with a process, hook-like in ventral view, uncus lobes are frequently less separated from each other
than in the nominotypical subtribe (Stempffer 1967). Best distinguished by DNA and a combination of
39
Oxylidina
100 Hemiolaina
100
100
100
100
100
Hypotheclina
Cupidopsina
Niphandina
98
100
100
Oxylides faunus|19119A09|Cameroon|1989
Syrmoptera melanomitra|19119A10|Cameroon|1987
Hemiolaus caeculus caeculus|21019F04|Zambia|1961
Ancema ctesia|21018G06|Naga Hills|old
Remelana jangala|21018G12|India:Sikkim|old
Hypolycaena sipylus|21019A01|Indonesia:Buru|old
Leptomyrina lara|22025D05|Namibia|1972
Anthene emolus|19118B04|Myanmar|2003
Neurellipes lusones|19118B06|Cameroon|1989
Hypothecla astyla|19119A11|Philippines:Leyte|1986
Cupidopsis jobates|22026G07|Kenya|1978
Niphanda tessellata|19114F04|Thailand|1971
Theclinesthina —— Theclinesthes miskini|22026H10|Australia|1943
Neolucia agricola|22026H12|Australia|1942
140 Azanina r Azanus ubaldus|20128A02|South Africalold
Azanus isis|22038B10|Uganda|1951
ee Unina -—> Una usta|22026G09|Malaysia:Malaccal|old
, 54 Petrelaea dana|22026H01|India:Darjeeling|old
Danina Nacaduba kurava|22026H03|Sri Lankalold
60 ‘ Danis danis|22027A10|Ambonjold
lonolycina -—— lonolyce helicon|22038A11|Myanmar|1989
Paraduba owgarra|22103G03|New Guinea|1972
Pithecops corvus|22027E04|Bali|1980
Pithecops dionisius|22027E07|T of euanthes|Buru|1898
Zizula hylax|20127H04|Phillipines:_Luzon|old
ug? = Oraidium barberae|21109A05|South Africa|1962
Pithecopsina
74 100
Zizulina
Brephidiina Brephidium exilis|6827|USA:TX,San Patricio Co.|2016
Oreolyce vardhana|22026F01|Himalaya|1924
Celastrina argiolus|6242|Bosnia|2009
Megisba malaya|22038B12|Indonesia:Lombok|1990
Jamides bochus|22027B04|India:Nilgiri Hils|old
Catopyrops ancyra|22026H09|Lombok|old
Zizeeria karsandra|22027C09|Nepal|1967
74 Famegana nisa|22027D01|NGuinea|1963
96 Catochrysopina—~——_———— Epimastidia inops|22027B01|Aru|1884
68 Catochrysops strabo|22027B05|Nepal|1973
gq Oboroniina Oboronia punctatus|22028D04|Ghana|1965
Lepidochrysops parsimon|22028D01|Kenyalold
Caleta caleta|22027A04|Celebes|old
Castalius rosimon|22027C07|Nepal|1964
Scolitantides orion|20062A01|Bohemia|1958
ay Euphilotes enoptes|PAO65|USA:CA, Sierra Co.|2016
Uranothaumatina;—~ Phlyaria cyara|22027B09|Cameroonjold
AG 100 ‘Actizarina Uranothauma crawshayi|22038B04|Malawilold
ei Tantotiva Actizera lucida|22027D04|Malawi|1952
Leptotes cassius|10423|Jamaica|2017
Lampides boeticus|20055G01|Greece|2018
Cacyreus lingeus|22027B11|Ethiopia|1939
Cupido argiades|22027E09|Austria|1927
Elkalyce cogina|22038B08|Brazil:SP|1991
Pseudochrysops bornoi|22037G05|DR|1981
Polyommatus icarus|PAOE03|France|2017
Zizeeriina ia
86
4 Fameganina
100
100 ws
Castaliina aT
Scolitantidina BO
Lampidina
Everina
100
100
Polyommatina
Fig. 22. The phylogenetic tree of selected Polyommatinae (other Lycaenidae are shown in Fig. 20) inferred from protein-
coding regions of the nuclear genome (autosomes). Family-group names are shown above or below the corresponding
branches. Not all subtribes are shown and/or labeled (see the subtribal classification list of Lycaenidae below). Names, clades,
and species of new subtribes proposed in this work are shown in color. Names of other subtribes are shown in black, and names
of subfamilies and tribes are shown in shades of gray.
the following nuclear genomic base pairs is diagnostic: cce303351.9.14:A88G, cce303351.9.14:A89G,
cece 14215.8.1:C143T, cce881.1.6:A79G, cce462.24.2:C89G.
Genera included. The type genus (1.e., Pilodeudorix H. H. Druce, 1891), Hypomyrina H. H. Druce, 1891,
and Paradeudorix Libert, 2004.
Parent Taxon. Tribe Rapalini Grishin, trib. n.
Oxylidini Eliot, 1973, Remelanini Eliot, 1973, and Hypolycaenini Swinhoe, 1910
belong to Polyommatinae Swainson, 1827, not to Theclinae Swainson, 1831
Traditionally placed among hairstreaks (Theclinae Swainson, 1831) due to their appearance (frequently
with very long hindwing tails), species from the tribes Oxylidini Eliot, 1973, Remelanini Eliot, 1973, and
Hypolycaenini Swinhoe, 1910 are confidently placed as a sister clade to “Blues” and are not
monophyletic with the subfamily Theclinae (Figs. 20, 22). Therefore, they do not belong to Theclinae.
Their genetic differentiation from the clade that consists of traditional Polyommatinae Swainson, 1827
40
(tribes Lycaenesthini Toxopeus, 1929, Hypotheclini Eliot, 1973, and Polyommatini Swainson, 1827) is
smaller than that for other subfamilies of Lycaenidae. Insufficient differentiation argues against treating
Oxylidini, Remelanini, and Hypolycaenini as a subfamily of their own. Therefore, we place them in the
subfamily Polyommatinae. We see that the three subfamilies, Lycaeninae, Theclinae, and Polyommatinae,
are closely related to each other (Figs. 20, 22), as expected and evidenced by morphology (Eliot 1973).
The genetic distinction of Lycaeninae from the two other subfamilies is more pronounced, and the tree
branches separating them are more prominent (Fig. 20). However, Theclinae and Polyommatinae are less
distinct from each other, and “blues” originate from within “hairstreaks”, not next to them, like butterflies
originate from within moths, birds from within reptiles, and tetrapods from within fishes. Furthermore,
due to their close relationship, it is conceivable to unify Theclinae and Polyommatinae into one subfamily
(Polyommatinae). We are not taking this step here and continue with the traditional tri-subfamily
arrangement for now, simply rearranging tribes among Theclinae and Polyommatinae to restore
monophyly. See our proposed subtribal classification of Lycaenidae below.
Hemiolaina Grishin, new subtribe
http://zoobank. org/45FFC7EB-6CFA-49A6-A688-EC98E721BA62
Type genus. Hemiolaus Aurivillius, 1922.
Definition. Hemiolaus (type species Jolaus caeculus Hopffer, 1855) forms a lineage sister to other
Oxylidini Eliot, 1973, but is genetically differentiated from them at the subtribal level, and therefore
represents a subtribe (Fig. 22). This new subtribe is diagnosed by a combination of the following
characters, as given for the Hemiolaus section by Eliot (1973): juxta enlarged, longer than half of valva,
shaped as the end of a nail puller with a deep cleft; ventral hindwing of males with a scent patch beneath a
hair brush; antennal club short, nudum confined to the club, about 32 segments, palpi with 3 segment
slightly less than half of the 2", tarsus of male foreleg terminally tapered and downturned. A combination
of the following nuclear genomic base pairs is diagnostic: cce54422.3.2:C373T, cce993.15.2:A922T,
cce303329.2.7:A2399C, cce2502.15.1:A320C, cce5483.2.11:T370A.
Genera included. Only the type genus.
Parent Taxon. Tribe Oxylidini Eliot, 1973.
Cupidopsina Grishin, new subtribe
http://zoobank.org/8AFD9453-3743-4ECB-BA87-4DAC0A3297FB
Type genus. Cupidopsis Karsch, 1895.
Definition. Confidently placed in the tribe Hypotheclini Eliot, 1973, the lineage with Cupidopsis (type
species Lycaena jobates Hopffer, 1855) is genetically differentiated from the Hypothecla Semper, 1890
lineage at the tree level of subtribes (Fig. 22) and therefore represents a subtribe. This new subtribe is
diagnosed by a combination of the following characters as given for the Cupidopsis section by Eliot
(1973): only 10 veins on the forewing, secondary sexual characters absent, aedeagus with developed
coecum and ductus entrance on dorsal side, saccus smaller than in relatives, nearly vestigial, tegumen
with uncus comparatively massive, the same length as valva in lateral view. A combination of the
following nuclear genomic base pairs is diagnostic: cce9377.2.3:A136T, cce4053.12.2:A3235C, cce332.21.
2:G117T, cce199. 20.2:A244C, cce3203.9.2:A172C.
Genera included. Only the type genus.
Parent Taxon. Tribe Hypotheclini Eliot, 1973.
Comments. A family-group name formed from the same genus was proposed as a nomen nudum (fails
ICZN Art. 13.) by Kogak (1996). The genomic tree demonstrates that this subtribe (as other Hypotheclin1)
belongs to Polyommatinae Swainson, 1827 (Figs. 20, 22), contrary to the hypothesis of Stradomsky
4]
(2016), who nevertheless correctly associated Cupidopsis with Hypothecla.
Niphandina Sibatani & Ito, 1942 is a subtribe
In agreement with Stradomsky (2016), we find that Niphandini Sibatani & Ito, 1942 clusters closely with
Polyommatini Swainson, 1827, being at the tree level with subtribes (Fig. 22). Therefore, we confirm its
treatment as a subtribe Niphandina Sibatani & Ito, 1942, stat. conf.
Theclinesthina Grishin, new subtribe
http://zoobank. org/32E65 13 1-DDFB-4EBC-BE37-4F42E8F5F6D3
Type genus. 7heclinesthes Rober, 1891.
Definition. The clade with Theclinesthes (type species Plebeius (Theclinesthes) eremicola Rober, 1891,
which is a junior subjective synonym of Nacaduba miskini gaura Doherty, 1891) originates near the base
of Polyommatini Swainson, 1827 (Fig. 22) and therefore represents a subtribe. This new subtribe is
diagnosed by a combination of the following characters, as given for the Theclinesthes section by Eliot
(1973) and Stradomsky (2016): uncus lobes and (vestigial) falces directed ventrad, vinculum in lateral
view much broader than in relatives, as broad as valva, aedeagus basally bulbous and apically tapered,
ductus enters at anterior end, valva constricted in the middle. A combination of the following nuclear
genomic base pairs is diagnostic: cce2737.15.2:A259G, cce3516.7.8:A98T, cce10374.3.2:A67C, cce2234.8.
11:G1960A, cce2399.18.8:A86G.
Genera included. The type genus (1.e., Theclinesthes R6ber, 1891), Neolucia G. Waterhouse & Turner,
1905, and Sahulana Hirowatari, 1992.
Parent Taxon. Tribe Polyommatini Swainson, 1827.
Comment. The same name was published in a pioneering study by Stradomsky (2016) without explicitly
indicating that the name was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus
of this taxon was (fails ICZN Art. 16.2.). This name for the subtribe already discovered by Stradomsky
and confirmed by our genomic analysis is simply formalized here to comply with the ICZN Code ICZN
[International Commission on Zoological Nomenclature] 1999).
Azanina Grishin, new subtribe
http://zoobank. org/DF55B888-23ED-4B2E-94F9-B 1 B6685CBDA3
Type genus. Azanus F. Moore, 1881.
Definition. Azanus (type species Papilio ubaldus Stoll, 1782) is confidently placed in a clade of
Polyommatini Swainson, 1827 containing several subtribes, not confidently grouping with any of them
(Fig. 22). Therefore, the lineage with Azanus represents a subtribe. This new subtribe is diagnosed by a
combination of the following characters, as given for the Azanus section by Eliot (1973): male genitalia
elongated and flattened, uncus narrowly divided into separate lobes, forewings veins SC and R; come
together and then diverge, androconia of two unusual types: nearly rectangular scales with concave bases
and long padded scales, eyes hairy, ventral forewing with a dark streak below SC vein. A combination of
the following nuclear genomic base pairs is diagnostic: cce9549.2.2:A815G, cce302383.7.1:TI1I53A,
cce302383.7.1:C1154G, cce2510.1.2:A686G, ccel178.15.6:A356G.
Genera included. Only the type genus.
Parent Taxon. Tribe Polyommatini Swainson, 1827.
Comment. The same name was proposed as a nomen nudum (fails ICZN Art. 13.) by Kocgak (1996) and
then published in a pioneering study by Stradomsky (2016) without explicitly indicating that the name
was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus of this taxon was (fails
42
ICZN Art. 16.2.). This name for the subtribe already discovered by Kocgak and Stradomsky and confirmed
by our genomic analysis is simply formalized here to comply with the ICZN Code (ICZN [International
Commission on Zoological Nomenclature] 1999).
Unina Grishin, new subtribe
http://zoobank.org/2FD670E6-5ECD-404E-A 1F7-842AEF97335C
Type genus. Una Nicéville, 1890.
Definition. Una (type species Zizera? usta Distant, 1886) is confidently placed in the clade of Polyom-
matini Swainson, 1827 with several subtribes, not confidently grouping with any of them (Fig. 22).
Therefore, the lineage with Jonolyce represents a subtribe. This new subtribe is a union of the Una and
Petrelaea sections of Eliot (1973), who listed characters for them, and is diagnosed as follows: male
genitalia elongated and appear flattened, with gracile and long aedeagus and prominent saccus (absent in
close relatives); forewings with 11 veins, veins SC and Rj fuse at least for some distance. A combination
of the following nuclear genomic base pairs is diagnostic: ccel0730.5.6:A179T, cce7658.4.3:A184G,
cce4822.3.3:A98T, cce5018.4.1:A78G, cce870.7.1:G452A.
Genera included. The type genus (1.e., Una Nicéville, 1890), Orthomiella Nicéville, 1890, Petrelaea
Toxopeus, 1929, and Pseudonacaduba Stempffer, 1942.
Parent Taxon. Tribe Polyommatini Swainson, 1827.
Comment. The same name was proposed as a nomen nudum (fails ICZN Art. 13.) by Kocak & Seven
(1997).
Ionolycina Grishin, new subtribe
http://zoobank.org/7708 IBED-FF23-424A-98B3-54 LEO4BA53E5
Type genus. /onolyce Toxopeus, 1929.
Definition. Jonolyce (type species Ionolyce helicon javanica Toxopeus, 1929) is confidently placed in the
clade of Polyommatini Swainson, 1827 with several subtribes, not confidently grouping with any of them
(Fig. 22). Therefore, the lineage with Jonolyce represents a subtribe. This new subtribe is diagnosed by a
combination of the following characters, as given for Jonolyce by Tite (1963): cornuti in aedeagus are
large and spine-like, ribs in androconial scales are ribbon-like with nodular irregularities mainly in the
posterior third of the scale; fused part of veins SC and Rj is typically longer than in relatives, and the free
end of vein SC is faint. A combination of the following nuclear genomic base pairs is diagnostic:
cce437.15.1:A182G, cce303334.4.2:C106G, cce3111.1.6:A86G, cce3368.2.2:T241A, cce29649.12.1:A151G.
Genera included. The type genus (i.e., Jonolyce Toxopeus, 1929) and Paraduba Bethune-Baker, 1906.
Parent Taxon. Tribe Polyommatini Swainson, 1827.
Pithecopina Grishin, new subtribe
http://zoobank.org/3 ESE4A9A-64A9-4AFC-85DD-81B13BES53FBE
Type genus. Pithecops Horsfield, 1828.
Definition. The clade with Pithecops (type species Pithecops hylax corax Fruhstorfer, 1919, which is a
subspecies of Pithecops corvus Fruhstorfer, 1919) is confidently placed as sister to the “crown group” of
Polyommatini Swainson, 1827 that undergoes extensive diversification (Fig. 22), and we include it in the
“crown group” despite its unusual wing patterns. The Pithecops clade does not have close relatives within
Polyommatini and, therefore, represents a subtribe. This new subtribe is diagnosed by a combination of
the following characters, as given for the Pithecops section by Eliot (1973): male genitalia elongated and
43
appear flattened, uncus broadly divided nearly to its base, secondary sexual characters absent, veins SC
and R; fuse at least for some distance, eyes not hairy, palpi hairy. A combination of the following nuclear
genomic base pairs is diagnostic: cce59502.1.2:A118G, cce1246.19.3:A71G, cce9990.6.1:G740A, cce1317.
1.1:C772T, cce3516.4.2:G83T.
Genera included. Only the type genus.
Parent Taxon. Tribe Polyommatini Swainson, 1827.
Comment. The same name was published in a pioneering study by Stradomsky (2016) without explicitly
indicating that the name was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus
of this taxon was (fails ICZN Art. 16.2.). This name for the taxon already discovered by Stradomsky and
confirmed by our genomic analysis is simply formalized here to comply with the ICZN Code (ICZN
[International Commission on Zoological Nomenclature] 1999).
Zizulina Grishin, new subtribe
http://zoobank.org/A230CCD 1-B083-4025-8B78-A3 1A89478932
Type genus. Zizu/a Chapman, 1910.
Definition. The lineage with Zizula (type species Lycaena gaika Trimen, 1862, which is a junior
subjective synonym of Papilio hylax Fabricius, 1775) is a confident sister to Brephidiina Stempffer, 1957,
but is at the tree level that corresponds to subtribes in the “crown group” of Polyommatini Swainson,
1827 (Fig. 22) and therefore represents a subtribe. This new subtribe is diagnosed by a combination of the
following characters, as given for the Zizula section by Eliot (1973): male genitalia unusual, aedeagus
stout and terminally divided into two processes of about half of its length, dorsal and ventral, together
resembling a beak, valva with a rod-like process of about the same length as genitalia and long bristles
twice of valval length, veins SC and Ri fused towards costa, secondary sexual characters absent. A
combination of the following nuclear genomic base pairs is diagnostic: cce993.15.2:A161G, cce993.15.2:
T162C, cce811.10.3:A2207G, cce811.10.3:T2197C, ccel162.15.2:TISIA.
Genera included. Only the type genus.
Parent Taxon. Tribe Polyommatini Swainson, 1827.
Comment. The same name was proposed as a nomen nudum (fails ICZN Art. 13.) by Kocak (1996) and
then published in a pioneering study by Stradomsky (2016) without explicitly indicating that the name
was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus of this taxon was (fails
ICZN Art. 16.2.). This name for the subtribe already discovered by Kogak and Stradomsky and confirmed
by our genomic analysis is simply formalized here to comply with the ICZN Code (ICZN [International
Commission on Zoological Nomenclature] 1999).
Jamidina Grishin, new subtribe
http://zoobank. org/F3E26669-CDF0-4EFC-9539-F88A3D47B1F7
Type genus. Jamides Hubner, [1819].
Definition. The lineage with Jamides (type species Papilio bochus Stoll, 1782) is a confident sister to
Celastrinina Tutt, 1907, but splits from the latter at the tree level of subtribes (Fig. 22), thus representing a
subtribe. This new subtribe is diagnosed by a combination of the following characters, as given for the
Jamides section by Eliot (1973): male genitalia with vinculum lacking cephalad expansion, uncus directed
ventrad, falces very long (nearly half of valva length), aedeagus longer than valva (usually by a third or
more), valva deeply bilobed; forewing veins SC and R: are not fused for any distance, but connected with
a short cross-vein. A combination of the following nuclear genomic base pairs is diagnostic: cce23510.3.2:
T93C, cce23510.3.2:A432G, cce1568.2.4:A5519G, cce1568.2.4:A6856C, cce10823.2.3:T258C.
44
Genera included. Only the type genus.
Parent Taxon. Tribe Polyommatini Swainson, 1827.
Comment. The same name was proposed as a nomen nudum (fails ICZN Art. 13.) by Kocak (1996) and
then published in a pioneering study by Stradomsky (2016) without explicitly indicating that the name
was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus of this taxon was (fails
ICZN Art. 16.2.). This name for the subtribe already discovered by Kocgak and Stradomsky and confirmed
by our genomic analysis is simply formalized here to comply with the ICZN Code (ICZN [International
Commission on Zoological Nomenclature] 1999).
Fameganina Grishin, new subtribe
http://zoobank.org/07D24435-1EAD-4C80-9350-0A 1FA6003972
Type genus. Famegana Eliot, 1973.
Definition. The lineage with Famegana (type species Lycaena alsulus Herrich-Schaffer, 1869, which is a
junior subjective synonym of Lycaena nisa Wallace, 1866) is sister to Zizeeriina Chapman, 1910 with
moderate confidence (Fig. 22). Because the confidence of this grouping is not the highest and because this
lineage originates at the tree level of subtribes, it represents a subtribe. This new subtribe is diagnosed by
a combination of the following characters, as given for the Famegana section by Eliot (1973): in male
genitalia, tegumen and uncus bulky, falces stout and nearly rigidly connected, uncus lobes terminally
pointed and slightly downturned; veins SC and Rj touch each other over a short distance, eyes not hairy,
palpi with bristles. A combination of the following nuclear genomic base pairs is diagnostic: cce1088.12.
3:A100T, cce1088.12.3:G102A, cce18.45.4:G1256T, ccel8.45.4:G1255A, cce10490.1.2:T1933A.
Genera included. Only the type genus.
Parent Taxon. Tribe Polyommatini Swainson, 1827.
Comment. The same name was proposed as a nomen nudum (fails ICZN Art. 13.) by Kocak & Seven
(1997) and then published in a pioneering study by Stradomsky (2016) without explicitly indicating that
the name was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus of this taxon
was (fails ICZN Art. 16.2.). This name for the subtribe already discovered by Kocak& Seven and
Stradomsky and confirmed by our genomic analysis is simply formalized here to comply with the ICZN
Code (ICZN [International Commission on Zoological Nomenclature] 1999).
Oboroniina Grishin, new subtribe
http://zoobank.org/FB96541D-672A-41A6-9C47-2EDAADECOD60
Type genus. Oboronia Karsch, 1893.
Definition. The clade with Oboronia (type species Oboronia staudingeri Hemming, 1960, which is a
junior subjective synonym of Plebeius punctatus Dewitz, 1879) is placed within the “crown group” of
Polyommatini Swainson, 1827 without strongly supported phylogenetic affinity to any subtribe (Fig. 22)
and therefore represents a subtribe of its own. This new subtribe is diagnosed by a combination of the
following characters, as given for the Euchrysops section by Eliot (1973): male genitalia with long falces,
vinculum broadening in the middle in lateral view, long and narrow valva, massive rod-shaped aedeagus
with anterior ductus entrance; veins SC and Ri: not fused. A combination of the following nuclear
genomic base pairs is diagnostic: cce349.2.1:C166A, cce349.2.1:A167T, cce935.8.2:A66G, cce2073.8.1:
A230G, cce178.15.6:A190G.
Genera included. The type genus (i.e., Oboronia Karsch, 1893), Euchrysops Butler, 1900, Lepidochrys-
ops Hedicke, 1923, Orachrysops Vari, 1986, and Thermoniphas Karsch, 1895.
Parent Taxon. Tribe Polyommatini Swainson, 1827.
45
Comment. The same name was published in a pioneering study by Stradomsky (2016) without explicitly
indicating that the name was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus
of this taxon was (fails ICZN Art. 16.2.). This name for the subtribe already discovered by Stradomsky
and confirmed by our genomic analysis is simply formalized here to comply with the ICZN Code ICZN
[International Commission on Zoological Nomenclature] 1999).
Uranothaumatina Grishin, new subtribe
http://zoobank. org/57D2B8F3-36FA-4457-88B2-FCIJDADC2EF8
Type genus. Uranothauma Butler, 1895.
Definition. The lineage with Uranothauma (type species Uranothauma crawshayi Butler, 1895) is
confidently placed as sister to Scolitantidina Tutt, 1907 (Fig. 22), but it was not traditionally included in
the latter subtribe. Additionally, because it originates at the tree level corresponding to subtribes, it
represents a subtribe. This new subtribe is a union of the Uranothauma and Phlyaria sections of Eliot
(1973), who listed characters for them, and is diagnosed as follows (see also Stradomsky (2016) for
genitalia illustrations): in male genitalia, saccus absent, falces developed, as long as tegumen with uncus,
vinculum expanded in the middle in lateral view, aedeagus shorter than valva, rod-shaped with ductus
entrance dorso-cephalad, valva elongated, undivided; veins SC and Ri touch each other or fuse at least for
some distance, eyes hairy, palpi hairy or bristly. A combination of the following nuclear genomic base
pairs is diagnostic: cce993.29.2:A515G, ccel03.22.12:A47G, cce462.35.1:G193T, cce912.1.1:C56A,
ccel 162.12.1:G739A.
Genera included. The type genus (i.e., Uranothauma Butler, 1895) and Phlyaria Karsch, 1895.
Parent Taxon. Tribe Polyommatini Swainson, 1827.
Comment. The same name was published in a pioneering study by Stradomsky (2016) without explicitly
indicating that the name was intentionally new (fails ICZN Art. 16.1.) and not stating what the type genus
of this taxon was (fails ICZN Art. 16.2.). This name for the subtribe already discovered by Stradomsky
and confirmed by our genomic analysis is simply formalized here to comply with the ICZN Code ICZN
[International Commission on Zoological Nomenclature] 1999).
Higher classification of Lycaenidae to the subtribal level
Based on our genome-scale phylogeny (Figs. 20-22) complemented with other studies (Talavera et al.
2012; Boyle et al. 2015; Robbins et al. 2022; Boyle et al. 2023; Kawahara et al. 2023), we propose the
following provisional classification of Lycaenidae into subfamilies, tribes, and subtribes. We partition the
family into eight subfamilies. If no tribes and subtribes are listed for a subfamily, we consider that
subfamily to be monotypic. If no subtribes are listed for a tribe, we consider that tribe to be monotypic.
The type genus name for each taxon is given in parentheses. New taxa and status changes are shown in
red font. Synonymy ts not provided.
Family Lycaenidae [Leach], [1815] (Lycaena [Fabricius], 1807)
Subfamily Curetinae Distant, 1884 (Curetis Hiibner, [1819])
Subfamily Liphyrinae Doherty, 1889 (Liphyra Westwood, [1864]), stat. rest.
Subfamily Miletinae Reuter, 1896 (Miletus Hiibner, [1819])
Tribe Lachnocnemini Clench, 1955 (Lachnocnema Trimen, 1887)
Tribe Miletini Reuter, 1896 (Miletus Hubner, [1819])
Subtribe Miletina Reuter, 1896 (Miletus Hubner, [1819])
Subtribe Megalopalpina Grishin, subtrib. n. (Megalopalpus Rober, 1886)
Tribe Spalgini Toxopeus, 1929 (Spalgis F. Moore, 1879)
Subtribe Spalgina Toxopeus, 1929 (Spalgis F. Moore, 1879)
Subtribe Tarakina Eliot, 1973, stat. rev. (Taraka Doherty, 1889)
46
Subfamily Poritiinae Doherty, 1886 (Poritia F. Moore, [1866])
Tribe Liptenini Rober, 1892 (Liptena Westwood, [1851 ])
Subtribe Durbaniina Clench, 1955 (Durbania Trimen, 1862)
Subtribe Pentilina Aurivillius, 1914 (Pentila Westwood, [1851])
Subtribe Liptenina Rober, 1892 (Liptena Westwood, [1851]); includes Mimacraeina Stempffer, 1961
Subtribe Iridanina Clench, 1965 U/ridana Aurivillius, 1920)
Subtribe Epitolina Jackson, 1962 (Epitola Westwood, [1851])
Subtribe Cooksoniina Safian, Boyle & Pierce, 2023 (Cooksonia H. H. Druce, 1905)
Tribe Poritiini Doherty, 1886 (Poritia F. Moore, [1866])
Subfamily Aphnaeinae Distant, 1884 (Aphnaeus Hiibner, [1819]); not monophyletic with Theclinae!
Tribe Axiocersini Grishin, trib. n. (Axiocerses Hubner, [1819])
Tribe Cigaritini Grishin, trib. n. (Cigaritis Donzel, 1848)
Subtribe Pseudaletidina Grishin, subtrib. n. (Pseudaletis H. H. Druce, 1888)
Subtribe Cigaritina Grishin (Cigaritis Donzel, 1848)
Tribe Aphnaeini Distant, 1884 (Aphnaeus Hubner, [1819])
Subtribe Aloeidina Grishin, subtrib. n. (A/oeides Hubner, [1819])
Subtribe Phasisina Grishin, subtrib. n. (Phasis Hubner, [1819])
Subtribe Aphnaeina Distant, 1884 (Aphnaeus Hubner, [1819])
Subfamily Lycaeninae [Leach], [1815] (Lycaena [Fabricius], 1807)
Subfamily Theclinae Swainson, 1830 (Thecla [Fabricius], 1807)
Tribe Theclini Swainson, 1830 (Thecla [Fabricius], 1807)
Tribe Surendrini Kocak & Seven, 1997, stat. nov. (Surendra F. Moore, 1879)
Tribe Arhopalini Bingham, 1907 (Arhopala Boisduval, 1832)
Tribe Drinini Grishin, trib. n. (Drina Nicéville, 1890)
Tribe Candalidini Eliot, 1973 (Candalides Hubner, [1819])
Tribe Hypochrysopini Grishin, trib. n. (Hypochrysops C. Felder & R. Felder, 1860)
Tribe Luciini Waterhouse & Lyell, 1914 (Lucia W. Swainson, 1833)
Tribe Ogyrini Waterhouse & Lyell, 1914 (Ogyris Angas, 1847)
Tribe Jalmenini Grishin, trib. n. (Ja/menus Hubner, 1818)
Tribe Pseudalmenini Grishin, trib. n. (Pseudalmenus H. H. Druce, 1902)
Tribe Amblypodiini Doherty, 1886 (Amblypodia Horsfield, 1829)
Tribe Myrinini Toxopeus, 1929, stat. nov. (Myrina [Fabricius], 1807)
Tribe Cheritrini Swinhoe, 1910 (Cheritra F. Moore, 1881)
Subtribe Cheritrina Swinhoe, 1910 (Cheritra F. Moore, 1881)
Subtribe Horagina Swinhoe, 1910, stat. nov. (Horaga F. Moore, 1881)
Subtribe Loxurina Swinhoe, 1910, stat. nov. (Loxura Horsfield, [1829])
Tribe Iolaini Riley, 1958 (Jo/aus Hubner, [1819])
Tribe Catapaecilmatini Eliot, 1973 (Catapaecilma Butler, 1879)
Tribe Zesiusini Swinhoe, 1912 (Zesius Hubner, [1819])
Tribe Tomarini Eliot, 1973 (Tomares Rambur, 1840)
Tribe Rapalini Grishin, trib. n. (Rapala F. Moore, 1881)
Subtribe Rapalina Grishin (Rapala F. Moore, 1881)
Subtribe Pilodeudorigina Grishin, subtrib. n. (Pilodeudorix H. H. Druce, 1891)
Tribe Deudorigini Doherty, 1886 (Deudorix Hewitson, 1863)
Tribe Eumaeini Doubleday, 1847 (Eumaeus Hubner, [1819])
Subtribe Eumaeina Doubleday, 1847 (Eumaeus Hubner, [1819])
Subtribe Rhammina Prieto & Busby, 2022 (Rhamma K. Johnson, 1992)
Subtribe Timaetina Busby & Prieto, 2022 (Timaeta K. Johnson, Kruse & Kroenlein, 1997)
Subtribe Atlidina Martins & Duarte, 2022 (Atlides Hubner, [1819])
Subtribe Evenina Faynel & Grishin, 2022 (Evenus Hubner, [1819])
Subtribe Jantheclina Robbins & Faynel, 2022 (Janthecla Robbins & Venables, 1991)
Subtribe Paiwarriina Lamas & Robbins,2022 (Paiwarria Kaye, 1904)
Subtribe Cupatheclina Lamas & Grishin, 2022 (Cupathecla Balint, 2005)
Subtribe Parrhasiina Busby & Robbins, 2022 (Parrhasius Hubner, [1819])
Subtribe Ipideclina Martins & Grishin, 2022 (Ipidecla Dyar, 1916)
Subtribe Calycopidina Duarte & Robbins, 2010 (Calycopis Scudder, 1876)
Subtribe Strymonina Tutt, 1907 (Strymon Hubner, 1818)
Subtribe Strephonotina K. Johnson, Austin, Le Crom & Salazar, 1997 (Strephonota K. Johnson et al., 1997)
Subtribe Trichonidina Duarte & Faynel, 2022 (Trichonis Hewitson, 1865)
47
Subtribe Callophryidina Tutt, 1907 (Callophrys Billberg, 1820)
Subfamily Polyommatinae Swainson, 1827 (Polyommatus Latreille, 1804)
Tribe Oxylidini Eliot, 1973 (Oxylides Hubner, [1819])
Subtribe Oxylidina Eliot, 1973 (Oxylides Hubner, [1819])
Subtribe Hemiolaina Grishin, subtrib. n. (Hemiol/aus Aurivillius, 1922)
Tribe Remelanini Eliot, 1973 (Remelana F. Moore, 1884)
Tribe Hypolycaenini Swinhoe, 1910 (Hypolycaena C. Felder & R. Felder, 1862)
Tribe Lycaenesthini Toxopeus, 1929 (Lycaenesthes F. Moore, 1866)
Tribe Hypotheclini Eliot, 1973 (Hypothecla G. Semper, 1890)
Subtribe Hypotheclina Eliot, 1973 (Hypothecla G. Semper, 1890)
Subtribe Cupidopsina Grishin, subtrib. n. (Cupidopsis Karsch, 1895)
Tribe Polyommatini Swainson, 1827 (Polyommatus Latreille, 1804)
Subtribe Niphandina Sibatani & Ito, 1942, stat. conf. (Niphanda F. Moore, 1875)
Subtribe Theclinesthina Grishin, subtrib. n. (Theclinesthes Rober, 1891)
Subtribe Azanina Grishin, subtrib. n. (Azanus F. Moore, 1881)
Subtribe Unina Grishin, subtrib. n. (Una Nicéville, 1890)
Subtribe Danina Ko¢ak & Seven, 1997 (Danis [Fabricius], 1807)
Subtribe Ionolycina Grishin, subtrib. n. (Jonolyce Toxopeus, 1929)
Subtribe Pithecopina Grishin, subtrib. n. (Pithecops Horsfield, 1828)
Subtribe Zizulina Grishin, subtrib. n. (Zizu/a Chapman, 1910)
Subtribe Brephidiina Stempffer, 1957 (Brephidium Scudder, 1876)
Subtribe Celastrinina Tutt, 1907 (Celastrina Tutt, 1906)
Subtribe Jamidina Grishin, subtrib. n. (Jamides Hubner, [1819])
Subtribe Zizeeriina Chapman, 1910 (Zizeeria Chapman, 1910)
Subtribe Fameganina Grishin, subtrib. n. (Famegana Eliot, 1973)
Subtribe Catochrysopina Toxopeus, 1929 (Catochrysops Boisduval, 1832)
Subtribe Oborontina Grishin, subtrib. n. (Oboronia Karsch, 1893)
Subtribe Castaliina Distant, 1884 (Castalius Hubner, [1819])
Subtribe Scolitantidina Tutt, 1907 (Scolitantides Hubner, [1819])
Subtribe Uranothaumatina Grishin, subtrib. n. (Uranothauma Butler, 1895)
Subtribe Actizerina Kogak, 1996 (Actizera Chapman, 1910)
Subtribe Leptotina Wagener, 1995 (Leptotes Scudder, 1876)
Subtribe Lampidina Tutt, 1907 (Lampides Hubner, [1819])
Subtribe Everina Tutt, 1907 (Everes Hubner, [1819])
Subtribe Polyommatina Swainson, 1827 (Polyommatus Latreille, 1804)
Our classification of Polyommatini Swainson, 1827
compared to that by Stradomsky (2016)
In his pioneering work based on limited DNA sequence data and careful genitalic comparison,
Stradomsky (2016) proposed to partition the tribe Polyommatini into 22 subtribes. Stradomsky’s
classification fares well compared to our genomic results (see above), and his study is impressive in its
insight. Out of our 23 subtribes, 20 match Stradomsky’s in names, and one, Celastrinina Tutt, 1907, was
referred to by its junior subjective synonym, Lycaenopsina Swinhoe, 1910. The remaining two subtribes,
Ionolycina subtrib. n. and Unina subtrib. n., were placed by Stradomsky into his Danina Kocak &
Seven, 1997 and “Azanina,” respectively. Una Nicéville, 1890 cannot belong to “Azanina,” because it is
in the clade with Danis [Fabricius], 1807 and not with Azanus F. Moore, 1881 (see Fig. 22 and Kawahara
et al. (2023)). While it is indeed possible to unify these four groups into a single subtribe, Danina, genetic
differentiation within this subtribe would be larger than in other subtribes in Polyommatini (Fig. 22).
Therefore, dividing the group into four subtribes brings the classification in line with the genetic
differentiation within other Polyommatini subtribes. Finally, Stradomsky’s “Cacyreina” is merged into
our Lampidina Tutt, 1907 due to genetic similarities, and Stradomsky’s phylogeny based on a small
number of gene markers is poorly supported around these taxa. We put names of subtribes used by
Stradomsky in quotes because they were proposed somewhat informally: authorship of previously
published names was not indicated, and for the names we could not find in previous publications,
Stradomsky did not explicitly indicate that they were intentionally new (fails ICZN Art. 16.1.) and did not
specify what their type genera were (fails ICZN Art. 16.2.). Moreover, it remains unclear from the text of
48
his article which names Stradomsky considered new in the sense of the ICZN Code (if any) and if he
intended to propose new ICZN-compliant names in his work.
Paralycaeides Nabokov, 1945 is a subgenus of /tylos Draudt, 1921
and Eldoradina Balletto, 1993 of Nabokovia Hemming, 1960
Inspection of genomic trees reveals that two pairs of Pseudochrysops bornoi]22037G05|DR|1981
: 1 ; Itylos moza|22028E03|Bolivia|1949
eenkta: (1) Itylos Draudt, 1921 (type aReett> Cupido ° Itylos pacis|22076C08|Peru:Arequipa|2009
speciosa Staudinger, 1894, which is a junior sear a ed teat
subjective synonym of Lycaena titicaca Weymer, oe aralycaeides inconspicua|22028E08|Perulold
1890 : k Paralycaeides vapa|22028E09|Bolivia|1954
) and Paralycaeides Nabo OV, 1945 (type Pseudolucia chilensis|22028E05|Chile|1954
‘ . . Pseudolucia andina|22075G04|Chile|1993
species Itylos LNCONSPICUua Draudt, 1921) and (2) ) Pseudolucia vera|22075F 10|Chile|1990
; i 1 Pseudolucia collina|22075F12|Chile|1991
Nabokovia Hemming, 1960 (type species Thecla faga Pseudolucia plumbea|22076C04|Chile|1993
1 j abokovia ada|22028C07|Chile|1952
Dognin, 1895 and Eldoradina Balletto, 1993 (type | ig ooene le Sal soapacoeceusiee?
species Nabokovia (Eldoradina) cyanea _ Balletto, Pieredas satel ea il ate Me z
. a emiargus Ceraunus “HOPKINS CO.
1993) are closely related to each other in each pair Cyclargus thomasi|LEP22359]FL, Monroe Co.
(Fig. 23): COI barcode difference of 5.9%—6% (39-40 | Fig. 23. Nuclear genome tree (autosomes): genus /ty/os
bp) in each pair. Furthermore, at least one genus in (red, subgenus Paralycaeides in magenta) and genus
Nabokovia (blue, subgenus E/doradina in violet color).
each pair consists of a small number of species.
Therefore, we propose to treat the junior name in each pair as a subgenus name: Paralycaeides Nabokov,
1945 of Jtylos Draudt, 1921 and Eldoradina Balletto, 1993 of Nabokovia Hemming, 1960.
Shijimia Matsumura, 1919 is confirmed as a valid genus
with Shijimia potanini Alphéraky, 1889, new combination
Genomic sequencing and analysis of representatives of the subtribe Everina Tutt, 1907 (type genus Everes
Hiibner, [1819])) reveals that Shijimia Matsumura, 1919 (type species Lycaena moorei Leech, 1889) may
not be monophyletic with Cupido Schrank, 1801 (type species Papilio minimus Fuessly, 1775) and
instead may be sister to Bothrinia Chapman, 1909 (type
. we Ee CF ee: A Cupido minimus|20058D07|Denmark|2006
species Cyaniris chennellii de Nicéville, [1884]) (Fig. Cupido argiades|22027E 10|Italy|1960
*“Cupido comyntas|3506|USA:TX,Hardin Co.|2015
24), confirming that it is meaningful to treat Shijimia as Silt meee ase ede ene cu tn eae
anal gre cuUS: Hy exsed Ucn e cd: ONG, Clete tw OsSyntypes ice “Frbolitinia nebulosala20270 1o|china: Sichuan [1929
Everes umbriel Doherty, 1889 (type locality Tenasserim a pororiniaic Hens lezas oe Myaninetle og)
Valley) currently treated as a junior subjective synonym “Tongeis fischeri|22027D09|Korea|1910
(or subspecies) of Lycaena potanini Alphéraky, 1889 ie Falicada nyseus|22027E01|no datalold
Thy Karyce cogina|22038B08|Brazil:SP|1991
kalyce cogina|22038B09|Brazil:SP|1995
(type locality in China: Gansu Province) in the genus
Tongeia Tutt, 1908 (type species Lycaena fischeri | Fig. 24. Nuclear genome tree (autosomes) of Everina
Eversmann, 1843), and found that it is not monophyletic a alae eae a Pa ee ae Ged),
with Tongeia fischeri, but is closely related to Shijimia
Matsumura, 1919 (type species Lycaena moorei Leech, 1889) (Fig. 24). Therefore, we propose a new
combination: Shijimia potanini (Alphéraky, 1889), comb. nov.
Family Hesperiidae Latreille, 1809
Pyrrhochalcia Mabille, 1904 is a subgenus of Coeliades Hiibner, 1818
Although immediately distinguishable by its much larger size, black wings with metallic-green shine (and
broad green streaks in females) above, and shiny cyan-green-olive hindwings beneath, Pyrrhochalcia
Mabille, 1904 (type and the only species Papilio iphis Drury, 1773) was recognized as a close relative of
Coeliades Hiibner, 1818 (type species Papilio forestan Stoll, 1782) by Evans (1937) and placed next to
Pyrrhiades Lindsey & Miller, 1965 (type species Papilio lucagus Cramer, 1777)—currently within
49
Coeliades—by Chiba (2009) in his key, differing by
the relative positions of vein origins on hindwing.
Moreover, some species of Coeliades are patterned
similarly, although without extensive green coloration
on ventral hindwing: C. /ucagus (Cramer, 1777) and
C. aeschylus (Pl6tz, 1884) (both formerly in
Pyrrhiades). Our genomic tree and recently published
phylogeny (Toussaint et al. 2021) support this close
relationship between Pyrrhochalcia and Coeliades by
placing the former as a close sister of the latter
without prominent separation between them (Fig. 25).
Genetic differentiation within Coeliades even after
sPyrrhochalcia iphis|17108E08|Ivory Coast|1965
ibyrrhochalcia iphis|17112G09|Ghana|1996
Pyrrhochalcia iphis|7873|Nigeria|1960
eee lucagus|17068F09|Ghanalold
tod oeliades anchises|17118E08|Kenya|1939
Coeliades pansa|17118G11|Madagascar|1962
ogc Oeliades rama|17118F02|Madagascar|old
Coeliades forestan|18054H02|Namibia|2002
Coeliades libeon|17118H01|Cameroon|1973
Coeliades keithloa|18096A08|South Africa|old
Coeliades hanno|17118F10|Uganda|1960
Coeliades pisistratus|17118F05|Kenya|1941
) Coeliades fervida|17118G06|Madagascar|1990
Coeliades chalybe|17118H04|Cameroon|1972
Coeliades bixana|18019D05|Nigeria|1972
zg hoaspes stigmata|18028D09|no datalold|
72Choaspes adhara visaya|18093E12|HT|Philippines|1979
oChoaspes benjaminii|21103A11|Sri Lanka|1904
Choaspes illuensis|18096A07|Indonesia:Afrak|old
og - Nhoaspes subcaudata|18028D12|no datalold
Choaspes furcata|18028E02|China:Sichuan|1938
Choaspes xanthopogon|19064E08|Malaysia|1992
Tool ekliades ramanatek|17118G05|Madagascar|1990
Tekliades ramanatek|7871|Madagascar|1990
Fig. 25. Nuclear genome tree (autosomes): genus
Coeliades (blue, with subgenus Pyrrhochalcia
labeled in violet) and genus Choaspes (green).
including Pyrrhochalcia is approximately the same as
that within the genus Choaspes F. Moore, 1881 (type
species Hesperia (Thymele) benjaminii Guérin-
Méneville, 1843) (Fig. 25 blue vs. green). Therefore,
we propose that Pyrrhochalcia Mabille, 1904, stat.
nov. is a subgenus of Coeliades Hiibner, 1818.
Cecropterus (Thorybes) nevada (Scudder, 1872) is restricted to OR, CA, and NV and
Cecropterus (Thorybes) dobra (Evans, 1952) is found eastward in the US
Genomic sequencing of specimens from the northeastern part of the range of the Cecropterus (Thorybes)
mexicana species group that consists of three species: Cecropterus (Thorybes) nevada (Scudder, 1872),
Cecropterus (Thorybes) dobra (Evans, 1952), and Cecropterus (Thorybes) mexicana (Herrich-Schaffer,
1869) reveals that all of them are C. dobra, which is genetically uniform throughout its range (Fig. 26).
Therefore, C. nevada is restricted to the westernmost part of the USA (Oregon, California, and Nevada)
and is separated from C. dobra by a wide gap in its distribution, according to iNaturalist observations
(2023) (Fig. 26).
ar & yet 2 is b
Cecropterus dobra|21089E11|USA:AZ,Coconino Co.|2021
Cecropterus dobra|14114A07|USA:AZ,Coconino Co.|1993
Cecropterus dobra|11395|USA:AZ,Apache Co.|2018
Cecropterus dobra|20102B12|USA:CO,Grand Co.|1995
Cecropterus dobra|11182|USA:NM, Otero Co.|2018
Cecropterus dobra|20045E09|USA:UT,San Juan Co.|2020
Cecropterus dobra|20045E10|USA:UT,San Juan Co.|2020
Cecropterus dobra|20102B04|USA:CO,Mesa Co.|2020
Cecropterus dobra|22101A11|USA:UT, Iron Co.|1977
Cecropterus dobra|22101A12|USA:UT, Garfield Co.|1977
Cecropterus dobra]20102B06|USA:CO,Montrose Co.|1966
Cecropterus dobra|20102B08|USA:CO, Garfield Co.|1975
Cecropterus dobra|20102B10|USA:CO,Gilpin Co.|1990
Cecropterus dobra]20102B11|USA:CO,Clear Creek Co.|1968
Cecropterus dobra|20102B07|USA:CO, Gunnison Co.|1965
Cecropterus dobra|20102B09|USA:CO,Pitkin Co.|1973
Cecropterus dobra|]11263|USA:NM,Bernallilo Co.|2018
Cecropterus dobra|22101A10|USA:NM,San Miguel Co.|1978
Cecropterus dobra|20102B05|USA:CO,Mesa Co.|2020
P| Cecropterus dobra|22101A09|USA:NM,Rio Arriba Co.|1978
Cecropterus nevada aemilea|15024D06|USA:OR,Klamath Co.|1991
Cecropterus nevada aemilea|15024D07|USA:OR,Deuschutes Co.|2001
Cecropterus nevada aemilea|15095F02|ST|USA:OR, Klamath Co.|old
Cecropterus nevada aemilea|15024D08|USA:OR,Deuschutes Co.|2002
Cecropterus nevada blanca|22094A11|USA:CA,Mono Co.|1993
Cecropterus nevada nevada|PAO946|USA:CA, Sierra Co.|2019
Cecropterus nevada blanca|22094A12|USA:CA,Mono Co.|1993
=r Cecropterus nevada nevada|14114A09|USA:CA, Tulare Co.|2003
100 Cecropterus nevada nevada|14114A10|/USA:CA, Tulare Co.|2003
nevada Ti Cecropterus nevada blanca|22101B01|USA:CA,Mono Co.|1977
8 Cecropterus nevada blanca|PAO1152|USA:CA,Mono Co.|2019
Cecropterus nevada blanca|PAO1151|USA:CA,Mono Co.|2019
Cecropterus mexicana mexicana|14112D11|Mexico:SLP|1980
Cecropterus mexicana mexicana|19125B08|Mexico:Hidalgo|1988
Cecropterus mexicana mexicana|14114A12|Mexico:Hid|1981
Cecropterus mexicana mexicana|21115C02|ST|Mexico|old
Cecropterus mexicana mexicana]14114A11|Mexico:Hid|1981
Cecropterus mexicana mexicana|19125B07|Mexico:Col|1981
Cecropterus mexicana mexicana|14114B01|Mexico:O0ax|1986
Cecropterus mexicana mexicana (=ananius)|15032A01|ST|Mexicolold
Cecropterus mexicana mexicana|19125B06|Mexico:Oax|1988
Cecropterus diversus|14114B02|USA:CA,Madera Co.|1993
Cecropterus diversus|17116E02|USA:CA, Tuolumne Co.|1972
Cecropterus diversus|17114A01|USA:CA,Madera Co.|2007
Cecropterus diversus|22101B03|USA:CA,Plumas Co.|1986
Fig. 26. Cecropterus (Thorybes) dobra (blue) and Cecropterus (Thorybes) nevada (red): a) a distribution map made on the
basis of iNaturalist (2023) observations: iNaturalist maps for C. dobra and C. nevada were superimposed and merged in
Photoshop and re-colored (CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/), the map does not refer to
sequenced specimens, records were not checked and some may be misidentifications; b) nuclear genome tree (autosomes)
showing that specimens we sequenced from several localities in Utah, Colorado, New Mexico, and Arizona are C. dobra.
50
Cecropterus floridianus|22032A08|PT|USA:FL, Franklin Co.|1977
Cecropterus floridianus|22032A08|PT|USA:FL,Franklin Co.|1977
00 Cecropterus floridianus|22032A09|HT|USA:FL,Volusia Co.|1969 €ecropterus floridianus|22032A11|PT|USA:FL, Volusia Co.|1969
c arse Cecropterus floridianus|22032A11|PT|USA:FL, Volusia Co.|1969 Secropterus floridianus|22032A10|PT|USA:FL,Alachua Co.|1973
al 2 Cecropterus floridianus|22032A10|PT|USA:FL,Alachua Co.|1973 Cecropterus floridianus|22032A12|PT|USA:FL,Marion Co.|1988
7) Cecropterus floridianus|20062C06|PT|USA:FL,Levy Co.|1963 ‘éecropterus floridianus|20062C06|PT|USA:FL,Levy Co.|1963
7) F rT; Cecropterus floridianus|22032A07|PT|USA:FL,Dixie Co.|1988 1@becropterus floridianus|22032A09|HT|USA:FL, Volusia Co.|1969
= q Cecropterus floridianus|22032A12|PT|USA:FL,Marion Co.|1988 pe onierus floridianus|22032A07|PT|USA:FL, Dixie Co.|1988
AC) Cecropterus floridianus|22101A01 |PT|USA:FL,Martin Co.|1939 ecropterus floridianus|22101A01|PT|USA:FL,Martin Co.|1939
3S C. pylades (=timmaculata)|15095E09|"HT"|PA, Philadelphia Co.|old Cecropterus pylades|22064H06|Canada:Manitoba|1990
S a Cecropterus pylades|22064H03|Canada:Alberta|1977 ecropterus pylades|22064H04|Canada:Alberta|1977
= pascal PU ReSe SOR IROSICARAAH baci iors reese abe PT indecjonel Usa reMentaGriery. CO DOT?
ecropterus pylades anada:Alberta ecropterus pylades :AR,Montgomery Co.
Cecropterus pylades|22064H04|Canada:Alberta|1977 3%. pylades (=timmaculata)|15095E09|"HT"|PA,Philadelphia Co.
Cecropterus pylades|6022|USA:TX,Wise Co.|2016 4eecropterus pylades|6022|USA:TX,Wise Co.|2016
aa Cecropterus pylades|3313|USA:TX,Sabine Co.|2015 Cecropterus pylades|3313|USA:TX,Sabine Co.|2015
A Cecropterus pylades|8586|USA:OK, Atoka Co.|2017 #Pecropterus pylades|8586|USA:OK,Atoka Co.|2017
o a Cecropterus pylades|4403|USA:TX,Lamar Co.|2015 Cecropterus pylades|4403|USA:TX,Lamar Co.|2015
® Cecropterus pylades|9288|USA:AR,Montgomery Co.|2017 Cecropterus pylades|22064H03|Canada:Alberta|1977
3 Cecropterus indistinctus|22094A07|Canada:BC, Vancouver |.|1958 pees indistinctus|22094A07|Canada:BC, Vancouver |.|1958
= Fi Cecropterus indistinctus|22094A05|Canada:BC, Fitzgerald|1921 ecropterus indistinctus|22094A05|Canada:BC, Fitzgerald|1921
Q. 4 Cecropterus indistinctus|18037D11|USA:CA,SLO Co.|2002 s€ecropterus indistinctus|15024D05|USA:CA,SLO Co.|1994
se Cecropterus indistinctus|15024D03|USA:CA, Alpine Co.|1943 pros indistinctus|PAO35|USA:CA,Monterey Co.|2016
B ; PEM EILEL EA GSCI SRCAMIGH eres Ole. Diego Co.|1964 ecouirus Hap AEH nooueaHarrMenEs SGn neg
ecropterus indistinctus :CA,Monterey Co. ecropterus indistinctus exico:
‘ Cecropterus indistinctus|15024D05|USA:CA,San Luis Obispo Co.|1994 pocorn: indistinctus|17109A08|HT|USA:CA,San Diego Co.|1961
10 See orton teeue wndlsiine uAlezecsHitlikexiee:8C ITObe, Co.|1961 tho eh a indistinctue}is024D0a/ USA. CALAISIne rome alae
ecropterus indistinctus exico: ecropterus indistinctus :CA, Alpine Co.
7) nF Cecropterus rockiensis|22094A09|PT|USA:UT,Salt Lake Co.|1930 Cecropterus rockiensis|20045E08|PT|USA:UT,San Juan Co.|2020
3 - Cecropterus rockiensis|22099H06|PT|USA:UT,Washington Co.|1977 Gecropterus rockiensis|22099H08|PT|USA:UT,Salt Lake Co.|1946
= 5 Cecropterus rockiensis|22099G12|PT|USA:UT, Utah Co.|1947 gba edet rockiensis|22099H06|PT|USA:UT, Washington Co.|1977
3 ROM atc te (densis|22099HOSIPHUSASUT. Utah C ees ae ae Racontinds rocklonsls|22094A09/PTIUSALUT Salt Laks Co 11930
= ecropterus rockiensis :UT,Utah Co. ecropterus rockiensis :UT,Salt Lake Co.
= - Cecropterus rockiensis|22068D07|PT|USA:UT,Beaver Co.|2022 Cecropterus rockiensis|22068D07|PT|USA:UT, Beaver Co.|2022
= S Cecropterus rockiensis|22099H10|PT|USA:UT, Zion NP|1928 Cecropterus rockiensis|22099HO9|PT|USA:UT, Utah Co.|1946
Cecropterus rockiensis|22099HO7|PT|USA:UT,Salt Lake Co.|1967 cropterus rockiensis|22099H05|PT|USA:CO, Eagle Co.|1976
nO ; Cecropterus rockiensis|22064H01|PT|USA:NE,Sioux Co.|1983 gsecropterus rockiensis|22099H0O2|PT|USA:CO, Garfield Co.|1977
ae Cecropterus rockiensis|22064HO02|PT|USA:NE, Sioux Co.|1983 100) Cecropterus rockiensis|22099HO7|PT|USA:UT,Salt Lake Co.|1967
c Cecropterus rockiensis|22099H04|PT|USA:MT, Yellowstone Co.|1948 ecropterus rockiensis|20045E07|PT|USA:UT,San Juan Co.|2016
et of*— Cecropterus rockiensis|8970|PT|USA:NM,Otero Co.|2017 Cecropterus rockiensis|11465|PT|USA:AZ,Apache Co.|2018
7) 8 Cecropterus rockiensis|15099HO9|PT|USA:NM, Lincoln Co.|1981 '€ecropterus rockiensis|21089E12|PT|USA:AZ,Lockett Mdw|2021
Y 7 Cecropterus rockiensis|9057|PT|USA:NM, Otero Co.|2017 ppcreptene rockiensis|22094A02|PT|USA:AZ,Grand Cyn S rim|1942
ec Cecropterus rockiensis|22094A08|PT|USA:CO, Boulder|1953 ecropterus rockiensis|22094A03|PT|USA:AZ,Grand Cyn S rim|1942
eco r i e eastesnosrloshcO.coas O90 Serer eshesoeanasr|USANE Sct Co '36
x 0 ecropterus rockiensis :CO,Eagle Co. ecropterus rockiensis :NE,Sioux Co.
8 Bie Cecropterus rockiensis|20045E07|PT|USA:UT,San Juan Co.|2016 ecropterus rockiensis|22099H04|PT|USA:MT, Yellowstone Co.|1948
4 or 5 f rockionsis|SG0U[PT|USA:NM Sandoval Go:l2017- Co.|1979 ake abo ate aU eA pe cee
ecropterus rockiensis :NM, Sandoval Co. ecropterus rockiensis :NM, Otero Co.
Cecropterus rockiensis|20045E08|PT|USA:UT,San Juan Co.|2020 Gecropterus rockiensis|15099HO9|PT|USA:NM,Lincoln Co.|1981
* Cecropterus rockiensis|22099H02|PT|USA:CO, Garfield Co.|1977 Cecropterus rockiensis|22099H01|PT|USA:CO, Boulder Co.|1954
yr Cecropterus rockiensis|21089E12|/PT|USA:AZ,Lockett Mdw|2021 €ecropterus rockiensis|22064HO1|/PT|USA:NE, Sioux Co.|1983
Cecropterus rockiensis|22094A02|PT|USA:AZ,Grand Cyn S rim|1942 §,ecropterus rockiensis|8970|PT|USA:NM, Otero Co.|2017
7 C. rockiensis|22094A03|PT|USA:AZ,Grand Cyn S rim|1942 Cecropterus rockiensis|22099H03|HT|USA:CO, Jefferson Co.|1979
T Cecropterus rockiensis|11465|PT|USA:AZ,Apache Co.|2018 Cecropterus rockiensis|22094A08|PT|USA:CO, Boulder|1953
Cecropterus rockiensis|18037D10|PT|USA:AZ,Graham Co.|2009 Cecropterus rockiensis|18037D10|PT|USA:AZ,Graham Co.|2009
* p Shes Ge SbOR IIS ATA TE onan Goo boas athe aibosuftusal@6QslUSALAZ, Santa Ceue CO 12017
4 ecropterus albosuffusa :AZ,Santa Cruz Co. ecropterus albosuffusa :AZ,Santa Cruz Co.
y Cecropterus albosuffusa|13386D04|USA:AZ,Cochise Co.|1991 Raha ais albosuffusa|20062C04|USA:AZ,Cochise Co.|1970
TO Cecropterus albosuffusa|12264|USA:AZ,Cochise Co.|2019 Cecropterus albosuffusa|12264|USA:AZ,Cochise Co.|2019
ao Cecropterus albosuffusa|20062C04|USA:AZ,Cochise Co.|1970 bat aoe albosuffusa|19013H07|Mexico:NL|1978
Cecropterus albosuffusa|22099H12|Mexico:Dgo|1988 ecropterus albosuffusa|20062C05|Mexico:NL|1981
z Cecropterus albosuffusa|15104C02|HT|TX,Jeff Davis Co.|1940 ecropterus albosuffusa|22101A04|Mexico:DF|1952
7 Cecropterus albosuffusa|9810|USA:TX,Jeff Davis Co.|2017 ecropterus albosuffusa|22101A05|Mexico:DF|1952
4 100 ; Cecropterus albosuffusa|19013H06|Mexico:Coah|1978 ecropterus albosuffusa|19013H08|Mexico:NL|1978
vi Cecropterus albosuffusa|20062C05|Mexico:NL|1981 stecropterus albosuffusa|22056A04|Mexico:NL|1981
Cecropterus albosuffusa|22056A11|USA:TX,Real Co.|1969 + 100 Gecropterus albosuffusa|21014G02|Mexico:Pue|1991
0 4) 9 a peor Cecropterus albosuffusa|19013H05|Mexico:Coah|1978 Cecropterus albosuffusa|21014G01|Mexico:Pue|1991
8 7 Cecropterus albosuffusa|22056A10|Mexico:Coah|1981 Cecropterus albosuffusa|22099H12|Mexico:Dgo|1988
& ry Cecropterus albosuffusa|19013H08|Mexico:NL|1978 Heceherus albosuffusa|22056A07|Mexico:Coah|1981
3 0 Cecropterus albosuffusa|22101A05|Mexico:DF|1952 ecropterus albosuffusa|9810|USA:TX,Jeff Davis Co.|2017
re) p Cecropterus albosuffusa|22056A04|Mexico:NL|1981 Gecropterus albosuffusa|22056A08|Mexico:Coah|1976
& ‘eer Cecropterus albosuffusa|22056A08|Mexico:Coah|1976 Gecropterus albosuffusa|19013H06|Mexico:Coah|1978
ba G Cecropterus albosuffusa|8378|USA:TX,Blanco Co.|2017 es albosuffusa|8378|USA:TX,Blanco Co.|2017
icc 8 Cecropterus albosuffusa|22101A04|Mexico:DF|1952 ee albosuffusa|15104C02|HT|TX,Jeff Davis Co.|1940
. Cecropterus albosuffusa|19013H0O7|Mexico:NL|1978 cropterus albosuffusa|22056A10|Mexico:Coah|1981
o eT Cecropterus albosuffusa|22056A07|Mexico:Coah|1981 Cecropterus albosuffusa|22056A11|USA:TX,Real Co.|1969
Y ‘ Cecropterus albosuffusa|22101A02|Mexico:NL|1977 Secropterus albosuffusa|19013H05|Mexico:Coah|1978
2 re Cecropterus albosuffusa|21014G02|Mexico:Pue|1991 Cecropterus albosuffusa|22101A02|Mexico:NL|1977
o Cecropterus albosuffusa|21014G01|Mexico:Pue|1991 Cecropterus albosuffusa|13386D04|USA:AZ,Cochise Co.|1991
o Cecropterus oaxacensis|19125BO9|HT|Mexico:Oax|1988 Cecropterus oaxacensis|19125B09|HT|Mexico:0ax|1988
x Cecropterus drusius|14065A10|USA:AZ,Pima Co.|1991 Gecropterus drusius|14065A10|USA:AZ,Pima Co.|1991
S Cecropterus drusius|15097HO7|LT|USA:South AZ|old ef ecropterus drusius|14063A05|USA:AZ,Santa Cruz Co.|1957
Cecropterus drusius|9688|USA:AZ,Santa Cruz Co.|2017 sie ecropterus drusius|15097HO7|LT|USA:South AZ|old
Cecropterus drusius|9656|USA:AZ,Santa Cruz Co.|2017 ecropterus drusius|14063A07|USA:AZ,Santa Cruz Co.|1961
Cecropterus drusius|14063A07|USA:AZ,Santa Cruz Co.|1961
Cecropterus drusius|14063A05|USA:AZ,Santa Cruz Co.|1957
i@ecropterus drusius|9656|USA:AZ,Santa Cruz Co.|2017
Cecropterus drusius|9688|USA:AZ,Santa Cruz Co.|2017
0.007
0.003
Fig. 27. Phylogenetic trees of Cecropterus (Thorybes) pylades species group inferred from protein-coding regions of a) the Z
chromosome (best for species delimitation) and b) the mitochondrial genome. Different species are shown in different colors:
C. floridianus sp. n. (ted), C. pylades (green), C. indistinctus stat. nov. (cyan), C. rockiensis sp. n. (purple), C. albosuffusa
stat. nov. (blue), C. oaxacensis sp. n. (orange), and C. drusius (black). Primary type specimens are labeled in magenta (except
that C. oaxacensis 1s left in orange as the sole representative of its species).
Cecropterus albosuffusa (H. Freeman, 1943) and Cecropterus indistinctus (Austin &
J. Emmel, 1998) are species distinct from Cecropterus pylades (Scudder, 1870)
Genomic comparison of Cecropterus Herrich-Schaffer, 1869 (type species Cecrops zarex Hubner, 1818)
reveals close relationship between Cecropterus (Thorybes) pylades (Scudder, 1870) (type locality in
USA: Massachusetts) and Cecropterus (Thorybes) drusius (W. H. Edwards, [1884]) (type locality in
southern Arizona) that are unified by the presence of costal fold in males (Evans 1955). We regard them
as the C. pylades species group (Fig. 27). Genomic trees (the Z chromosome and the mitogenome)
confirm that C. drusius with its distinctive genitalia (Fig. 30q) is sister to all others but reveal that the
entity currently treated as a single species C. pylades consists of several genetically differentiated clades
(Fig. 27). The Z chromosome (Fig. 27a) and the mitochondrial genome (Fig. 27b) trees show identical
strongly supported topology between the clades (but not within clades, where the subtrees are comb-like
51
due to genetic similarity and gene exchange) and placement of specimens into them, thus increasing the
confidence in the results due to this uncommon congruence between nuclear and mitochondrial trees.
The extent of genetic differentiation suggests that the clades within C. pylades represent distinct
species (Cong et al. 2019a). We find that Cecropterus pylades albosuffusa (H. Freeman, 1943) (type
locality USA: Texas, Ft. Davis) forms a clade distant from the nominotypical C. pylades with Fs/Gmin of
0.39/0.001 and COI barcode difference of 2.1% (14 bp). Similarly, the westernmost Cecropterus pylades
indistinctus (Austin & J. Emmel, 1998) (type locality in USA: California: San Diego Co.) is separated
from the nominotypical C. pylades with Fst/Gmin of 0.41/0.002 and COI barcode difference of 1.7% (11
bp). Therefore, we propose treating Cecropterus (Thorybes) albosuffusa (H. Freeman, 1943), stat. nov.
and Cecropterus (Thorybes) indistinctus (Austin & J. Emmel, 1998), stat. nov. as species-level taxa, not
subspecies of C. pylades. Hence, no subspecies are recognized in the C. pylades species group.
Furthermore, three additional clades with strong genetic differentiation do not have names and represent
new species. These three new species are described below. Finally, we note that the speciation scenario in
the “crown” subgroup of the C. pylades group consisting of four USA species: Floridian, eastern, west-
coastal, and central (Fig. 27 red, green, cyan, and purple) parallels that of the Erynnis brizo (Boisduval &
Le Conte, [1837]) species group as laid out by Burns (2020).
Cecropterus (Thorybes) rockiensis Grishin, new species
http://zoobank.org/7CC2D85B-497D-4A81-9486-82434CCBE 143
(Figs. 27 part, 28, 29 part, 30k, 1)
Definition and diagnosis. Both the Z chromosome and the mitogenome trees reveal partitioning of
western US populations previously assigned to Cecropterus (Thorybes) pylades (Scudder, 1870) (type
locality in USA: Massachusetts) into two clades: Cecropterus (Thorybes) indistinctus (Austin & J.
Emmel, 1998), stat. nov. (type locality in the USA: California: San Diego Co., holotype sequenced as
NVG-17109A08) and a clade consisting of specimens from and around the Rocky Mountains region in
the US, not associated with any available names (Fig. 27 cyan and purple). The Fst/Gmin between the two
clades are 0.37/0.004, and their COI barcodes differ by 1.1% (7 bp). Therefore, the Rocky Mountains
clade represents a species-level taxon. This new species is generally similar in appearance to its closest
relative, C. indistinctus, in the following combination of characters: stronger checkered fringes (especially
on the forewing), ventral wing surface distally paler gray-brown, but not strongly overscaled with white,
on average smaller hyaline spots, and less rounded forewings; and differs from it by more prominently
checkered fringes, paler ground color, stronger expressed darker framing around (or in place of) hyaline
forewing spots, better defined ventral hindwing bands, typically larger hyaline spots and specimen size. In
male genitalia, uncus arms are thicker and not as widely separated as in C. (Thorybes) albosuffusa (H.
Freeman, 1943), stat. nov. (type locality USA: Texas, Ft. Davis), more angled than rounded at the base
between them; similar to C. pylades and C. indistinctus and differ from them by somewhat wider
Fig. 28. Holotype of Cecropterus (Thorybes) rockiensis sp. n. in dorsal (left) and ventral (right) views, data in text.
52
separation of uncus arms, rather parallel than
slightly converging distad and usually longer
compared to tegumen than in the other two
Species, a notch between ampulla and harpe is
typically shallower and wider, harpe is longer,
more upcurved. Definitive identification is
provided by DNA, and a combination of the
following characters is diagnostic in nuclear
genome: aly5196.9.2:C9I5T, aly536.8.1:C750T,
aly1259.10.2:A1122G, aly276561.5.1:G2469A,
x ry
aly5021.6.4:A1940G and in the COI barcode:
A217G, T460C, T596C, A637A. J ¥
Barcode sequence of the holotype: Sample ~) | \ 7
NVG-22099H03, GenBank OR578714, 658 a [ Ld
5 » fs ae floridianus
base pairs: \s \ y : ates
AACTTTATATTTTATTTTCGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAG SaaS ane : y
TTTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCA
AATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTCTTTATAGT
ATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCCCTTATACTAGG
GGCTCCTGACATAGCTTTTCCTCGTATAAATAATATAAGATTTTGATTATTACC L ., J @ - floridianus sp. 0.
TCCATCTTTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGAGCAGGTAC &, \ V aay \ ery @ - pylades
TGGATGAACTATTTACCCCCCTTTATCTTCTAATATTGCTCATCAAGGAGCTTC SN ae I ee (° > indistinctus stat. n.
AGTAGATTTAGCAATTTTTTCTTTACATCTTGCTGGAATTTCTTCAATTTTAGG ; ik Ye : , < AS : y, % j [0 - rockiensis sp. n.
AGCTATTAATTTTATTACAACTATTATCAATATACGAATTAATAATTTATCATT - at apa oes mi me _ Lv ¥ - albosuffusa stat. n.
TGATCAAATACCATTATTTATTTGAGCTGTTGGAATTACAGCTTTATTACTTTT » ent yy A- oaxacensis sp. Nn.
ACTTTCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAA oN -
CCTAAATACTTCATTTTTTGATCCAGCAGGTGGAGGAGATCCAATTTTATATCA Fig. 29. A map of Paitencedice specimens from the Cecropterus
ACATTTATTT
(Thorybes) pylades group. Different species are shown in different
Type ree Holotype: ¢ deposited 1 in the |symbols of different colors: C. floridianus sp. n. (larger red
California Academy of Sciences, San circles), C. pylades (smaller green circles), C. indistinctus stat.
: : aes: nov. (cyan diamonds), C. rockiensis sp. n. (purple squares), C.
Francisco, CA, USA [CAS], illustrated in Fig. albosuffusa stat. nov. (smaller dark blue downturned triangles),
28, bears six printed (other text but “COLO” |and C. oaxacensis sp. n. (larger orange upturned triangle) and
on the first label is handwritten) labels: five | labeled on the map near their type localities. Type localities for
white [ COLO. V-24-79 | Jefferson Co. | Clear |i names ae insted by fn cles placed inside cymbols,
Cr. Cyn. ], [Ray E. Stanford | collector |, | circle framed with the color of the taxon (for C. pylades only).
| Collection of | C.D.MacNeill ], [DNA
sample ID: | NVG-22099H03 | c/o Nick V. Grishin |, [| {QR Code} CASENT | 8566837 ], and one red
[| HOLOTYPE co | Cecropterus (Thorybes) | rockiensis Grishin ]. Paratypes: 20ch'ch 799: 19 Montana,
Yellowstone Co., Billings, 5-Jun-1948, Neil Euting leg. (NVG-22099H04, CASENT8566838) [CAS];
200 Nebraska, Sioux Co., Monroe Cyn., 6 mi. N of Harrison, 25-Jun-1983, S. M. Spomer leg. (NVG-
22064H01 & HO2); Utah: Salt Lake Co.: 1c Mill Creek Canyon, 28-Jun-1967, C. J. Callaghan leg.
(NVG-22099H07, CASENT8566841) [CAS]; Salt Lake, City Creek Canyon: Ico 15-Jun-1930, Lloyd M.
Martin leg. (NVG-22094A09) [LACM]; 1c 9-Jun-1946, L. I. Hewes leg. (NVG-22099H08, CASENT
8566842) [CAS]; Utah Co.: 1o& Provo Canyon, 14-Jun-1947, William A. Hammer leg. (NVG-22099G12,
CASENT8566834) [CAS]; lo Mt. Timpanogos, 5.6 mi W of Jct. Hwy 189 & 92 on 92, 22-Jul-1946, C.
D. MacNeill leg. (NVG-22099H09, CASENT8566843) [CAS]; 1c& Beaver Co., East Fork Baker Canyon,
SH153, Tushar Mts, N side of Beaver Canyon, larva collected on 1-Jul-2022, eclosed 7-Dec-2022, Todd
Stout leg. (NVG-22068D07); 12 Washington Co., 11-May-1977, D. F. Shillingburg leg. (NVG-
22099H06, CASENT8566840) [CAS]; 12 Zion National Park, 15-Jun-1928, T. Craig leg. (NVG-
22099H10, CASENT8566844) [CAS]; San Juan Co.: 12 La Sal Mts., Pack Creek day use area, 31-May-
2016, Robb Hannawacker leg. (NVG-20045E07); 1c Abajo Mts., Indian Creek trail, el. 6400'-7400'", 8-
May-2020, Robb Hannawacker leg. (NVG-20045E08); Colorado: 1¢& Garfield Co., Glenwood Cyn, el.
6200', 8-Jun-1977, Ray E. Stanford leg. (NVG-22099H02, CASENT8566836) [CAS]; 1c Eagle Co.,
Fryingpan River, 10-Jun-1976, Ray E. Stanford leg. (NVG-22099H05, CASENT8566839) [CAS];
Boulder Co.: 19 Lefthand Canyon, 16-May-1954, Donald Eff leg. (NVG-22099H01, CASENT8566835)
[CAS]; Io Flagstaff Mtn., 15-Jun-1953, Donald Eff leg. (NVG-22094A08) [LACM]; New Mexico: Il¢&
53
floridianus
PT
Le! 1 MM
floridianus °
HT
aa ~ a
pylades pylades pylades
pylades
indistinctus
Ke) 1mm
rockiensis
PT
rockiensis
PT
Fig. 30. Male genitalia of Cecropterus (Thorybes) pylades species group: a—d) C. floridianus sp. n. from USA, FL: a) NVG-
22101A01, paratype, genitalia slide J. W. T. 25-34, data in text [CAS]; b) holotype, data in text; c) and d) from genitalia slides
G11 and G14, respectively, by E. L. Bell, only valvae shown [AMNH]; e-i) C. pylades from USA: e-g) left valva in situ, N. V.
Grishin, leg.: e) TX, Wise Co., LBJ National Grassland, 4-May-2008 and f, g) OK: Murray Co., 5 mi S of Davis, 23-Apr-2008;
h) NVG-9288, AR, Montgomery Co., Ouachita National Forest, 6.5 air mi WNW of Oden, 6-Jul-2017, N. V. Grishin leg.; i)
NJ, from genitalia slide G13 by E. L. Bell, only valvae shown [AMNH]; j) C. indistinctus stat. nov., USA: CA, San Diego Co.,
El Cajon, 28-Apr-1934, Ray Hulbirt leg., genitalia slide J. W. T. 25-36 by J. W. Tilden [CAS]; k,l) C. rockiensis sp. n.
paratypes from USA: k) NVG-11465 from AZ: Apache Co. and 1) NVG-8970 from NM: Otero Co., data in text; m—o) C.
albosuffusa stat. nov.: m, n) Mexico [TMMC]: m) NVG-22056A08, Coahuila, Zaragosa, C. J. Durden leg., 11-Apr-1976,
genitalia vial NVG-22056A09 and n) NVG-22056A04, Nuevo Leon: Galeana, Cerro Potosi, C. J. Durden leg., 25-Jul-1981,
genitalia vial NVG-22056A05; 0) USA: AZ, Santa Rita Mts., 10-Jul-1941, J. W. Tilden leg. and genitalia slide J. W. T. 25-13
[CAS]; p) C. oaxacensis sp. n. holotype from Mexico: Oaxaca, data in text; q) C. drusius USA: AZ, from genitalia slide G47
by E. L. Bell, aedeagus (left) and valva (right) [AMNH]. Panels b, h, k, 1, n, p) show complete genitalia in dorsal (above) and
left lateral (below) views, and m) only left lateral view. Panels a, j, 0) assemble genitalia parts from slides to display aedeagus
(if detached, top left), detached valva (left), and the rest of the genital capsule in lateral view (right). All images are to scale.
Sandoval Co., Cibola National Forest, SH165 4.2 mi S of Placitas, GPS 35.2502, —106.4104, 14-May-
2017, Qian Cong, Jing Zhang & Nick V. Grishin leg. (NVG-8800); 1c 1¢ Lincoln Co.,1.5 mi E of
Capitan Gap Rd N water course, el.7000', 10-May-1981, J. McCaffrey leg. (NVG-15099H08 & H09)
[FMNH]; 2c’o Otero Co., Lincoln National Forest, La Luz Canyon Rd., 4.8 air mi NE of High Rolls, GPS
32.9992, —105.7759, 21-May-2017, Qian Cong, Jing Zhang & Nick V. Grishin leg. (NVG-8970, Fig. 301
54
& NVG-9057); Arizona: Coconino Co.: lo 19 S rim of Grand Cyn, 10-Jun-1942, J. S. Garth leg. (NVG-
22094A02 & A03) [LACM]; 1c Lockett Meadow, GPS 35.3605, —111.6208, 24-May-2021, Brian
Banker leg. (NVG-21089E12); 1c Apache Co., Greens Peak area, Pipeline Spring at Fsl17, GPS
34.1413, —109.5809, 25-May-2018, Jing Zhang & Nick V. Grishin leg. (NVG-11465, Fig. 30k); lo
Graham Co., Adam's Flat, GPS 32.6508, —109.8125, 23-Apr-2009, Mark Walker leg. (NVG-18037D 10).
Type locality. USA: Colorado, Jefferson Co., Clear Creek Canyon.
Etymology. The name is given for the general area of the distribution of this species, which is in and
around the Rocky Mountains (the Rockies), by fusing the Latin suffix -ensis (meaning “from place” or “of
place”) with the word “Rockies”. The name is a masculine adjective in the nominative case.
English name. Rocky Mountains Cloudywing.
Distribution. Across the Rocky Mountains and neighboring states: confirmed from Montana, Nebraska,
Utah, Colorado, New Mexico, and Arizona.
Cecropterus (Thorybes) floridianus Grishin, new species
http://zoobank. org/EA537AE1-E4FB-4C72-8615-D9BE2DE7336A
(Figs. 27 & 29 parts, 30a—d, 31)
Definition and diagnosis. Both the Z chromosome and the mitogenome trees reveal that eastern US
populations previously assigned to Cecropterus (Thorybes) pylades (Scudder, 1870) (type locality in
USA: Massachusetts) are not monophyletic, and populations from Florida form a clade sister to three
species combined (C. pylades, C. indistinctus, and C. rockiensis sp. n.) (Fig. 27). Genetic differentiation
between C. pylades and the Floridian populations is notable: Fs/Gmin between the two clades are
0.24/0.003 and the COI barcode difference is 2.3%—2.4% (15-16 bp). Therefore, the Floridian clade
represents a distinct species. This new species is similar in appearance to C. pylades in darker ground
color, weaker checkered fringes (especially on forewing), weaker developed marginal pale overscaling on
wings beneath, larger size, and rounder wings; and differs from it by darker appearance and generally
smaller hyaline spots. In the male genitalia, most similar to C. pylades, e.g., uncus arms slightly converge
distad, but valva is usually broader, the central bump on its costa is typically less pronounced (in lateral
view), harpe is relatively shorter, broader, and straighter, less angled along the ventral margin, and uncus
arms are usually shorter compared to tegumen (Fig. 30a—d). Definitive identification is provided by DNA
and a combination of the following characters is diagnostic in nuclear genome: aly1409.4.2:G1779A,
aly383.20.2:TI131A, aly3507.12.1:G3947C, aly383.21.1:A1654G, aly1409.4.2:A1477C and in COI barcode:
T9LA, T232C, T355C, T478C, T514A.
Barcode sequence of the holotype: Sample NVG-22032A09, GenBank OR578715, 658 base pairs:
AACTTTATATTTTATTTTCGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCATTAATTGGAGATGACCAAATTTATAATACT
ATTGTCACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTCTTATACTAGGAGCTCCTGATATAGCCTTTCCTCGTA
TAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGAGCAGGTACTGGATGAACTGTTTATCCCCCATTATCTTCCAATATTGC
TCACCAAGGAGCTTCAGTAGATTTAGCAATTTTTTCTTTACATCTTGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAACTTATCA
TTTGATCAAATACCATTATTTATTTGAGCAGTTGGAATTACAGCTTTATTACTTTTACTTTCACTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT
CATTTTTTGATCCAGCAGGTGGAGGAGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: co deposited in the National Museum of Natural History, Smithsonian
Institution, Washington, DC, USA [USNM], illustrated in Fig. 31, bears four printed labels: three white
| USA:FLA: Volusia Co. | New Smyrna Beach | 3 April 1969 | Leg. G. Rawson ], [ DNA sample ID: |
NVG-22032A09 | c/o Nick V. Grishin |, [| genitalia vial | NVG230917-01 | Nick V. Grishin |, and one red
[| HOLOTYPE o& | Cecropterus (Thorybes) | floridianus Grishin ]. Paratypes: 4¢'c 3992 from USA,
Florida: Io Franklin Co., USH98 0.4 mi. S of junction with Co. Rd. 370, 3 air mi N of Alligator Point,
GPS 29.9378, —84.3907, 29-Mar-1988, J. M. Burns leg., (NVG-22032A08) [USNM]; 1¢ Dixie Co., 16
km S Steinhatchee, end of Rt. 361, 4-Apr-1988, Scott W. Gross leg. (NVG-22032A07) [USNM]; Io
Levy Co., Cedar Key, 25-Jul-1963, C. J. Durden leg. (NVG-20062C06) [TMMC]; 19° Alachua Co.,
Gainesville, 20-Apr-1973, E. C. Knudson leg. (NVG-22032A10) [USNM]; 1c& Marion Co., Ocala
National Forest nr. Juniper Springs, 15-May-1988, Scott W. Gross leg. (NVG-22032A12) [USNM]; 1°
Volusia Co., New Smyrna Beach, G. W. Rawson leg. 10-Mar-1969 (NVG-22032A11) [USNM]; Ic
Martin Co., Port Sewall, 16-Mar-1939, genitalia 25-34 J. W. Tilden (NVG-22101A01, Fig. 30a) [CAS].
35
|
Fig. 31. Holotype of Cecropterus (Thorybes) floridianus sp. n. in dorsal (left) and ventral (right) views, data in text.
Type locality. USA: Florida, Volusia Co., New Smyrna Beach.
Etymology. The name for this Floridian species is formed by adding “-us” and is a masculine adjective.
English name. Florida Cloudywing.
Distribution. Confirmed only from the USA: Florida, but is likely to be found at least in Georgia.
Cecropterus (Thorybes) oaxacensis Grishin, new species
http://zoobank.org/5638F005-DC60-47A2-BB6F-6D9B0650F399
(Figs. 27 & 29 parts, 30p, 32, 33)
Definition and diagnosis. Inspection of genomic trees reveals that a single specimen from Mexico,
Oaxaca, initially identified by us as “Cecropterus albosuffusa” (curated with “Cecropterus drusius” in the
collection), is not placed among Cecropterus (Thorybes) albosuffusa (H. Freeman, 1943) (type locality
USA: Texas, Ft. Davis) specimens we sequenced from across the range (Fig. 27). This specimen is sister
to all analyzed C. albosuffusa, some from Puebla and DF in Mexico. This consistent placement of the
specimen in the trees constructed from protein-coding regions in autosomes, Z chromosome, and
mitochondrial genome, where all sequenced C. albosuffusa specimens across the range from Arizona and
Texas to Pueblo cluster closely together, and its distinction in the COI barcode of 1.2% (8 bp, while C.
albosuffusa did not show variation in the barcode) suggest that it represents a distinct species. This new
Species is diagnosed by white hindwing fringe from vein M2 to tornus, similar to Cecropterus (Thorybes)
drusius (W. H. Edwards, [1884]) (type locality in southern Arizona) but has C. albosuffusa-like genitalia
with rounded (Fig. 30p), not claw-shaped (Fig. 30q) harpe, rounder hindwings in males (in C. drusius
males, hindwings are slightly extended at tornus, almost lobed), broad paler “frosty” submarginal area on
ventral hindwing, which C. drusius typically lacks (some specimens with narrower pale overscaling), and
broader forewing subapical spots in a straight line, each spot is nearly square. In male genitalia (Fig. 30p),
it is most similar to C. albosuffusa (Fig. 30m—o) but differs in thicker and shorter relative to tegumen
uncus arms, broader and more rounded in lateral view tegumen, and broader, rounder and more upturned
harpe. In DNA, a combination of the following characters is diagnostic in nuclear genome: aly638.13.2:
A120C, aly638.13.2:C165T, aly4592.3.6:T120C, aly4592.3.6:AIS9T, aly727.34.3:C417T, aly596.8.8:G120G
(not A), aly596.8.8:G618G (not A), aly767.17.3:A273A (not G), aly767.17.3:T941T (not G), aly1432.13.4:
C50C (not T) and COI barcode: A181G, A421A, T574C, C595C, T604C.
Barcode sequence of the holotype: Sample NVG-19125B09, GenBank OR578716, 658 base pairs:
AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGTTTACTTATTCGAACTGAAT TAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT
ATTGTCACAGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGGGGATTTGGAAATTGATTAATTCCTCTTATATTAGGAGCTCCTGATATAGCTTTTCCTCGTA
TAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTCTTTTAATT TCAAGAAGTATT GTT GAAAACGGAGCAGGTACTGGATGAACTGTTTATCCCCCTTTATCTTCTAATATTGC
TCATCAAGGAGCTTCAGTAGATTTAGCAATTTTTTCTTTACATCTTGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACTATTAT TAATATACGAATTAATAATTTATCA
TTTGATCAAATACCATTATTTATTTGAGCTGTTGGAAT TACAGCCTTATTACTTTTACTTTCATTACCTGTTTTAGCTGGAGCTATTACCATATTATTAACTGATCGAAACTTAAATACCT
CATTTTTTGATCCTGCAGGTGGAGGAGATCCTATTTTATATCAACATTTATTT
56
rg
YN es X & “heed oi 5 ‘ W pas
YN, wots ie SAN Mae NES me lek io! Ly 7 Made ae lis, el 9
Fig. 33. Cecropterus (Thorybes) oaxacensis sp. n. female, iNaturalist observation 110602850 from Mexico: Oaxaca, San Miguel
Tequixtepec, 17-Jun-2014, © John Kemner; photographs show the same individual. Images are color-corrected, and the rightmost is rotated approximately 90°
clockwise. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/
sa eh
Type material. Holotype: & deposited in the University of Texas Biodiversity Center collection, Austin,
TX, USA [TMMC], illustrated in Fig. 32, bears four printed labels: three white [ OA.Tlalixtac.002 | 5 mi
N Oaxaca | KemnerJ 88138A02 |, [ DNA sample ID: | NVG-19125B09 | c/o Nick V. Grishin |], [ DNA
sample ID: | NVG-22056A03 | c/o Nick V. Grishin ], and one red [ HOLOTYPE co | Cecropterus (Thorybes)
| oaxacensis Grishin ], collected by John Kemner on 17-May-1988 (1.e., “88138”: day 138 of 1988).
Type locality. Mexico: Oaxaca, Tlalixtac de Cabrera, Hwy 175, ca. 5 mi north of Oaxaca City.
Etymology. The name is given for the type locality and is a masculine adjective in the nominative case.
English name. Oaxaca Cloudywing.
Distribution. Known only from Mexico: Oaxaca. Specimens from phenotypically similar (but mostly
darker-fringed) populations to the north (e.g., Puebla and Ciudad de México) are Cecropterus (Thorybes)
albosuffusa (H. Freeman, 1943) as identified by genomic sequencing (Fig. 27).
Telemiades solon P\6tz, 1882 is a junior subjective synonym
of Nascus (Bron) broteas (Cramer, 1780)
The name Jelemiades solon Pl6tz, 1882 (type locality in South America), currently applied to a valid
species of Nascus Watson, 1893 (type species Papilio phocus Cramer, 1777), was proposed in a key with
a specimen number 4874 in Berlin collection (MFNB) mentioned and the drawing “t. 154” referenced
57
(Plétz 1882). Neither the specimen nor the illustration or its copy could be found. Godman (1907) skipped
the numbers t. 149 to t. 159 in his analysis of unpublished illustrations of American Hesperiidae by Plotz,
and none of these drawings were copied. The fate of the original Pl6tz’s illustrations is still unknown
(Zhang et al. 2023d). A search of the Hesperiidae holdings in MFNB did not yield the specimen with the
number 4874. However, the catalog of the old Hesperiidae collection in MFNB handwritten by Hopffer
(Zhang et al. 2023d) has a record for No. 4874: two specimens collected in “Rio” [Brazil: Rio de Janeiro].
Initially, they were listed as “sp.” (1.e., unidentified), but subsequently, “sp.” was crossed out, and
“Pherenice Hew.” was written instead. Eudamus pherenice Hewitson, 1867 (type locality in Brazil) is
currently regarded as a junior subjective synonym of Nascus (Nascus) phocus (type locality in Suriname).
Thus, the appearance of these two specimens No. 4874 was likely that of Nascus, even if they were
misidentified by Hopffer (1.e., they were not pherenice but some other similar species), and thus, if they
were 7. solon, consistent with the placement of 7. solon in Plétz’s key among species currently in Nascus.
Therefore, it is possible that the specimen(s) referred to by Plétz as “4874” was (were) listed in the
Hopffer catalog for that entry and collected in Southeast Brazil (Rio de Janeiro), a detail not given in the
original description of 7. solon.
Evans (1952) applied the name “Nascus solon” to an Amazonian species not known from
Southeast Brazil. This discrepancy found after an inspection of the Berlin collection catalog prompted us
to study the original description of 7. solon more closely. We concluded that Evans misidentified 7. solon
because the species Evans identified as “N. solon” does not agree with the original description of 7. solon.
Most significantly, Plétz mentions a brown “hair pencil” (a tuft of long hair-like scales) at the base of cell
1° fice., LA+2A-3A] on ventral hindwing in 7. so/on, but this tuft is pale, mostly yellow, in Evans’ “N.
solon.” Then, in T. solon, pale spots in the middle of the forewing are close together and “only separated
by veins” (Pl6tz 1882); but in “NV. solon”, the spot in cell M3-CuA; does not reach the cell origin, which is
filled with the ground color (yellow-brown) for at least half of the width of the pale spot in cell CuAi-
CuA2 along vein CuA}. Furthermore, in 7. solon, the hyaline spot in forewing cell Mi-Mb is small, a pale
spot by the costa in the middle of the forewing is mentioned only as “beneath, costal margin is also
spotted with pale’, and the ventral hindwing is with brown “crossbar in cell 7 [Sc+Ri-RS] and in the
discal cell”. In contrast, in “N. solon’, the spot in the forewing cell Mi-Mp is nearly the same size as the
spot in the cell Rs-Mj, forewing is with a well-developed hyaline spot by mid-costa, which is seen from
the dorsal side as well (hyaline!), hindwing is with weakly developed or missing cental brown spot in the
discal cell, and the spot in the cell Sct+Ri-RS is small, not a “crossbar”. Therefore, Evans’ “N. solon” is
not conspecific with the true 7. solon.
Next, we searched for specimens that agree with the original description of 7. solon. The specimen
we found to match the description closely was No. 4865 in MFNB. This specimen was previously curated
as a type of Netrocoryne seneca Plotz, 1882 (type locality Brazil) because No. 4865 was mentioned by
Pl6tz (1882) in the original description of N. seneca. However, this specimen is a pseudotype because it
agrees neither with the original description nor with a copy of Pl6étz’s unpublished illustration of N.
seneca (Zhang et al. 2023d). It is possible that due to some mistakes in referencing the MFNB specimen
numbers, this specimen No. 4865 was instead (or in addition) a syntype of 7. solon. However, we do not
have defendable evidence to support this hypothesis. Therefore, we proceeded with the neotype
designation because there is an exceptional need to clarify both the taxonomic identity and the type
locality of 7. solon. This taxon has been misidentified by Evans (1952), who applied this name to a
species that does not agree with the original description of 7. solon. This mistake creates inconsistencies
in the literature and the potential for further destabilization of nomenclature due to the existence of
additional species in this group unless the name T. solon is objectively defined by the neotype. Therefore,
N.V.G. designates the specimen No. 4865 in MFNB illustrated in Fig. la—c in Zhang et al. (2023d) (DNA
sample NVG-15031F11) as the neotype of Telemiades solon Plétz, 1882.
Our neotype of 7. solon satisfies all requirements set forth by the ICZN Article 75.3, namely:
75.3.1. It is designated to clarify the taxonomic identity of Telemiades solon Pl6tz, 1882, which has been
misinterpreted and attributed to a different species that does not agree with the original description of T.
solon, and to detail its type locality that was given only generally (as “South America”) in the original
58
description; 75.3.2. The characters to differentiate this taxon from others were specified by Pl6tz (1882),
and we regard them as follows: forewing with a hyaline spot in cell CuA2-1A+2A, hyaline spots in the
middle of the forewing are crowded together and separated only by veins, hyaline spots in cells Mi-Mo2
and M>-Ms3 are small, and the former is merged with the apical spots that together form an oval-shaped
hyaline patch separated by veins, a hyaline spot in cell R2-R3 is merged with this patch and not offset
basad, the hyaline spot is absent by the costal margin near its middle, but the costal margin with a pale
spot in the middle beneath; ground color of wings olive-brown, the base of ventral hindwing and most of
ventral hindwing are clay-yellow, ventral hindwing with brown crossbars in cell Sct+Ri-RS and the discal
cell, and, in addition to the broadly brown outer margin area, with a postdiscal brown band and a brown
tuft of hair-like scales at the base of cell 1A+2A-3A; 75.3.3. The neotype specimen is a male bearing
eight labels (1t red, 3 bluish-greenish, the last orange, and others white): [ typus ], [ 4865 ], [ Bahia
Sello |, [ GEN.PREP., | MIELKE | 1996 ], | seneca | PI. | type |, [ DNA sample ID: | NVG-15031F11 | c/o
Nick V. Grishin ], [ {QR Code} http://coll.mfn-berlin.de/u/ | 940b3c |], [ not a type specimen of |
Netrocoryne seneca | Pl6tz, 1882 | determined by Zhang, | Cong et al. 2023 | and illustrated in Fig. la—c
(without the last label, which was added later) in Zhang et al. (2023d); the neotype has a chipped off
tornus on both hindwings; 75.3.4. We searched for syntypes of 7. solon in the MFNB collection because
the original description specified specimen(s) with the number 4874 in Berlin. While there was an entry in
the old collection catalog with No. 4874 listing two specimens, we could not find them among
Hesperiidae holdings, and therefore, we believe that syntypes were lost; 75.3.5. The neotype closely
agrees with the original description of 7. so/on in all (but one) characters, as evidenced by comparing the
neotype illustrated in Fig. la—-c in Zhang et al. (2023d) with the characters for this taxon given in the
original description (Pl6tz 1882) and listed above (75.3.2.); the only discrepancy is that palpi are nearly
white beneath, not clay-yellow (could have been discolored) as stated by Pl6tz (1882); 75.3.6. The
neotype is from Brazil: Bahia, which is within the original type locality given as “South America”; 75.3.7.
The neotype is in the collection of the Museum fiir Naturkunde, Berlin, Germany (MFNB).
Genomic sequencing confirms the phenotypic assessment of the 7. solon neotype as a specimen of
Nascus (Bron) broteas (Cramer, 1780) (type locality in Suriname) (Zhang et al. 2023d) because it groups
with specimens of the latter species in the tree (Fig. 34). Notably, Draudt (1922) has already placed 7.
solon within his Nascus cous (Méschler, 1879) (listing Nascus eugamon Godman & Salvin, 1893 as a
synonym of the latter), and expressed an opinion that these may be males of N. broteas, which was then
known only by females. Therefore, as a result of the neotype designation, Te/emiades solon Plétz, 1882,
Syn. nov. becomes a junior subjective synonym of Nascus (Bron) broteas (Cramer, 1780). The COI
barcode eee of 7. solon neotype, sample NVG-15031F11, GenBank OR578717, 658 base pairs, is:
AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCTCTTAGATTACTAATTCGAACT GAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACT
ATCGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATT GATTAGTACCTCTTATACTAGGAGCTCCTGATATAGCATTTCCACGAA
TAAATAACATAAGATTTTGATTATTACCTCCATCATTAACATTATTAATTTCAAGAAGAATTGTCGAAAATGGTGCTGGTACTGGATGAACAGTTTACCCCCCTT TATCAGCAAATATTGC
TCACCAAGGTTCTTCCGTAGATTTAGCAATCTTTTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCT
TTTGATCAAATACCATTATTTATTTGAGCTGTAGGAAT TACAGCATTATTATTACTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT
CTTTCTTTGACCCAGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
Nascus (Bron) corilla Evans, 1952 is a species-level taxon
Nascus solon corilla Evans, 1952 (type locality in Venezuela) was proposed as a subspecies of a species
Nascus corilla]17104F06|05-SRNP-55005|Costa Rica|2005
= Nascus corilla}17103E03|Panama|1969
Nascus corilla|18054A11|Colombia|1924
100 Nascus lux [not solon]|17103E04|PT|Peru|1994
: Nascus lux [not solon]|17103G06|PT|Brazil:RO|1994
Nascus lux [not solon]|18088H10|PT|Brazil:AM|2007
Nascus lux [not solon]|21012D07|HT|Brazil:AP|1918
aa0 Nascus lux [not solon]|18098E10|H3956|PT|French Guiana|1992
Nascus broteas|22018C05|Suriname|old
Nascus broteas|18088H11|Brazil:PA|2009
Nascus broteas|17103E05|Brazil:PA|1981
3 Nascus broteas (=cous)|15031G05|ST|Colombia|1876
i op Nascus broteas|22018C04|Suriname|old
Nascus broteas (=solon)|15031F11|NT|Brazil:BA|old
Nascus broteas|17103E06|Brazil:RJ|old
Nascus broteas|17103G05|Argentina|1999
Nascus prax|18098E12|H11686|French Guiana|1996
0.006 28
10)
Fig. 34. The phylogenetic tree of Nascus (Bron) inferred from nuclear genome protein-coding regions (autosomes): N. (B.)
corilla stat. nov. (blue), N. (B.) /ux sp. n. (red), and N. (B.) broteas (black). Primary type specimens are labeled in magenta.
59
that Evans misidentified as “N. solon”. We argue above that the true Telemiades solon Plotz, 1882 (type
locality in Brazil: Bahia) is conspecific with Nascus broteas (Cramer, 1780) (type locality in Suriname).
Because a species that Evans considered to be “N. so/on” is distinct from N. broteas, it is not conspecific
with the true 7. solon and should not be identified by this name. Because no other available name applies
to Evans’ “N. solon”, Nascus corilla Evans, 1952, stat. nov. becomes a species-level taxon.
Nascus (Bron) lux Grishin, new species
http://zoobank. org/4B4097CE-A43 D-4A BB-A5E5-lEAE4FD5C049
(Figs. 34 part, 35)
Definition and diagnosis. Inspection of genomic trees reveals that Amazonian populations, which Evans
(1952) considered to be conspecific with Nascus corilla Evans, 1952, stat. nov. (type locality in
Venezuela) and misidentified as Telemiades solon Plétz, 1882 (type locality in Brazil: Bahia) as
determined above, are genetically differentiated from N. corilla with Fst/Gmin of 0.48/0.003 (although their
COI barcodes do not reveal differences but in | or 2 base pairs) and therefore represent a distinct species
(Fig. 34). This species does not have a name. This new species keys to “Nascus solon solon” D.5.3(b) in
Evans (1952) and is distinguished from its closest relative, N. corilla, stat. nov. (see above), by pale-
yellow to orange-yellow patches of scales, variable in their expression, dividing the brown outer marginal
area on the ventral hindwing (that is solid dark brown in N. corilla) into narrow postdiscal and broad
submarginal bands in males, and usually having five (not four) subapical hyaline spots in females; and
from other species of Nascus by the following combination of characters: forewing apical spot in cell Ro-
R3 is in line with others, not offset basad; yellow or pale brown tuft of long scales at the base of cell
1A+2A-3A on ventral hindwing; palpi beneath and cheeks are white; prominent hyaline spot in the
middle of forewing by costal margin in males; forewing typically larger than 28 mm in males and 30 mm
in females. A combination of the following nuclear genomic characters is diagnostic: aly525.35.1:C54T,
aly214.21.1:C303T, aly214.21.1:G312A, aly26.5.3:C294T, aly50.27.2:A51G.
Fig. 35. Holotype of Nascus /ux sp. n. in dorsal (left) and ventral (right) views, data in text.
Barcode sequence of the holotype: Sample NVG-21012D07, GenBank OR578718, 658 base pairs:
AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCTCTTAGATTATTAATTCGAACTGAATTAGGCACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACA
ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGACTAGTACCTCTTATATTAGGAGCTCCTGATATAGCATTTCCACGAA
TAAATAATATAAGATTTTGATTATTACCTCCATCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGTACTGGTTGAACAGTTTACCCCCCTTTATCAGCAAATATTGC
TCACCAAGGATCTTCTGTAGATTTAGCAATTTTTTCATTACATTTAGCAGGAATTTCCTCAATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCT
TTTGATCAAATACCATTATTTATTTGAGCTGTAGGTATTACAGCTTTATTATTATTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT
CTETTTTTGATCCTCCAGGAGGAGGTGATCCAATICTTTATCAACATTTATT?T
Type material. Holotype: ¢& deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA
[CMNH], illustrated in Fig. 35, bears four printed (last two digits of the year handwritten) labels: three
60
white | Uassa Island, | Uassa Swamp. | S. M. Klages, C. M. Acc. 6176 ], [ May | 1918 ], [ DNA sample
ID: | NVG-21012D07 | c/o Nick V. Grishin ], and one red [HOLOTYPE oc | Nascus (Bron) | lux
Grishin |. Paratypes: 4c’c’, one from each locality Peru: Huanuco, Tingo Maria, 800m, May-Jun-1994,
genitalia X-5174 J. M. Burns 2002 (NVG-17103E04, USNMENT00913776); Brazil: Rond6nia, 62 km S
Ariquemes, Fazenda Rancho Grande, elevation 165m, GPS —10.53, —63.80, 27-Aug-8-Sep-1994, Ron
Leuschner leg. (NVG-17103G06, USNMENT00913805); Amazonas, Maues, Rio Preto, 15-25-Nov-2007
(NVG-18088H10); and French Guiana: Roura, Coralie, GPS 4.5083, —52.3750, L. Sénécaux & A.
Docquin leg. 24-Jul-1992 (NVG-18098E10, H3956).
Type locality. Brazil: Amapa, Rio Uaca region (“Uassa Swamp”), which is by the border between Brazil
and French Guyana.
Etymology. In Latin, /ux means “light” and refers to the lighter (i.e., paler) overall appearance of this
sunny species, light—instead of brown—tuft of scales on the hindwing (a beam of light), and a sprinkle of
light scales between the postdiscal and submarginal brown bands on the ventral hindwing (a phenotypic
character that typically separates this species from its closest relative). The name is a noun in apposition.
Distribution. Generally, in and around the Amazonian region in South America. This species has been
recorded from French Guiana, Peru, Ecuador, and Brazil (Amapa, Amazonas, Rondonia).
Comment. This name is proposed for Evans’ concept of “Nascus solon solon” (Evans misidentified
Telemiades solon Plotz, 1882), and due to genetic differentiation, the two taxa Evans considered to be
subspecies: “Nascus solon corilla” and “Nascus solon solon” are distinct species: Nascus corilla and
Nascus lux sp. n., respectively.
Cogia hiska Evans, 1953 (with its subspecies Cogia hippalus hester Evans, 1953) is a
species distinct from Cogia hippalus (W. H. Edwards, 1882)
Genomic sequencing of Cogia hippalus (W. H. Edwards, 1882) (type locality USA: AZ, Pima Co.
Tucson, lectotype sequenced as NVG-15101B12) specimens across the range reveals their partitioning
into two clades with genetic differentiation at the species level: Fs/Gmin and COI barcode difference of
0.49/0.004/2.9% (19 bp) (Fig. 36). Therefore, the two clades represent two distinct species. One clade
contains specimens from the northwestern part of the range northeast to South Texas, USA, and south to
Oaxaca, Mexico: the nominotypical C. hippalus and its close relative Cogia hippalus peninsularis L.
Miller & MacNeill, 1969 (type locality Mexico: Baja California Sur, Arroyo San Bartolo, holotype
sequenced as NVG-15095C07). The other clade consists of specimens from the southeastern part of the
range from Mexico: Tamaulipas to Venezuela: Cogia hippalus hiska Evans, 1953 (type locality Costa
Rica: Puerto Carrillo) and Cogia hippalus hester Evans, 1953 (type locality Venezuela: Merida). Our
methods of analysis do not find species-level genetic differences between C. h. hiska and C. h. hester. The
names hiska and hester were proposed in the same work issued on the same date. As the first revisers, we
a ri Cogia outis|12408|USA:OK,Cleveland Co.|2019
3 Cogia outis]17116A05|USA:TX,Cooke Co.|1973
700 Cogia outis]15095E10|ST|USA:TX,Blanco Co.|old
z Cogia outis|18116B07|ST|USA:TX,Blanco Co.|1895
Cogia outis|19014A11|USA:TX,Uvalde Co.|1968
Cogia hippalus hippalus|17113D07|Mexico:Son|1987
Cogia hippalus hippalus|15101B12|LT|USA:AZ,Pima Co.|old
Cogia hippalus hippalus|19014A10|USA:TX,Hidalgo Co.|1974
Cogia hippalus hippalus|20059G05|USA:TX,Starr Co.|2007
b Cogia outis|17116A05|USA:TX,Cooke Co.|1973
€ogia outis]15095E10|ST|USA:TX, Blanco Co.|old
Cogia outis]19014A11|USA:TX,Uvalde Co.|1968
Gogia outis]12408|USA:OK,Cleveland Co.|2019
Cogia outis|18116B07|ST|USA:TX,Blanco Co.|1895
Cogia hippalus hippalus|]19014A10|USA:TX,Hidalgo Co.|1974
iGogia hippalus hippalus|15101B12|LT|USA:AZ,Pima Co.|old
Cogia hippalus hippalus|19124H08|Mexico:Oax|1988
gia hippalus hippalus|17113D07|Mexico:Son|1987
100
y Cogia hippalus hippalus|19124H08|Mexico:Oax|1988 g@ogia hippalus hippalus|17113D06|Mexico:Son|1987
i 7a Cogia hippalus hippalus|17113D06|Mexico:Son|1987 o€ogia hippalus hippalus|20059G05|USA:TX, Starr Co.|2007
Cogia hippalus hippalus|22064F06|USA:NM,Eddy Co.|2014 Cogia hippalus hippalus|22064F06|USA:NM, Eddy Co.|2014
2 ie Cogia hippalus peninsularis|15095C07|HT|Mexico:BCS|1961 "Cogia hippalus peninsularis|15095C07|HT|Mexico:BCS|1961
a Cogia hippalus peninsularis|18028B06|Mexico:BCS|1978 9 ogia hippalus peninsularis|18028B07|Mexico:BCS|1979
60 oa Cogia hippalus peninsularis|18028B07|Mexico:BCS|1979 feogia hippalus peninsularis|20124D01|PT|Mexico:BCS|1961
Cogia hippalus peninsularis|20124D01|PT|Mexico:BCS|1961 Cogia hippalus peninsularis|18028B06|Mexico:BCS|1978
Cogia hiska hiska [not hippalus]|19014A12|Mexico:Tam|1975 Go9gia hiska hiska [not hippalus]|19092G04|03-SRNP-101|C.Rica
a Cogia hiska hiska [not hippalus]|17111F06|Mexico:SLP|1981 Cogia hiska hiska [not hippalus]|19092G03|06-SRNP-12193/C.R
3 Cogia hiska hiska [not hippalus]|17111F05|Mexico:Hid|1981 Cogia hiska hiska [not hippalus]|19014A12|Mexico:Tam|1975
é Cogia hiska hiska [not hippalus]|17111F07|Mexico:Hid|1982 o§s0gia hiska hiska [not hippalus]|19124H0O7|Mexico:SLP|1987
Cogia hiska hiska [not hippalus]|19124HO7|Mexico:SLP|1987 Gogia hiska hiska [not hippalus]]17111F07|Mexico:Hid|1982
ip0,,— Cogia hiska hiska [not hippalus]|19092G03|06-SRNP-12193|Costa Rica @ogia hiska hiska [not hippalus]]17111F06|Mexico:SLP|1981
Cogia hiska hiska [not hippalus]|19092G04|03-SRNP-101|Costa Rica 7€0gia hiska hiska [not hippalus]|17111F05|Mexico:Hid|1981
oe e Cogia hiska hester [not hippalus]|15105B11|Colombia|1952 s¢ogia hiska hester [not hippalus]|15105B11|Colombia|1952
Cogia hiska hester [not hippalus]|22018C10|Venezuela|old Cogia hiska hester [not hippalus]|22018C10|Venezuelalold
Fig. 36. Phylogenetic trees of selected Cogia inferred from protein-coding regions of a) the nuclear (autosomes) and b) the
mitochondrial genomes. Different species are shown in different colors: C. hippalus (blue with its subspecies C. h. peninsularis
labeled in violet), C. hiska (red, with its subspecies C. h. hester labeled in magenta), and C. outis (black).
61
give precedence to hiska due to its larger distribution. Thus, we propose that Cogia hiska Evans, 1953,
stat. nov. is a species and Cogia hiska hester Evans, 1953, comb. nov. is its subspecies.
Lectotype designation for Eudamus caicus Herrich-Schiaffer, 1869
with the type locality likely in Mexico: Oaxaca
Eudamus caicus Herrich-Schaffer, 1869 (type locality Tropical America, possibly into southern USA),
currently a valid species in the genus Cogia Butler, 1870 (type species Cogia hassan Butler, 1870) was
described from an unstated number of specimens without details about their localities (Herrich-Schaffer
1869). One specimen without a locality label is curated in the MFNB collection as a syntype of E. caicus.
We determine that this specimen is indeed a syntype because it agrees with the original description and
matches closely in wing patterns a specimen BMNH(E) 1236437 (a male, in BMNH) that Godman
selected as the most similar in his collection to the unpublished drawing by Plétz of Eudamus schaefferi
Pl6tz, 1881 (a replacement name for EF. caicus Herrich-Schaffer, 1869, erroneously deemed preoccupied),
and labeled as “Compared with | Plotz’s drawing of | schaefferi, | Pl6tz | caicus, | HS.” Godman placed
such similar-styled labels on specimens that, in his opinion, closely resembled the originals of Pl6tz’s
drawings that he inspected (Godman 1907), and we use this specimen as a “proxy” for the drawing. We
note that E. schaefferi (Plotz’s t[afel]. 129, which is E. caicus H.-S.) was not mentioned in Godman’s
publication (1907), which might be because that work dealt with American species, but the locality for E.
schaefferi was not explicitly stated in the original description and, due to the lack of locality labels on the
syntype, likely not appearing on the Plétz’s drawing numbered 129. This Godman’s specimen from “N.
Sonora, | Mexico” is actually Cogia caicus moschus (W. H. Edwards, 1882), but is similar in wing pattern
to the nominotypical C. caicus; its photographs are shown on the Butterflies of America website (Warren
et al. 2023). To stabilize nomenclature, N.V.G. hereby designates the syntype in the MFNB collection, a
female with the following seven printed labels, the 1° purple and others white: [ Origin ], [ Coll. H—
Sch. |, [| Daunus Cr. |, [| Caicus | HS. | Achlyodes ], [ Caicus | H-Sch. ], [ {QR Code} http://coll.mfn-
berlin.de/u/ | 940b5d |, and [ DNA sample ID: | NVG-15032A02 | c/o Nick V. Grishin | as the lectotype of
Eudamus caicus Herrich-Schaffer, 1869. Genomic trees place the lectotype among specimens from
Mexico, Oaxaca (Fig. 37), suggesting that it was collected there because it is genetically within this
metapopulation. Therefore, we infer that the type locality of Cogia caicus (Herrich-Schaffer, 1869) may
be in Oaxaca and will test this hypothesis further by sequencing specimens from other localities.
Cogia moschus|15097HO6|LT|AZ,Graham Co. fg
Cogia moschus|10881|USA:AZ,Pinal Co.|2018
Cogia moschus|18033E12|Mexico:Son|2010
= Cogia moschus|15097HO6|LT|AZ,Graham Co. © gg Ogia moschus|15097HO6|LT
Too Cogia moschus|10881|USA:AZ,Pinal Co.|2018 g@ogia moschus|10881|USA:AZ
Cogia moschus|18033E12|Mexico:Son|2010 Cogia moschus|18033E12|Mex
C. caicus|15032A02|LT|no datalold C. caicus|15032A02|LT|no datalold Go Caicus|15032A02|LT|
Cogia caicus|22079A03|Mexico:0ax|1989 Cogia caicus|17113D04|Mexico:Oax|1988 100 fg0gia caicus|22079A03|Mex
Cogia caicus|20062G07|Mexico:Oax|1988 Cogia caicus|20062G07|Mexico:0ax|1988 9sCogia caicus|20062G07|Mex
Cogia caicus|17113D04|Mexico:O0ax|1988 Cogia caicus|22079A03|Mexico:0ax|1989 Cogia caicus|17113D04|Mex
Cogia chiagua|19124HO5|PT|Mexico:Chia|1987 Cogia chiagua|19124HO5|PT|Mexico:Chia|1987 Gogia chiagua|19124HO5|PT
Cogia chiagua|22079A01|HT|Guatemala|1993 Cogia chiagua|22079A01|HT|Guatemala|1993 {gogia chiagua|22079A01|HT
0.002 Cogia chiagua|17109FO9|PT|Guatemala|1968 — 0.003 Cogia chiagua|17109FO9|PT|Guatemala|1968 001 ~ Cogia chiagua|17109FO9|PT
Fig. 37. Phylogenetic trees of selected Cogia species inferred from protein-coding regions of a) the nuclear genome
(autosomes), b) the Z chromosome, and c) the mitochondrial genome. Different species are shown in different colors: C.
moschus stat. rest. (blue), C. caicus (green), and C. chiagua sp. n. (red). Primary type specimens are labeled in magenta.
Cogia moschus (W. H. Edwards, 1882) is a species distinct
from Cogia caicus (Herrich-Schaffer, 1869)
We find the genetic differentiation between Cogia caicus (Herrich-Schaffer, 1869) (type locality likely in
Mexico: Oaxaca, as deduced above, lectotype sequenced as NVG-15032A02, in MFNB) and Cogia caicus
moschus (W. H. Edwards, 1882) (type locality in USA: AZ, Graham Co., lectotype sequenced as NVG-
15097H06, in CMNH) to be of a magnitude suggestive of distinct species: Fst/Gmin/COI differences are
0.50/0.003/0.9% (6 bp) (Fig. 37). Therefore, we propose that Cogia moschus (W. H. Edwards, 1882),
stat. rest. is a species-level taxon.
62
Cogia chiagua Grishin, new species
http://zoobank. org/OOE80EF8-25B0-4A36-97FC-E6157CD96DE5
(Figs. 37 part, 38, 39a)
1cm
Fig. 38. Holotype of Cogia chiagua sp. n. in dorsal (left) and ventral (right) views, data in text.
Definition and diagnosis. In addition to Cogia moschus (W. H.
Edwards, 1882) (type locality in USA: AZ, Graham Co.) and
Cogia caicus (Herrich-Schaffer, 1869) (type locality likely in
Mexico: Oaxaca), genomic trees reveal a third lineage of similar
genetic differentiation (Fig. 37 red) with Fst/Gmin/COI differences
from the former and the latter, respectively: 0.49/0.009/0.9% (6 bp)
and 0.4/0.006/0.5% (3 bp) that represents a species. This new
species differs from its two close relatives by being darker overall,
smaller (or lacking) hyaline spots, and darker palpi beneath. Male
genitalia are variable, but the harpe typically is broader, rounder,
and dorsally with more robust teeth on a shorter ridge near the
ampulla; aedeagus with a smaller number of cornuti (Fig. 39). A
combination of the following characters in the COI barcode is
diagnostic: A40A, C343C, T349T, T386T, A481G, T556A.
Barcode sequence of the holotype: Sample NVG-22079A01,
GenBank OR578719, 658 base pairs:
AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTTTAAGTTTATTAATTCGTACTGAATTAG
GAACTCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTT
TTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCCTTAATATTAGGAGCTCCTGATATAGC
TTTTCCTCGTATAAATAATATAAGATTTTGATTACTTCCCCCATCATTAACATTATTAATTTCTAGAAGTATTGTAG
AAAATGGTGCTGGTACTGGATGAACAGTATATCCCCCCCTTTCATCAAATATTGCACATCAAGGTTCATCAGTAGAT
TTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCATCTATTTTAGGTGCTATTAATTTTATTACTACAATTATTAA
AT’
TATACGAATTAGAAATTTGTCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACAGCTTTATTACTTT
TACTTTCTTTACCTGTATTAGCTGGTGCTATTACTATACTTTTAACAGAT CGAAATCTTAATACATCATTTTTTGAT
CCT GCTGGAGGAGGAGACCCTATTTTATATCAACATTTATTT
Type material. Holotype: & deposited in the McGuire Center for re a
Lepidoptera and Biodiversity, Gainesville, FL, USA [MGCL], ~ b
illustrated in Fig. 38, bears five printed labels: four white | Fig. 39. Male genitalia of Cogia in lateral
| Antigua, Sacatepequez | Guatemala | September 16, 1993 | 180°) a pg amines ee
D.L.Lindsley ], [ Cogia Butler | caicus (Herrich-Schaffer) | caicus | mini-slide 153, data in text. b) Gomis
(Herrich-Schaffer) |, [ D.L. Lindsley colln. | MGCL Accession | # | stat. rest., Mexico: N Sonora, Morrison
2008-20 ], [DNA sample ID: | NVG-22079A0I | c/o Nick V. neh ee aS eae,
Grishin ], and one red [ HOLOTYPE o@ | Cogia chiagua | Grishin ]. | Natural History Museum London and are made
Paratypes: 3c'c, 19: 1c Mexico, Chiapas, Comitén, Laguna ie unger Census onuionse (accuser
ps://creativecommons.org/licenses/by/4.0/).
Chamula, 7100’, 13-May-1987, C.J. Durden leg. (NVG-19124H05)
[TMMC] and Guatemala: Io Panajachel, 2-Jun-1968, Beals leg. (NVG-17109F09) [LACM] and Duenas,
G.C. Champion leg. [BMNH]: 1o& (BMNH(E) 1236437, genitalia mini-slide 153, Fig. 39a) and 19.
63
Type locality. Guatemala: Sacatepéquez Department, Antigua.
Etymology. The name is a fusion of Chia[pas| + Gua|temala] for the known distribution of this species
and is a feminine noun in apposition.
Distribution. Currently known from Mexico: Chiapas and from Guatemala.
Pholisora albicirrus Glassberg, 2023 is a species distinct
from Pholisora catullus (Fabricius, 1793)
We find the genetic differentiation between Pholisora catullus (Fabricius, 1793) (type locality “Indiis,”
probably eastern USA) and Pholisora catullus albicirrus Glassberg 2023 (type locality in USA: AZ,
Santa Rita Mts.) to be of a magnitude suggestive of distinct species: Fs/COI differences are 0.46/2.3% (15
bp) (Fig. 40), similar to that for Pholisora crestar J. Scott & Davenport, 2017 (type locality in USA: CA,
Tulare Co.) (Zhang et al. 2020). Therefore, we propose that Pholisora albicirrus Glassberg 2023, stat.
nov. is a species-level taxon in agreement with phenotypic differences mentioned in the original
description (Glassberg 2023), which, from our experience with other Hesperiidae, also suggest species,
and not subspecies, status.
a Pholisora catullus|22088B12|Mexico:Dur|1967 b -holisora catullus|22088B10|Mexico:NL|1965
Pholisora catullus|3277|USA:TX,Brewster Co.|2001 }holisora catullus|22088B08|Mexico:SLP|1973
Pholisora catullus|20045E03|USA:UT|2020 sPholisora catullus|3277|USA:TX,Brewster Co.|2001
Pholisora catullus|13344|USA:NM,Dona Ana Co.|2021 Pholisora catullus|22088B12|Mexico:Dur|1967
079 Pholisora catullus|3990|USA:TX,Starr Co.|2015 **Pholisora catullus|3276|USA:IN, Elkhart Co.|1988
Pholisora catullus|22088B08|Mexico:SLP|1973 g#holisora catullus|4278|USA:IN,Montgomery Co.|2015
Pholisora catullus|3278|USA:NM,Lea Co.|1979 oP. catullus|22065G03|USA:MD,Montgomery Co.|1999
Pholisora catullus|4278|USA:IN,Montgomery Co.|2015 holisora catullus|13344|USA:NM,Dona Ana Co.|2021
Pholisora catullus|3276|USA:IN, Elkhart Co.|1988 A holisora catullus|3278|USA:NM,Lea Co.|1979
a P. catullus]22065G03|USA:MD,Montgomery Co.|1999 *holisora catullus|16107D02|USA:TX,Jeff Davis Co.|2016
oy Pholisora catullus|22088B09|Mexico:Hid|1987 holisora catullus|3990|USA:TX,Starr Co.|2015
Pholisora catullus|16107D02|USA:TX,Jeff Davis Co.|2016 Pholisora catullus|19042A05|Mexico:Hid|1964
: Pholisora catullus|22088B10|Mexico:NL|1965 *Bholisora catullus|22088B09|Mexico:Hid|1987
Pholisora catullus|19042A05|Mexico:Hid|1964 Pholisora catullus|20045E03|USA:UT|2020
Pholisora catullus]22031F10|USA:CA,Kern Co.|1984
I=aq P. catullus|22031F09|USA:CA, Tulare Co.|1995
P. catullus|22031F08|USA:CA, Tulare Co.|1984
0 Pholisora catullus|22088B05|USA:CA, Alpine Co.|1968
>? Pholisora catullus|3266|USA:CA,Mono Co.|1969
sa Pholisora catullus|21021D03|USA:CA,Mono Co.|2021
Pholisora catullus|20038E12|USA:CA,Inyo Co.|2018
0 Pholisora catullus|20038E09|USA:CA, Inyo Co.|2018
P. catullus|17066H12|PT of crestar|CA,Mono Co.|2006
Pholisora crestar|20038E11|USA:CA,Kern Co.|2003
sq, Pholisora crestar|20038E10|USA:CA,Kern Co.|2016
jop NOlisora crestar|17066H11|PT|USA:CA,Kern Co.|2010
36 Pholisora crestar|22088B04|USA:CA,Kern Co.|1994
Pholisora crestar|19083E02|HT|USA:CA, Tulare Co.|2013
Pholisora crestar|17066H10|PT|USA:CA, Tulare Co.|2015
7 Pholisora albicirrus|22088B11|Mexico:BCS|1982
Pholisora albicirrus|22088B07|Mexico:Sin|1968
Pholisora mejicanus|7976|USA:NM,Colfax Co.|1989
Pholisora mejicanus|19013D11|USA: CO,EI Paso Co.|1982
* Pholisora mejicanus|17067A02|USA:NM, Colfax Co.|1996
Pholisora mejicanus|17067A01|USA:NM,Lincoln Co.|2000
94
0.005
1Pholisora catullus]22031F10|USA:CA,Kern Co.|1984
peiscla catullus|22031F08|USA:CA, Tulare Co.|1984
holisora catullus|22031FO9|USA:CA, Tulare Co.|1995
Bholisora catullus|20038E09|USA:CA, Inyo Co.|2018
‘8 catullus|17066H12|PT of crestar|CA,Mono Co.|2006
Pholisora catullus|20038E12|USA:CA,Inyo Co.|2018
‘Bholisora catullus|21021D03|USA:CA,Mono Co.|2021
ePholisora catullus|22088B05|USA:CA, Alpine Co.|1968
Pholisora catullus|3266|USA:CA,Mono Co.|1969
ooPholisora albicirrus|22088B11|Mexico:BCS|1982
*'Pholisora albicirrus|22088B07|Mexico:Sin|1968
Pholisora crestar|19083E02|HT|USA:CA, Tulare Co.|2013
holisora crestar|17066H10|PT|USA:CA, Tulare Co.|2015
sPholisora crestar|17066H11|PT|USA:CA,Kern Co.|2010
iRholisora crestar|22088B04|USA:CA,Kern Co.|1994
poleers crestar|20038E11|USA:CA,Kern Co.|2003
holisora crestar|20038E10|USA:CA, Kern Co.|2016
sf holisora mejicanus|7976|NM,Colfax Co.|1989
6 P. mejicanus|19013D11|CO,EI Paso Co.|1982
9. mejicanus|17067A01|NM,Lincoln Co.|2000
P. mejicanus|17067A02|NM,Colfax Co.|1996
0.02
Fig. 40. Phylogenetic trees of Pholisora species recorded from the USA inferred from protein-coding regions of a) the Z
chromosome (best for species delimitation) and b) the mitochondrial genome. Different species are shown in different colors:
P. catullus (blue), P. crestar (violet), and P. albicirrus stat. nov. (red).
Celotes sabinus Grishin, new species
http://zoobank.org/O85EAF93-91A9-4F81-886C-0E77073C8BOE
(Figs. 41 part, 42, 43a)
Definition and diagnosis. Inspection of genomic trees reveals that Celotes nessus (W. H. Edwards, 1877)
(type locality USA: Texas, Bexar Co., San Antonio; lectotype sequenced as NVG-15097F12) as currently
circumscribed (Fig. 41 blue and red) is not monophyletic, and populations from the eastern part of the
range (Fig. 41 blue) are sister to Celotes spurcus A. Warren, Steinhauser, Hernandez-Mejia & Grishin,
2008 (type locality in Mexico: Querétaro) (Fig. 41 green). While species, in general, do not have to be
monophyletic, populations currently identified as C. nessus from the western part of the range (Fig. 41
red) are genetically differentiated from the eastern populations (which include nominotypical) at the level
characteristic of distinct species, with Z chromosome Fs/Gmin of 0.32/0.008 and COI barcode difference
64
of ~2.0% (13 bp, but barcodes introgress between these species). Therefore, these western populations are
a species distinct from C. nessus. This western species does not have a name because the only two junior
synonyms of C. nessus: Spilothyrus notabilis Strecker, [1878] (type locality in the USA: Texas, vicinity
of New Braunfels and San Antonio; two syntypes sequenced as NVG-15039C06 and NVG-15039C07)
and Carcharodus radiatus P\6tz, 1884 (type locality in USA: Texas, syntypes not located, attributed to a
species by locality), are conspecific with the eastern species. This new species is distinguished from C.
spurcus by approximately two times shorter process of valva (from the base of ampulla), which is similar
in length to C. nessus, and from C. nessus by terminally broader harpe, wider separation between harpe
and ampulla (broader gap between them), wider process of valva, broader valva narrowing less towards
vinculum, and two small teeth on aedeagus shaft: by its bend and halfway between the bend and distal end
(Fig. 43). A combination of the following nuclear genomic characters is diagnostic: aly2284.30.1:
G1323A, aly40182.1.2:C154A, aly40182.1.2:C171T, aly1445.3.1:G246A, aly1445.3.1:A195G.
Celotes sabinus|20065A08|PT|USA:AZ,Mohave Co.|2008 b
Celotes sabinus|22104H11|PT|USA:AZ,Mohave Co.|1972
Celotes sabinus|22105A03|PT|USA:AZ, Yavapai Co.|1976
Celotes sabinus|22104H12|PT|USA:AZ,Gila Co.|1960
Celotes sabinus|8304|PT|USA:AZ,Pinal Co.|2017
es Celotes sabinus|22105A01|PT|USA:AZ,Pima Co.|1951
16 Celotes sabinus|22104H09|PT|USA:AZ,Santa Cruz Co.|1938
: Celotes sabinus|22104H08|PT|USA:AZ,Pima Co.|1938
Celotes sabinus|2252|PT|USA:AZ,Santa Cruz Co.|1972
Celotes sabinus|22105A02|HT|USA:AZ,Pima Co.|1960
Celotes sabinus|2115|PT|USA:AZ,Santa Cruz Co.|1981
Celotes sabinus|2116|PT|USA:AZ,Santa Cruz Co.|1978
Celotes sabinus|2113|PT|Mexico:Son|1984
Celotes sabinus|5997|PT|USA:AZ,Santa Cruz Co.|2016
Celotes sabinus|2114|PT|Mexico:Son|1984
a 24
16
22
L 26
a “0
0.007 16
8
100 Celotes sabinus|20066B02|PT|Mexico:Son|1998 0.007
Celotes nessus|22105A05|USA:TX,Hudspeth Co.|1967
Celotes nessus|2247|USA:TX,Brewster Co.|1982
Celotes nessus|19012E05|USA:TX,Jeff Davis Co.|2018
by Celotes nessus|3370|M|USA:TX,Hidalgo Co.|2015
Celotes nessus|19012E03|F|USA:TX,Jeff Davis Co.|2018
0 Celotes nessus|3956|USA:TX,Hidalgo Co.|2015
i Celotes nessus (=notabilis)|15039C07|ST|USA:central TX|old
Celotes nessus|2245|USA:TX,Brewster Co.|1982
Celotes nessus|2246|USA:TX,Brewster Co.|1982
Celotes nessus|15097F12|LT|USA:TX,Bexar Co.|old
Celotes nessus (=notabilis)|15039C06|ST|USA:central TX|old
Celotes nessus|22105A04|Mexico:Tam|1970
Celotes nessus|22104H10|USA:TX,Live Oak Co.|1940 100
Celotes nessus|2254|USA:TX,Jeff Davis Co.|1969
Celotes nessus|2255|USA:TX, Williamson Co.|1971
Celotes spurcus|17067E03|PT|Mexico:Queretaro|2007
Celotes spurcus|17067E04|PT|Mexico:Queretaro|2007
Celotes spurcus|22064H12|PT|Mexico:Queretaro|2007
Celotes spurcus|17067E05|PT|Mexico:Queretaro|2007
Celotes spurcus|22065E08|PT|Mexico:Queretaro|2007
Celotes limpia|2248|Mexico:Coah|1977
oy,- Celotes limpia|19012E04|PT|USA:TX,Jeff Davis Co.|2018
zz— Celotes limpia|2253|USA:TX,Brewster Co.|2003
Celotes limpia|2249|PT|USA:TX, Presidio Co.|1966
16
Celotes sabinus|20065A08|PT|USA:AZ,Mohave Co.|2008
Celotes sabinus|22105A03|PT|USA:AZ, Yavapai Co.|1976
Celotes sabinus|22104H11|PT|USA:AZ,Mohave Co.|1972
Celotes sabinus|22104H12|PT|USA:AZ,Gila Co.|1960
“— Celotes sabinus|22104H08|PT|USA:AZ,Pima Co.|1938
Celotes sabinus|22105A01|PT|USA:AZ,Pima Co.|1951
p> Celotes sabinus|2115|PT|USA:AZ,Santa Cruz Co.|1981
z Celotes sabinus|5997|PT|USA:AZ,Santa Cruz Co.|2016
Celotes sabinus|22105A02|HT|USA:AZ,Pima Co.|1960
Celotes sabinus|2116|PT|USA:AZ,Santa Cruz Co.|1978
= Celotes sabinus|22104HO9|PT|USA:AZ,Santa Cruz Co.|1938
i, Celotes sabinus|2113|PT|Mexico:Son|1984
Celotes sabinus|2114|PT|Mexico:Son|1984
Celotes sabinus|20066B02|PT|Mexico:Son|1998
Celotes sabinus|2252|PT|USA:AZ,Santa Cruz Co.|1972
Celotes sabinus|8304|PT|USA:AZ,Pinal Co.|2017
Celotes nessus|22105A05|USA:TX,Hudspeth Co.|1967
; Celotes nessus|2246|USA:TX,Brewster Co.|1982
ig. Celotes nessus|2245|USA:TX,Brewster Co.|1982
7a, Celotes nessus|2247|USA:TX, Brewster Co.|1982
Celotes nessus|2254|USA:TX,Jeff Davis Co.|1969
Celotes nessus ae TsUdeC OHS e eaioeien TX\old
tm Celotes nessus (=notabilis)|15039C07|ST|USA:central TX|old
Celotes nessus|19012E03|F|USA:TX,Jeff Davis Co.|2018
, Celotes nessus|19012E05|USA:TX,Jeff Davis Co.|2018
6 Celotes nessus|2255|USA:TX,Williamson Co.|1971
0 Celotes nessus|15097F12|LT|USA:TX,Bexar Co.|old
HL 45 Celotes nessus|22104H10|USA:TX,Live Oak Co.|1940
s*S— Celotes nessus|22105A04|Mexico:Tam|1970
Celotes nessus|3956|USA:TX,Hidalgo Co.|2015
Celotes nessus|3370|M|USA:TX,Hidalgo Co.|2015
Celotes spurcus|17067E03|PT|Mexico:Queretaro|2007
7a, ~6Celotes spurcus|17067E04|PT|Mexico:Queretaro|2007
77 Celotes spurcus|22065E08|PT|Mexico:Queretaro|2007
7 Celotes spurcus|17067E05|PT|Mexico:Queretaro|2007
Celotes spurcus|22064H12|PT|Mexico:Queretaro|2007
7. Celotes limpia|2249|PT|USA:TX,Presidio Co.|1966
za Celotes limpia|19012E04|PT|USA:TX,Jeff Davis Co.|2018
Celotes limpia|2253|USA:TX, Brewster Co.|2003
Celotes limpia|2248|Mexico:Coah|1977
f
at 22
|
34
82
Fig. 41. Phylogenetic trees of Ce/otes inferred from protein-coding regions of a) the nuclear genome (autosomes) and b) the Z
chromosome. Different species are shown in different colors: C. sabinus sp. n. (red), C. nessus (blue), and C. spurcus (green).
Primary type specimens are labeled in magenta.
Barcode sequence of the holotype: Sample NVG-22105A02, GenBank OR578720, 658 base pairs:
AACTTTATATTTCATTTTTGGAATTTGAGCAGGCATAGTAGGTACTTCTCTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCTCTAATTGGGGATGATCAAATTTATAATACT
ATTGTAACAGCACATGCCTTCATTATAATTTTTTTTATGGTAATGCCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCTGATATAGCATTCCCACGTA
TAAATAATATAAGATTTTGATTATTACCTCCTTCTTTAACACTTCTTATT TCAAGAAGTATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCTCTATCATCTAATATTGC
TCATCAAGGTTCATCTGTTGACTTAGCTATCTTTTCTTTACATCTAGCAGGAATTTCATCAATCTTAGGAGCAATTAACTTCATTACAACTATTATTAATATACGAATTAGAAATTTATCA
TTTGATCAAATACCTTTATTCGTATGAGCTGTAGGAATTACAGCATTACTTTTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACAT
CTTTCTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACACTTATTT
Type material. Holotype: o& deposited in the California Academy of Sciences, San Francisco, CA, USA
[CAS], illustrated in Fig. 42, bears seven printed labels (date on the first label handwritten): six white
| Sabino Cany. | Santa Catalina Mts. | Pima Co. Arizona | 1. IV. 60 ], [ collected by | Kilian Roever ],
| Collection of | J. W. Tilden ], [ JAMES W. TILDEN | COLLECTION — 1985 | Gift to the California |
Academy of Sciences |], [DNA sample ID: | NVG-22105A02 | c/o Nick V. Grishin |, [ {QR Code}
CASENT | 8568344 ], and one red [ HOLOTYPE @ | Celotes sabinus | Grishin ]. Paratypes: 13c'c’, 499:
USA, Arizona: Mohave Co., 12 Hualapai Mts., lower el., 16-Apr-2008, Ken Davenport leg. (NVG-
20065A08, CSU_ENT1024696) [CSUC]; Ic nr. Wickieup, 30-Mar-1972, J. W. Tilden leg. (NVG-
22104H11, CASENT8568341) [CAS]; 12 Yavapai Co., 8 mi SW of Prescott, 21-Apr-1976, James W.
“Bill” Tilden leg. (NVG-22105A03, CASENT8568345) [CAS]; 1c Maricopa Co., Camp Creek on Cave
65
yg as eC
Fig. 42. Holotype of Celotes sabinus sp. n. in dorsal (left) and ventral (right) views, data in text.
Creek Rd., 12 mi NE of Jct. of Cave Creek and
Scottsdale Rds., 8-Apr-1968, J. A. Miller leg.,
genitalia NVG140320-91 (NVG-2250) [TAMU];
lo Gila Co., Sevenmile wash, 22-Aug-1960, P.
A. Opler leg. (NVG-22104H12, CASENT
8568342) [CAS]; Ic Pinal Co., Coronado Na-
tional Forest, Santa Catalina Mts., Peppersauce
Canyon, 26-Mar-2017, Q. Cong, J. Zhang, and N.
V. Grishin leg. (NVG-8304); Pima Co.: Id
Baboquivari Mts., Brown Canyon, 21-Mar-1938,
J. W. Tilden leg., genitalia J.W.T. 25-15 (NVG-
22104H08, CASENT8568338) [CAS] (Fig. 43a); \ ig AF,
Io Santa Catalina Mts., Molino Basin, 7-Sep- Pe b
1951, C. D. MacNeill leg. (NVG-22105A01, Fig. 43. genitalia of Celotes from USA, aa Tian
CASENT8568343) [CAS]; Santa Cruz Co.: 1c | a) Celotes sabinus sp. n. paratype, slide J. W. T. 25-15, AZ:
is ; Baboquivari Mts., Brown Canyon, 21-Mar-1938, DNA sample
ae pean eta i ee nk ot NVG-22104H08. b) Celotes nessus, slide 25-16, TX: George
eg. (NVG-2115); 2¢¢ Walker Canyon nr. Pena | west, 12-Jun-1940, DNA sample NVG-22104H10. Specimens
Blanca Lake, 16-Aug-1972, John Hafernik leg., | are in CAS, collected and genitalia prepared by J. W. Tilden.
genitalia NVG140320-92 & -93 (NVG-2251 & | Genital capsule is shown on the right, separated valva is on the
; os . left with aedeagus above it. Aedeagus of C. sabinus is shown
el i ceie Ae ae A — Rie ae in ventrolateral view as mounted on the slide.
nia Gulch, 30-Mar- , N. Grishin leg. -
5997); 1o& Patagonia, 24-Mar-1938, J. W. Tilden leg. (NVG-22104H09, CASENT8568339) [CAS]; 19
3.5mi SW of Patagonia, 6-Aug-1978, Jim P. Brock leg. (NVG-2116); Mexico: Sonora: 1c 16 mi E of
Tecoripa, 15-Mar-1984, Jim P. Brock leg. (NVG-2114); 12 8 mi W of Rio Yaqui, 16-Mar-1984, Jim P.
Brock leg. (NVG-2113); Ih ca. 8 mi NE of Bavispe, elevation ca. 4000’, 25-Mar-1998, Richard W.
Holland leg. (NVG-20066B02, CSU_ENT1024701) [CSUC].
Type locality. USA: Arizona, Pima Co., Santa Catalina Mountains, Sabino Canyon.
Etymology. The name is formed from the type locality of this species, Sabino Canyon, a place familiar to
many naturalists, which is just northeast of Tucson at the foothills of the Santa Catalina Mountains in
southeastern Arizona, where this species is common. The name ts a masculine adjective.
English name. Arizona streaky-skipper.
Distribution. Currently known from USA: Arizona and Mexico: Sonora and is likely present in south-
western New Mexico.
Comment. We were surprised to learn that C. sabinus sp. n. is more distant from C. nessus than morpho-
logically distinct C. spurcus, which is rather close to C. nessus genetically.
66
Charmion Nicéville, 1894 is a genus distinct from Celaenorrhinus Hibner, [1819]
Genomic tree reveals that Hesperia ficulnea
Celaenorrhinus aegiochus|18011B06|Panama|1981
Hewitson, 1868, the type species of the Celaenorrhinus monartus|18088A09|Mexico:Ver|2010
: ee ae C. eligius|18013G07|10-SRNP-20588|Costa Rica|2010
genus Charmion Nicéville, 1894 currently Celaenorrhinus syllius|7993|Ecuador|2002
: : : : Celaenorrhinus spilothyrus|18011B08|Sri Lanka|1976
regarded as a junior subjective synonym of Celaenorrhinus sumitra|21116C08|Indialold
. * Bettonula bettoni|18064A04|Uganda|1955
the genus Celaenorrhinus WHtibner [1819] Charmion ficulnea [not Celaenorrhinus]|18087G11|Indonesia|2010
: P 1; ligi Stoll 1781 : Seed Gacatarakraas(ksctmian ver:
arangesa dasahara anmar
(type pn le aa ie a ) 1S Stance a tertullianus|18073G06|Sierra Leone|old
Eretis melania|17069B02|Tanzania|1963
not ONO etic with It (Fig. 44 red). We Sape lucidella inot Sarangesaii18011C01|Kenya|1955
Pseudocoladenia dan|7331|Myanmar|2001
find that Bettonula Libert & Larsen, 2014 Apallaga mokeezi|18011B09|South entey8
(type species Celaenorrhinus bettoni Butler, UP e Menage Puke eve Uneral ee |
1902) renders Celaenorrhinus paraphyletic. Fig. 44. Nuclear genome tree (autosomes): Charmion (red) and
Celaenorrhinus (blue), Sape (magenta) and Sarangesa (green).
Therefore, to restore the monophyly, we
propose that Charmion Nicéville, 1894, stat. rest. is a genus distinct from Celaenorrhinus Hubner, [1819].
Sape Mabille, 1891 is a genus distinct from Sarangesa F. Moore, [1881]
Genomic tree reveals that Sape lucidella Mabille, 1891, the type species of the genus Sape Mabille, 1891
currently treated as a junior subjective synonym of the genus Sarangesa F. Moore, [1881] (type species
Sarangesa albicilia F. Moore, [1881]) is not monophyletic with it (Fig. 44 magenta). We find that Eretis
Mabille, 1891 (type species Eretis melania Mabille, 1891) renders Sarangesa paraphyletic. Therefore, to
restore the monophyly, we propose that Sape Mabille, 1891, stat. rest. is a genus distinct from Sarangesa
F. Moore, [1881].
Cupithina Grishin, new subtribe
http://zoobank. org/905E8 1 10-34EC-4CB3-A0C0-3F 90024 14D3E
Type genus. Cupitha F. Moore, 1884.
Definition. The tribe Astictopterini Swinhoe, 1912 splits into two clades containing approximately the
same number of genera, each supported by 100% of partitions (see Fig. | in Zhang et al. (2023b) and
Figs. 45, 46). Although neither clade is very prominent (branches separating them are not particularly
long), both are most strongly supported. Therefore, to bring order to the genera in Astictopterini, we
divide the tribe into two subtribes. The clade with the type species of the tribe contains generally larger
Species with more robust bodies and corresponds to the nominotypical subtribe. The second clade, with
Cupitha (type species Cupitha tympanifera F. Moore, 1884, which is a junior subjective synonym of
Pamphila purreea Moore, 1877), consists of smaller and frequently brighter patterned species and
corresponds to the subtribe without an available name. This new and mostly Afrotropical subtribe is
distinguished from its relatives by a combination of the following characters (Evans 1937; Evans 1949):
palpi either porrect with convergent 3 segment or erect with thin and erect 3™ segment; antennal club
with pointed apiculus, either obtuse or hooked; caudal angle of hindwing discal cell not bent up: median
vein and vein M3 collinear, end of cell relatively straight, and vein 3A usually shorter than vein CuAz;
thorax not shaggy beneath; coxae and tibiae of hindlegs not densely fringed; valvae symmetrical, uncus
typically narrowing to a point, ovate, terminal part narrow, frequently needle-like, uncus usually not
expanded terminally and not hourglass-shaped. Most confidently identified by DNA and a combination of
the following nuclear genomic base pairs is diagnostic: aly1775.3.2:A50G, aly27.16.1:A638C,
aly27.16.1:C644G, aly1603.20.3:G76C, aly1651.28.7:A167G.
Genera included. The type genus (1.e., Cupitha F. Moore, 1884), Acada Evans, 1937, Acleros Mabille,
1885, Andronymus Holland, 1896, Caenides Holland, 1896, Ceratricula Larsen, 2013, Fresna Evans,
1937, Gorgyra Holland, 1896, Gyrogra Lindsey & Miller, 1965, Hollandus Larsen & Collins, 2015,
Hypoleucis Mabille, 1891, Melphina Evans, 1937, Melphinyet Larsen, 2012, Noctulana Larsen, 2012,
67
Tribes Subtribes Genera Subgenera
tolefae Husnaoeseo irene saaiiecr
H TAL or Herila herilus|18064E01|Tanzania|1951
ea LULL FN Pardaleodes edipus|17108G05|Congo|1981
baialalall Gerais a eee EY rire
Argemma argyrosticta|18064D06|Cameroon|old
Acleros (lsocleros) mackenii|17092B05|South Africa|1968
gs Acleros (lsocleros) mackenii|18099G03|Kenya|old
Acleros (Isocleros) mackenii|20126G11|?ST|South Africalold
3e Acleros (Isocleros) instabilis [not mackenii]|18099G01|Kenya|1955
joo Acleros (Isocleros) instabilis [not mackenii]|18099G05|Uganda|1921
Acleros (Isocleros) instabilis [not mackenii]|21099E10|Kenya|1957
Acleros (lsocleros) olaus [not mackenii]|18073C07|ST|Congolold
700 Lp-g5 Acleros (Isocleros) olaus [not mackenii]|18099G02|Malawilold
Acleros (lsocleros) olaus (=nyassicola) [not mackenii]|20082G06|HT|Malawilold
Acleros (lsocleros) togo|22017G12|HT|Togo|1893
Isocleros su | se
— Acleros (Isocleros) togo|22047H11|PT|Liberia|1946
TT Acleros (lsocleros) ploetzi|18073C05|Gabon|1892
Acleros (lsocleros) bibundica|18073D06|ST|Equatorial Guinea|1904
Acleros (Acleros) leucopyga|18019F01|Madagascar|old
100 av Acleros (Acleros) nigrapex|21099E06|Cameroon|old
00 Acleros (Acleros) bobiri]21099E09|Ghana|1967
Acleros (Acleros) sparsum|7794|Cameroon|1987
Acleros (Paracleros) substrigata]17091H01|Cameroonlold
Acleros (Paracleros) biguttulus|18073D04|Equatorial Guinea|1913
5 Acleros (Paracleros) placidus|21099E04|Liberia|1958
94
Acleros
Acleros
Paracleros 100
LI Andronymus caesar|17092B02|Uganda|1961
pe} Acada biseriata|17069G02|Kenya|1950
Teniorhinus watsoni|20126F12|T|Gabonlold
Fresna (Fresna) netopha|17092A07|Uganda|1960
Fresna 94 Fresna (Fresna) nyassae|18054G01|Malawi|1996
EE Fresna (Fresna) maesseni|21043E02|HT|Ghana|1970
Fresna (Fresna) carlo|21102B02|Cameroonlold
Fresna (Mesna) larea [not Meza]|19043D02|Tanzania|1930
Fresna (Mesna) mabea [not Meza]|20124H11|T|Gabon,Ogowelold
3 72 _Fresna (Mesna) bassa [not Meza leucophaea]|20124HO07|HT|Liberia|1956
Too ~Fresna (Mesna) bassa [not Meza leucophaea]|21099F09|PT|Liberia|1955
Fresna (Mesna) bassa [not Meza leucophaea]|21099F10|PT|Liberia|1955
re Fresna (Mesna) leucophaea [not Meza]|20124H08|T|Gabon|old
TO Fresna (Mesna) leucophaea [not Meza]|21099F08|Cameroon|old
Fresna (Mesna) leucophaea [not Meza]|21099F07|T|Gabon|old
73 Paronymus punctata [not Ceratrichia]|18073A05|HT|West Africalold
ago 140 Paronymus punctata [not Ceratrichia]|21099A08|Liberia|1955
Was Geratricula 36 Paronymus semilutea [was Ceratricula]|21099A09|Cameroon|old
ae 2, 100 Paronymus semilutea [was Ceratricula]|21118G05|ST|Nigeria|1885
3 Paronymus indeterminabilis [not semilutea, was Ceratricula]|18073A07|ST|Eq. Guinea|1906
100 00 Paronymus indeterminabilis [not semilutea, was Ceratricula]|18073A08|ST|Eq. Guinea|1906
Paronymus congdoni [not semilutea, was Ceratricula]|19043B08|Uganda|1956
Paronymus xanthias|18072H11|ST|Sierra Leonelold
7 Paronymus cybeutes pallida [not Meza]|19043D04|Uganda|1957
00 Paronymus cybeutes cybeutes [not Meza]|21099G07|Cameroon|old
aay,
Nido Fresna
Mesna subgen. n.
100
Cupithina subtrib. n. Paronymus
100 Paronymus cybeutes cybeutes [not Meza]|21099G06|ST|Gabonlold
700 Paronymus volta [not Meza cybeutes]|21043D12|HT|Ghana|1969
Paronymus volta [not Meza cybeutes]|21099G05|PT|Ghana|1970
Paronymus nevea|7804|Cameroon|1989
Paronymus indusiata [not Meza]|21099F11|Liberia|1958
F Paronymus hidaroides|KS19|Cameroon
7 Paronymus mabillei [not Meza]|21099G03|Cameroon|old
Paronymus ligora|21099G09|Cameroonlold
me Semalea sextilis|18075A02|T|Ghana|1882
5 Semalea arela|19043C07|Uganda|1953
Semalea corvinus [not sextilis]|18075A05|T|Sierra Leone|1887
Semalea pulvina|7803|Cameroon|1989
m3 «©6Semalea rega (=sierrae) [was Xanthodisca]|18073A01|ST|Sierra Leonelold
100 98 Semalea rega [was Xanthodisca]|18073A03|ST|Sierra Leone|old
Semalea rega (=evansi) [was Xanthodisca]|18087B08|T|Sierra Leone|1906
: Semalea rega (=staudingeri) [was Xanthodisca]|20125A08|HT|Cameroon|old
100 ony ee ik Semalea vibius [was Xanthodisca]|18096F03|Congo|old
was Xanthodisca 7 — Semalea vibius [was Xanthodiscal|7765|Cameroon|1987
Semalea vibius [was Xanthodisca]|18099F02|Uganda|1940
Semalea malawi|19043B12|Malawi|1940
Semalea
: Hypoleucis tripunctata|17091H02|Uganda|1960
Hypoleucis oo Hypoleucis ophiusa|18095A03|Cameroonlold
. Phe Hypoleucis dacena|18011C03|Cameroon|old
Astictopterini Xanthoneura Xanthoneura (Xanthoneura) corissa|17091D06|Borneol|old
Xanthoneura —- Xanthoneura (Xanthoneura) patmapana [not corissa]|18096B10|Javalold
Lippina subgen. n. Er Xanthoneura (Lippina) telesinus|17091D07|Philippines:Luzon|old
Xanthoneura (Lippina) obscurior|17091D08|Philippines:Luzon|1966
Dotta Dotta tura|17093B01|Tanzania|1954
Dotta stellata|17093B03|Kenya|1957
Dotta callicles|18054F12|Namibia|1992
To Galerga paroechus [was Perrotia]|18099H08|Madagascar|1990
Galerga kingdoni [was Perrotia]|21101B03|Madagascar|old
tal ps Galerga ariel [not Xanthodisca]|19043C03|Madagascar|old
do 86 Galerga albiplaga [was Perrotia]|21101B06|Madagascar|old
Galerga paroechus [was Perrotia]|7779|Madagascar|1990
Fulda Galerga ellipsis|7815|Madagascar|1988
100 Fulda coroller|7762|Madagascar|1991
Isoteinon lamprospilus|17091A08|Japan|1929
100 FOO Isoteinon abjecta|20126F10|Congo|1910
ye Isoteinon anomoeus [not Astictopterus]|21097H11|Liberia|1958
[700 Isoteinon punctulata [not Astictopterus]|21068F04|Africa|1956
Isoteinon inornatus [not Astictopterus]|21098A01|South Africalold
. Astictopterus chinensis|18021G05|China:Hong Kong|1960
Astictopterus i Astictopterus olivascens (=henrici)|20126G01|T|China:Hainan|old
a af Eee ATUGEEONIGcHaeeh ee
i i onza cretacea|17069H12|Nigeria|1951
Astictopterina 100 -— Pteroteinon laufella|7757|Liberia|1988
Hidari irava|7823|Singapore|1989
50 700 ZOphopetes MeL TAOIBINICcHalta
100 Zophopetes cerymica|21101B11|Nigeria|1965
Zophopetes 100 Zophopetes dysmephila|18099H09|Kenya|1958
Zophopetes nobilior|18075D05|T|Gabun|1892
Leona (Leona) stoehri|18075D01|HT|Togolold
100
Galerga
106
Isoteinon
100 100
Leona Tf 2° Leona (Leona) leonora|18087A09|Gabon|1969
9A 00 Leona (Leona) reali (=na)|20124HO6|HT|Liberia|1958
Leona ee TT EET TE Leona (Leona) lota|21101F02|Cameroon|old
Wen opala | Leona (Ganda) ganda [not Zophopetes]|21101B08|Cameroonlold
34 Leona (Mopala) orma|18094H04|Cameroon|old
Lennia Lennia binoevatus|21101F04|Gabon|old
= eS Lennia maracanda|21101F06|Gabonlold
Lennia lena|21101F07|Cameroon|old
Fig. 45. The phylogenetic tree of selected Ceratrichiini and Astictopterini inferred from protein-coding regions of the nuclear
genome (autosomes). Levels in the tree that approximately correspond to the taxonomic hierarchy are marked above as Tribes,
Subtribes, Genera, and Subgenera. Family-group names (roman font) and relevant genus-group names (genera in bold italics
and subgenera in italics) are shown by corresponding branches. New species are in green, clades of new subgenera are in
magenta, labels of taxa previously in Meza are in red, and others are colored as follows: elevated to species (blue), transferred
between genera (cyan; green arrows show the transfer), and included into other genera as subgenera or synonyms (violet).
68
Tribes Subtribes Genera Subgenera
Meza meza|17091H09|Cameroon|old
99
robe eg Herila herilus|18064E01|Tanzania|1951
Argemma argyrosticta|18064D06|Cameroonlold
Ceratrichia nothus|18053E03|no datajold
Acleros (Isocleros) mackenii|17092B05|South Africa|1968
AEleros (lsocleros) mackenii|18099G03|Kenyalold
cleros (lsocleros) mackenii|20126G11|?ST|South Africaljold
eteros (Isocleros) olaus [not mackenii]|18099G02|Malawilold
100 cleros (Isocleros) olaus (=nyassicola) [not mackenii]|20082G06|HT|Malawilold
Acleros (Isocleros) olaus [not mackenii]|18073C07|ST|Congolold
sn Acleros (Isocleros) instabilis [not mackenii]|21099E10|Kenya|1957
fen nian ean aan ioAAcleros (Isocleros) instabilis [not mackenii]|18099G01|Kenya|1955
Benet 80 Acleros (Isocleros) instabilis [not mackenii]|18099G05|Uganda|1921
Agleros (Isocleros) togo|22047H11|PT|Liberia|1946
Acleros (Isocleros) togo|22017G12|HT|Togo|1893
73 [oN Acleros (lsocleros) bibundica|18073D06|ST|Equatorial Guinea|1904
Acleros (lsocleros) ploetzi|18073C05|Gabon|1892
cleros (Paracleros) substrigata|17091H0O1|Cameroonl|old
Paracleros 1068
Acleros (Paracleros) biguttulus|18073D04|Equatorial Guinea|1913
0
[104 Acleros (Paracleros) placidus|21099E04|Liberia|1958
[\79 Acleros (Acleros) bobiri]21099E09|Ghana|1967
| 100 Acleros (Acleros) sparsum|7794|Cameroon|1987
[10 $F Acleros (Acleros) nigrapex|21099E06|Cameroon|old
Acleros (Acleros) leucopyga|18019F01|Madagascar|old
Acada biseriata|17069G02|Kenya|1950
Teniorhinus watsoni|20126F12|T|Gabon|old
Andronymus caesar|17092B02|Uganda|1961
Foo Fresna (Fresna) netopha|17092A07|Uganda|1960
[700 \ Fresna (Fresna) nyassae|18054G01|Malawi|1996
foe Fresna (Fresna) maesseni|21043E02|HT|Ghana|1970
Fresna (Fresna) carlo|21102B02|Cameroon|old
Fresna (Mesna) larea [not Meza]|19043D02|Tanzania|1930
Fresna (Mesna) mabea [not Meza]|20124H11|T|Gabon, Ogowe|old
Fresna (Mesna) bassa [not Meza leucophaea]|20124HO7|HT|Liberia|1956
A. (Mesna) bassa [not Meza leucophaea]|21099F09|PT|Liberia|1955
100 resna (Mesna) bassa [not Meza leucophaea]|21099F10|PT|Liberia|1955
Fresna (Mesna) leucophaea [not Meza]|21099F08|Cameroonlold
hy ontestta (Mesna) leucophaea [not Meza]|20124H08|T|Gabonlold
resna (Mesna) leucophaea [not Meza]|21099F07|T|Gabon|old
aaronymus punctata [not Ceratrichia]|21099A08|Liberia|1955
Paronymus punctata [not Ceratrichia]|18073A05|HT|West Africa|old
Paronymus semilutea [was Ceratricula]|21118G05|ST|Nigeria|1885
Acleros
Acleros
77
100
was Ceratricula 100 100 Paronymus semilutea [was Ceratricula]|21099A09|Cameroonlold
cals . Paronymus indeterminabilis [not semilutea, was Ceratricula]|18073A07|ST|Eq. Guinea|1906
Cupithina subtrib. n. 100 99 10° Paronymus indeterminabilis [not semilutea, was Ceratricula]|18073A08|ST|Eq. Guinea|1906
Paronymus congdoni [not semilutea, was Ceratricula]|19043B08|Uganda|1956
Paronymus xanthias|18072H11|ST|Sierra Leone|old
62 Paronymus cybeutes pallida [not Meza]|19043D04|Uganda|1957
o Paronymus cybeutes cybeutes [not Meza]|21099G06|ST|Gabon|old
Paronymus cybeutes cybeutes [not Meza]|21099G07|Cameroon|old
faronymus volta [not Meza cybeutes]|21043D12|HT|Ghana|1969
aronymus volta [not Meza cybeutes]|21099G05|PT|Ghana|1970
Paronymus nevea|7804|Cameroon|1989
Paronymus ligora|21099G09|Cameroon|old
Paronymus mabillei [not Meza]|21099G03|Cameroon|old
Paronymus hidaroides|KS19|Cameroon
Paronymus indusiata [not Meza]|21099F11|Liberia|1958
Semalea corvinus [not sextilis]|18075A05|T|Sierra Leone|1887
Semalea sextilis|18075A02|T|Ghana|1882
Semalea a7 Semalea arela|19043C07|Uganda|1953
nog Semalea pulvina|7803|Cameroon|1989
Callie rega (=evansi) [was Xanthodisca]|18087B08|T|Sierra Leone|1906
emalea rega (=sierrae) [was Xanthodisca]|18073A01|ST|Sierra Leone|old
able rega [was Xanthodisca]|18073A03|ST|Sierra Leone|old
emalea rega (=staudingeri) [was Xanthodisca]|20125A08|HT|Cameroonj|old
bani vibius [was Xanthodisca]]18096F03|Congo|old
1o~emalea vibius [was Xanthodisca]|7765|Cameroon|1987
Semalea vibius [was Xanthodisca]|18099F02|Uganda|1940
Semalea malawi|19043B12|Malawi|1940
AGO [100 \ Hypoleucis tripunctata|17091H02|Uganda|1960
Astictopterini - p10 Hypoleucis ophiusa|18095A03|Cameroon|old
p Hypoleucis Hypoleucis dacena|18011C03|Cameroon|old
Xanthoneura Xanthoneura (Xanthoneura) corissa|17091D06|Borneolold
ONO eU TT 8 Lippina subgen.n, __—\ 10° Xanthoneura (Xanthoneura) patmapana [not corissa]|18096B10|Javalold
Lippina subgen. n. T700\, Xanthoneura (Lippina) telesinus|17091D07|Philippines:Luzon|old
Xanthoneura (Lippina) obscurior|17091D08|Philippines:Luzon|1966
[es \ Galerga paroechus [was Perrotia]|18099H08|Madagascar|1990
Galerga paroechus [was Perrotia]|7779|Madagascar|1990
Galerga ariel [not Xanthodisca]|19043C03|Madagascar|old
Galerga kingdoni [was Perrotia]|21101B03|Madagascar|old
Galerga albiplaga [was Perrotia]|21101B06|Madagascar|old
Galerga ellipsis|7815|Madagascar|1988
Fulda coroller|7762|Madagascar|1991
Dotta callicles|18054F12|Namibia|1992
Dotta stellata|17093B03|Kenya|1957
Dotta tura|17093B01|Tanzania|1954
Isoteinon abjecta|20126F10|Congo|1910
Isoteinon anomoeus [not Astictopterus]|21097H11
Isoteinon lamprospilus|17091A08|Japan|1929
EE Isoteinon punctulata [not Astictopterus]|21068F04|Africa|
Isoteinon inornatus [not Astictopterus]|21098A01|South Africalold
§tictopterus chinensis|18021G05|China:Hong Kong|1960
106 Astictopterus olivascens (=henrici)|20126G01|T|China:Hainanlold
Astictopterus jama|18089E02|Malaysia:Penang|1980
100 500 Monza SSM SIU A ga 1aqv787
j i 58 teroteinon laufella
Astictopterina Hidari irava|7823|Singapore|1989
Zophopetes haifa|17109A03|Kenya|1968
97 Zophopetes cerymica|21101B11|Nigeria|1965
31 Zophopetes 100 Zophopetes dysmephila|18099HO9|Kenya|1958
Zophopetes nobilior|18075D05|T|Gabun|1892
Leona (Leona) stoehri|18075D01|HT|Togolold
100
Paronymus
100 100
was Xanthodisca
Galerga
Astictopterus
100
82 teond 68 28 Leona (Leona) leonora|18087A09|Gabon|1969
Be Hy 100 Leona (Leona) lota|21101F02|Cameroonjold
Leona (Leona) reali (=na)|20124HO06|HT|Liberia|1958
Leona Mopala
100 P Leona (Mopala) orma|18094H04|Cameroonl|old
Leona (Ganda) ganda [not Zophopetes]|21101B08|Cameroon|old
O04 sonal Ganda subgen. n. ~ Lennia binoevatus|21101F04|Gabonlold
100 Lennia lena|21101F07|Cameroon|old
Lennia maracanda|21101F06|Gabonlold
Fig. 46. The phylogenetic tree of selected Ceratrichiini and Astictopterini inferred from protein-coding regions of the
mitochondrial genome. See Fig. 45 for notations.
Osmodes Holland, 1892, Osphantes Holland, 1896, Paracleros Berger, 1978 (see below), Paronymus
Aurivillius, 1925, Parosmodes Holland, 1896, Platylesches Holland, 1896, Rhabdomantis Holland, 1896,
Semalea Holland, 1896, Teniorhinus Holland, 1892, Xanthodisca Aurivillius, 1925 (see below),
69
Xanthonymus Grishin, 2019, and Zographetus Watson, 1893. All other genera placed in Astictopterini by
Zhang et al. (2023b) belong to the nominotypical subtribe Astictopterina.
Parent Taxon. Tribe Astictopterini Swinhoe, 1912.
Paracleros Berger, 1978 is a subgenus of Acleros Mabille, 1885
Acleros Mabille, 1885 (type species Cyclopides leucopyga Mabille, 1877) and Paracleros Berger, 1978
(type species Acleros biguttulus Mabille, 1889) are two phenotypically similar sister genera, which, taken
together, are prominently separated from others (Figs. 45, 46). COI barcode difference between their type
species is 9.1% (60 bp), which is borderline for distinct genera in many butterfly groups. Moreover,
Acleros, as currently circumscribed, is not a genetically prominent group and splits into two such groups
in the nuclear genome tree (Fig. 45): the nominotypical Ac/eros and the other one, which is proposed as a
new subgenus below. In the mitochondrial genome tree, Ac/eros is not even monophyletic, albeit with a
weaker support (Fig. 46). On the one hand, we see that Ac/eros and Paracleros taken together form a
prominent clade. On the other hand, Ac/eros and Paracleros are not prominently separated from each
other, and there is a third clade of nearly the same rank. This clade is currently included in Ac/leros but is
sister to Paracleros in the mitochondrial genome tree. Neither of these three groups consists of a large
number of species. For all these reasons, we propose to treat Paracleros Berger, 1978, stat. nov. as a
subgenus of Acleros Mabille, 1885.
Isocleros Grishin, new subgenus
http://zoobank.org/1 1OQEYE2-43 A8-422D-BF56-967608087687
Type species. Pamphila (?) mackenii Trimen, 1868.
Definition. As discussed in the previous section, Acleros Mabille, 1885 (type species Cyclopides
leucopyga Mabille, 1877) that includes Paracleros Berger, 1978 (type species Acleros biguttulus Mabille,
1889) splits into three prominent clades: the nominotypical Acleros, Paracleros, and the third clade not
associated with any available genus-group names (Figs. 45,46). The third clade represents a new
subgenus that keys to 41.B.(a) (excluding a”) or 41.B.(b)(b!) in Evans (1937) and is distinguished from its
relatives by darker distal half of ventral hindwing or if hindwing is more uniform in color then dorsal
forewing is with broadly white inner margin; tegumen with uncus are narrow in lateral view, uncus in
dorsal view is either bulb-shaped or continuously narrows to a point. A combination of the following
nuclear genomic base pairs is diagnostic: aly2627.4.1:T63A, aly2627.4.1:C69T, aly116.29.1:T2049A,
aly116.29.1:G2814A, aly9673.4.1:A480G.
Etymology. The name of the other subgenus was formed by adding the prefix par- (i.e., besides,
alongside) to the genus name. Similarly, we fuse the prefix iso- (1.e., similar, equal, the same) to the genus
name. The name is a masculine noun in the nominative singular.
Species included. The type species (1.e., Pamphila (?) mackenii Trimen, 1868), Acleros bibundica Strand,
1913, Acleros instabilis Mabille, 1889, Apaustus olaus Plétz, 1884, Acleros ploetzi Mabille, 1889, and a
new species described below.
Parent taxon. Genus Acleros Mabille, 1885.
Acleros ({socleros) instabilis Mabille, 1889 and Acleros [socleros) olaus (Pl6tz, 1884)
are Species distinct from Acleros [socleros) mackenii (Trimen, 1868)
Inspection of genomic trees (Figs. 45, 46) and analysis of genetic differentiation reveals that Acleros
instabilis Mabille, 1889 (type locality in Tanzania) and Apaustus olaus Plétz, 1884 (type locality in
Congo, syntype sequenced as NVG-18073C07) currently treated as subspecies of Acleros (Isocleros)
mackenii (Trimen, 1868), (type locality in South Africa, possible syntype sequenced as NVG-20126G11)
70
are genetically differentiated from it with Fs/COI barcode difference of 0.23/4% (26 bp) and 0.49/2.6%
(17 bp), respectively, and from each other with 0.39/4.7% (31 bp). Therefore, we propose to reinstate
these two taxa as species: Acleros ([socleros) instabilis Mabille, 1889, stat. rest. and Acleros (Isocleros)
olaus (Pl6tz, 1884), stat. rest.
Acleros nyassicola Strand, 1921 is a junior subjective synonym of Acleros ([socleros)
olaus (Pl6tz, 1884), not of Acleros ([socleros) mackenti (Trimen, 1868)
In the genomic trees, the holotype of Ac/eros nyassicola Strand, 1921 (type locality in Malawi, sequenced
as NVG-20082G06, in SDEI) reveals that it is not conspecific with Acleros (Isocleros) mackenii (Trimen,
1868), (type locality in South Africa, possible syntype sequenced as NVG-20126G11) and instead groups
with Acleros UIsocleros) olaus (Pl6tz, 1884), stat. rest. (type locality in Congo, syntype sequenced as
NVG-18073C07) (Figs. 45, 46). Therefore, we propose to treat Acleros nyassicola Strand, 1921 as a
junior subjective synonym of Acleros ([socleros) olaus (P16tz, 1884).
Acleros (Isocleros) togo Grishin, new species
http://zoobank.org/10245D25-D8E1-4342-A2AA-0104A185EA97
(Figs. 45-46 part, 47)
Definition and diagnosis. Genomic trees reveal that two specimens from Western Africa identified as
Acleros olaus (Pl6tz, 1884), stat. rest. (type locality in Congo, syntype sequenced as NVG-18073C07)
are not monophyletic with A. olaus and form a clade approximately equidistant from it and Acleros
mackenii (Trimen, 1868) (type locality in South Africa, possible syntype sequenced as NVG-20126G11)
with Acleros instabilis Mabille, 1889, stat. rest. (type locality in Tanzania) (Figs. 45, 46), suggesting that
these two specimens belong to a distinct species. Its genetic differentiation measured by Fs/COI barcode
difference is: 0.31/5.5% (36 bp) from A. olaus, 0.31/4.7% (31 bp) from A. mackenii, and 0.41/5.3% (35 bp
from A. instabilis, which is substantial and provides strong support for these two specimens as
Fig. 47. Holotype & (a) and paratype ? (b) of Ac/eros togo sp. n. in dorsal (left) and ventral (right) views, data in text.
71
representatives of a new species. This species is distinguished from its relatives by the following
combination of characters: forewing subapical spots are present, yellowish above and purplish beneath
(not white in the specimens of the type series), diffuse, nearly in line (spot by costa is not strongly offset
distad from others), other forewing spots are crisper, with sharper defined edges, the spot in cell CuAo-
1A+2A on ventral forewing is with equally sharp edges (not more diffuse and disappearing towards the
outer margin), forewing spot in cell CuA1-CuAz is closer to the spot in cell CuA2-1A+2A than in A. olaus.
Due to variability in phenotype, this rather cryptic species is confidently identified by DNA: in the
nuclear genome: aly164.2.2:C73A, aly173.7.6:A182T, aly8937.5.1:A305G, aly1260.26.1:A247G, aly24.4.2:
G63T and in the COI barcode: T38A, T91C, T376A, G380A, A514C, T571C.
Barcode sequence of the holotype: Sample NVG-22017G12, GenBank OR589638, 658 base pairs:
AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATAATAGGATCATCTTTAAGATTATTAATTCGTACAGAATTAGGTAACCCTGGATCCTTAATCGGAGATGATCAAATTTATAATACA
ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTCTTATATTAGGAGCTCCTGATATAGCTTTCCCCCGAA
TAAATAATATAAGATTTTGAATACTTCCCCCATCTTTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACTGGCTGAACTGTTTACCCCCCTCTTTCTTCTAATATTGC
ACATCAAGGATCATCAATTGATTTAGCTATTTTTTCTTTACATTTAGCCGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAAAAATATATCA
TTTGATCAATTACCTTTATTTATTTGATCCGTAGGTATTACTGCTTTACTTTTACTTTTATCTCTACCTGTTTTAGCAGGTGCTATCACAATACTTCTTACTGACCGAAACTTAAATACTT
CTTTTTTCGATCCTGCCGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: ¢ deposited i in the Zoologische Staatssammlung Miinchen, Germany [ZSMC],
illustrated in Fig. 47a, bears six labels: 2" blue, last red, and others white [ 43390 ], [ Togo | Misahohe |
1893 | E. Baumann S. |, [| 363 | 7.XII.93 | A. olaus ], [ olaus | Plotz |, [ DNA sample ID: | NVG-22017G12
| c/o Nick V. Grishin ], and [ HOLOTYPE o@ | Acleros ([socleros) | togo Grishin |. Paratype: ° Liberia:
Monrovia, Firestone Plantation, Dec-1946, Harry A. Beatty leg. (NVG-22047H11) [CUIC] (Fig. 47b).
Type locality. Togo: Misahéhe.
Etymology. The name is given for the country with the type locality. The name is a noun in apposition.
Distribution. Western Africa, recorded from Togo and Liberia.
Taxonomic rearrangement of species currently in the genus Meza Hemming, 1939
The genus Meza Hemming, 1939 (type species Hesperia meza Hewitson, 1877) currently consists of 10
species. Genomic trees reveal that the genus is not monophyletic (Figs. 45, 46) and partitions according to
the three sections of the identification key provided by Evans (1937): (i) no secondary sexual characters;
(ii) male dorsal hindwing with a hair tuft that overlays bases of veins CuA; and CuAz2 and (i) hair tuft
enters a pouch either at the end of discal cell or along the median vein. The type species M. meza—
section (1), no tuft—belongs to the tribe Ceratrichiini Grishin, 2019 and other species (with tuft) belong to
two clades in the tribe Astictopterini Swinhoe, 1912. Section (11) consists of three species and is sister to
the genus Fresna Evans, 1937 (type species Hesperia netopha Hewitson, 1878). Although this clade is
prominent, it is at the tree level of a subgenus (Figs. 45, 46). We include these species in Fresna, forming
the following new combinations: Fresna larea (Neave, 1910), comb. nov., Fresna leucophaea (Holland,
1894), comb. nov., and Fresna mabea (Holland, 1894), comb. nov. All the remaining species are from
section (111) and are dispersed within the clade corresponding to the genus Paronymus Aurivillius, 1925
(type species Hesperia ligora Hewitson, 1876) (Figs. 45, 46). We assign them to this genus, forming new
combinations: Paronymus banda (Evans, 1937), comb. nov., Paronymus cybeutes (Holland, 1894),
comb. nov., Paronymus elba (Evans, 1937), comb. nov., Paronymus gardineri (Collins & Larsen, 2008),
comb. nov., Paronymus indusiate (Mabille, 1891), comb. nov., Paronymus mabillei (Holland, 1893),
comb. nov. As a result, Meza becomes monotypic to consist of only the type species VM. meza, while other
Species currently in Meza are transferred to Fresna or Paronymus.
Mesna Grishin, new subgenus
http://zoobank.org/A3 DDA72C-3 E34-42E8-82FF-45771 5 B8E65E
Type species. Parnara leucophaea Holland, 1894.
Definition. As discussed above, Meza Hemming, 1939 (type species Hesperia meza Hewitson, 1877) was
not monophyletic, and some of its species formed a clade sister to Fresna Evans, 1937 (type species
Te
Hesperia netopha Hewitson, 1878) (Figs. 45, 46). To restore the monophyly, we placed these species in
Fresna. However, they are genetically and morphologically distinct from other Fresna and constitute a
new subgenus. Species of this new subgenus key to 44.B. in Evans (1937) and are distinguished from
similar-looking species (e.g., Meza and Paronymus) by the following characters: male dorsal hindwing
with a hair tuft that overlays bases of veins CuA; and CuA2 (does not enter a pouch either at the end of
discal cell or along the median vein as in Paronymus; Meza lacks the tuft) and uncus narrowly squared at
the tip in dorsal view, not terminating in a sharp point (as in Paronymus), and not bulb-shaped (as in
Meza). A combination of the following nuclear genomic base pairs is diagnostic: aly1249.14.7:T1966C,
aly 1249.14.7:C2004T, aly536.106.2:A3984G, aly1656.5.1:A135C, aly8937.7.1:A198C.
Etymology. The name indicates that these species started in the genus Me[za| and ended in [Fre]sna. The
name is a feminine noun in the nominative singular.
Species included. The type species (1.e., Parnara leucophaea Holland, 1894), Meza leucophaea bassa
Lindsey & L. Miller, 1965 (see below), Parnara larea Neave, 1910, and Parnara mabea Holland, 1894.
Parent taxon. Genus Fresna Evans, 1937.
Fresna (Mesna) bassa (Lindsey & L. Miller, 1965) is a species distinct
from Fresna (Mesna) leucophaea (Holland, 1894)
Genetic differentiation between Meza leucophaea bassa Lindsey & L. Miller, 1965 (type locality in
Liberia, holotype sequenced as NVG-20124H07) that we placed in the genus Fresna Evans, 1937 (type
species Hesperia netopha Hewitson, 1878) and Fresna leucophaea leucophaea (Holland, 1894) (type
locality in Gabon, syntypes sequenced as NVG-21099F07 and NVG-21099F08) is notable, e.g., COI
barcode differ by 3.3% (22 bp) and the two taxa form separate clades in genomic trees (Figs. 45, 46).
Therefore, we propose that Fresna (Mesna) bassa (Lindsey & L. Miller, 1965), stat. nov. is a species
distinct from Fresna (Mesna) leucophaea (Holland, 1894).
Paronymus volta (L. Miller, 1971) is a species distinct
from Paronymus cybeutes (Holland, 1894)
Genetic differentiation as measured by Fs/COI barcode difference between Meza cybeutes volta Miller,
1971 (type locality in Ghana, holotype sequenced as NVG-21043D12) that we placed in the genus
Paronymus Aurivillius, 1925 (type species Hesperia ligora Hewitson, 1876) and Paronymus leucophaea
leucophaea (Holland, 1894) (type locality in Gabon, syntype sequenced as NVG-21099G06) is:
0.43/3.8% (25 bp) and the two taxa form separate clades in genomic trees (Figs. 45, 46). Therefore, we
propose that Paronymus volta (L. Miller, 1971), stat. nov. is a species distinct from Paronymus cybeutes
(Holland, 1894). Paronymus cybeutes pallida (Holland, 1896) (type locality in Congo) does not differ
prominently from the nominotypical subspecies, and we retain it as a subspecies of P. cybeutes.
Ceratricula Larsen, 2013 is a Junior subjective synonym
of Paronymus Aurivillius, 1925
The genus Ceratricula Larsen, 2013 (type species Ceratrichia semilutea Mabille, 1891) forms a tight
clade within Paronymus Aurivillius, 1925 (type species Hesperia ligora Hewitson, 1876) that is a
confident sister to Paronymus xanthias (Mabille, 1891) (type locality in Nigeria) (Figs. 45, 46) rendering
Paronymus paraphyletic. To restore the monophyly, we propose that Ceratricula Larsen, 2013, syn. nov.
is a junior subjective synonym of Paronymus Aurivillius, 1925.
73
Paronymus punctata (Holland, 1896), new combination;
its type locality is Sierra Leone: Freetown
The name Ceratrichia punctata (type locality in “Tropical West Africa”) was published by Holland
(1896) in synonymy with Ceratrichia phocion (Fabricius, 1781) (type locality in South Africa) and
attributed to Mabille as a “MS. name”, with the holotype specimen (“another male ... has been designated
as the type’’) from the Staudinger collection, now in MFNB. A short description was provided: “primaries
more spotted than is quite usual.” Evans (1937) used the name “Ceratrichia punctata Holland” as valid,
attributing it to Holland’s publication and citing the same “type” specimen in Berlin. Therefore, under
Articles 11.6.1 and 50.7 of the ICZN Code (1999), the name Ceratrichia punctata Holland 1896 is
currently both available and valid and is based on the holotype in Berlin. N.V.G. found the holotype,
which bears a purple “Origin.” label, an identification label in Mabille’s handwriting, “C. punctata / Mab.
o”’, and an identification label in Holland’s handwriting, “Ceratrichia / phocion, / &”’, among several
others. The locality label on the holotype is “Frtn. / Pr.” meaning that it was collected by Preuss in
Freetown, Serra Leone. German botanist Paul Rudolph Preuss collected in Sierra Leone in 1886—1888
(Barnhart 1965), giving a possible range of dates when the holotype was captured.
Genomic sequencing of the holotype (NVG-18073A05) places it as sister to Paronymus semilutea
(Mabille, 1891) (type locality in Nigeria, syntype sequenced as NVG-21118G05) (Figs. 45, 46), being
distinct from it due to genetic differentiation, e.g., COI barcode difference of 2.1% (14 bp). Therefore, we
propose Paronymus punctata (Holland, 1896), comb. nov. The holotype of P. punctata is not conspecific
with the species Evans (1937) identified as C. punctata: e.g., the holotype has ventral forewing nearly
uniformly brown without pale areas by the inner margin characteristic of Evans’ C. punctata; smaller
forewing and ventral hindwing spots, and brownish tuft of hair-like scales by the base of dorsal hindwing.
Evans’ C. punctata lacks androconia and is a species of Ceratrichia Butler, 1870 (type species Papilio
nothus Fabricius, 1787); it does not have a name. This new species is described below.
Ceratrichia notata Grishin, new species
http://zoobank.org/3 BD674EC-B 100-4309-8 18 1-393 A29D4EE03
Definition and diagnosis. As shown above, Evans misidentified Paronymus punctata Holland, 1896,
comb. nov. The distinctive species he considered “Ceratrichia punctata” does not have a name and is
new. This new species keys to 31.A.(b)(b*)(a*) in Evans (1937) and is identified by a combination of
brown dorsal forewing with white dots, single (upper) dot in discal cell, ventrally with pale-yellow area
by inner margin; most of dorsal hindwing is yellow with costal third brown, ventrally pale yellow, not
white, broadly brown at the outer margin and with submarginal dots encircled with brown, such dot in the
discal cell, and (frequently replaced with brown spots) 3—4 additional dots around.
Type material. Holotype: & deposited in the African Butterfly Research Institute, Nairobi, Kenya
[ABRI], collected in Central African Republic: Zomea, Oct-1982, ABRI-2019-2412, and its photographs
can be found in Williams (2023a), as the male “Ceratrichia punctata’ (misidentification). Paratypes:
20h 299: 12 with the same data as the holotype but Sep-1996 and ABRI-2019-2413; others in BMNH:
1o¢ 19 from Cameroon and 1c from Angola.
Type locality. Central African Republic: Zomea.
Etymology. This species was previously misidentified as “punctata”, which means “dotted” in Latin. A
Latin synonym of “punctata” is “notata”, which is adopted as the name of this species. The name “notata”
can also be translated as “noted”, and this species is noted for its larger white dots and bright colors and
for the confusion about its name due to misidentification that genomic analysis of primary type specimens
helped to resolve. The name is a feminine adjective.
Distribution. Western Africa, recorded from Cameroon, Central African Republic, and Angola.
74
Paronymus indeterminabilis (Strand, 1912) and Paronymus congdoni (Larsen, 2013)
are Species distinct from Paronymus semilutea (Mabille, 1891)
Genomic trees reveal that sister taxa Ceratrichia indeterminabilis Strand, 1912 (type locality Equatorial
Guinea [not Cameroon!]|: Benito [river] area, Monte Alen, syntypes sequenced as NVG-18073A07 and
NVG-18073A08) and Ceratricula semilutea congdoni Larsen, 2013 (type locality in Uganda) prior to this
publication treated as subspecies of Ceratricula semilutea (Mabille, 1891) (type locality Nigeria: Lagos,
syntype sequenced as NVG-21118G05) that we placed in Paronymus Aurivillius, 1925 (type species
Hesperia ligora Hewitson, 1876) (see above), are not monophyletic with C. semilutea (Figs. 45, 46) and
are well differentiated from it genetically with COI barcode difference of 3.0% (20 bp) and 3.6% (24 bp),
respectively, and from each other of 3.3% (22 bp). Therefore, we propose to treat them as species-level
taxa: Paronymus indeterminabilis (Strand, 1912), stat. rest. and Paronymus congdoni (Larsen, 2013),
Stat. nov.
Sematlea corvinus (Mabille, 1890) is a species distinct
from Semalea sextilis (Plétz, 1886)
Genomic sequencing of Cobalus corvinus Mabille, 1890 (type locality in Sierra Leone, type sequenced as
NVG-18075A05) currently treated as a junior subjective synonym of Semalea sextilis (Plétz, 1886) (type
locality in Ghana) reveals that it is not monophyletic with it and instead originates deep in the radiation of
Semalea Holland, 1896 (type species Hesperia pulvina Plotz, 1879) (Figs. 45, 46). Therefore, we reinstate
Semalea corvinus (Mabille, 1890), stat. rest. as a species-level taxon.
Xanthodisca Aurivillius, 1925 is a junior subjective synonym
of Semalea Holland, 1896
Genomic trees reveal that Semalea Holland, 1896 (type species Hesperia pulvina Plotz, 1879) in
paraphyletic with respect to Xanthodisca Aurivillius, 1925 (type species Astictopterus vibius Hewitson,
1878) (Figs. 45, 46). Restoring monophyly, we propose that Xanthodisca Aurivillius, 1925, syn. nov. is a
junior subjective synonym of Semalea Holland, 1896 due to genetic similarity.
Semalea malawi Grishin, new species
http://zoobank.org/A 1A A303B-9ABF-4F7C-B84B-2ABD765583DF
(Figs. 45—46 part, 48)
Definition and diagnosis. The mitochondrial genome tree reveals that a specimen from Malawi identified
as Semalea vibius (Hewitson, 1878), comb. nov. (type locality in Gabon) is sister to both S. vibius and
Semalea rega (Mabille, 1889), comb. nov. (type locality in Sierra Leone) (Fig. 46), suggesting that it is a
third species distinct from them. We sequenced primary type specimens of all four names associated with
S. rega and confirmed their synonymy (Figs. 45, 46). Specimens from western Africa (Cameroon, Congo)
serve as references for S. vibius. Therefore, the third species is new. In the COI barcode, it differs from S.
vibius by 1.1% (7 bp), which is larger than the difference between S. vibius and S. rega of 0.6% (4 bp).
Despite this moderate difference in the barcode, Fst/Gmin of 0.35/0.008 for S. vibius and S. rega indicate
that they are distinct species, in agreement with phenotypic distinction. However, we could not compute
these statistics for the new species because it is known from a single specimen (at least two specimens are
needed). This new species is distinguished from its relatives by the lack of subapical spots on the
forewing, larger forewing orange patch that reaches closer to the outer margin, palpi beneath and cheeks
more orange than yellow in color, and largely brown ventral hindwing, which is unspotted, and sparsely
overscaled with orange. Due to variability in phenotype, confidently identified by DNA: in the nuclear
genome: aly281.6.2:A130G, aly281.6.2:C131T, aly1249.8.1:T514C, aly1603.31.1:A370C, aly37338.23.1:C264T,
aly54.4.1:T1461T (not A), aly6648.1.2:A161A (not C), aly5294.20.2:T630T (not C), aly386.8.2:A506A (not T),
aly393.3.1:A492A (not G) and in the COI barcode: T88C, T118C, T139A, T202C, T547T, T610T, T646T.
PS
Fig. 48. Holotype of Semalea malawi sp. n. in dorsal (left) and ventral (right) views, data 1n text.
Barcode sequence of the holotype: Sample NVG-19043B12, GenBank OR589640, 658 base pairs:
AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATATTAGGAACATCTTTAAGTTTATTAATTCGAACTGAATTAGGTAATCCTGGCTCATTAATTGGAGATGATCAAATTTATAACACA
ATT GTAACAGCTCATGCATTTATTATAATTTTTTT TATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTCCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAA
TAAATAATATAAGATTTTGATTACTTCCCCCCTCCCTTACCTTATTAATCTCAAGAAGAATT GTAGAAAATGGAGCTGGAACTGGATGAACTGTCTATCCCCCCCTTTCATCTAATATTGC
TCACCAAGGTTCTTCTGTTGATTTAGCAATCTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTATCT
TTT GATCARCTACCTTTATTIGTTIGATCTIGTIGGTATTACTGCTIETACTTCTICTETCTITCTITACCTGTTTTAGCT GGAGCTATTACAATATTATTAACTGATCGTAATCTTAATACTT
CTTTTTTTGACCCTGCTGGAGGAGGAGACCCTATTCTTTATCAACATTTATTT
Type material. Holotype: & deposited in the American Museum of Natural History, New York, NY,
USA [AMNH], illustrated in Fig. 48, bears five labels: four white [ 11-viti-40. | & | Vizara | 2600’. |
Nyasaland | R. C. Wood ], [ vibius | vibius | & ], [DNA sample ID: | NVG-19043B12 | c/o Nick V.
Grishin ], [ {QR Code} | AMNH_IZC 00337937 |, and one red [ HOLOTYPE o& | Semalea malawi |
Grishin ].
Type locality. Malawi: ca. 9 mi E of Nkhata Bay, Vizara Rubber Plantation, elevation 2600’.
Etymology. The name is given for the country with the type locality. The name is a noun in apposition.
Distribution. Currently known only from the holotype collected in Malawi.
The type locality of Osmodes staudingeri Holland, 1896 is Cameroon: Efoulan
The type locality of Osmodes staudingeri Holland, 1896, currently treated as a junior subjective synonym
of Semalea rega (Mabille, 1889), comb. nov. (type locality in Sierra Leone) was given in the original
description as “Valley of the Ogové” (Holland 1896), which is in Gabon, frequently spelled as Ogooué
River Valley. This species was described from the female holotype in Holland’s collection, which is in
CMNH: “Type [not types] in my collection” and “I do not know the male of this species. The solitary
female in my collection ...,” which was illustrated (Holland 1896). N.V.G. found a female in CMNH with
the following five labels, white, but the 4" (without any text) red: [ Efulen, | Kamerun, | A. I. Good |
C.M. Acc. 4454 ], [ Osmodes | staudingeri | ¢ type Holl. |, [ unknown | to Mabille |, [ ], [ DNA sample
ID: | NVG-20125A08 | c/o Nick V. Grishin |. The female matches the original description perfectly and
agrees with the illustration rather closely. Provided that it carries its identification label (2"¢ label) in
Holland’s handwriting, it is the holotype of O. staudingeri. However, the locality label does not mention
“Valley of the Ogové,” but points to Cameroon: Efoulan (in current spelling). This is a more likely
locality because this species is not otherwise known from Gabon but recorded from Cameroon (Williams
2023b). Therefore, we hypothesize that the locality in the original description is erroneous, and the
locality label on the holotype points to its provenance. Hence, the type locality of O. staudingeri is
Cameroon: Efoulan, and genomic sequencing of the holotype confirms this taxon as a junior subjective
synonym of S. rega (syntype in MFNB sequenced as NVG-18073A03) (Figs. 45, 46).
76
Xanthoneura patmapana (Fruhstorfer, 1911) is a species distinct
from Xanthoneura corissa (Hewitson, 1876)
Two phenotypically different subspecies, Xanthoneura corissa corissa (Hewitson, 1876) (type locality in
Kalimantan) and Xanthoneura corissa patmapana (Fruhstorfer, 1911) (type locality in Java), are
genetically differentiated (Figs. 45,46) and differ by 4.1% (27 bp) in their barcodes. Therefore, we
propose treating Xanthoneura patmapana (Fruhstorfer, 1911), stat. nov. as a species distinct from
Xanthoneura corissa (Hewitson, 1876).
Lippina Grishin, new subgenus
http://zoobank.org/22B4014B-4B5D-45D4-8283-6C65583887B7
Type species. Carystus telesinus Mabille, 1878.
Definition. Genomic trees reveal that while Xanthoneura Eliot, 1978 (type species Hesperia corissa
Hewitson, 1876) is monophyletic (and we keep it as a single genus), it deeply splits into two clades: the
nominotypical and unnamed that represents a new subgenus. Members of this new subgenus key to
J.10.23. in Evans (1949) and are distinguished from their relatives by the 3% segment of palpi stout and
bent forward, ventral hindwing largely unmarked (or with a central spot), veins not yellower, forewing
with a spot in cell Mo-M3 right above the spot in cell M3-CuAj, these two spots together give an
appearance of a single larger spot; uncus in dorsal view much narrower than long, narrowing in the
middle, divided, arms small knob-like, not widely separated. A combination of the following nuclear
genomic base pairs is diagnostic: alyS77.16.2:T174C, aly577.16.2:TI198A, aly577.16.2:A216G, aly1591.7.3:
A333C, aly1222.40.2:A15G.
Etymology. The species of this subgenus are from [Phi|/ippin[es|+a. The name is a feminine noun in the
nominative singular.
Species included. The type species (1.e., Carystus telesinus Mabille, 1878) and Xanthoneura obscurior de
Jong & Treadaway, 2007.
Parent taxon. Genus Xanthoneura Eliot, 1978.
Perrotia Oberthiir, 1916 is a Junior subjective synonym of Galerga Mabille, 1898
Genomic trees reveal a tight clade of Malagasy species sister to a Malagasy genus Fulda Evans, 1937
(type species Hesperia coroller Boisduval, 1833) (Fig. 45, 46). Currently, these species are placed in two
genera: Perrotia Oberthiir, 1916 (type species Perrotia albiplaga Oberthitir, 1916) and Galerga Mabille,
1898 (type species Galerga hyposticta Mabille, 1898). However, the two genera are genetically close,
e.g., the COI barcode difference between their type species is 7.3% (48 bp), and not distinctly
differentiated from each other. Therefore, we propose to treat Perrotia Oberthiir, 1916, syn. nov. is a
junior subjective synonym of Galerga Mabille, 1898.
Galerga ariel (Mabille, 1878), new combination
Currently in Xanthodisca Aurivillius, 1925 (type species Astictopterus vibius Hewitson, 1878), Pamphila
ariel Mabille, 1878 (type locality in Madagascar) is not monophyletic with it and instead originates deep
within Galerga Mabille, 1898 (type species Galerga hyposticta Mabille, 1898) (Figs. 45, 46), where we
place it as Galerga ariel (Mabille, 1878), comb. nov.
Afrotropical species of Astictopterus C. Felder & R. Felder, 1890 belong
to [soteinon C. Felder & R. Felder, 1862
Genomic trees reveal that Afrotropical species currently placed in Astictopterus C. Felder & R. Felder,
1860 (type species Astictopterus jama C. Felder & R. Felder, 1860) are not monophyletic with it and
Tis
instead originate within /soteinon C. Felder & R. Felder, 1862 (type species Isoteinon lamprospilus C.
Felder & R. Felder, 1862) (Fig. 45, 46). Therefore, to restore monophyly, we transfer these species from
Astictopterus to Isoteinon, forming the following new combinations: /soteinon anomoeus (Pl6tz, 1879),
comb. nov. (type locality in Ghana), /soteinon bruno (Evans, 1937), comb. nov. (type locality in
Tanzania), [soteinon inornatus (Trimen, 1864), comb. nov. (type locality in South Africa), and /soteinon
punctulata (A. Butler, 1895), comb. nov. (type locality in Tanzania).
Mopala Evans, 1937 is a subgenus of Leona Evans, 1937
The monotypic genus Mopala Evans, 1937 (type species /smene ? orma P\6tz, 1879), which stands out by
the large white patch on ventral hindwing and otherwise unspotted wings, is genetically close to Leona
Evans, 1937 (type species Hesperia leonora Plotz, 1879) in our genomic trees (Fig. 45, 46), while they
both are distant from other genera that are their closest relatives. Male genitalia in both genera are similar
in the shape of uncus and valva, and all these species could be accommodated within one genus. Because
Mopala and Leona were described in the same work published on the same date, as the first revisers, we
give priority to Leona due to it being a larger genus, and propose that Mopala Evans, 1937 stat. nov. is a
subgenus of Leona Evans, 1937.
Ganda Grishin, new subgenus
http://zoobank.org/P9A4C7BA6-2C42-47E6-B619-ES54A20FF850E
Type species. Zophopetes ganda Evans, 1937.
Definition. Described by Evans (1937) in the genus Zophopetes Mabille, 1904 (type species Pamphila
dysmephila Trimen, 1868) and kept in it since, Z. ganda (type locality in Ivory Coast) is not monophyletic
with Zophopetes and instead is in the same clade with Leona Evans, 1937 (type species Hesperia leonora
Pl6tz, 1879) and its subgenus Mopala Evans, 1937 (type species Ismene ? orma Plétz, 1879): sister to the
subgenus Leona in the nuclear genome tree (Fig. 45) and sister to both Leona and Mopala, but less
confidently, in the mitochondrial genome tree (Fig. 46). In either case, it is closely related to them both
and yet genetically differentiated from them at approximately the same level as they are from each other.
Therefore, similarly to Mopala, the lineage with Z. ganda represents a subgenus of Leona. This new
subgenus keys to 53.A. in Evans (1937) and is distinguished from its relatives by males with a brand
(from the base of vein CuA; to near vein 1A+2A) and an apical spot on dorsal forewing (both absent in
Zophopetes), ventral hindwing uniformly pale-brown with small dark-brown-framed spots (not like Leona
and Mopala); upturned harpe, uncus in dorsal view narrower than in Zophopetes, especially in the middle,
with smaller knob-shaped arms. A combination of the following nuclear genomic base pairs is diagnostic:
aly1038.19.1:T165C, aly1405.10.1:T456C, aly925.11.3:A69G, aly587.17.1:T205A, aly2127.3.3:A24G,
aly 1838.61.1:T618T (not C), aly1838.61.1:T675T (not A), aly4305.26.4:C31C (not G), aly27.16.1:C354C (not
A), aly614.16.1:A1098A (not G).
Etymology. The name is a feminine noun in the nominative singular, a tautonym of the type species name.
Species included. Only the type species.
Parent taxon. Genus Leona Evans, 1937.
Balenga Grishin, new genus
http://zoobank. org/2 1 C6F5FF-4E85-4D88-AD3B-DO10BIFIIF7B
Type species. Proteides balenge Holland, 1891.
Definition. Currently, Gretnini Grishin, 2019 is a monotypic tribe consisting of a single genus Gretna
Evans, 1937 (type species Hesperia cylinda Hewitson, 1876). Inspection of genomic trees reveals that
Grenta balenge (Holland, 1891) (type locality in Gabon) is strongly differentiated genetically from the
78
rest of the genus (e.g., COI barcode difference of 10.9%, 72 bp), at least to the same extent as /sma
Distant, 1886 (type species /sma obscura Distant, 1886) from Jambrix Watson, 1893 (type species
Nisoniades salsala F. Moore, 1866) or Hyarotis F. Moore, 1881 (type species Papilio adrastus Stoll,
1780) from Quedara Swinhoe, 1919 (type species Quedara comoplea Swinhoe, 1919) and is at the tree
level corresponding to genera. Therefore, the lineage with G. balenge represents a genus-level taxon (Fig.
49). This new genus keys to 57.B. in Evans (1937) and is distinguished from its relatives by the subapical
forewing spot in cell Rs-M; being offset distad from others, uncus with processes at its base directed
sideways (one on each side, no processes in Gretna), and deeper separation between harpe and ampulla
that is more expanded than in Gretna. A combination of the following COI barcode base pairs is
diagnostic: T206C, A494T, A520C, A562C, A586T.
Etymology. The name is a feminine noun in the nominative singular, formed from the type species name.
Species included. Only the type species.
Parent taxon. Tribe Gretnini Grishin, 2019.
Gretna (Gretna) bugoma|21101C12|Cameroonl|old
{Gretna (Gretna) carmen|19043D09|Congo|1910
57 Gretna (Gretna) waga|21101D02|Cameroonl|old
Gretna (Gretna) capra [not carmen]|19043D08|Kenya|1933
Gretna (Gretna) cylinda|21101D07|Liberia|1958
Gretna (Zarida) lacida]21101D06|Cameroon|old
Gretna (Zarida) zaremba|21101D03|Cameroon|old
Balenga balenge zowa [not Grenta]|20124H02|HT|Liberia|1958
Balenga balenge balenge[not Grenta]|21101D09|Cameroonl|old
Isma protoclea purpurascens|17091D04|Sarawak|1966
Isma iapis|7774|Malaya|1989
Isma bononia|18014E03|Thailand|1899
Isma cronus|21105E10|Javal|old
Isma umbrosa|18101F07|Borneo|old
Isma guttulifera|18074E10|ST|Borneolold
Idmon latifascia|18101B04|Borneo|old
Idmon obliquans|21104H07|Borneolold
Idmon distanti|7806|Malaysia|1990
lambrix salsala|19067B04|Malaysia|1992
lambrix stellifer|19067B05|Malaysia|1992
Gretna (Gretna) bugoma|21101C12|Cameroonl|old b
Gretna (Gretna) carmen|19043D09|Congo|1910
, Gretna (Gretna) waga|21101D02|Cameroon|old
Gretna (Gretna) capra [not carmen]|19043D08|Kenya|1933
Gretna (Gretna) cylinda|21101D07|Liberia|1958
Gretna (Zarida) lacida|21101D06|Cameroonljold
Gretna (Zarida) zaremba|21101D03|Cameroon|old
;alenga balenge zowa [not Grenta]|20124H02|HT|Liberia|1958
Balenga balenge balenge [not Grenta]|21101D09|Cameroon|old
Isma protoclea purpurascens|17091D04|Sarawak|1966
Isma iapis|7774|Malaya|1989
Isma bononia|18014E03|Thailand|1899
Isma cronus|21105E10|Javal|old
Isma umbrosa|18101F07|Borneolold
Isma guttulifera|18074E10|ST|Borneolold
,o{dmon latifascia|18101B04|Borneoljold
Idmon obliquans|21104H07|Borneolold
Idmon distanti|7806|Malaysia|1990
lambrix salsala|19067B04|Malaysia|1992
lambrix stellifer|19067B05|Malaysia|1992
Hyarotis biseriata|18094B12|HT|Philippines|old Hyarotis biseriata|18094B12|HT|Philippines|old
Hyarotis adrastus|22048B03|India:Sikkim|1894 Hyarotis adrastus|22048B03|India:Sikkim|1894
Quedara basiflava|21105E07|India:Keralaljold — Quedara basiflava|21105E07|India:Keralaljold
Quedara Quedara monteithi|17091D02|Thailand|1899 oes Quedara monteithi|17091D02|Thailand|1899
0.02
Zarida
subgen. n.
Fig. 49. Phylogenetic trees of selected Gretnini species and ingroups inferred from protein-coding regions of a) the nuclear
(autosomes) and b) the mitochondrial genomes. Different genera are shown in different colors: Gretna (blue with subgenus
Zarida subgen. n. in violet and Gretna capra stat. nov. with Gretna carmen in orange), Balenga gen. n., [sma (cyan), Idmon
(magenta), Jambrix (green), Hyarotis (olive), and Quedara (brown).
Zarida Grishin, new subgenus
http://zoobank.org/699B2792-5716-45FF-B4D9-477760251BD8
Type species. Hesperia lacida Hewitson, 1876.
Definition. Within a smaller genus Gretna Evans, 1937 (type species Hesperia cylinda Hewitson, 1876)
due to removal of Balenga balenge Holland, 1891, comb. nov. (type locality in Gabon), we note the
genetic differentiation of a clade sister to that with the type species (Fig. 49). This clade diverges from
other Gretna at least at the tree level corresponding to subgenera (if not genera), i.e., approximately the
same as /sma Distant, 1886 (type species /sma obscura Distant, 1886) from /dmon Nicéville, 1895 (type
species Baoris unicolor Distant, 1886, a junior homonym, available name for this species is Jambrix
distanti Shepard, 1937) (Fig. 49), and we regard it as representing a subgenus. This new subgenus keys to
53.A.(a)(b') in Evans (1937) and is distinguished from its relatives by an undivided and much narrower
uncus, almost spike-shaped in dorsal view; better developed (and hyaline) spot in the middle of dorsal
hindwing, prominent spot in forewing cell CuA2-1A+2A, and clearly defined whitish bands or area on
ventral hindwing. A combination of the following COI barcode base pairs is diagnostic: T56C, T154C,
T379A, T553A, T556A.
Etymology. The name is a feminine noun in the nominative singular and is a fusion of species names in
this subgenus: Zar[emba]+|lac]ida.
79
Species included. The type species (i.e., Hesperia lacida Hewitson, 1876) and Telesto zaremba Plotz,
1884.
Parent taxon. Genus Gretna Evans, 1937.
Gretna capra Evans, 1937 is a species distinct from Gretna carmen Evans, 1937
Originally proposed as a subspecies, Gretna carmen capra Evans, 1937 (type locality in Kenya) is not
monophyletic with Gretna carmen Evans, 1937 (type locality in Cameroon) in genomic trees (Fig. 49)
and is strongly differentiated from it genetically, e.g., COI barcode difference of 3.6% (24 bp). Therefore,
we propose that Gretna capra Evans, 1937, stat. nov. is a species distinct from Gretna carmen Evans,
1937, as hinted by Larsen (1991).
Milena Evans, 1912 is a genus distinct from Caltoris Swinhoe, 1893
Genomic trees reveal that Caltoris Swinhoe, 1893 (type species Hesperia kumara F. Moore, 1878) as
currently circumscribed is not monophyletic, and phylogenetic positions of some species differ between
trees not being strongly supported in any of them (Fig. 50). One of such lineages is Caltoris plebeia
(Nicéville, 1887) (type locality in India): it is sister to the clade of Caltoris with its type species in the Z
chromosome tree (with weak support: 46% partitions), and sister to Prusiana Evans, 1937 (type species
Pamphila prusias C. Felder, 1861) in the nuclear genome tree from autosomes (58% of partitions) and
mitogenome (70% of partitions), indicating complex evolutionary history of this lineage. Recognizing the
uniqueness of C. plebeia, it has been chosen as the type species of the available genus-group name Milena
Evans, 1912, which is currently regarded as a synonym of Caltoris. Presently, we have decided to keep
Prusiana as a genus (instead of placing it as a subgenus in Caltoris) due to its genetic differentiation and
phenotypic differences. Therefore, to ensure monophyly of all the taxa, we propose that Milena Evans,
1912, stat. rest. is a genus distinct from Caltoris Swinhoe, 1893.
Tulsia Grishin, new genus
http://zoobank.org/52B76DE3-029E-4623-B87F-578013E5C53F
Type species. Parnara tulsi Nicéville, 1884.
Definition. Genomic trees reveal that the lineage of Caltoris tulsi (Nicéville, 1884) (type locality in India)
originates in rapid radiation and is not strongly grouped with any other single genus. Complemented with
its strong genetic differentiation from others (Fig. 50), it represents a genus-level taxon. This new genus
keys to M.7.12. in Evans (1949) and is distinguished from its relatives by forewing without tuft of scales
beneath and spots in discal cell, ventral hindwing in its basal half and ventral forewing along costal
margin overscaled with pale purplish (not ocherous) scales; uncus rounded at its distal end, only slightly
knobbed on the sides, ampulla expanded and pointed dorsad (not rounded at its apex). A combination of
the following nuclear genomic base pairs is diagnostic: aly2643.5.1:T192C, aly2613.4.2:G2377C, aly1877.
13.1:A892T, aly1877.13.1:T938C, aly1877.13.1:A1195T.
Etymology. The name is a feminine noun in the nominative singular formed from the type species name.
Species included. Only the type species.
Parent taxon. Tribe Baorini Doherty, 1886.
Afrogegenes Jong & Coutsis, 2017 and Torbenlarsenia Kemal & Kogcak, 2020
are subgenera of Gegenes Hiibner, 1819
Nuclear genome trees point to a strongly supported clade that is sister to Borbo Evans, 1949 (type species
Hesperia borbonica Boisduval, 1833) and includes type species of three genera: Gegenes Hiibner, 1819
80
a Iton semamora|7393|Myanmar|2001 b : Iton semamora|7393|Myanmar|2001
Polytremis lubricans|7396|Myanmar|2001 is Polytremis lubricans|7396|Myanmar|2001
a5 Gegenes (Gegenes) nostrodamus|17119G03|Greece|1963 Gegenes 77) Gegenes (Gegenes) nostrodamus|17119G03|Greece|1963
Gegenes (Gegenes) pumilio|7764|Greece|1990 Gegenes (Gegenes) pumilio|7764|Greece|1990
TT Gegenes (Afrogegenes) hottentota|18064D02|Kenya|1960 Afrogegenes Gan Gegenes (Afrogegenes) hottentota|18064D02|Kenya|1960
18 Gegenes (Afrogegenes) letterstedti|18073H05|South Africajold Tet Gatien cubeenth Gegenes (Afrogegenes) letterstedti|18073H05|South Africajold
ne A hares Gegenes (Havea) havei|21102D03|Madagascar|old Ws mee Gegenes (Havea) havei|21102D03|Madagascar|old
Too ©Gegenes (Flanga) perobscura [was Torbenlarsenia]|18019G03|Uganda|1954 Flanga subgen.n. __-—>5—— Gegenes (Flanga) perobscura [was Torbenlarsenia]|18019G03|Uganda|1954
Gegenes (Flanga) detecta|18102F08|Kenya|1960 Gegenes (Flanga) detecta|18102F08|Kenya|1960
88 a8 Gegenes (Torbenlarsenia) fallax}21102C08|/Cameroonlold 88 aT Gegenes (Torbenlarsenia) fallax]21102C08|Cameroon|old
Gegenes (Torbenlarsenia) holtzi]21102C12|Angola|old
Gegenes (Torbenlarsenia) sirena|21102D01|Angolaljold
16 Gegenes (Torbenlarsenia) micans|21102D02|Kenya|1958
Gegenes (Torbenlarsenia) fanta]21102C11|Malawilold
Gegenes (Torbenlarsenia) holtzi]21102C12|Angolalold
Gegenes (Torbenlarsenia) sirena|21102D01|Angolalold
By] Be Gegenes (Torbenlarsenia) micans|21102D02|Kenya|1958
Gegenes (Torbenlarsenia) fanta|21102C11|Malawilold
x; x Borbo Boronia 130 AGH amt np ee Tormeniarsenia Borbo borbonica|18054G08|Namibia|1993
orbo lugens|181 11|Kenya|1 Borbo lugens|18102F11|Kenya|1966
100 7 Borbo cinnara|18102F07|Taiwan|1980 100 Borbo tignar|181026 0-4] raiwen|1980
ort 36 Borbo ferruginea|21102D06|Kenyalold oT; Borbo ferruginea|21102D06|Kenyalold
100 Borbo gemella [not Torbenlarsenia}|21102D07|Madagascar|old ton 100 Borbo gemella [not Torbenlarsenia]|21102D07|Madagascar|old
Borbo impar ceramica|22016H12|LT|Seram Isl.|1884 Borbo impar ceramica|22016H12|LT|Seram Is!.|1884
joPorbo ratek|17119G06|Madagascar|1988 700 Borbo ratek|17119G06|Madagascar|1988
Se etapa lye ea[20 Peyote TATE aa
_ Brusa allardi21 10881 2langolalold. y 100 BPs ca alamieiaeoeteangoelaa ee
é : rusa allardi ngola|o
sa . :
. F— Chiov Gunestteiosntolieesee Cahors crummeslisiosnioperaioe
98 Caltoris philippina|18103A01|Philippines|1913 ae Caltoris philippina|18103A01|Philippines|1913
vn 100 eons FumeraligiO3A0e|inaia, Sikkiisjold ' aa Caltoris cahira]18097A11|India:Sikkim|old
) al : 1 i Caltoris kumara|18103A02|India:Sikkimlold
78 Caltoris aurociliata|21106H08|Northern Indialold Caltoris aurociliata|21106HO8|Northern Indialold
saa Frisina Rochniszosabos| ctsboc|io4 ere__[yq———~ rusiana prusiasgo4abtolceleben 1a
46 58 Prusiana kuehni|22048D09|Celebes|1940
i i j lena P : |
100 Mienteks are] rot Caliorellod i 1erossumatcajotd Seic i Milena plebeia [was Caltoris]|7389|Myanmar|2001
—— B ‘gana|18102HO06|India:Sikkimlold ' Tulsia tulsi [not Caltoris]|21116F03|Sumatra|old
saoris paga 8102HO06 a: SIKKIM | Ol¢ - Baoris pagana|18102H06|India:Sikkim|old
100——— {30 " Baoris aH A pitt via aint ale gris ] B pti ees 21106HO1 India Sikkim old
| 3 eechii|791 >hina:Sichuan|1982 [ > ic ech 1912/China:Sict 111982
Le eia|17091G11|Phillipines|1914 — 3 Sate oh LS OOT ET IPHlancetaNts
7 ae ris penicillata 21106HO5|India Sikkim|old LSS Baoris sehicillata 21106HOS\India Sikkimlold
re i poophiog smenselieid2e nichine sehuamtard soe ok Pelopidas assamensil18089F Olinda, Naga Hills|1988
: Pelopidas thrax|7768|Greece|1983. S Pelopidas sinensis|18102G10|China:Sichuanlold
38 i
2 Pelopidas jansonis|18102609|Japanjol a St ea ae
Too Pelopidas conjuncta|22048E05|Timor|1929 16 Pel RI ited P
; . 100 elopidas conjuncta|22048E05|Timor|1929
2 Pelopidas mathias|18099C09|Myanmar|2001 Pelopidas i i
00 Pelopidas agna|18102G02|Myanmar|2000 92 oreaae WM petra nL WL A Poe
Pelopidas lyelli|18102G09|Australia:Qld|1980 woo elopidas agna| Mysore
‘ A : Pelopidas lyelli]18102G09|Australia:Qld|1980
joo Zenonia (Zenonia) zeno|18096F07|Tanzanialold Zenonia (Zenonia) zeno|18096F07|Tanzanialold
100 Zenonia (Zenonia) crasta|]21102C02|Uganda|1952 Zenonia aoe i i
’ : : : 100 Zenonia (Zenonia) crasta|21102C02|Uganda|1952
100 Zenonia (Zenonia) anax|21102C05|Malawilold Zenonial;00 Z ia (Z : 21102 Malawilol
Zenonia (Zenonoida) discreta|19043E04|India|1963 ; rented ceneuie) apekieddocnuolmaan ag
100 P P Zenonoida Zenonia (Zenonoida) discreta|19043E04|India|1963
Zenonia (Zenonoida) eltola|7372|Myanmar|2003 100 ' F
100 700 -Zinaida nascens|18011A03|Chinalold Zenonia (Zenonoida) eltola|7372|Myanmar|2003
76 Zinaida caerulescens|18103A06|China:Sichuan|1930 100 700 rind orplmeauniee Mianare- vgs bere lb ey
Zinaida pellucida|18064C09|Japan|1963 76 Zinaida caerulescens|18103A06|China:Sichuan|1930
ae F inal Sy 9 Zinaida pellucida|18064CO9|Japan|1963
Zinaida zina|18103A10|China:Sichuan|old esidaeel China:Sich ld
Zinaida gigantea|21037A07|HT|China:Sichuan|1990 Zinaida Zinaida zina|18103A10|China:Sichuan|o!
7 Parnara guttatus|21105G11|China:Zhejiang|old Zinaida gigantea|21037A07|HT|China:Sichuan|1990
~-[h— Parmara poutier|7781iMadagascar)1990 pe ne ee ee en ate ne
Parnara amalia|18019D03/Australia:QIdjold 7 :
—————— on | | oe Parnara amalia|18019D03|Australia:Qid|old
Cc Iton semamora|7393|Myanmar|2001 d Iton semamora|7393|Myanmar|2001
Polytremis lubricans|7396|Myanmar|2001 Polytremis lubricans|7396|Myanmar|2001
ron Gegenes (Gegenes) nostrodamus|17119G03|Greece|1963 Too Gegenes (Gegenes) nostrodamus|17119G03|Greece|1963
Gegenes (Gegenes) pumilio|7764|Greece|1990 Gegenes (Gegenes) pumilio|7764|Greece|1990
+00 Gegenes (Afrogegenes) hottentota|18064D02|Kenya|1960 <a0 Gegenes (Afrogegenes) hottentota|18064D02|Kenya|1960
Gegenes (Afrogegenes) letterstedti|18073H05|South Africalold | 72 Gegenes (Afrogegenes) letterstedti|18073H05|South Africajold
ed edoor {roe Gegenes (Torbenlarsenia) fallax}21102C08|Cameroon|old 10g | 2° 0 Gegenes (Havea) havei|21102D03|Madagascar|old
et 4 100 Gegenes (Torbenlarsenia) holtzi|21102C12|Angola|old Gegenes (Flanga) perobscura [was Torbenlarsenia]|18019G03|Uganda|1954
ato Gegenes (Torbenlarsenia) sirena|21102D01|Angolalold Gegenes (Flanga) detecta|18102F08|Kenya|1960
ee Gegenes (Torbenlarsenia) micans|21102D02|Kenya|1958 34 ri Gegenes (Torbenlarsenia) fallax|21102C08|Cameroon|old
86 Gegenes (Torbenlarsenia) fanta]21102C11|Malawilold an Gegenes (Torbenlarsenia) holtzi]21102C12|Angola|old
Gegenes (Havea) havei|21102D03|Madagascar|old 5 700 Gegenes (Torbenlarsenia) sirena|21102D01|Angola|old
100 To) Gegenes (Flanga) perobscura [was Torbenlarsenia]|18019G03|Uganda|1954 ‘fa Gegenes (Torbenlarsenia) micans|21102D02|Kenya|1958
Gegenes (Flanga) detecta|18102F08|Kenya|1960 Gegenes (Torbenlarsenia) fanta]21102C11|Malawilold
a 300 Borbo borbonica|18054G08|Namibia|1993 Borbo impar ceramica|22016H12|LT|Seram Is!.|1884
Borbo lugens|18102F11|Kenya|1966 100 AOD Borbo ferruginea|21102D06|Kenya|old
100 Borbo cinnara|18102F07|Taiwan|1980 * 100 Borbo gemella [not Torbenlarsenia]|21102D07|Madagascar|old
56 err Borbo ferruginea|21102D06|Kenyal|old 99 100 Borbo cinnara|18102F07|Taiwan|1980
100 100 Borbo gemella [not Torbenlarsenia]|21102D07|Madagascar|old 300 Borbo lugens|18102F11|Kenya|1966
Borbo impar ceramica|22016H12|LT|Seram Is!.|1884 ay Borbo borbonica|18054G08|Namibia|1993
;oPorbo ratek|17119G06|Madagascar|1988 i00 Borbo ratek|17119G06|Madagascar|1988
Borbo fatuellus|18102F09|Uganda|1958 Borbo fatuellus|18102F09|Uganda|1958
300 Pseudoborbo bevani|18099C06|Myanmar|2001 Caltoris cormasa|18038H09|Malaysia|2018
Al Brusa allardi|21102B12|Angolalold Dad pers Caltoris brunnea|18102H10|Javalold
Baoris pagana|18102H06|India:Sikkimjold 100 Caltoris philippina|18103A01|Philippines|1913
— Baoris farri|21106HO1|India:S zs 6a TT Caltoris cahira]18097A11|India:Sikkimjold
4 Baoris leechii|7912|China:Sichuan|1982 Caltoris kumara|18103A02|India:Sikkim|old
- Baoris oceia|17091G11|Phillipines|1914 Caltoris aurociliata|21106HO8|Northern Indialold
—— Baoris penicillata|21106HO05|India:Sikkim|old $3 Milena plebeia [was Caltoris]|7389|Myanmar|2001
100 Be Pelopidas assamensis|18089F04|India,Naga Hills|1988 un 500 Prusiana prusias|22048D10|Celebes|1896
T00 Pelopidas sinensis|18102G10|China:Sichuan|old " Prusiana kuehni|22048D09|Celebes|1940
7 Pelopidas mathias|18099C09|Myanmar|2001 Pr Tulsia tulsi [not Caltoris]|21116F03|Sumatra|old
a Pelopidas iyeni|8102G09|austratia ‘bid! 980 = ice Hey allardile1102B12|Angolajold.
De fe te Pelopidas jansonis|18102G08|Japan|old “4 7B l : — Baoris pagana|18102H06|India:Sikkim|old
a Pelopidas conjuncta|22048E05|Timor|1929 ot : — — Baoris farri]21106HO1|India:Sikkimlold
Pelopidas thrax|7768|Greece|1983 | t Baoris leechii|7912|China:Sichuan|1982
Tulsia tulsi [not Caltoris]|21116F03|Sumatra|old [[bewiars Baoris oceia|17091G11|Phillipines|1914
rns Caltoris cormasa|18038H09|Malaysia|2018 100 —— Baoris penicillata]21106H05|India:Sikkimjold
ty oer pales est ede herb oa ; Wins Pelopidas assamensis|18089F04|India,Naga Hills|1988
2 altoris philippina| |Philippines| 7) Pelopidas sinensis|18102G10|China:Sichuan|old
too ~Caltoris cahira]18097A11|India:Sikkim|old 10's Pelopidas jansonis|18102G08|Japan|old
Caltoris kumara|18103A02|India:Sikkim|old Pelopidas thrax|7768|Greece|1983
“ Caltoris aurociliata|21106HO8|Northern Indialold 98 _ Pelopidas agna|18102G02|Myanmar|2000
00 wae peesaehed DAEDRIC enciae ae 100 Pelopidas mathias|18099C09|Myanmar|2001
eS piisiane prusiasi22048D10|Celebes] 1896 ss ee elopliies cunjunctal22p4SEO5[timer1929
I I C elopidas conjuncta imor
7o0 Znonia (Zenonia) zeno|18096F07|Tanzanialold <oZenonia (Zenonia) zeno|18096F07|Tanzanialold
7Stnis enone) ansn 2 tezcoe|elowible enone eee (Gerona) aney}e4v6scos Malawiol
( l I | 100 enonia (Zenonia) anax alawilo
Darotes anonblday hols iaeinvcaneooose 7 Zenonia (Zenonoida) discreta|19043E04|India|1963
Zinaida ‘geconel 1801103|Chinalald a rl eae a BOT IAOSIChesiols oa
Mee ° , 85 inaida nascens inalo
Zinaida caerulescens|18103A06|China:Sichuan|1930 100 — Zinaida caerulescens|18103A06|China:Sichuan|1930
einginaida pollucida|18b64C08|Japan{io63 81 Zinaida zina|18103A10|China:Sichuan|old
zinaide al TeIGaTAOT HTIChi a fh 1990 oo Zinaida gigantea|21037A07|HT|China:Sichuan|1990
inaida gigantea| |HT|China:Sichuan| Zinaida pellucida|18064C09|Japan|1963
rr er een a a ey EO
ig f : ~4 78 arnara poutieri adagascar
Parnara amalia|18019D03|Australia:QIdjold Parnara amalia|18019D03|Australia:Qld|old
0.02 —— 003
Fig. 50. Phylogenetic trees of selected Baorini species inferred from protein-coding regions of a,b) the nuclear genome
(autosomes), b) proportionally rescaled to bring leaves to the same level, c) the Z chromosome, and d) the mitochondrial
genome. Parnara 1s genetically removed from the rest, and the corresponding tree branches were truncated (as indicated by
dots) to save space. The translucent vertical lime bar in (b) denotes the level approximately corresponding to genera. Shown by
branches they refer to, names of genera are in bold italics, and subgenera are in italics: Gegenes (blue with Havea subgen. n.
red and Flanga subgen. n. aquamarine), Borbo (olive), Baoris (gray), Tulsia gen. n. (magenta), Caltoris (violet), Milena stat.
rest. (bright green), Prusiana (brown), Zenonia (cyan with subgenus Zenonoida stat. nov. orange), and Zinaida (purple).
81
(type species Papilio pumilio Hoffmansegg, 1804), Afrogegenes Jong & Coutsis, 2017 (type species
Hesperia hottentota Latreille, 1824), and Torbenlarsenia Kemal & Kogak, 2020 (type species Hesperia
holtzi Plotz, 1882) in addition to several species currently in Borbo Evans, 1949 (type species Hesperia
borbonica Boisduval, 1833) (Fig. 50). However, within this clade, strongly supported major subclades are
absent, and 7orbenlarsenia as currently circumscribed (Fan et al. 2016) is not monophyletic. Moreover,
Torbenlarsenia gemella (Mabille, 1884) (type locality in Madagascar) is not in this clade but belongs to
Borbo, where we transfer it as Borbo gemella (Mabille, 1884), stat. rev. This whole clade with Gegenes
is at the genus level in the tree and splits into five confident subclades, three of which represent named
genus-group taxa: we propose to treat Afrogegenes Jong & Coutsis, 2017, stat. rev. and Torbenlarsenia
Kemal & Kocak, 2020, stat. rev. as subgenera of Gegenes Hiibner, 1819. The remaining two subclades
do not have names and are described as new subgenera below. Finally, to restore the monophyly of
Borbo, we transfer several species to the subgenus 7orbenlarsenia, forming new combinations: Gegenes
(Torbenlarsenia) cottrelli (Larsen, 2013), comb. nov., Gegenes (Torbenlarsenia) fallax (Gaede, 1916),
comb. nov., Gegenes (Torbenlarsenia) fanta (Evans, 1937), comb. nov., Gegenes (Torbenlarsenia)
micans (Holland, 1896), comb. nov., and Gegenes (Torbenlarsenia) sirena (Evans, 1937), comb. nov.
Flanga Grishin, new subgenus
http://zoobank.org/894F0986-7046-4A95-8D78-73 1C61C881A0
Type species. Parnara perobscura H. H. Druce, 1912.
Definition. As discussed above and shown in the trees (Fig. 50), the newly expanded genus Gegenes
Hiibner, 1819 (type species Papilio pumilio Hoffmansegg, 1804) can be partitioned into five subgenera.
The species previously called Torbenlarsenia perobscura (H. H. Druce, 1912) (type locality in Ghana) is
not monophyletic with Hesperia holtzi Plétz, 1882 (type locality in Angola), which is the type species of
Torbenlarsenia Kemal & Kogak, 2020, and belongs to a distinct clade that we define as one of the five
subgenera. It does not have a name. This new subgenus keys to 68.B.(b)(a!)(a7)(a°) in Evans (1937) and is
distinguished from its relatives by long, finger-like flanges at the base of uncus and thinner, more
terminally rounded tooth of harpe projecting anteriad. A combination of the following nuclear genomic
base pairs is diagnostic: aly151.39.1:A351T, aly1139.20.2:A245C, aly1412.8.1:G430C, aly1412.8.1:C431A,
aly 1349.7.9:G58T.
Etymology. The name is a feminine noun in the nominative singular and refers to long flanges from the
base of uncus that identify this subgenus.
Species included. The type species (1.e., Parnara perobscura H. H. Druce, 1912) and Pamphila detecta
Trimen, 1893.
Parent taxon. Genus Gegenes Hiibner, 1819.
Havea Grishin, new subgenus
http://zoobank.org/48 16F043-591A-46E9-B19C-5C9761CD7AD9
Type species. Hesperia havei Boisduval, 1833.
Definition. As discussed above and shown in the trees (Fig. 50), the newly expanded genus Gegenes
Hiibner, 1819 (type species Papilio pumilio Hoffmansegg, 1804) can be partitioned into five subgenera.
The lineage with the species currently called Borbo havei (Boisduval, 1833) (type locality in Madagascar)
corresponds to the last one (others discussed above). This new subgenus keys to 68.B.(b)(b')(c’) in Evans
(1937) and is distinguished from its relatives by narrower uncus terminally rounded in dorsal view with
approximately parallel sides (not concave, and not gradually narrowing distad) and ampulla expanded
distad and rounded, nearly reaching the distal end of harpe, which is with a sharp, tooth-like process
directed anterodorsad at its base. A combination of the following nuclear genomic base pairs is
diagnostic: aly1952.2.12:C46T, aly1952.2.12:T48A, aly310.6.1:G1542C, aly4196.3.1:T1023C, aly4196.3.1:
G1039T, aly127.59.2:T289T (not C), aly6209.2.1:T1095T (not G), aly813.4.5:A855A (not C), aly275211.12.
82
5:A60A (not G), aly7600.1.6:T103T (not A).
Etymology. The name is a feminine noun in the nominative singular formed from the type species name.
Species included. Only the type species.
Parent taxon. Genus Gegenes Hibner, 1819.
Zenonoida Fan & Chiba, 2016 is a subgenus of Zenonia Evans, 1935
Genomic trees reveal that genetic differentiation between Zenonia Evans, 1935 (type species Pamphila
zeno Trimen, 1864) and Zenonoida Fan & Chiba, 2016 (type species Hesperia eltola Hewitson, 1869) is
smaller than that within their sister genus Zinaida Evans, 1937 (type species Parnara nascens Leech,
1893) and places the former two at the subgenus tree level (Fig. 50). COI barcodes of their type species
differ by 8.8% (58 bp). Furthermore, these genera are phenotypically close, and neither of them includes a
large number of species. Therefore, we propose that Zenonoida Fan & Chiba, 2016, stat. nov. is a
subgenus of Zenonia Evans, 1935.
On the distribution of Euphyes vestris (Boisduval, 1852)
and Euphyes kiowah (Reakirt, 1866)
On the basis of genetic differences, Euphyes kiowah (Reakirt, 1866) (type locality in the USA: Colorado,
Rocky Mountains) was regarded by Zhang et al. (2022b) as a species distinct from Euphyes vestris
(Boisduval, 1852) (type locality in
USA: California, Plumas Co.). Here, we
investigate the distribution of these two
Species using genomic sequencing and
analysis. Specimens from across the
range were selected for sequencing
(Fig. 51), and genomic trees are shown
in Fig. 52. Both autosome and Z
chromosome trees confirm prominent
genetic differentiation between the two
species (EF. vestris and E. kiowah). In
the US, Euphyes kiowah is confined to
the south-central area, confirmed from
Colorado, Arizona, New Mexico, and
Texas (excluding northeastern, eastern, re ee
and coastal regions) (Fig. 51 squares), oe
and EF. vestris occurs everywhere else VLE @ - harbisoni
© § ° @ - metacomet
(Fig. 51 circles). Interestingly, the Euchist Rowal
entire central Texas (Edwards Plateau 3 mi - kiowah
Bi - chamuli
region) is inhabited by E. kiowah, but
pa 2 : f Fig. 51. A map of sequenced specimens: Euphyes vestris (circles, purple
E. vestris is found immediately to the | and shades of blue) and Euphyes kiowah (squares, shades of red) with their
south of it in more coastal regions. The subspecies: E. vestris osceola (purple), E. vestris vestris (darker blue), E.
vestris harbisoni (paler blue), E. vestris metacomet (sky blue), E. kiowah
eastern boundary between these two kiowah (red), and E. kiowah chamuli (maroon).
parapatric species is relatively straight
in the northwest-to-southeast direction and likely goes through northeastern Colorado, Oklahoma, and
Texas panhandles and towards the Texas coast, where the boundary turns southwest to circumvent coastal
areas. Studies of specimens along this boundary may bring insights into the speciation process and
isolation mechanisms of these two species. On the western side, E. kiowah and E. vestris are separated by
the Great Basin, in which neither species seems to be present. As a result, we see that the distribution of
E. vestris engulfs that of E. kiowah, the latter being restricted to more arid areas.
83
10 Euphyes vestris. osceola|22101H12|USA:CA,Mendocino ies Euphyes vestris Decree Orc Lasnecrce tapae Co.|1962
a Euphyes vestris osceola|22102A04|USA:CA,Sonoma Co.|1959 osceola Euphyes vestris osceola|22102A01|USA:CA,Mendocino Co.|1953
Euphyes vestris osceola}PAO410|USA:CA,Sonoma Co.|2017 ee yes vestris osceola| Gta TAA ipa wg g ese Co.|1982
osceola (2 uphyes vestris osceola|22102A02|USA:CA,Sonoma Co.|1982 uphyes vestris osceola|22102A Saree eo Pangite 0.|1959
7 Euphyes vestris osceola|3248|USA:CA,Sonoma Co.|1971 Besa Euphyes vestris osceola|3 tea ,Sonoma Pee
EG Euphyes vestris osceola|22102A01|USA:CA,Mendocino Co.|1953 ie Euphyes vestris osceola}|PAO410|USA:CA,Sonoma Co.|2017
7 ph sd po vestris ae PO ee yaa etatoneae ie Co.J1953 Euphyes vestris pee be oe pL rat a A Co.|1959
Euphyés vestris Re tapaes b 2102A03|USA:CA,Sonoma Co.|1959 — Euphyes vestris osceola|22102B06|USA:CA,Mendocino Co.|1953
Euphyes vestris vestris|221 meornat :CA, Siskiyou pag Utes es foes vestris vestris|15102A11|USA:OR, Yamhill Co.|1977
9B uphyes epee ONE) EAT SL oe 0.|2005 1 uphyes vestris vestris]1710 PO oneanal Thurston Co.|1985 :
Euphyes vestris vestris|2208 OOF USAY V,Washoe eo ae 94,0 B Euphyes vestris vestris|22087D06|Canada:British Columbia|1962
Euphyes vestris eel -A0444|USA:CA,Plumas Co.|2017 Oy 4s Euphyes vestris retard aeatct dt (MIO Ces Co.|2001
Euphyes vestris Leyte ep rare ATPL Co.|1997 i 7 Euphyes vestris vestris|22087D03|USA:OR, Klamath Co.|2007
Euphyes vestris rh ab |USA:CA, Sierra Co./1947 0) Euphyes vestris vestris|22102B12|USA:CA, Sierra Co.|1947
! . vestris vestris|22 6 700e|Ganada-Fritish rt pth lene S 7) Euphyes vestris ee ee Ec ad A ay ere rag Ah
vestris Euphyes vestris vastly eacil SA:OR,Klamath Co.|200 ty Euphyés vestris vestris]17108B05|USA:WA, Kittitas Ce See ya
Euphyes vestris vestris|22102B08|USA:OR, Josephine Co.|1975 7 — Euphyes vestris vestris|22087D05|USA:WA, Kittitas Co.|1996
E. vestris AEE aa ben WA, Kittitas ee Rte Euphyes vestris vestris|22102B08|USA: HCH ra wot Co.|1975
Euphyes vestris vestris|17108B05|USA:WA Kittitas Co.,|198 - Euphyes vestris vestris|22087C12|USA:CA,Plumas Co.|1997
6 lei eed vestris vestris|1 Lee OCALA Teen Co.|1992 7) 2 Euphyes vestris Vestris|22087D02|USA:NV,Washoe Co.|2002
Eup Fee ue Meer nee, JUSA:WA, Thurston Co.|1985 — Euphyés vestris vestris|PAO444|USA:CA, Plumas Baie aes
Euphyes vestris ver ciaerr DO4|USA:OR, Benton Co.|2001 he — 30 Euphyes vestris aa aNd yr ete be Co.|1960
Euphyes vestris vestris]15102A11|USA:OR, Yamhill Co.|1977 2 & Euphyes vestris a TUE etal SA:CA,San Diego Co.|1963
. Vestris harbisoni|2: or |USA:CA,San Diego Co.|1980 ie) a Pues vestris vestris|22087D01|USA:CA, Siskiyou Co,|2005,
Euphyes vestris harbisoni/eco TIN peat ata iego Co.|1963 rh) D775 44 Euphyés vestris harbisoni|22094D0/7|USA:CA,San Diego Co.|1939
Eupnye vestris harbisoni|2 aera A:CA,San Diego Co.|1987 Ss Euphyes vestris harbisoni|22094D05|USA:CA,San Diego Co.|1987
harbisoni ME yes vestris Fen aul eas tea USA:CA,San Diégo Co.|1939 > S v7, Euphyes vestris harbisoni|150 BvCaT Moots Diego Co.|1981
. vestris harbisoni|15 PF bik SA:CA,San Diego Co.|1982 & Euphyes vestris I As Semen ate Diego Co.|1982
Euphyes vestris harbisoni|[15102B02|PT|USA:CA,San Diego Co.|1982 ~ a Euphyes vestris harbisoni|22094D09|PT|USA:CA,San Diego Co.|1980
Euphyes vestris harbisoni|1509 Pele ona oan Diego Co.|1981 oO uphyes vestris harbisoni|15097D06| eS Cana Diego Co.|1982
b Eupiyes vestris metacomet| feodeanis anada:Manitoba|1962 = el vestris Fe nae 7E12|Canada:Nova Scotia|]1971
2 uBnyes vestris metacomet|22064H Bao Fall River_Co.|1988 fo} 70 Euphyes vestris metacomet|20059E0 Senate Co.|2009
0 Mphiyes vestris Mapes ats aS fen earls Co.|1964 3 Euphyes vestris metacome yeaa USA:ME,Hancock Co.|1978
. vestris metacomet|22087E04|USA:SD,Rennington Co.|1981 oO ones vestris metacomet|21032H03|USA:ME,Hancock Co.|1978
Euphyes vestris metacomet|21032H03|USA:ME,Hancock Co.|1978 ~ q uphyes vestris metacomet|21049C07|USA:ME, Piscataquis Co.|1985
> uphyes vestris metacomet|21049C07|USA:ME, Piscataquis Co.|1985 i) BAe! err} Eupaees vestris eeu feecenos Canada: Saskatchewan|1962
Euphyes vestris metacomet|22087F01|USA:ME, Lincoln Ge eaes € 6 Euphyes vestriS metacomet|22087E10|Canada: Heat ;
: Euphyes vestris Lar gto ang EOA ES ME,Hancock Co.|1978 Euphyes vestris metacomet|22087E11|Canada:Ontario|1989
Se ej Euphyes vestris metacomet|22064H07|USA:NE, Sioux Co.|2004 4 Euphyes vestris Te aC Oe ige: SA:MN,Lake Co.|1985
0 Euphyes vestris metacomet|22064HO9|USA:ND,Ransom Co.|2003 Euphyes vestris metacomet|22 i acta i a Co.|1973__
w~ gj 0 Euphyes vestris metacomet|22087F09 Penee ou e. Co.|1973 1) Euphyes vestris ede Ea ee A:SD,Fall River Co.|1988
® Euphyes vestris metacomet|22064H11]USA:NE, Brown Co.|1987 2 Euphyes vestris metacomet]|2208 mente L,Collier Co.|1989
§ eupn ies vestris metacomet| aay pi aulig Co.|197 5 Euphyes vestris metacomet|22087F0 el incoln Sa eo as
>) 0 2 uphyes vestris metacomet|22064H10|USA:NE, Sioux Co.|1982 7 Euphyes vestris metacomet|22087F07|USA:MN,Koochiching Co.|1988
ra E. v. metacomet|22087E08|Canada:Saskatchewan|1962 Fi uphyes vestris metacomet|22087F08|USA:IA,Dickonson Co.|1970
o E. vestris metacomet|22087E12|Canada:Nova Scotia]1971 Euphyes vestris metacomet|3252|USA:OH, Paulin SREY
tS | (Ko 5 Euphyes vestris metacomet|22087E03|USA:SD,Fall River Co.|1983 7 upiyes vestris metacomet (=os aoe 12|LT|USA:LA, Orleans Pa.|old
o 0 E. vestris metacomet|22087F08|USA:1A,Dickonson Co.|1970 Euphyes vestris metacomet|22064H09|USA:ND, Ransom a
& Y Euphyes vestris metacomet PTE ER MA ese tye BS 0 rT) E. vestris metacomet ae gO ida onigomery Co.|1999
Euphyes vestris metacomet|22087F06|USA:MN, Aitkin Co.|1980 Euphyes vestris metacomet|2208 Ae A tigga Co.|1987
7 Euphyes vestris metacomet Beene unity 7G12|LT|USA:LA,Orleans Pa 0 Euphyes vestris metacomet|22087E01|USA:NE,Dawes Co.|1984
0 Euphyes vestris metacomet|200 AB epee aguas tL at Gd Co.|1999 + 100 Mtr) Euphyes vestris metacomet|22087E04|U Ab Renaingion Co.|1981
n Euphyés vestris metacomet|2 eh SA:NY,Hamilton Co.[2009 a Euphyes vestris metacomet|220 Lorene dents Co.|1980
Euphyes vestris metacomet|22058C06|USA:IN,Perry Co.|2021 A Euphyes vestris metacomet|22087E05|USA:NE, Souix Co.|1964
9 Euphyes vestris metacomet|21 Rr pet Rae ape Co.|1989 Euphyes vestris metacomet|21032H02|USA:NJ,Sussex es Sd
ae : E. vestris metacomet|22087E09|Canada:Manitoba|1996 3 Euphyes vestris metacomet|22058C06|USA:IN,Perry Co.|2021
7 0° Euphyes vestris metacomet|22087F03|USA:AL,Cullman Sree on 5 Euphyes vestris metacomet|22087E03|USA:SD,Fall River Co.|1983
q 7) Euphyes vestris metacomet Sud ree ean eee Co.|1961 ; Euphyes vestris metacomet|22064HO7|USA:NE, Sioux Co.|2004
~W uphyes vestris metacomet|22087F Suen euneed a has p Euphyes vestris metacomet|22087E06|USA:ND,Slope Co.|1961
— Eupiee vestris metacomet|2 aerate A:NE,Souix Co.|1964 6 Euphyes vestris metacomet|22087F03|USA:AL,Cullman Co.|2010
he u Tee vestris metacomet|17108B04|USA:KS, Barber Co.|2002 K Euphyes vestris metacomet|22087E07|USA:NE,Souix Co.|1964
~~ uphyes vestris Rear eae ry sar te Co.|1989 : — E. vestris metacomet|22087E09|Canada:Manitoba|1996
” E. vestris metacomet|22087F1 ai SA:TX,San Patricio Co.|1968 : Euphyes vestris Ste con eN epee au aU emus Veh Micke
® Euphyes vestris Pea aati :TX, Jefferson oo Euphyes vestris metacomet|21049C06|USA:MA, Middlesex Co.|1989
Euphyes vestris metacomet|21049C11|USA:LA, Tangipahoa Pa.|1992 Euphyes véstris metacomet|22064H11|USA:NE,Brown Co.|1987
phy i gip phy
> Euphyes vestris iene pete py aera yd ean eon Co.|1971 i Euphyes vestris metacomet|3925| See eenonicny eke bg
4 Euphyes vestris metacomet|22087F02|USA:PA, Tioga Co.|1987 38 a E. vestris metacomet|22087F1 Wie :TX,San Patricio Co.|1968
Een es vestris metacomet|3925 TEAS ary oe ad Co.|2015 E. vestris meron ea er oh henpy Co.|2006
uphyes vestris metacomet|4200|USA:TX,Dallas Co.|201 66 eas vestris sterol y era) SA:TX,San Particio Co.|1968
Euphyes vestris metacomet|4327|USA:IN, Newton Seater rT) uphyes vestris metacomet|17108B04|USA:KS, Barber Co.|2002
Euphyes vestris metacomet|4614|USA:FL,Sumter ae T5444 SHpryGS vestris metacomet eA ape ag Co.|2015
E. vestris metacomet(22087F07|USA:MN,k oer Co.|1988 Md iphyes vestris metacomet|/3251|USA:TX, Jefferson an
Euphyes vestris metacomet|7699|USA:TX,San Particio Co.|1968 5q Euphyés vestris metacomet|4327|USA:IN,Newton Co.|2015
E. vestris metacomet (=rurea)|15096D01|NT|USA:IL,Mercer eon iae! 60.35 E. vestris De eae eer ees Pa.|1992
Euphyes vestris metacomet|21049C10(USA:LA,St Tammany Pa.|1997 "7 Euphyes vestris metacomet|4 LaF Sumter Co.|2015
bh LES Euphyes vestris metacomet|22087E01|USA:NE,Dawes Co.]1984 E. vestris metacomet (=rurea)|15096D01|NT|IL,Mercer Co.|1967
Ms ua
3 - E. vestris metacomet|22087G02|USA:TX,Hemphill Co.|2006 <= E. vestris metacomet|21049C10|USA:LA,St Tammany Pa.|1997
3 Euphyes kiowah kiowah|3199|USA:TX,Pecos eos 5 ’ & Euphyes kiowah kiowah|3201|USA:CO,El Paso ile
; la A iowah Baers oc ae JUSA:TX, Travis Co.|1993 Euphyes kiowah kiowah|22087D09|USA:TX,Culberson Co.|2000
7 Euphyes kiowah kiowah|8743|USA:TX, Randall Co.|2017 Euphyes kiowah kiowah|22087G04|USA:TX,Bexar hap sy
0 uphyes kiowah kiowah], ee Th ar Co.|2002 Te) op i 7} Euphyes kiowah kiowah|22087G06|USA:TX,Edwards Co.|1973
5 Euphyes kiowah kiowah|220 et pea ey ia Kerr Co.|1981 [ Euphyes kiowah chamuli|22087C11|Mexico:Chia|1972
Euphyes kiowah kiowah|2 ead RA A:TX,Kinney Co.[1997 he] 7 ale ad kiowah pripeoallh Rit) ee :TX,Blanco Co.|2017
fajne se; — Euphyes kiowah hlowanle 087G06(USA:TX, Edwards Co.|1973 < Euphyes kiowah kiowah|220 AGO USAL TX Real Co.|2002
i co Ta Euphyes kiowah kiOwah|22087G01|USA:TX,Real aes O = be kiowah kiowah|8743|USA:TX,Randall Co.|2017
ors uphyes kiowah kiowah|8380|USA:TX,Blanco Co.|2017 y uphyes kiowah kiowah]31 BSN eeEe Rice {1975
© 0 Euphyes kiowah kiowah|22087G04|USA:TX, Bexar Co.|1999 A Euphyes kiowah kiowah/2208 ry SH eG Co.|1997
= r Euphyes kiowah kiowah|3250|USA:TX,Uvalde Co.|1992 Euphyes kiowah kiowah|3202|Mexico:N L978
ela kiowah kiowah|22087D10|USA:OK,Cimarron Co.|1988 16 Euphyes kiowah kiowah|7581|USA:TX,Brewster Co.|1971
(o Fag pig rT Euphyes kKiowah Wnt tesed re hh ieee a ape Co.|2019 d Euphyes kiowah kiowah|22087G07|USA:TX, Travis Co.|1993
hd 0 Euphyes kiowah povenie tne 2|USA::CO, Jefferson Co.|2022 Euphyes kiowah a US EE CaS UC:
x 7] a Hh kiowah kiowah|3201|USA:CO,EI! Paso Co.|1982 0 Euphyes kiowah kiowah|3200|USA:NM, Otero Bole
uphyes kiowah kiowah]15102A09|USA:CO, Boulder Co.|1985 ks Tr Euphyes kiowah kiowah|22087G05|USA:TX,Kerr Co.|1981
Euphyes kiowah pet RE A UST eS Co.|1971 0 Euphyes kiowah kiowah|22087D08|USA:NM, Santa Fe Co.|1989
2 Euphyes kiowah pwn. oe USA:TX,Brewster Co.|1961 ors Euphyes kiowah kiowah|PAO1422|USA:CO, Jefferson Co.|2019
a} y er ithe iowah kiowah|22087D0 Ae EE Co.|2000 Euphyes kiowah kiowah|22064C12|USA::CO Jefferson Co.|2022
< 7) uphyes kiowah led EEA A:NM, Otero Co.|1977 Euphyes kiowah cf aol ceeett SE Co.]1992
© Euphyes kiowah kiowah]15102B04|USA:NM, Otero Co.|1986 Euphyes kiowah kiowah|758 Pees eta See
= Euphyes kiowah kiowah/15102B03/USA:NM, Otero Co.|1986 {Ls Euphyes kiowah kiowah|2208 COs Wont e avalde 0.|2002
“ 12 Eupayes kiowah kiowah|2 AE anal tay bla Co.|1986 oF Euphyes kiowah kiowah|22087D10|USA:OK,Cimarron Se eee
= ° ae Euphyes kiowah kiowah|22087D1 Dita ne econne Co.|1981 0 Euphyes kiowah chamuli rae Wie betel oe pe 972
TH Euphyes kiowah kiowah|22087D0. af era ee Fe Co.|1989 114 Euphyes kiowah kiowah ery, SA:NM, Otero Bouse
Supe iowah kiowah|22087D07|USA:NM, Grant sr he Euphyes kiowah kiowah]15102B03|USA:NM, Otero Co.|1986
=. kiowah kiowah a ts A sa LT|NM, Sandoval Co. Euphyes kiowah kiowah|15102A09/USA:CO, Boulder Co pues
0 Euphyes kiowah kiowah|320 Det ee 8 a err: E. kiowah kiowah (=timmaculatus)|150 eens ere Co.|old
76 Euphyes kiowah kiowah|22056HO7|Mexico:NL|1977 Euphyes kiowah ane eae ee ai eee Co.|1986
18 Euphyes kiowah kiowah|21049C09|Mexico:NL ; ’ euonyes kiowah kiowah|22087D07|USA:NM,Grant Co.|1981
—— Euphyes kiowah aw alt eae ed Lt 0 Euphyes kiowah kiowah|]22087D11|USA:AZ,Coconino Co.|1981
% Euphyes kiowah chamuli|22087C10 Palin TZ 0.003 Euphyes kiowah kiowah|21049CO9/|Mexico:NL
chamuli i> Euphyes kiowah chamuli|21049C08|Mexico:Chia|1973 oo Euphyes kiowah chamuli|18025F07|HT|Mexico:Chia|1965
“D4 Euphyes kiowah mau alee 56D03|Mexico:Chia|]1987 4 Euphyes kiowah chamuli[21 soe eon eure na i
0.004 Euphyes kiowah chamuli|18025F07|HT|Mexico:Chia|1965 Euphyes kiowah chamuli|22056D03|Mexico:Chia|1987
Fig. 52. Phylogenetic trees of Euphyes vestris (purple and shades of blue) and Euphyes kiowah (red) inferred from protein-
coding regions of a) the nuclear genome (autosomes) and b) the Z chromosome. Different subspecies are shown in different
shades of colors and labeled in smaller font by their clades or regions (if not monophyletic) in the tree.
Euphyes vestris osceola (Lintner, 1878) is a valid subspecies
Currently placed as a junior subjective synonym of Euphyes vestris vestris (Boisduval, 1852) (type
locality in the USA: California, Plumas Co.), Pamphila osceola Lintner, 1878 (type locality in the USA:
California, Mendocino Co.) shows genetic differentiation from it and forms a distinct clade in genomic
trees (Fig. 52). Due to this genetic differentiation, coastal north-central California populations of E. vestris
are best treated as a separate subspecies, even more distant genetically from the nominotypical subspecies
than southern Californian Euphyes vestris harbisoni J. Brown & McGuire, 1983 (type locality in USA:
California, San Diego Co.) (Fig. 52). Therefore, in agreement with Emmel et al. (1998), we consider
Euphyes vestris osceola (Lintner, 1878), stat. rev. to be a valid subspecies.
Vernia verna sequoyah (H. Freeman, 1942) is a valid subspecies
Polites verna sequoyah H. Freeman, 1942 (type locality USA: Arkansas, Little Rock) was placed by
Evans (1955) as a junior subjective synonym of Pamphila verna W. H. Edwards, 1862 (type locality in
84
Vernia verna verna (=pottawattomie)|15101C10|ST|USA:IN|old
wWernia verna verna|15096D02|NT|USA:IL,Mercer Co.|1971
fernia verna verna|SAMN18587413|USA:KY,Oldham Co.
Vernia verna verna|5015|USA:PA,Indiana Co.|1977
Vernia verna verna|18014H01|USA:OH,Summit Co.|2012
yernia verna sequoyah|15104D01|HT|USA:AR, Pulaski Co.|1941
\ernia verna sequoyah|5016|PT|USA:AR, Little Rock|1941
Vernia verna sequoyah|11019|USA:TX,San Jacinto Co.|2018
Vernia dares|18115C04|Mexico:Chia|1972
Vernia dares|22035A08|Panama|1975
7 Vernia verna verna|15096D02|NT|USA:IL,Mercer Co.|1971 b
go Vernia verna verna|5015|USA:PA, Indiana Co.|1977
>> ©Wernia verna verna (=pottawattomie)|15101C10|ST|USA:IN|old
Vernia verna verna|18014HO1|USA:OH,Summit Co.|2012
53 Vernia verna sequoyah|15104D01|HT|USA:AR, Pulaski Co.|1941
94 Vernia verna sequoyah|5016|PT|USA:AR, Little Rock|1941
Vernia verna sequoyah|11019|USA:TX,San Jacinto Co.|2018
[700 Vernia dares|18115C04|Mexico:Chia|1972
Vernia dares|22035A08|Panama|1975
Fig. 53. Phylogenetic trees inferred from protein-coding regions in: a) the Z chromosome and b) the mitochondrial genome
with Vernia verna verna (blue) and V. verna sequoyah (red). Primary type specimens are labeled in magenta. The sequence of
SAMN18587413 is taken from the alignment provided in Kawahara et al. (2023).
USA: Mercer Co.), the type species of and currently in the genus Vernia Grishin, 2019. The genomic tree
reveals that sequenced specimens of Vernia verna partition into two clades (Fig. 53). The clades are
characterized by close genetic similarity of specimens within each clade and a certain level of genetic
differentiation between the clades. Therefore, populations assigned to these clades can be treated as two
distinct subspecies. The neotype of V. verna and a syntype of Pamphila pottawattomie Worthington, 1880
from “N. Ind.” (type locality in USA: IL, Cook Co., and IN, Lake Co.) belong to one clade, and the
holotype of P. v. sequoyah belongs to the other. We propose that the two clades represent two subspecies
and reinstate Vernia verna sequoyah (H. Freeman, 1942), stat. rest. as a valid subspecies. Moreover, due
to genetic differentiation, future studies of additional specimens may determine that it is a species-level
taxon.
Lerodea dysaules Godman, 1900 is a valid species distinct from
Lerodea arabus (W. H. Edwards, 1882)
Originally proposed as a species and treated (with some reservations) as such by Evans (1955), Lerodea
dysaules Godman, 1900 (type locality Mexico: Guerrero, Venta de Zopilote) was later synonymized with
Lerodea arabus (W. H. Edwards, 1882) (type locality USA: Arizona, Pima Co., Sabino Canyon), because
no appreciable differences in genitalia were observed, and wing pattern differences given by Evans (1955)
do not hold up in a larger series of specimens (Warren and Mielke 2005). Genomic sequencing of L.
arabus from across its range reveals a deep split into two clades (Fig. 54a, b), unexpected from
phenotypic assessment. The two clades are most strongly differentiated genetically with Fst/Gmin statistics
0.70/0.00 and COI barcode difference of 8.2% (54 bp), typical for species from different subgenera and
remarkably large for close relatives. Therefore, the two clades represent two distinct species.
The distribution of ZL. arabus as recorded on iNaturalist (2023) is disjoint, showing a cluster of
observations in southeastern Arizona and the major range from Sinaloa — Durango — Coahuila — Nuevo
Leon —south Texas southwards (Fig. 54c). These two disjoint areas in the distribution correspond
perfectly to the two distinct species revealed by genomic sequencing (plus specimens from both clades in
Sonora, Mexico where no iNaturalist observations existed) (Fig. 54). Sequenced specimens from near the
type locality of ZL. arabus provide the name for the southeastern Arizona and Sonora (except
southernmost) cluster (Fig. 54 blue). The type locality of Lerodea dysaules falls well within the major
range, and the sequenced specimen from Guerrero belongs to the second species along with other
Specimens across the major range (Fig. 54 red), providing an available name for this species. Therefore,
we reinstate Lerodea dysaules Godman, 1900, stat. rest. as a species-level taxon. In conclusion, L.
arabus is the northwestern species, and L. dysaules is the southeastern species. The two species may meet
in southern Sonora, Mexico, and the westernmost record of L. dysaules is from Alamos, Sonora
(sequenced as NVG-21056A02) (Fig. 54 red). Curiously, genomic sequencing suggests that populations
from Mexico Baja California Sur are L. arabus (Fig. 54).
As for the phenotypic assessment, both species are variable in wing patterns, and if identification
is possible, it should be done within each pattern form, comparing specimens with similar patterns
between species. Generally, ventral overscaling in L. dysaules is more mottled in appearance, especially
85
in a form with a well-developed brown discal patch on the ventral hindwing; this patch is smaller, not
extending towards the apex but turning towards mid-costa and is bordered by more diffuse small pale
spots (if the spots are present at all), these spots are also diffuse and frequently connected into a band even
if the central brown patch is absent. In L. arabus, pale ventral overscaling is more uniform, without
apparent mottling, the hindwing brown patch (if expressed) is larger and frequently extending towards the
apex (at least the area between the patch and the apex is darker than the central submarginal area), giving
the patch a more triangular appearance; if postdiscal small pale spots are expressed, their edges are better
defined, and the spots are more contrasty on the background, better separated from each other, especially
in specimens lacking the patch, and the spot in cell SctRi-RS may be particularly prominent. To aid in
the identification of these species, we provide COI barcodes of specimens from near the type localities:
Lerodea arabus from USA: AZ, Pima Co. [LACM], sample NVG-22094F10, GenBank OR578721:
AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACATCATTAAGTCTTTTAATTCGAACAGAATTAGGTAATCCTGGATCTT TAAT TGGAGATGATCAAATTTACAATACT
ATTGTGACAGCTCACGCTTTTATTATAATTTTTTTCATGGTAATACCTATTATAATTGGTGGATTTGGTAATTGATTAGTTCCTCTAATATTAGGTGCCCCAGATATAGCTTTCCCACGAA
TAAATAATATAAGATTTTGAATACTGCCACCTTCCTTAATATTATTAATTTCAAGTAGAATTGTAGAAAATGGT GCAGGAACAGGTTGAACTGTATATCCTCCTCTTTCTTCTAATATTGC
CCACCAAGGAGCCTCAGTTGACTTAGCGATTTTTTCATTACATTTAGCAGGTATTTCATCTATTTTAGGAGCTATTAACTTTATTACTACTATTATTAATATACGAATTAAAAATTTATCA
TTTGATCAAATACCTTTATTTGTTTGATCAGTAGGAATTACAGCATTATTATTACTTTTATCTCTACCTGTTTTAGCAGGTGCTATTACCATACTTTTAACTGACCGAAATTTAAACACTT
CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Lerodea dysaules from Mexico: Guerrero [MGCL], sample NVG-21085D09, GenBank OR578722:
AACTTTATACTTTATTTTTGGAATTTGAGCAGGAATAT TAGGAACATCTT TAAGTCTTTTAATTCGAACAGAATTAGGCAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT
ATTGTAACAGCCCATGCCTTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGTAATTGACTAGTTCCTTTAATATTAGGAGCACCTGACATAGCATTCCCACGAA
TAAATAATATAAGATTTTGAATACTACCACCTTCTCTAATATTATTAATCTCAAGTAGAATTGTAGAAAATGGTGCAGGTACAGGTT GAACAGTATATCCCCCTCTTTCATCTAATATTGC
ACATCAAGGAGCCTCAGTTGACCTTGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCCATTTTAGGAGCTATTAATTTTATTACTACTATTATTAACATACGAATTAAAAATTTATCA
TTCGATCAAATACCTTTATTTGTCTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTCTTAGCAGGAGCTATTACTATACTTTTAACCGATCGAAACCTTAATACTT
CATTCTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Lerodea arabus|21015D01|M
L. arab ial S
ba
a
°
“Y
°
=
=
©
ror)
ane
o
OD
a ‘ us|22094F10|U Pima Co.|1950 a
Lerodea arabus|22094F1 Saag td - Co.|1920 = ‘
Lerodea arabus|]22102A0 AERICO: BS [1959 4
L. arabus|2210 Foebatal Z,Santa Cruz Co.|1964 ,
b ~, Lerodea arabus|21056A03|Mexico:BC$|1990 ied a Hla
arapus erodea arabus|22103B08|USA:AZ, Pima Co.|1966 ) Pnoenix | ;
0 Lerodea arabus|20039D07|Mexico:Son|1998 ‘
Lerodea arabus|20039D09/|Mexico:BCS|1974 ban
Lerodea arabus|22094F11]USA:AZ,Pima Co.|1950 | ucson
Lerodea arabus|21015C12{Mexico:BCS|1961 |
102A0 Tate ane BC 4 28
056A 84 /~]
@
=
iz]
4
"~~
°
3
=
:TX, Hidalgo Co.|2015 Ore ene eee a
:TX,Starr Co.|2
2|Mexico:Oax]1
3|Mexico:0ax|199
ri
Lerodea peeve peal
ww
coo
=o*
+c
=xmwn
OpY
Lerodea 7 braeled ded AM
Lerodea
M<
vw
ry
=%
oO
V).
ny
ps
Oo
mt
rs
x=
o.
Lerodea oP fear pie
Lerodea dysaules
Lerodea dysaules
Lerodea dysaules
Lerodea dySaules|
DO8 Pept 003
100 Lerodea eufala|1 A edd alee ak Ley 4
Lerodea pitalnnoorith: allas Co.|2015 aE 4
100 <0, Lerodea gracia|19019D05|Ecuador|1988 Y Bees
100 Lerodea Gracia eoeben 0 i thes
100 erodea emba|1 eru
507 ~Lerod ba|19093C09|Peru|1999
Cavaed Eorodes Gctosti JP
erodea erythrostictus
0007 Cine. Lerodea etythrostictus|
Lerodea arabus|22094
b & arabus|22103B07|U
erodea arabus|210
Lerodea arabus]2105
rodea arabus
. arabus|2209
perodea arabus
erodea arabus
arabus erodes arabus
0
019D03|Brazil:DF|1991 ee. |
JUSA:AZ, Yuma Co.|1920 rOA M@nterrey
:AZ,Santa Cruz Co.|1964 ese,
1|Mexico:Son|1961 iste a
exica BCS 1 “
1
aN
OD
SOV
ord
Tete)
on
of §
=
o
uo
Oo
=—
a
oe |
‘e)
<<
en
¢
oO
20343 =9ON6=Non IN
CLPDSDD0OL 250503509
af
=
o
bad
ie]
°
o
Ke)
=]
=
Oo
©
OG
|_|
im |
mm
fs
n3.
2)
{o)
=
oOo
a
a
a
o-f900D>
pape
°
a
@
»
»
oS
i)
ot
Cc
RAAT
ASAGNOIG
=
= f
bs
3
°
o
(2)
7)
°o
exico:B
exico:Son|
Mexico:NL|2000 , |
Mexico:Son|199 } |
Mexico:Tam|2008 Oe ee
price uel eas
: X,Hidal 0 Co.|20
Lerodea arabus
Lerodea arabus|
Lerodea dysaules
2erodea dysaules
erodea dysaules
SPoNWoSN
>
o2
i?)
aN
o>
o
Ny
foe)
|
|
DANANPOCHD=O@ .To)
ADHPLPRGAVORE
Or>
ooo
Opn
IG
Oo
aa
=
exico: onl e
°
w
1S
n
>
=f
es
=
a
=
°
pa
‘terodea dysaules
Lerodea dysaules
isPerodea dysaules
erodea dysaules
Lerodea dysaules|53
rodea erythrosti if:D
erodea erythrosti 08{Brazil:B
jor odes Staragorg 1X Dall a 1
erodea eufala :
100 rodea gracia|19019D05 Ecuador|1988 m - Lerodea dysaules stat. rest. 4
erodea gracia|19019D07 Seabee 0 As 2 ia
Lerodea emba|19093C09|Peru|1999 yl
Lerodea emba|20017B05|Peru|1998
Mexico:Sin
Mexico:Sin
Mexico: Tam}
2
NNONVCNHHNDMNNDNPNNnpp
=
oo
AW
Aon
ooo
conor:
NS
=
o
=
exico:Oax
.Starr Co,
03)Brazi
w
©
=
ch
=2]nLr
°°.
np
O25
2 = §
5 m - Lerodea arabus Sorte hy ae
Pies poe?
a6
on
ES
Fig. 54. Lerodea arabus (blue) and Lerodea dysaules stat. rest. (red): phylogenetic trees inferred from protein-coding regions
in: a) the nuclear genome (autosomes) and b) the mitochondrial genome; c) a distribution map made from iNaturalist (2023)
observations: some points in the iNaturalist map L. arabus were re-colored in Photoshop and the two points corresponding to
sequenced specimens from Mexico: Sonora were added (CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/),
other points do not refer to sequenced specimens, records were not checked, and some may be misidentifications.
[No genus] ositbius Draudt, 1924 is an unavailable name
The name “osibius” was published by Draudt (1921-1924) below a specimen illustration on the plate
113B entitled “AGRIAS-ERYNNIS”, row c image 4 from the left, out of 7. No other mention of the name
86
is found in this work. The species illustrated first (1.e., top left: row a image [1]) on plate 113B was placed
in the genus Agrias, and the species illustrated last (1.e., bottom right: row c image [7], current name
Hesperia colorado (Scudder, 1874)) was placed by Draudt (1923b) in the genus Erynnis. The species
illustrated next to last (row c, images [5] and [6], current name 7uresis complanula (Herrich-Schaffer,
1869), misidentified as “/ucasi’’) was placed by Draudt (1923a) in the genus Turesis. Only two genera are
mentioned in the title of this plate (Agrias and Erynnis), but at least three are illustrated. Therefore, it
remains unclear which genus “osibius” was placed in (Agrias, Turesis [not mentioned on the plate],
Erynnis, or some other genus). Mielke (1993) listed “osibius” (as “osybius”) in combination with the
genus Turesis Godman, 1901 (type species Hesperia lucas Fabricius, 1793) and treated it as a valid
species (Mielke 2004; Mielke 2005). However, the name “osibius” by Draudt is unavailable because it
was not proposed “in unambiguous combination with a generic name” as demonstrated above (fails ICZN
Code Art. 11.9.3) and therefore cannot be used as a valid name for any species. Finally, we were not able
to unambiguously determine the identity of the specimen illustrated by Draudt (1921-1924) (among
others, it might have been Rhinthon Godman, 1900 or Niconiades Hubner, [1821]), but it does not seem to
belong to Turesis due to details in its wing pattern, such as a postdiscal arc of increasing in size pale spots
on ventral hindwing, that are not characteristic of Turesis.
ACKNOWLEDGMENTS
This study is dedicated to the memory of Paul A. Opler, our close collaborator on genomic projects. We
are most grateful to Paul and his wife Evi for participating in these projects, sharing knowledge,
discussions, insights, critiques, and numerous specimens they collected for genomic research, which we
used in this and future studies. We acknowledge Ping Chen and Ming Tang for their excellent technical
assistance. We are grateful to David Grimaldi and Courtney Richenbacher (AMNH: American Museum
of Natural History, New York, NY, USA), Jason Weintraub (ANSP: The Academy of Natural Sciences of
Drexel University, Philadelphia, PA, USA), Blanca Huertas, David Lees, and Geoff Martin (BMNH:
Natural History Museum, London, UK), Chris Grinter, Denise Montelongo, David Bettman, Vince Lee,
and the late Norm Penny (CAS: California Academy of Sciences, San Francisco, CA, USA), Jim Fetzner,
Bob Androw, Vanessa Verdecia, Cat Giles, and the late John Rawlins (CMNH: Carnegie Museum of
Natural History, Pittsburgh, PA, USA), the late Paul Opler, Chuck Harp, and the late Boris Kondratieff
(CSUC: Colorado State University Collection, Fort Collins, CO, USA), Jason Dombroskie (CUIC:
Cornell University Insect Collection, Ithaca, New York, USA), Crystal Maier and Rebekah Baquiran
(FMNH: Field Museum of Natural History, Chicago, IL, USA), Weiping Xie and Giar-Ann Kung
(LACM: Los Angeles County Museum of Natural History, Los Angeles, CA, USA), Théo Léger, Viola
Richter, and Wolfram Mey (MFNB: Museum fiir Naturkunde, Berlin, Germany), Andrei Sourakov,
Andrew D. Warren, Debbie Matthews-Lott, Riley J. Gott, and Keith R. Willmott (MGCL: McGuire
Center for Lepidoptera and Biodiversity, Gainesville, FL, USA), Rodolphe Rougerie (MNHP: Muséum
National d'Histoire Naturelle, Paris, France), Matthias Nuss and Manuela Bartel (MTD: Museum fiir
Tierkunde, Dresden, Germany), Gerardo Lamas (MUSM: Museo de Historia Natural, Lima, Peru), Larry
F. Gall (PMNH: Peabody Museum of Natural History, Yale University, New Haven, CT, USA), Martin
Wiemers and Christian Kutzscher (SDEI: Senckenberg Deutsches Entomologisches Institut, Miincheberg,
Germany), Wolfgang A. Nassig (SMF: Natural History Museum, Frankfurt, Germany), Edward G. Riley,
Karen Wright, and John Oswald (TAMU: Texas A&M University Insect Collection, College Station, TX,
USA), Alex Wild (TMMC: University of Texas Biodiversity Center, Austin, TX, USA), Jeff Smith and
Lynn Kimsey (UCDC: Bohart Museum of Entomology, University of California, Davis, CA, USA),
Robert K. Robbins, John M. Burns, and Brian Harris (USNM: National Museum of Natural History,
Smithsonian Institution, Washington, DC, USA), Jonathan P. Pelham (UWBM: Burke Museum of
Natural History and Culture, Seattle, WA, USA), and Axel Hausmann, Andreas Segerer, and Ulf
Buchsbaum (ZSMC: Zoologische Staatssammlung Miinchen, Germany), for granting access to the
collections under their care, sampling specimens, and stimulating discussions; to Brian Banker, Gian C.
87
Bozano, Jim P. Brock, Ernst Brockmann, Jack S. Carter, Bill R. Dempwolf, Mike Fisher, Robb
Hannawacker, Bernard Hermier, James McDermott, the late James A. Scott, Kojiro Shiraiwa, Steve M.
Spomer, and Mark Walker for specimens and leg samples, to Gerardo Lamas and Jonathan P. Pelham for
discussions, advice, helpful suggestions, patiently answering numerous questions, and sharing their
research files, and to Bernard Hermier and Gerardo Lamas for critical review of the manuscript and many
helpful corrections. We are indebted to the California Department of Fish and Game for collecting permit
SC13645, Texas Parks and Wildlife Department (Natural Resources Program Director David H. Riskind)
for the research permit 08-02Rev, to U. S. National Park Service for the research permits: Big Bend
(Raymond Skiles) for BIBE-2004-SCI-0011 and Yellowstone (Erik Oberg and Annie Carlson) for YELL-
2017-SCI-7076, and to the National Environment & Planning Agency of Jamaica for the permission to
collect specimens. Please note that photographs from iNaturalist (2023) reproduced in this work and
photographs ©The Trustees of the Natural History Museum, London are made available under Creative
Commons License 4.0 (https://creativecommons.org/licenses/by/4.0/), which means in particular that
when using the images you must give appropriate credit and provide a link to the license. We
acknowledge the Texas Advanced Computing Center (TACC) at The University of Texas at Austin for
providing HPC resources. This study was supported in part by the HHMI Investigator funds and by grants
from the National Institutes of Health GM127390 and the Welch Foundation I-1505 to N.V.G.
LITERATURE CITED
Bachtrog, D., K. Thornton, A. Clark, and P. Andolfatto. 2006. Extensive introgression of mitochondrial
DNA relative to nuclear genes in the Drosophila yakuba species group. Evolution 60(2): 292-302.
Barnhart, J. H. 1965. Biographical Notes Upon Botanists, vol. 3. G. K. Hall and Co.; Boston, MA. 545 pp
Boyle, J. H., M. Espeland, S. Safian, R. Ducarme, A. J. Gardiner, J. W. Coleman, A. Heath, S. Fisher, S.
C. Collins, D. J. Martins, kK. Aduse-Poku, M. Libert, E. Dankowicz, A. Y. Kawahara, D. J.
Lohman, and N. E. Pierce. 2023. Phylogeny of the Poritiinae (Lepidoptera: Lycaenidae), butterflies
with ant associations and unusual lichenivorous diets. Systematic Entomology 48(3): 422-433.
Boyle, J. H., Z. A. Kaliszewska, M. Espeland, T. R. Suderman, J. Fleming, A. Heath, and N. E. Pierce.
2015. Phylogeny of the Aphnaeinae: myrmecophilous African butterflies with carnivorous and
herbivorous life histories. Systematic Entomology 40(1): 169-182.
Burns, J. M. 2020. Taxonomic status of a Florida differentiate in the Erynnis brizo species group: classical
evidence (Lepidoptera: Hesperiidae: Pyrginae). Proceedings of the Entomological Society of
Washington 122(1): 25-41.
Burns, J. M., D. H. Janzen, M. Hajibabaei, W. Hallwachs, and P. D. Hebert. 2008. DNA barcodes and
cryptic species of skipper butterflies in the genus Perichares in Area de Conservacion Guanacaste,
Costa Rica. Proceedings of the National Academy of Sciences of the United States of America
105(17): 6350-6355.
Calhoun, J. V. 1997. Updated list of the butterflies and skippers of Florida (Lepidoptera: Papilionoidea and
Hesperioidea). Holarctic Lepidoptera 4: 39-50.
Carneiro, E., O. H. H. Mielke, and M. M. Casagrade. 2013. Thorax and abdomen morphology of some
Neotropical Hesperiidae (Lepidoptera). Insecta Mundi 0327: 1-47.
Casagrade, M. M., and O. H. H. Mielke. 1979. Eurema (Eurema) furtadoi sp. n. de Mato Grosso, Brasil
(Lepidoptera, Pieridae). Dusenia (Curitiba) 11(3): 137-142.
Chermock, R. L. 1950. A Generic Revision of the Limenitini of the World. The American Midland Naturalist
43(3): 513-569.
Chiba, H. 2009. A revision of the subfamily Coeliadinae (Lepidoptera: Hesperiidae). Bulletin of the
Kitakyushu Museum of Natural History and Human History, Series A (Natural History) 7: 1-102.
Chou, I. (Editor) 1994. Monographia Rhopalocerorum Sinensium [in Chinese]. Henan Scientific and
Technological Publishing House; Zhengzhou, China. viii + 854 pp.
Cong, Q., D. Borek, Z. Otwinowski, and N. V. Grishin. 2015. Tiger swallowtail genome reveals
mechanisms for speciation and caterpillar chemical defense. Cell Reports 10(6): 910—919.
88
Cong, Q., J. Shen, D. Borek, R. K. Robbins, P. A. Opler, Z. Otwinowski, and N. V. Grishin. 2017a. When
COI barcodes deceive: complete genomes reveal introgression in hairstreaks. Proceedings of the Royal
Society B: Biological Sciences 284(1848): 20161735.
Cong, Q., J. Shen, D. Borek, R. K. Robbins, Z. Otwinowski, and N. V. Grishin. 2016. Complete genomes
of hairstreak butterflies, their speciation, and nucleo-mitochondrial incongruence. Scientific Reports 6:
24863.
Cong, Q., J. Shen, W. Li, D. Borek, Z. Otwinowski, and N. V. Grishin. 2017b. The first complete genomes
of metalmarks and the classification of butterfly families. Genomics 109: 485—493.
Cong, Q., J. Shen, J. Zhang, W. Li, L. N. Kinch, J. V. Calhoun, A. D. Warren, and N. V. Grishin. 2021.
Genomics reveals the origins of historical specimens. Molecular Biology and Evolution 38(5): 2166—
2176.
Cong, Q., J. Zhang, and N. V. Grishin. 2019a. Genomic determinants of speciation. bioRxiv BIORXIV/
2019/837666.
Cong, Q., J. Zhang, J. Shen, X. Cao, C. Brevignon, and N. V. Grishin. 2020. Speciation in North American
Junonia from a genomic perspective. Systematic Entomology 45(4): 803-837.
Cong, Q., J. Zhang, J. Shen, and N. V. Grishin. 2019b. Fifty new genera of Hesperiidae (Lepidoptera).
Insecta Mundi 0731: 1—56.
Davey, J. W., M. Chouteau, S. L. Barker, L. Maroja, S. W. Baxter, F. Simpson, R. M. Merrill, M. Joron,
J. Mallet, K. K. Dasmahapatra, and C. D. Jiggins. 2016. Major improvements to the Heliconius
melpomene genome assembly used to confirm 10 chromosome fusion events in 6 million years of
butterfly evolution. G3 (Bethesda) 6(3): 695-708.
Dhungel, B., and N. Wahlberg. 2018. Molecular systematics of the subfamily Limenitidinae (Lepidoptera:
Nymphalidae). PeerJ 6: e4311.
Draudt, M. W. K. 1921-1924. B. Grypocera, breitképfige Tagfalter. Jn: Seitz, A. (Ed.). Die Gross-
Schmetterlinge der Erde. Alfred Kernen; Stuttgart, pp. 833-1011, 1046-1139, pls 113B, 160-193.
Draudt, M. W. K. 1922. B. Grypocera, breitképfige Tagfalter. In: Seitz, A. (Ed.). Die Gross-Schmetterlinge
der Erde. Alfred Kernen; Stuttgart, pp. 873-880.
Draudt, M. W. K. 1923a. B. Grypocera, breitképfige Tagfalter. Jn: Seitz, A. (Ed.). Die Gross-Schmetterlinge
der Erde. Alfred Kernen; Stuttgart, pp. 953-992.
Draudt, M. W. K. 1923b. B. Grypocera, breitkopfige Tagfalter. Jn: Seitz, A. (Ed.). Die Gross-Schmetterlinge
der Erde. Alfred Kernen; Stuttgart, pp. 913-952.
Eliot, J. N. 1973. The higher classification of the Lycaenidae (Lepidoptera): a tentative Arrangement. Bulletin
of the British Museum of Natural History (Entomology) 28(6): 373-505.
Emmel, J. F., T. C. Emmel, and S. O. Mattoon. 1998. The types of California butterflies named by Jean
Alphonse Boisduval: Designation of lectotypes and a neotype, and fixation of type localities. Jn:
Emmel, T. C. (Ed.). Systematics of Western North American Butterflies. Mariposa Press; Gainesville,
pp. 3-76.
Evans, W. H. 1937. A catalogue of the African Hesperiidae indicating the classification and nomenclature
adopted in the British Museum. The Trustees of the British Museum (Natural History); London. xii +
212 pp., 30 pls.
Evans, W. H. 1949. A catalogue of the Hesperiidae from Europe, Asia, and Australia in the British Museum
(Natural History). The Trustees of the British Museum (Natural History); London. xix + 502 pp., 53
pls.
Evans, W. H. 1952. A catalogue of the American Hesperiidae indicating the classification and nomenclature
adopted in the British Museum (Natural History). Part II. Pyrginae. Section I. The Trustees of the
British Museum (Natural History); London. v + 178 pp., pls. 10—25.
Evans, W. H. 1955. A catalogue of the American Hesperiidae indicating the classification and nomenclature
adopted in the British Museum (Natural History). Part IV. Hesperiinae and Megathyminae. The
Trustees of the British Museum (Natural History); London. v + 499 pp., pls. 54-88.
Fan, X., H. Chiba, Z. Huang, W. Fei, M. Wang, and S. Safian. 2016. Clarification of the phylogenetic
framework of the tribe Baorini (Lepidoptera: Hesperiidae: Hesperiinae) inferred from multiple gene
sequences. PLoS One 11(7): e0156861.
89
Glassberg, J. 2023. Description of a new subspecies of common sootywing, ‘white-tufted’ common
sootywing, Pholisora catullus albicirrus new subspecies. American Butterflies 31(3): 36-39.
Godman, F. D. 1907. Notes on the American species of Hesperiidae described by Plétz. Annals and Magazine
of Natural History (7)20(16): 132-155.
Hall, J. P., K. R. Willmott, and D. H. Ahrenholz. 2023. A review of the Argyrogrammana amalfreda group
fauna of the western Amazon (Lepidoptera: Riodinidae: Symmachiin1). Tropical Lepidoptera Research
33(Suppl. 1): 61-85.
Hall, J. P. W. 2002. A phylogenetic revision of Calydna and relatives (Lepidoptera: Riodinidae). Insect
Systematics & Evolution 33: 185-237.
Hall, J. P. W. 2003. Phylogenetic reassessment of the five forewing radial-veined tribes of Riodininae
(Lepidoptera: Riodinidae). Systematic Entomology 28(1): 23-38.
Hall, J. P. W., and K. R. Willmott. 1996. Notes on the genus Argyrogrammana, part 2, with one new species
(Lepidoptera: Riodinidae). Tropical Lepidoptera 7: 71—80.
Heath, A. 1997. A review of African genera of the tribe Aphnaeini (Lepidoptera: Lycaenidae).
Metamorphosis 8(Suppl. 2): 1-60.
Heath, A., E. L. Pringle, and S.-P. Quek. 2023. Chrysoritis Butler (Papilionoidea: Lycaenidae: Aphnaeinae)
— Part III: An integrative taxonomic revision. Metamorphosis 33: 11-28.
Hebert, P. D., A. Cywinska, S. L. Ball, and J. R. deWaard. 2003. Biological identifications through DNA
barcodes. Proceedings of the Royal Society B: Biological Sciences 270(1512): 313-321.
Henning, S. F., and G. A. Henning. 1996. A review of the genus Axiocerces Hiibner (Lepidoptera:
Lycaenidae), with descriptions of nine new species and three new subspecies. Metamorphosis 7(Suppl.
1): 1-48.
Herrich-Schaffer, G. A. W. 1869. Prodromus systematis lepidopterorum. Versuch einer systematischen
Anordnung der Schmetterlinge. Correspondenz-Blatt des zoologisch-mineralogischen Vereines in
Regensburg 23(12): 184-204.
Holland, W. J. 1896. A preliminary revision and synonymic catalogue of the Hesperiidae of Africa and the
adjacent islands, with descriptions of some apparently new species. Proceedings of The Zoological
Society of London 1896: 2—107.
Howarth, T. G. 1966. Revisional notes on the genus Antanartia (Lepidoptera: Nymphalidae). Bulletin of the
British Museum of Natural History 18: 21-43.
ICZN [International Commission on Zoological Nomenclature]. 1999. International code of zoological
nomenclature. Fourth edition. International Trust for Zoological Nomenclature; London. xxx + 306
iNaturalist. 2023. A Community for Naturalists — iNaturalist. Available from https://www.inaturalist.org.
Accessed 25-Aug-2022.
Jiang, D., S. Klaus, Y. P. Zhang, D. M. Hillis, and J. T. Li. 2019. Asymmetric biotic interchange across the
Bering land bridge between Eurasia and North America. National Science Review 6(4): 739-745.
Kaur, M., J. S. Kirti, and A. K. Sidhu. 2022. Taxonomic study of the Genus Gandaca Moore (Lepidoptera:
Pieridae) from India. Ecology, Environment and Conservation Journal 28(May Suppl. Issue): S$572—
S578.
Kawahara, A. Y. 2009. Phylogeny of snout butterflies (Lepidoptera: Nymphalidae: Libytheinae): combining
evidence from the morphology of extant, fossil, and recently extinct taxa. Cladistics 25: 263-278.
Kawahara, A. Y., C. Storer, A. P. S. Carvalho, D. M. Plotkin, F. L. Condamine, M. P. Braga, E. A. Ellis,
R. A. St Laurent, X. Li, V. Barve, L. Cai, C. Earl, P. B. Frandsen, H. L. Owens, W. A. Valencia-
Montoya, K. Aduse-Poku, E. F. A. Toussaint, K. M. Dexter, T. Doleck, A. Markee, R. Messcher,
Y. L. Nguyen, J. A. T. Badon, H. A. Benitez, M. F. Braby, P. A. C. Buenavente, W. P. Chan, S. C.
Collins, R. A. Rabideau Childers, E. Dankowicz, R. Eastwood, Z. F. Fric, R. J. Gott, J. P. W.
Hall, W. Hallwachs, N. B. Hardy, R. L. H. Sipe, A. Heath, J. D. Hinolan, N. T. Homziak, Y. F.
Hsu, Y. Inayoshi, M. G. A. Itliong, D. H. Janzen, I. J. Kitching, K. Kunte, G. Lamas, M. J.
Landis, E. A. Larsen, T. B. Larsen, J. V. Leong, V. Lukhtanov, C. A. Maier, J. I. Martinez, D. J.
Martins, K. Maruyama, S. C. Maunsell, N. O. Mega, A. Monastyrskii, A. B. B. Morais, C. J.
Muller, M. A. K. Naive, G. Nielsen, P. S. Padron, D. Peggie, H. P. Romanowski, S. Safian, M.
Saito, S. Schroder, V. Shirey, D. Soltis, P. Soltis, A. Sourakov, G. Talavera, R. Vila, P. Vlasanek,
H. Wang, A. D. Warren, K. R. Willmott, M. Yago, W. Jetz, M. A. Jarzyna, J. W. Breinholt, M.
90
Espeland, L. Ries, R. P. Guralnick, N. E. Pierce, and D. J. Lohman. 2023. A global phylogeny of
butterflies reveals their evolutionary history, ancestral hosts and biogeographic origins. Nature
Ecology & Evolution 7(6): 903-913.
Klots, A. B. 1929. A revision of the genus Eurema Hiibner (Lepidoptera, Pieridae). Part II: New World
species, taxonomy and synonymy. Entomologica americana 9(3): 99-163.
Klots, A. B. 1933. A generic classification of the Pieridae (Lepidoptera) together with a study of the male
genitalia. Entomologica Americana 12: 139-242.
Kocak, A. O. 1996. Giiney bati asya Polyommatinae taksonlarinin listesi ve baz1 nomenklatiir notlar1
(Lepidoptera, Lycaenidae). Centre for Entomological Studies Ankara Miscellaneous Papers 30/33(1—
32).
Kocak, A. O., and S. Seven. 1997. Negros Papilionoidea, Hesperioidea faunas: ve taksonomisi tizerine
arastirmalar (Lepidoptera) (Filipin entomolojik ekspedisyonu sonuclari-IV). Priamus 9(2/3): 57-114.
Lamas, G. 2004. Pieridae, pp. 99-117. In: Lamas, G. (Ed.). Checklist: Part 4A. Hesperioidea - Papilionoidea.
In: Heppner, J. B. (Ed.), Atlas of Neotropical Lepidoptera. Volume 5A. Association for Tropical
Lepidoptera; Scientific Publishers; Gainesville.
Larsen, T. B. 1991. The Butterflies of Kenya and their Natural History. Oxford University Press; Oxford. 490
pp
Lees, D. C., C. Kremen, and H. Raharitsimba. 2003. Classification, diversity and endemism of the
butterflies (Papilionoidea and Hesperioidea): a revised species checklist. Jn: Goodman, S. M. and J. P.
Benstead (Eds.). The Natural History of Madagascar. University of Chicago Press; Chicago, pp. 762—
793.
Li, W., Q. Cong, J. Shen, J. Zhang, W. Hallwachs, D. H. Janzen, and N. V. Grishin. 2019. Genomes of
skipper butterflies reveal extensive convergence of wing patterns. Proceedings of the National
Academy of Sciences of the United States of America 116(13): 6232-6237.
Llorente, J. E., S. Nieves, and A. Flores. 2023. Exochorion in the tribe Nymphalini (Lepidoptera:
Nymphalidae): the genus Hypanartia Hiibner, [1821] and comparison with related genera. Zootaxa
5330(2): 151-200.
Lukhtanoy, V. A., A. Sourakov, and E. Zakharov. 2016. DNA barcodes as a tool in biodiversity research:
testing pre-existing taxonomic hypotheses in Delphic Apollo butterflies (Lepidoptera, Papilionidae).
Systematics and Biodiversity 14: 599-613.
Mielke, O. H. H. 1993. Sobre os tipos de Hesperiidae (Lepidoptera) neotropicais descritos por M. Draudt.
Revista Brasileira de Entomologica 37: 611-638.
Mielke, O. H. H. 2004. Hesperioidea. /n: Lamas, G. (Ed.). Checklist: Part 4A. Hesperioidea - Papilionoidea.
Association for Tropical Lepidoptera; Scientific Publishers; Gainesville.
Mielke, O. H. H. 2005. Catalogue of the American Hesperioidea: Hesperiidae (Lepidoptera). Sociedade
Brasileira de Zoologia; Curitiba, Parana, Brazil. xiii + 1536 pp.
Miller, J. S. 1987. Phylogenetic studies in the Papilioninae (Lepidoptera, Papilionidae). Bulletin of the
American Museum of Natural History 186(4): 365-512.
Miller, L. D. 1974. Revision of the Euptychiini (Satyridae) 2. Cy/lopsis R. Felder. Bulletin of the Allyn
Museum 20: 1-98.
Nguyen, L. T., H. A. Schmidt, A. von Haeseler, and B. Q. Minh. 2015. IQ-TREE: a fast and effective
stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and
Evolution 32(1): 268-274.
Opler, P. A., and A. D. Warren. 2002. Butterflies of North America. 2. Scientific names list for butterfly
species of North America, north of Mexico. Colorado State University, C. P. Gillette Museum of
Arthropod Diversity; Fort Collins. [2] + 79 pp.
Overlaet, F. G. 1940. Formes nouvelles ou peu connues de Nymphalides africains. Revue de Zoologie et de
Botanique Africaine 33: 150-172.
Pelham, J. P. 2008. Catalogue of the Butterflies of the United States and Canada. Journal of Research on the
Lepidoptera 40: 1-658.
Penz, C. M., and D. Peggie. 2003. Phylogenetic relationships among Heliconiinae genera based on
morphology (Lepidoptera: Nymphalidae). Systematic Entomology 28(4): 451-479.
91
Plétz, C. 1882. Einige Hesperiinen-Gattungen und deren Arten. Berliner entomologische Zeitschrift 26(1):
71-82.
Pollock, D. D., W. B. Watt, V. K. Rashbrook, and E. V. Iyengar. 1998. Molecular phylogeny for Colias
butterflies and their relatives (Lepidoptera: Pieridae). Annals of the Entomological Society of America
91(5): 524-531.
Rambaut, A. 2018. FigTree, version 1.4.4 http://tree.bio.ed.ac.uk/software/figtree/.
Riley, N. D. 1925. The species usually referred to the Genus Cigaritis Boisd. (Lycaenidae). Novitates
Zoologicae 32: 70—95.
Robbins, R. K., Q. Cong, J. Zhang, J. Shen, R. C. Busby, C. Faynel, M. Duarte, A. R. P. Martins, C.
Prieto, G. Lamas, and N. V. Grishin. 2022. Genomics-based higher classification of the species-rich
hairstreaks (Lepidoptera: Lycaenidae: Eumaeini). Systematic Entomology 47(3): 445-469.
Shen, J., Q. Cong, D. Borek, Z. Otwinowski, and N. V. Grishin. 2017. Complete genome of Achalarus
lyciades, the first representative of the Eudaminae subfamily of skippers. Current Genomics 18(4):
366-374.
Shen, J., Q. Cong, L. N. Kinch, D. Borek, Z. Otwinowski, and N. V. Grishin. 2016. Complete genome of
Pieris rapae, a resilient alien, a cabbage pest, and a source of anti-cancer proteins. F1000Research 5:
2631.
Simonsen, T. J. 2006. Fritillary phylogeny, classification and larval hostplants: reconstructed mainly on the
basis of male and female genitalic morphology (Lepidoptera: Nymphalidae: Argynnini). Biological
Journal of the Linnean Society 89: 627-673.
Sohn, J.-C., C. C. Labandeira, D. R. Davis, and C. Mitter. 2012. An annotated catalog of fossil and
subfossil Lepidoptera (Insecta: Holometabola) of the world. Zootaxa 3286(1): 1-132.
Stempffer, H. 1967. The genera of the African Lycaenidae (Lepidoptera: Rhopalocera). Bulletin of the British
Museum (Natural History) Entomology Suppl. 10: 3-322.
Stichel, H. 1910. Fam. Riodinidae. Allgemeines - Subfam. Riodininae. Genera Insectorum 112A: 1-238.
Stradomsky, B. V. 2016. A molecular phylogeny of subfamily Polyommatinae (Lepidoptera: Lycaenidae).
Caucasian Entomological Bulletin 12(1): 145-156.
Talavera, G., Z. A. Kaliszewska, A. Heath, and N. E. Pierce. 2020. Recent diversification of Chrysoritis
butterflies in the South African Cape (Lepidoptera: Lycaenidae). Molecular Phylogenetics and
Evolution 148: 106817:1—10.
Talavera, G., V. A. Lukhtanov, N. E. Pierce, and R. Vila. 2012. Establishing criteria for higher-level
classification using molecular data: the systematics of Polyommatus blue butterflies (Lepidoptera,
Lycaenidae). Cladistics 29: 166-192.
Tite, G. E. 1963. A synonymic list of the genus Nacaduba and allied genera (Lepidoptera: Lycaenidae).
Bulletin of the British Museum (Natural History) Entomology 13(4): 69-116.
Tite, G. E., and C. G. C. Dickson. 1973. The genus A/oides and allied genera (Lepidoptera: Lycaenidae).
Bulletin of the British Museum (Natural History) Entomology 29(5): 227-280.
Toussaint, E. F. A., H. Chiba, M. Yago, K. M. Dexter, A. D. Warren, C. Storer, D. J. Lohman, and A. Y.
Kawahara. 2021. Afrotropics on the wing: phylogenomics and historical biogeography of awl and
policeman skippers. Systematic Entomology 46(1): 172-185.
Turner, T., and V. Turland. 2017. Discovering Jamaican butterflies and their relationships around the
Caribbean. Caribbean Wildlife Publications; Safety Harbor, FL. 492
Wahlberg, N. 2019. The higher classification of Nymphalidae. <http://www.nymphalidae.net/Nymphalidae/
Classification/Higher_class.htm> Accessed on 16 Aug 2023.
Wahlberg, N., J. Maresova, L. Murillo-Ramos, S. Collins, and L.-W. Wu. 2020. The phylogenetic
positions of Bhagadatta Moore, 1898, Kumothales Overlaet, 1940 and Harmilla Aurivillius, 1892
(Lepidoptera, Nymphalidae, Limenitidinae) based on molecular data. Nota Lepidopterologica 43: 167—
171.
Wahlberg, N., and D. Rubinoff. 2011. Vagility across Vanessa (Lepidoptera: Nymphalidae): mobility in
butterfly species does not inhibit the formation and persistence of isolated sister taxa. Systematic
Entomology 36: 362-370.
Warren, A. D., K. J. Davis, E. M. Stangeland, J. P. Pelham, K. R. Willmott, and N. V. Grishin. 2023.
Illustrated Lists of American Butterflies. [23-VI-2023] <https://www.butterfliesofamerica.com/>.
92
Warren, A. D., and O. H. H. Mielke. 2005. Synonymic notes on North and Central American Lerodea
Scudder, 1872 and Corticea Evans, 1955 (Lepidoptera, Hesperiidae, Hesperiinae). Revista Brasileira
de Zoologia 22(1): 285-291.
Williams, M. 2023a. Afrotropical butterflies: 05laa Genus Ceratrichia Butler, 1870, updated 29 December
2020, <http://www.lepsocafrica.org/?p=publications&s=atb>, accessed on 20 August 2023.
Williams, M. 2023b. Afrotropical butterflies: 070 Genus Xanthodisca Aurivillius, [1925], updated 9 Feb
2021, <http://www.lepsocafrica.org/?p=publications&s=atb>, accessed on 20 August 2023.
Williams, M. 2023c. Afrotropical butterflies: 286 Genus Chrysoritis Butler, [1897], updated 7 May 2023,
<http://www.lepsocafrica.org/?p=publications&s=atb>, accessed on 20 August 2023.
Willmott, K. R. 2003. Cladistic analysis of the Neotropical butterfly genus Adelpha (Lepidoptera:
Nymphalidae), with comments on the subtribal classification of Limenitidini. Systematic Entomology
28(3): 279-322.
Willmott, K. R., J. P. W. Hall, and G. Lamas. 2001. Systematics of Hypanartia (Lepidoptera: Nymphalidae:
Nymphalinae), with a test for geographical speciation mechanisms in the Andes. Systematic
Entomology 26(4): 369-399.
Zhang, J., Q. Cong, J. M. Burns, and N. V. Grishin. 2022a. Checking the checkered taxonomy of Pl6tz's
checkered skippers (Hesperiidae: Pyrgini). The Taxonomic Report of the International Lepidoptera
Survey 10(5): 1-31.
Zhang, J., Q. Cong, and N. V. Grishin. 2023a. Thirteen new species of butterflies (Lepidoptera:
Hesperiidae) from Texas. Insecta Mundi 0969: 1-58.
Zhang, J., Q. Cong, J. Shen, E. Brockmann, and N. V. Grishin. 2019a. Genomes reveal drastic and
recurrent phenotypic divergence in firetip skipper butterflies (Hesperiidae: Pyrrhopyginae).
Proceedings of the Royal Society B: Biological Sciences 286(1903): 20190609.
Zhang, J., Q. Cong, J. Shen, and N. V. Grishin. 2022b. Taxonomic changes suggested by the genomic
analysis of Hesperiidae (Lepidoptera). Insecta Mundi 0921: 1-135.
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2019b. Changes to North American butterfly
names. The Taxonomic Report of the International Lepidoptera Survey 8(2): 1-11.
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2019c. Genomics of a complete butterfly
continent. bioRxiv BIORXIV/2019/829887.
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2020. Genomic evidence suggests further
changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8(7): 1-
AO.
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2021. Genomics-guided refinement of
butterfly taxonomy. The Taxonomic Report of the International Lepidoptera Survey 9(3): 1—54.
Zhang, J., Q. Cong, J. Shen, L. Song, and N. V. Grishin. 2022c. Genomic DNA sequencing reveals two
new North American species of Staphylus (Hesperiidae: Pyrginae: Carcharodini). The Taxonomic
Report of the International Lepidoptera Survey 10(4): 1-13.
Zhang, J., Q. Cong, J. Shen, L. Song, and N. V. Grishin. 2023b. A taxonomic list of the Old World genera
in the subfamily Hesperiinae (Hesperiidae) arranged into tribes. The Taxonomic Report of the
International Lepidoptera Survey 11(2): 1-6.
Zhang, J., Q. Cong, J. Shen, L. Song, P. A. Opler, and N. V. Grishin. 2023c. Additional taxonomic
refinements suggested by genomic analysis of butterflies. The Taxonomic Report of the International
Lepidoptera Survey 11(1): 1-25.
Zhang, J., Q. Cong, L. Song, J. Shen, T. Léger, G. Lamas, O. H. H. Mielke, and N. V. Grishin. 2023d.
Resolving inconsistencies between Plétz’s descriptions and presumed type specimens of some
Hesperiidae (Lepidoptera). Deutsche Entomologische Zeitschrift 70(1): 159-174.
Zhang, J., D. R. Dolibaina, Q. Cong, J. Shen, L. Song, C. G. C. Mielke, M. M. Casagrade, O. H. H.
Mielke, and N. V. Grishin. 2023e. Taxonomic notes on Neotropical Hesperiidae (Lepidoptera).
Zootaxa 5271(1): 091-114.
Zhang, J., J. Shen, Q. Cong, and N. V. Grishin. 2019d. Genomic analysis of the tribe Emesidini
(Lepidoptera: Riodinidae). Zootaxa 4668(4): 475—488.
93
The Taxonomic Report
is a platinum open access peer-reviewed publication of
The International Lepidoptera Survey (TILS)
The International Lepidoptera Survey is registered as a non-profit Limited Liability Company (LLC) in
the state of Virginia, U.S.A. The Taxonomic Report (TTR), ISSN 2643-4776 (print) / ISSN 2643-4806
(online) is published for the purpose of providing a public and permanent scientific record. Articles are
peer-reviewed but not necessarily through the anonymous editor-mediated review process. Typically, the
authors are encouraged to solicit reviews of their manuscripts from knowledgeable lepidopterists before
submission. TTR appears in digital, open-access form, is disseminated as a hardcopy to select institutional
repositories, and is available as printed copy upon request at the discretion of authors and/or the editor.
Printing and postage charges may apply. An initial run of 25 copies is printed on paper to meet ICZN
Code recommendation 8B. All published TTR articles are freely available at the archival TTR website
(http:/lepsurvey.carolinanature.com/report.html) and via the following digital repositories:
Internet Archive (https://archive.org/)
Biodiversity Heritage Library (https://www.biodiversitylibrary.org)
Zobodat (https://www.zobodat.at/)
Zenodo (https://zenodo.org)
Digital Commons (https://digitalcommons.unl.edu)
TILS Purpose
TILS is devoted to the worldwide collection of Lepidoptera for the purpose of scientific discovery,
determination, and documentation, without which there can be no preservation.
TILS Motto
“As a world community, we cannot protect that which we do not know”
Articles for publication are sought
Manuscripts may deal with any area of research on Lepidoptera, including faunal surveys, conservation
topics, life histories and foodplant records, matters of nomenclature, descriptions of new taxa, methods,
etc. Taxonomic papers are particularly welcome. There are no publication charges for authors. Before
submitting a manuscript, email TTR editor, Harry Pavulaan, 606 Hunton Place NE, Leesburg, VA,
20176, USA at [email protected] (cc: to [email protected] if you do not receive a reply
within one week) to initiate discussion on how to best handle your material for publication, and to discuss
peer review options.
Visit The International Lepidoptera Survey on the World Wide Web at:
http://lepsurvey.carolinanature.com
&
Join the discussion at our list serve on Groups.1io at:
https://groups.io/g/TILS
You can subscribe by sending an email to: [email protected]
&
Join The International Lepidoptera Survey on Facebook at:
https://www.facebook.com/groups/1072292259768446
94