Volume 11 Number 6 13 December 2023
The Taxonomic Report
OF THE INTERNATIONAL LEPIDOPTERA SURVEY
ISSN 2643-4776 (print) / ISSN 2643-4806 (online)
Genomic analysis reveals new species and subspecies of butterflies
Jing Zhang'”*, Qian Cong'*, Jinhui Shen'”, Leina Song'”, and Nick V. Grishin'”
Departments of 'Biophysics, 7Biochemistry, and 7Eugene McDermott Center For Human Growth & Development,
University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390-9050, USA;
“Corresponding author: [email protected]
ABSTRACT. Large-scale genomic sequencing of butterfly taxa reveals new findings that are presented here. While
we focus on detecting species by comparative genomics and define subspecies as groups of populations genetically
differentiated from each other but not as strongly as species (1.e., subspecies as “species in the making”), we report other
adjustments to butterfly classification. As a result, 4 subgenera, 11 species, and 6 subspecies are proposed as new. New
subgenera are: Rapis Grishin, subgen. n. (type species Papilio rapae Linnaeus, 1758, genus Pieris Schrank, 1801) in Pieridae
Swainson, 1820 and Callitera Grishin, subgen. n. (type species Eurygona? pulcherrima Herrich-Schaffer, [1853], genus /sapis
E. Doubleday, 1847), Matizada Grishin, subgen. n. (type species Themone poecila H. Bates, 1868, genus /sapis E. Doubleday,
1847), and Parapanara Grishin, subgen. n. (type species Lyropteryx diadocis Stichel, 1910, genus Paraphthonia Stichel,
1910) in Riodinidae Grote, 1895 (1827). New species are (type localities in parenthesis): Chlosyne pardelina Grishin, sp. n.
(USA: Texas, Duval Co.) in Nymphalidae Rafinesque, 1815; Erythia paracheles Grishin, sp. n. (Panama: Canal Zone), Erythia
borrosa Grishin, sp. n. (Panama: Panama), and Cremna telarania Grishin, sp. n. (Bolivia: La Paz) in Riodinidae; and
Euriphellus colombiensis Grishin, sp. n. (Colombia: Rio Dagua), Euriphellus ecuadoricus Grishin, sp. n. (Ecuador: Canelos),
Urbanus (Urbanus) cubanus Grishin, sp. n. (Cuba: Havana), Gorgythion guyanus Grishin, sp. n. (Guyana: Essequibo), Lon co
Grishin, sp. n. (Mexico: Guerrero), Lon ma Grishin, sp. n. (Panama: Chiriqui), and Lon chia Grishin, sp. n. (Mexico: Chiapas)
in Hesperiidae Latreille, 1809. New subspecies are (type localities in parenthesis): Chlosyne definita dolosa Grishin, ssp. n.
(Mexico: Chihuahua) in Nymphalidae and Limochores mystic nino Grishin, ssp. n. (USA: Arizona, Coconino Co.), Hesperia
pahaska hannawackeri Grishin, ssp. n. (USA: Utah, San Juan Co.), Pseudocopaeodes eunus ash Grishin, ssp. n. (USA:
Nevada, Nye Co.), Ochlodes napa kaibab Grishin, ssp. n. (USA: Arizona, Coconino Co.), and Lon melane sur Grishin, ssp. n.
(Mexico: Baja California Sur) in Hesperiidae. Furthermore, we confirm 1 genus, resurrect 2 subgenera, change the rank of 3
genera to subgenera, synonymize 3 genera, 1 species, and 1 subspecies, and present evidence to support 17 taxa (1 confirmed)
as species instead of subspecies or synonyms. Namely, we confirm Perpheres Hirowatari, 1992 as a valid genus, not a junior
subjective synonym of Danis [Fabricius], 1807 (Lycaenidae); treat Sinopieris H. Huang, 1995 and Artogeia Verity, 1947 as
subgenera (not genera or synonyms) of Pieris Schrank, 1801 (Pieridae); regard these genera as subgenera: Serradinga G.
Henning & S Henning, 1996 of Dingana van Son, 1955 (Nymphalidae), Necyria Westwood, 1851 of Lyropteryx Westwood,
1851 (Riodinidae), and Nothodanis Hirowatari, 1992 of Danis [Fabricius], 1807 (Lycaenidae); and propose that the following
are junior subjective synonyms, not genera, species, or subspecies: Eugrumia Della Bruna, Gallo, Lucarelli & Sbordoni, 2000
of Sinerebia Nakatani, 2017 in Nymphalidae: Satyrini: Ypthimina Reuter, 1896, new placement (not Erebiina Tutt, 1896),
Pistoria Hemming, 1964 of Caleta Fruhstorfer, 1922 and Upolampes Bethune-Baker, 1908 of Thaumaina Bethune-Baker,
1908 in Lycaenidae, and Synargis orestessa Hubner, [1819] of Synargis soranus (Stoll, 1781) and Mesosemia eumene furia
Stichel, 1910 of Ectosemia erinnya (Stichel, 1910) in Riodinidae. The following taxa are species, not subspecies or synonyms:
Pontia edusa (Fabricius, 1777) (not Pontia daplidice (Linnaeus, 1758)) and Pontia johnstonii (Crowley, 1887) (not Pontia
helice (Linnaeus, 1764)) in Pieridae; Chlosyne anastasia (Hemming, 1934) (not Chlosyne definita (E. Aaron, [1885])) and
Chlosyne bollii (W. H. Edwards, 1878) (not Chlosyne theona (Meénétriés, 1855)) in Nymphalidae; Ectosemia attavus (J. Zikan,
1952) (not Ectosemia eumene (Cramer, 1776)), Cremna dentata (Stichel, 1910) (not Cremna radiata (Godman & Salvin,
1886)), Cremna pupillata Stichel, 1915 (not Cremna alector (Geyer, 1837)), Lasaia peninsularis Clench, 1972 (not Lasaia
sula Staudinger, 1888), and Synargis arche (Hewitson, 1865) (not Synargis orestessa Hubner, [1819]) in Riodinidae; and
Quadrus (Zera) difficilis (Weeks, 1901) (confirmed as not Quadrus (Zera) zera (A. Butler, 1870)), Gorgythion marginata
Schaus, 1902 (not Gorgythion begga (Prittwitz, 1868)), Pardaleodes murcia (Pl6tz, 1883) (not Pardaleodes incerta (Snellen,
1872)), Pardaleodes pusiella Mabille, 1877 (not Pardaleodes sator (Westwood, 1852)), Ochlodes napa (W. H. Edwards, 1865)
and Ochlodes santacruza J. Scott, 1981 (not Ochlodes sylvanoides (Boisduval, 1852)), and Lon vitellina (Herrich-Schaffer,
1869) and Lon poa (Evans, 1955) (not Lon melane (W. H. Edwards, 1869)) in Hesperiidae. In addition, we propose new genus-
1
Species combinations: Ectosemia nesti (Hewitson, 1858) (not Semomesia Westwood, 1851), Ectosemia acuta (Hewitson, 1873)
and Ectosemia eurythmia (Stichel, 1915) (not Mesosemia Hubner, [1819]), Eugelasia satyroides (Lathy, 1926), Eugelasia
modesta (H. Bates, 1868) and Pelolasia leucophryna (Schaus, 1913) (not Euselasia Hubner, 1819), Lyropteryx melaniae
(Stichel, 1930) (not Melanis Hubner, [1819]), /sapis pulcherrima (Herrich-Schaffer, [1853]) and /sapis poecila (H. Bates,
1868) (not Themone Westwood, 1851), Paraphthonia diadocis (Stichel, 1910) (not Lyropteryx Westwood, 1851), Tarucus
clathratus W. Holland, 1891 (not Castalius Hubner, [1819]), and Vidius tanna (de Jong, 1983) (not Cobalopsis Godman,
1900); new species-subspecies combination Ochlodes santacruza catalina J. Emmel & T. Emmel, 1998 (not Ochlodes
sylvanoides (Boisduval, 1852)); and transfer junior subjective synonyms between taxa: Parnassius smintheus var. niger W. G.
Wright, 1905 of Parnassius smintheus smintheus E. Doubleday, 1847 (not of Parnassius smintheus behrii W. H. Edwards,
1870), Goniurus proteoides Plotz, 1881 of Urbanus proteus domingo (Scudder, 1872) (not of Urbanus proteus proteus
(Linnaeus, 1758)), Bolla subgisela Strand, 1921 of Staphylus melangon epicaste Mabille, 1903 (not of Bolla eusebius (Plotz,
1884)), Gorgythion beggoides Schaus, 1902 of Gorgythion begga begga (Prittwitz, 1868) (not of Gorgythion plautia
(Moschler, 1877)), and Pamphila milo W. H. Edwards, 1883 of Ochlodes agricola verus (W. H. Edwards, 1881) (not of
Ochlodes agricola nemorum (Boisduval, 1852)). Furthermore, by finding an additional specimen, we confirm Semalea malawi
Grishin, 2023 as a species-level taxon using genomic analysis; we conclude that populations of Hesperia pahaska Leussler,
1938 in most of New Mexico and the White Mountains, Arizona are the nominal subspecies, not H. pahaska williamsi Lindsey,
1940; and report a natural hybrid between Chlosyne bollii (W. H. Edwards, [1878]) and Chlosyne chinatiensis (Tinkham,
1944). Lectotypes are designated for 6 names: Erebia atramentaria Bang-Haas, 1927 (type locality in China: Gansu) in
Nymphalidae; Mesosemia eumene erinnya Stichel, 1910 (type locality in Peru: Pozuzo) and Mesosemia eumene furia Stichel,
1910 (type locality Bolivia: La Paz, Farinas) in Riodinidae; and Goniurus proteoides Pl6tz, 1881 (type locality in the Antilles),
Hesperia erratica Plotz, 1883 (type locality likely in the USA, not Guatemala, as deduced by genomic comparison),
confirming this name as a junior subjective synonym of Lon zabulon (Boisduval & Le Conte, [1837]), and Lerodea? rupilius
Schaus, 1913 (type locality Mexico: Jalisco, Guadalajara, not Costa Rica: Guapiles), not a nomen dubium, but a subspecies of
Atrytonopsis edwardsi W. Barnes & McDunnough, 1916, in Hesperiidae. A neotype is designated for Cobalus vitellina
Herrich-Schaffer, 1869 (type locality becomes Mexico: Oaxaca). Hesperia amanda Pl6tz, 1883 is regarded as a nomen dubium,
not a junior subjective synonym of Ochlodes sylvanoides napa (W. H. Edwards, 1865).
Additional keywords: taxonomy, subspecies, classification, genomics, phylogeny, biodiversity.
ZooBank registration: http://zoobank.org/4594F1CA-9EE8-4A 80-A0CA-792676139D20
INTRODUCTION AND METHODS
This work extends our studies that stem from genomic sequencing of butterflies and employs similar
principles and methods (Cong et al. 2019a, b, 2020, 2021; Li et al. 2019; Zhang et al. 2019a—d, 2020,
2021, 2022b, c, 2023b—d; Robbins et al. 2022). The objective is to enhance the classification of butterflies
by analyzing genomic data. The chosen method involves screening various specimens of butterfly taxa
across the world. The focus is on species found in the United States, with specimens collected from their
entire geographical range. These specimens are primarily sourced from museum and private collections
(see the acknowledgments section for details), with ages ranging from approximately 250 years to
recently collected. Whenever feasible, we sequence the DNA of primary type specimens to establish an
unbiased reference for their names (Zhang et al. 2022a). DNA extraction typically utilizes the legs of
Specimens, and our non-destructive protocol preserves these legs. The DNA is fragmented unless the
specimen's DNA is already short due to age and is then sequenced using the Illumina next-generation
sequencing platform with 150 bp reads. Our approach does not rely on the amplification of specific genes
or regions; instead, we sequence every extracted DNA segment. Consequently, the protocol is effective
even with very old specimens, whose DNA may be fragmented into 30—50 bp segments.
Sequence data, specifically segments that are 150 base pairs or shorter, from each specimen are
employed to construct exons of protein-coding genes. This construction is guided by a reference genome
from the species most closely related according to phylogeny. These protein-coding genes serve as the
basis for inferring the phylogenic trees. Three separate trees are generated using IQtree v1.6.12, utilizing
the GIR+GAMMA model (Nguyen et al. 2015): one tree is derived from autosomes in the nuclear
genome, another from the gene predicted to be located in the Z chromosome, and the third from the
mitochondrial genome. To reduce the computational workload, a random selection of 100,000 codons is
made, representing approximately 2% of the total dataset, for use in constructing the nuclear trees
2
(300,000 base pairs). Statistical support for the tree branches is determined based on 100 replicates, each
composed of 10,000 codons randomly sampled from the complete set of codons. Trees are constructed for
each replicate, and the statistical support value, ranging from 0 to 100, corresponds to the number of
replicates with a bipartition identical to that in the 100,000-codon tree. For further methodological details,
refer to our earlier publications (Li et al. 2019; Zhang et al. 2022b).
The phylogenetic trees were visualized, rotated, and colored using FigTree (Rambaut 2018). We
superimposed the current taxonomic classification onto these trees to identify taxa that are not
monophyletic and to pinpoint clades corresponding to taxa that lack names. Genomic trees often unveil
"levels," representing specific points in time when diversification occurred independently in multiple
lineages (Zhang et al. 2021). These instances of "synchronized" diversification arise from geological
events that affect major lineages simultaneously. They present an opportunity to align taxonomic ranks
(such as tribe, subtribe, genus, or subgenus) with the levels observed in genomic trees. This approach
results in a more objective and internally consistent classification that takes into account both genetic
differentiation and paleontological history. In making classification decisions, we heavily rely on genomic
trees, with morphological considerations as supplementary evidence to justify the outcomes. This
preference stems from the fact that genomes provide a comprehensive view of an organism,
encompassing more information than the morphology of adult specimens traditionally used in butterfly
classification. Genomes carry encoded data about life histories, habitat preferences, mating behavior, and
dietary sources. While we may not yet have the means to extract and predict phenotypic traits from this
genetic information, we can employ its genetic equivalent, derived from an aggregate of random codons
from all protein-coding genes. This allows us to deduce a taxonomic classification that is rooted in
phylogeny and sound from an evolutionary perspective.
The taxa we define are monophyletic and correspond to prominent clades. By “prominent,” we
refer to branches within the tree with strong statistical support, typically with 100% agreement among
replicates, and are usually longer than neighboring branches. The length of a branch is directly
proportional to the number of base-pair substitutions that have occurred along that branch. Not only do
longer branches receive high statistical support, but their larger number of base-pair substitutions is likely
to result in more noticeable phenotypic changes. These changes might be reflected in various
morphological characteristics, which may not necessarily manifest in adults but could be apparent in
immature stages or other aspects of the phenotype. However, it is important to note that the relationship
between the number of genetic changes and visually significant phenotypic differences is highly non-
linear (Zhang et al. 2019a). This means there can be short tree branches that correspond to visually
distinguishable taxa. Each case needs to be evaluated individually. Nonetheless, it remains unclear
whether a significant phenotypic change in the appearance of adults, brought about by a small number of
genetic changes, such as a single genomic segment inversion, justifies the erection of a distinct taxon for
that lineage. This is especially true if all other characteristics, like those of caterpillars, remain quite
similar to the relatives of this lineage. Importantly, our taxonomic proposals consider the current
classification, and we use currently recognized names and their respective taxonomic ranks as reference
points for defining levels within the trees and establishing new taxa.
While we address a number of higher classification issues in this work, such as altering some
genera, proposing new subgenera, and transferring species between genera to restore monophyly, the
focus is on the species and subspecies levels. Species are delineated by a combination of criteria that
include genetic differentiation in the Z chromosome measured by Fst (0.20 usually corresponds to
distinct species) and gene exchange Gmin (<0.05 for distinct species) (Cong et al. 2019a), COI barcode
difference (typically >2% for distinct species) (Hebert et al. 2003) and its correlation with phenotypic
differences (Lukhtanov et al. 2016), and the prominence of species-level clades (Zhang et al. 2022c).
However, COI barcodes (together with mitochondria) frequently introgress between species (Bachtrog et
al. 2006; Cong et al. 2017a), and some distinct species may possess highly similar or identical barcodes
(Burns et al. 2008; Zhang et al. 2023a). See the “Species, subspecies, and genomics” section in Zhang et
al. (2022a) for further discussion.
Traditionally, subspecies are defined as groups of populations from different geographical areas
that possess recognizable phenotypic differences (e.g., 70% of individuals can be identified by phenotype
without knowing their locality) but can successfully interbreed (Mayr 1982; Monroe 1982). In practice,
the “successfully interbreed” criterion is difficult to assess, and typically, wing pattern difference in
butterflies from different localities is the sole criterion for subspecies definition. It nearly always remains
unknown whether these wing pattern differences are genetically encoded or are a consequence of
environmental factors. Working with genomic sequences allows us to compare populations in their
genotypes. New subspecies names are proposed in this work for genetically differentiated populations that
form distinct clades in at least one of the genomic trees, but their genetic differentiation is lower than that
we use to delineate species. Thus, our subspecies are “species in the making:” differentiated populations,
but to a lesser extent than species. After we delineate subspecies in the genomic trees, we inspect the wing
patterns of these specimens and figure out wing pattern characters that may statistically diagnose these
subspecies. As for most subspecies, these phenotypic diagnoses are statistical, 1.e., they may apply to
~70% of specimens, and exceptions should be expected. However, because our subspecies are delineated
as Clades in the genomic trees, DNA-based characters that support these clades are expected to be much
stronger than wing pattern characters and to hold for nearly all specimens. Therefore, we also provide
DNA-based diagnoses for all newly described subspecies.
Sections of this work are arranged in taxonomic order deduced from genome-scale phylogeny
complemented by phenotypic considerations. For the new taxa, in addition to brief phenotypic diagnoses
sometimes accompanied by references that discuss and illustrate morphological characters in greater
detail, we provide diagnostic DNA characters in the nuclear genome and (when meaningful) in the COI
barcode. DNA characters are found in nuclear protein-coding regions using our previously developed
procedure (see SI Appendix to Li et al. 2019). The logic behind the character selection was described in
Cong et al. (2019b) and is aimed at finding more robust characters likely to stand when additional
Specimens and species are sequenced.
The character states are given in species diagnoses as abbreviations for one of the four reference
genomes: Pieris rapae (Linnaeus, 1758) (pra) (Shen et al. 2016), Heliconius melpomene (Linnaeus, 1758)
(hm) (Davey et al. 2016), Calephelis nemesis (W. H. Edwards, 1871) (cne) (Cong et al. 2017b), or
Cecropterus lyciades (Geyer, 1832) (aly, because this species was formerly in the genus Achalarus
Scudder, 1872) (Shen et al. 2017). E.g., aly728.44.1:G672C means position 672 in exon | of gene 44
from scaffold 728 of the Cecropterus lyciades (Geyer, 1832) reference genome (Shen et al. 2017) is C,
changed from G in the ancestor. When characters are given for the sister clade of the diagnosed taxon, the
following notation is used: aly5294.20.2:A548A (not C), which means that position 548 in exon 2 of gene
20 on scaffold 5294 is occupied by the ancestral base pair A, which was changed to C in the sister clade
(so it is not C in the diagnosed taxon). The same notation is used for COI barcode characters but without a
prefix ending with ‘:’. The sequences of exons from the reference genome with the positions used as
character states highlighted in green are in the supplemental file deposited at < https://osf.io/akhmg/ >.
This link to the DNA sequences accessible from this publication ensures that DNA characters given in the
diagnoses can be readily associated with actual sequences.
Whole genome shotgun datasets we obtained and used in this work are available from the NCBI
database < https://www.ncbi.nlm.nih.gov/ > as BioProject PRJNA1051313 and BioSample entries of the
project contain the locality and other collection data of the sequenced specimens shown in the trees. For
each specimen in tree figures, the following information is provided (separated by “|”): taxon name with
comments in square brackets, DNA sample code, type status, general locality, and year of collection
(“old” if not dated and likely collected 100—150 years ago). Type status abbreviations are: HT holotype,
LT lectotype, ST syntype, T type (could be ST, LT, paralectotype, or HT, status not investigated), PT
paratype; and if a synonym name is given (in parenthesis, preceded by “=”, and in addition by “t” for
unavailable names), type status refers to the synonym. COI barcode sequences reported here have been
deposited in GenBank with accessions OR837724—OR837745 and OR939283—OR939284. Abbreviations
or acronyms for collections are listed in the acknowledgments section.
4
Family Papilionidae Latreille, [1802]
Parnassius smintheus var. niger W. G. Wright, 1905 is a junior subjective synonym
of Parnassius smintheus smintheus E. Doubleday, 1847 and not
of Parnassius smintheus behrii W. H. Edwards, 1870
Genomic analysis of the holotype of Parnassius smintheus var. niger W. G. Wright, 1905 (type locality
USA: California, Sierra Co. Donner Summit, but no locality label on the holotype, sequenced as NVG-
22098G08) (Fig. 1 red, highlighted yellow) currently treated as a junior subjective synonym of
Parnassius smintheus behrii W. H. Edwards, 1870 (type locality USA: California, Tioga Pass) is not
monophyletic with it (Fig. 1 magenta) and is instead in the clade with more eastern subspecies of
Parnassius smintheus E. Doubleday, 1847 (type locality in “Rocky Mountains,” possibly Canada:
Alberta, vicinity of Rock Lake) (Fig. | blue, olive and cyan). While the affinity of P. smintheus var. niger
to these eastern subspecies and not to P. s. behrii or northern and western subspecies (P. s. sternitzkyi
McDunnough, 1937, P. s. olympianna Burdick, 1941 and P. s. yukonensis Eisner, 1969) is confident, it 1s
more challenging to assign it to one of the eastern taxa using the specimens we sequenced. Tentatively, in
accord with the nuclear genome tree (Fig. 1), we place P. smintheus var. niger as a junior subjective
synonym of Parnassius smintheus smintheus E. Doubleday, 1847, and hypothesize that its type locality
may have been incorrect. Sequencing of additional specimens across the range, including those from
around the Donner Pass area in Sierra Co., California, is needed to determine its locality and synonymy
more precisely. Our current genomic analysis reveals that Parnassius smintheus maximus Bryk & Eisner,
1937 (type locality in USA: Montana, Fergus Co.) is closely related to the nominotypical P. smintheus
(Fig. 1 blue), and it is possible that P. smintheus var. niger is synonymous with the former taxon, or all
Parnassius smintheus olympianna (=guppyi)|20094C03|HT|Canada:British Columbia|1962
Parnassius smintheus olympianna (=guppyi)|22022E12|Canada:British Columbia|1978
100 Parnassius smintheus olympianna|19083G06|USA:WA,Challam Co.|1970
56 Parnassius smintheus olympianna|19083G07|USA:WA,Challam Co.|1970
Parnassius smintheus olympianna|22022E11|USA:WA,Challam Co.|1979
Parnassius smintheus behrii]19083G11|USA:CA,Mono Co.|1961
Parnassius smintheus behrii|19083G12|USA:CA, Alpine Co.|1961
160 Parnassius smintheus behrii]22061C08|USA:CA,Alpine Co.|2015
Viera Parnassius smintheus behrii]21077A03|USA:CA, Alpine Co.|1990
100 L Parnassius smintheus behrii]22061C07|USA:CA,Alpine Co.|2020
Parnassius smintheus behrii|6662|USA:CA,Alpine Co.|2015
Parnassius smintheus behrii|20125E02|NT|USA:CA, Tioga Pass|1916
Parnassius smintheus behrii|21077A04|USA:CA, Tuolumne Co.|1991
Parnassius smintheus yukonensis|19083G09|Canada:British Columbia|1972
on ee Parnassius smintheus yukonensis|21058B07|Canada:Yukon|1984
uA Parnassius smintheus yukonensis|22104C02|PT|Canada:Yukon|1968
1 100 Parnassius smintheus yukonensis|22104C01|PT|Canada:Yukon|1968
Parnassius smintheus yukonensis|16107A10|Canada:Yukon|2016
Parnassius smintheus yukonensis|16107A12|Canada:Yukon|2016
Parnassius smintheus yukonensis|16107B01|Canada:Yukon|2016
Parnassius smintheus magnus|22098G09|LT|Canada:British Columbia|old
Parnassius smintheus magnus (=xanthus)|21018C09|ST|USA:ID,Latah Co.|old
Parnassius smintheus smintheus|19083G08|Canada:Alberta|2003
Parnassius smintheus smintheus (=niger) [not behrii]|22098GO08|HT|"USA:CA, Sierra Co."|old
90 7 Parnassius smintheus maximus|20067C02|USA:MT,Madison Co.|2004
Parnassius smintheus maximus|22075D06|USA:MT,Carbon Co.|1985
nae] = Parnassius smintheus maximus|20067C04|USA:MT,Gallatin Co.|1957
Parnassius smintheus maximus|22075D03|USA:MT,Fergus Co.|1982
Si deeat Parnassius smintheus maximus|22075D02|USA:MT,Fergus Co.|no date
88 Parnassius smintheus maximus|22075D04|USA:MT,Fergus Co.|1982
100 Parnassius smintheus maximus|22075D05|USA:MT,Carbon Co.|1985
Parnassius smintheus sayii|6542|USA:CO,Park Co.|2016
Parnassius smintheus sayii|6501|USA:CO, Teller Co.|2016
Parnassius smintheus sayii (=montanus)|21018D02|ST|USA:CO,Park Co.|old
“168 Parnassius smintheus sayii|20125E04|NT|USA:CO, Elbert Co.|old
Parnassius smintheus sayii (=rotgeri)|21128G09|?ST|USA:CO,Mt. Evans|old
700 Parnassius smintheus pseudorotgeri|19011HO2|USA:CO,Gunnison Co.|1962
: Parnassius smintheus pseudorotgeri|20039F11|USA:UT,San Juan Co.|2019
Parnassius smintheus pseudorotgeri|19011H01|USA:CO,Gunnison Co.|1962
100 Parnassius smintheus pseudorotgeri|M14|USA:CO,Hinsdale Co.|2018
Parnassius smintheus pseudorotgeri|19083G10|USA:CO,Hinsdale Co.|1979
= Parnassius smintheus pseudorotgeri|M15|USA:CO,Hinsdale Co.|2018
0.002 Parnassius smintheus pseudorotgeri|19011G11|USA:CO,Hinsdale Co.|1962
Fig. 1. The phylogenetic tree of the Parnassius smintheus subspecies inferred from protein-coding regions of the nuclear
genome (autosomes): 3,763,728 bp positions and ultra-fast bootstrap (Minh et al. 2013) were used for this tree. The holotype of
P. smintheus var. niger is shown in red and highlighted in yellow, and P. smintheus behrii is colored in magenta.
5
three are synonyms. Before sequencing the lectotype of P. smintheus smintheus that is expected to shed
light on the situation, we avoid replacing the name P. smintheus maximus with P. smintheus niger.
Family Pieridae Swainson, 1820
Pontia edusa (Fabricius, 1777) is confirmed as a species distinct
from Pontia daplidice (Linnaeus, 1758)
Although it cannot be readily identified by external appearance, Pontia edusa (Fabricius, 1777) (type
locality in Germany) is most strongly differentiated genetically from Pontia daplidice (Linnaeus, 1758)
(type locality in South Europe and Africa), with Fst/Gmin/COI barcode difference of 0.85/0.000/8.2% (54
bp) (Fig. 2). This difference is significantly more than usual for close relatives and is more in line with the
difference between species in different subgenera. Therefore, we confirm that Pontia edusa (Fabricius,
1777) is a species distinct from Pontia daplidice (Linnaeus, 1758). Finally, we note a curious
incongruence between the nuclear (Fig. 2a) and mitochondrial (Fig. 2b) genome trees. As expected from
their phenotypes, Pontia glauconome (Klug, 1829) (type locality in Egypt) is sister to both P. daplidice
and P. edusa in the nuclear genome tree. However, P. edusa gets within the P. glauconome clade in the
mitochondrial genome tree, likely due to mitochondrial introgression.
,gPontia daplidice|15117F12|Spain|1989 b mitochondrial
idgontia daplidice|20035A07|France|2018
Pontia daplidice|22095A06|Israel|1981
Pontia edusa|20058G08|Russia:South Ural|2020
Pontia edusa|22095A07|Kazakhstan|1970
ggontia daplidice|15117F12|Spain|1989
idgontia daplidice|20035A07|France|2018
Pontia daplidice|22095A06|Israel|1981
Bontia edusa|20058G08|Russia: eee Ural|2020
Pontia edusa|22095A05|India|1962
sePontia edusa|22095A07|Kazakhstan|1970
Pontia glauconome|20058G07|Sudan|2020
Pontia johnstonii [not helice]|22095A11|Kenya|1986
iT pentia helice|22095A10|South Africa|1981
0.02 Pontia helice|22095A12|South Africa|1981
a. nuclear
- Pontia edusa|22095A05|India|1962
Pontia glauconome|20058G07|Sudan|2020
Pontia johnstonii [not helice]|22095A11|Kenya|1986
» Pontia helice|22095A10|South Africa|1981
0,008 **Pontia helice|22095A12|South Africa|1981
Fig. 2. Phylogenetic trees of selected Pontia species inferred from protein-coding regions of a) the nuclear (autosomes) and b)
the mitochondrial genomes. Different species are shown in different colors: P. daplidice (blue), P. edusa (red), P. johnstonii
(magenta), P. helice (green), and P. glauconome (black).
Pontia johnstonii (Crowley, 1887) is a species distinct
from Pontia helice (Linnaeus, 1764)
Synchloe johnstonii Crowley, 1887 (type locality Tanzania: Kilimanjaro) currently treated as a subspecies
of Papilio helice Linnaeus, 1764 (type locality South Africa: Tulbagh) in the genus Pontia [Fabricius],
1807 (type species Papilio daplidice Linnaeus, 1758) is genetically differentiated from it at the level
characteristic of distinct species (Fig. 2), e.g., COI barcodes differ by 3.8% (25 bp), and is phenotypically
distinguished by nearly black framing around olive overscaling of veins on hindwing. Therefore, we
propose that Pontia johnstonii (Crowley, 1887), stat. rest. is a species distinct from Pontia helice
(Linnaeus, 1764).
Sinopieris H. Huang, 1995 and Artogeia Verity, 1947 are subgenera of Pieris Schrank, 1801
At times treated as a distinct genus or placed in Pontia [Fabricius], 1807 (type species Papilio daplidice
Linnaeus, 1758), Sinopieris H. Huang, 1995 (type species Sinopieris gongaensis H. Huang, 1995)
originates within Pieris Schrank, 1801 (type species Papilio brassicae Linnaeus, 1758) according to our
genomic trees (Fig. 3). Therefore, Sinopieris belongs to Pieris. However, due to the visual distinction of
some of these species resulting in their confusion with Pontia, instead of synonymizing Sinopieris with
Pieris, we propose to treat the former as a subgenus of the latter. We note that Pieris extensa Poujade,
1888 (type locality in China) belongs to the subgenus Sinopieris (Fig. 3). Then, to restore the monophyly
of the subgenus Pieris, we propose to treat Artogeia Verity, 1947 stat. rev. (type species Papilio napi
Linnaeus, 1758), which is sister to Sinopieris (Fig. 3), as another subgenus of Pieris.
6
Rapis Grishin, new subgenus
http://zoobank. org/CDE5789D-03D6-4AEF-8974-8F 1C57995DD5
Type species. Papilio rapae Linnaeus, 1758.
Definition. Genomic phylogeny of the genus Pieris Schrank, 1801 (type species Papilio brassicae
Linnaeus, 1758) reveals several prominent clades that could be regarded as subgenera, including the
nominotypical (Fig. 3 violet) and Artogeia Verity, 1947 (type species Papilio napi Linnaeus, 1758) (Fig.
3 blue). Although Sinopieris H. Huang, 1995 (type species Sinopieris gongaensis H. Huang, 1995) (Fig. 3
red) is not supported by a very prominent branch, this group of species is confidently monophyletic,
originates around the same time as other subgenera and is phenotypically distinct. The remaining fourth
clade (Fig. 3 green) is prominent and cannot be confidently included in other subgenera: it is sister to the
subgenus Pieris in the genomic tree, but only with 88% support (not above 95%). Therefore, this green
clade represents the fourth subgenus, and it does not have a name. This new subgenus constitutes the P.
rapae group of Robbins and Henson (1986), who described and illustrated diagnostic characters for it. In
brief, species in the new subgenus are distinguished from the nominotypical subgenus by shorter (less
than half the size) and onion-shaped, rather than elongated, androconia and from Artogeia and Sinopieris
by the lack of posterior process on signum (Robbins and Henson 1986) and, additionally, by the lack of
overscaling along ventral hindwing veins. In DNA, a combination of the following characters is
diagnostic in the nuclear genome: pra6360.8.e1:T87A, pra590.15.e1:A181C, pra82.57.e2:G168T, pra82.57.
e2:T177C, pra283.114.e1:A531T and in COI barcode: T163A, A205T, T421T, G512G, C533C, T535T,
TS89C, C64 1C.
Etymology. The name is a fusion of the type species name with its genus name: Rap[ae] + [Pier]is. The
name is a feminine noun in the nominative singular.
Species included. The type species (1.e., Papilio rapae Linnaeus, 1758), Papilio canidia Linnaeus, 1768,
Pieris krueperi Staudinger, 1860, Pontia mannii J. Mayer, 1851, and Pieris tadjika Grum-Grshimailo,
1888 (Robbins and Henson 1986), including their closest relatives sometimes regarded as distinct species.
Parent taxon. Genus Pieris Schrank, 1801.
Pieris (Rapis) rapae|7230|Sweden|1971
76 Pieris (Rapis) mannii|16103E12|Greece|1992
OU Pieris (Rapis) canidia]15112F06|Hong Kong|1982
100 Pieris (Rapis) tadjika|16103G03|Pamirlold
Pieris (Rapis) krueperi|16103E10|Greece|1992
To) Pieris (Pieris) brassicae|16103C06|Sweden|1983
003 Too Pieris (Pieris) deota|18096HO9|Uzbekistan|old
Pieris (Pieris) brassicoides|16103D07|Ethiopia|1956
700 Pieris (Artogeia) marginalis|15116B10|USA:WA,Mason Co.|1983
68 Pieris (Artogeia) virginiensis|6138|USA:WV,Pendleton Co.|2016
Pieris (Artogeia) oleracea|16105B04|USA:MI,St. Joseph Co.|1984
Pieris (Artogeia) dulcinea|16103G12|Russia:Primorskyi Krai|1981
10 4 Pieris (Artogeia) erutae|16103H08|India|1979
Pieris (Artogeia) melete|16104A01|Japan|1984
Pieris (Artogeia) nesis|16105D05|Japan|1971
Pieris (Artogeia) narina|16104A08|Kazakhstan|1963
' Pieris (Artogeia) segonzaci|16104C01|Marokko|1961
on Pieris (Artogeia) napi]16105D07|Norway|1987
100 Pieris (Artogeia) ochsenheimeri|18097F11|Uzbekistan|old
100 Pieris (Artogeia) ergane|16103H03|Albania|1991
Pieris (Sinopieris) extensa|16103H10|Chinalold
Pieris (Sinopieris) davidis]16103G09|Tibet|1911
Pieris (Sinopieris) dubernardi|16103G10|China:Yunnan|1914
88
Pieris (Sinopieris) venata|16103G08|no data|old
4 100 Talbotia naganum cisseis|16103D11|China|]1946
Pontia daplidice|15117F12|Spain|1989
gs 90” -Pontia callidice|15117HO3|Russia,Altai Mts.|2001
20 Pontia santamarta|19078C07|Colombia|1977
100 Pontia chloridice|7722|Kazakhstan|1966
Pontia sisymbrii|17066FO6|USA:CA, Tulare Co.|2009
90 Pontia shawii|19068G05|N Kashmirlold
06 Ganyra josephina|17116G12|Mexico:Tam|1974
86 Ascia monuste|4148|USA:TX,Jefferson Co.|2015
Leptophobia eleone|19078B12|Venezuela|1982
Fig. 3. The phylogenetic tree of selected Pierini species inferred from protein-coding regions of the nuclear genomes
(autosomes). Different subgenera of Pieris are shown in different colors: Rapis subgen. n. (blue), Pieris (violet), Artogeia
(blue), and Sinopieris (red). Note the several-fold difference in substitution rates reflected in branch lengths, e.g., low in some
Pontia and high in Ascia Scopoli, 1777.
7
Family Nymphalidae Rafinesque, 1815
Eugrumia Della Bruna, Gallo, Lucarelli & Sbordoni, 2000 is a junior subjective
synonym of Sinerebia Nakatani, 2017, which is a sister genus of Paralasa Moore, 1893
(Satyrini: Ypthimina)
Entirely dark-brown butterfly Erebia atramentaria Bang-Haas, 1927 (type locality China: Gansu
Province, Qinling Mountains, Datong River, syntype sequenced as NVG-22126F02) visually similar to a
better-known Erebia magdalena Strecker, 1880 (type locality in USA: Colorado, Clear Creek Co.) has
been kept in its original genus Erebia Dalman, 1816 (type species Papilio ligea Linnaeus, 1758), the type
genus of the subtribe Erebiina Tutt, 1896, since its description until it was designated the type species of
Sinerebia Nakatani, 2017, a genus sometimes synonymized with Erebia. Genomic phylogeny places a
syntype of Sinerebia atramentaria as a close sister to Eugrumia herse (Grum-Grshimailo, 1891) (type
locality in China), which is the type species of the genus Eugrumia Della Bruna, Gallo, Lucarelli &
Sbordoni, 2000 in the subtribe Ypthimina Reuter, 1896, not Erebiina (Fig. 4 red), with the COI barcode
difference of only 0.8—1.2% (5—8 bp), despite the remarkable difference in their wing patterns. Therefore,
we confidently propose that Eugrumia syn. nov. is a junior subjective synonym of Sinerebia Nakatani,
2017. Sinerebia is sister to Paralasa Moore, 1893 (type species Erebia kalinda Moore, 1865) (Fig. 4), and
some of Sinerebia species were previously included in Paralasa, which is supported by the genetic
similarity between the two genera, e.g., COI barcodes of their type species differ by 6.1% (40 bp). This
small difference is more characteristic of subgenera than genera. However, pending further studies, we
keep Sinerebia and Paralasa as distinct genera due to much closer relationships among species within
each genus than between these genera (Fig. 4).
We suspect that the absence of wing patterns in Sinerebia atramentaria hindered its taxonomic
classification until it was revealed by genomic sequencing. Finally, to define the taxonomic identity of
this species objectively, N.V.G. hereby designates a syntype in the MTD collection, a male with the
following five printed labels, the 4 yellow, and others white: [ Kansu sept.occ. | Hsining | Nanshan mont.
| Tatung | 3500m. Juli}, [| Staudinger | Ankauf 1948 |, [ 711], [ atramentaria O. Bang-Haas, 1927 |
a Erebia (Erebia) ligea|19099C04|France|1975 b Erebia (Erebia) ligea|19099C04|France|1975
Erebia (Erebia) epistygne|19099C07|Spain|1990 : . Erebia (Erebia) alberganus|19099C05|France|1981
nuclear Erebia (Erebia) alberganus|19099C05|France|1981 mitochondrial Erebia (Erebia) epiphron|19099C09|Spain|1982
Erebia (Erebia) medusa|19099C06|Albania|1991
°Erebia (Erebia) triarius|19099C11|France|1980
Erebia (Erebia) pronoe|19099C10|France|1980
Erebia (Erebia) epiphron|19099C09|Spain|1982
Erebia (Erebia) aethiops|19099C12|Austria|1978
Erebia reer} rossii]16106E05|Canada: Yukon|2016
‘Frei (Magda) disa]16106E08|Canada:Yukon|2016
rebia (Magda) mancinus|16106F06|Canada:Yukon|2016
rebia (Magda) mackinleyensis|16106E11|Canada:Yukon|2016
rebia (Magda) magdalena|6549|USA:CO,Park Co.|2016
rebia (Magda) fasciata]16106F02|Canada:Yukon|2016
rebia (Magda) erinnyn|22021H02|Russia: Buryatia|2002
Erebia (Magda) discoidalis|7999|USA:WI, Oneida Co.|1988
Erebia (Boeberia) parmenio|19115C10|Russia:Siberia|old
Erebia (Atercoloratus) aliniJ22126E11|?ST|China|1937
Maniola jurtina|20035B06|France:Var|2018
Cercyonis pegala texana|4506|USA:TX,Wise Co.|2015
Sinerebia herse [=Eugrumia]|19115D07|Chinal|old
Sinerebia atramentaria [not Erebia]|22126F02|LT|China:Gansulold
, Paralasa jordana|19115D08|Turalold
+, Paralasa manioides|20095A12|PT|Afghanistan|1963
*Paralasa mani (=lorimeri)|20129E04|T|Pakistan|1924|
Paralasa asura|20095A09|PT|Afghanistan|1960
Paralasa shakti|20095A10|HT|Afghanistan|1960
Paralasa danorum|21019G08|HT|Afganistan|1948
Paralasa maracandica|19115D09|Uzbekistan|old
Paralasa hades|19115D10|Tajikistan|1971
Paralasa kalinda]|SAMN18673646|India:Himachal
Strabena smithii]19115C11|Madagascar|1988
Ypthima huebneri|19115E04|Myanmar|2002
Melampias huebneri|19115C12|South Africa|1949
Stygionympha vigilans|19115E01|South Africa|1945
Proterebia phegea|19114D03]|Russia, Altailold
Callerebia scanda|19115D03|Indialold
Physcaeneura panda|19115D01|South Africa|1968
Physcaeneura leda|19115D02|Kenya|1950
10
10
100
20
Callerebiina
0.03
ooErebia (Erebia) medusa|19099C06|Albania|1991 FO8
109
Erebia (Erebia) triarius|19099C11|France|1980
aT Erebia (Erebia) pronoe|19099C10|France|1980
Erebia (Erebia) aethiops|19099C12|Austria|1978
Erebia (Erebia) epistygne|19099C07|Spain|1990
Erebia (Magda) rossii|16106E05|Canada:Yukon|2016
8 Erebia (Magda) disa|16106E08|Canada:Yukon|2016
8 Erebia (Magda) mancinus|16106F06|Canada: Yukon|2016
100 ipyepia (Magda) mackinleyensis|16106E11|Canada:Yukon|2016
g&rebia (Magda) fasciata|16106F02|Canada:Yukon|2016
okrebia (Magda) magdalena|6549|USA:CO,Park Co.|2016
eo Erebia (Magda) erinnyn|22021HO2|Russia: Buryatia|2002
60 Erebia (Magda) discoidalis|7999|USA:WI,Oneida Co.|1988
Erebia (Boeberia) parmenio|19115C10|Russia:Siberia|old
Erebia (Atercoloratus) alini|22126E11|?ST|China|1937
a Maniola jurtina|20035B06|France:Var|2018
~ Cercyonis pegala texana|4506|USA:TX,Wise Co.|2015
jopoinerebia herse [=Eugrumia]|19115D07|China|old
Sinerebia atramentaria [not Erebia]|22126F02|LT|China:Gansulold
33, Paralasa hades|19115D10|Tajikistan|1971
Paralasa jordana|19115D08|Turalold
aan jaParalasa asura|20095A09|PT|Afghanistan|1960
to *“Paralasa manioides|20095A12|PT|Afghanistan|1963
55 §7,,Paralasa danorum|21019G08|HT |Afganistan|1948
Paralasa shakti|20095A10|HT|Afghanistan|1960
Paralasa mani (=lorimeri)|20129E04|T|Pakistan|1924|
a Paralasa maracandica|19115D09|Uzbekistan|old
Paralasa kalinda|SAMN18673646|India:Himachal
Fa Strabena smithii]19115C11|Madagascar|1988
ae Ypthima huebneri|19115E04|Myanmar|2002
ary Melampias huebneri|19115C12|South Africa|1949
Stygionympha vigilans|19115E01|South Africa|1945
700 Proterebia phegea|19114D03|Russia,Altailold
AS Callerebia scanda|19115D03|Indialold
Physcaeneura panda|19115D01|South Africa|1968
003 Physcaeneura leda|19115D02|Kenya|1950
Fig. 4. Phylogenetic trees of selected Satyrini Boisduval, [1833] (1820) inferred from protein-coding regions of a) the nuclear
(autosomes) and b) the mitochondrial genomes. Different subtribes are colored differently: Erebiina (purple with Erebia
labeled in purple), Ypthimina (blue with Sinerebia colored and labeled in red and Paralasa labeled in blue), and Callerebiina
Grishin, 2021 (olive). The sequence of SAMN18673646 is taken from the alignment provided in Kawahara et al. (2023).
8
SYNTYPUS | Y. Nekrutenko det. 11.09.2000 ], and [ DNA sample ID: | NVG-22126F02 | c/o Nick V.
Grishin | as the lectotype of Erebia atramentaria Bang-Haas, 1927. The lectotype has noticeable areas on
wings with scales partially rubbed off and a small nick by the apex of the left forewing.
Serradinga G. Henning & S Henning, 1996 is a subgenus of Dingana van Son, 1955
Genomic sequencing of type species of genera Serradinga G. Henning & S Henning, 1996 (Leptoneura
bowkeri Trimen, 1870) and Dingana van Son, 1955 (Leptoneura dingana Trimen, 1873) reveals that they
are closely related to each other (Fig. 5 red and blue), e.g., their COI barcodes differ by 5.8% (38 bp),
which is typical for closely related congeners. Therefore, we propose to treat Serradinga G. Henning & S
Henning, 1996 as a subgenus of Dingana van Son, 1955.
it
a 4e Dingana (Dingana) dingana|22088H01|S Africa|1949 bins Dingana (Dingana) dingana|22088H01|South Africa|1949
Dingana (Serradinga) bowkeri|19098E09|S Africa|1952 Dingana (Serradinga) bowkeri|19098E09|South Africa|1952
Paralethe dendrophilus|19098E03|South Africa|1978 Torynesis mintha|19098E12|South Africa|1934
Aeropetes tulbaghia|19098E01|South Africa|1977 Dira clytus|19098E02|South Africa|1954
> arsocera cassina|19098E10|South Africa|1945 Paralethe dendrophilus|19098E03|South Africa|1978
Tarsocera cassus|19098E11|South Africa|1945 Aeropetes tulbaghia|19098E01|South Africa|1977
Dira clytus|19098E02|South Africa|1954 ool arsocera Cassina|19098E10|South Africa|1945
Torynesis mintha|19098E12|South Africa|1934 — 002 Tarsocera cassus|19098E11|South Africa|1945
Fig. 5. Phylogenetic trees of the type species of available genus-group names in the tribe Dirini Verity, 1953 inferred from
protein-coding regions of a) the Z chromosome and b) the mitochondrial genome. The genus Dingana is colored blue, with its
subgenus Serradinga in red.
Chlosyne pardelina Grishin, new species
http://zoobank.org/4BB18B88-5D3 1-42AF-B99C-5B7D74DDCDI1F
(Figs. 6 part, 7)
Definition and diagnosis. Genomic sequencing of specimens identified as Chlosyne endeis (Godman &
Salvin, 1894) (type locality in Mexico: Nayarit) reveals that they are either not monophyletic (in nuclear
trees) or prominently separated into two clades (in the mitochondrial genome) (Fig. 6). Fs/COI barcode
difference between the specimens in two clades are 0.38/1.5% (10 bp), typical for closely related but
distinct species of Chlosyne Butler, 1870. Therefore, the specimens we sequenced belong to one of the
two distinct species. We identify specimens from Nayarit, Mexico, the state with the type locality of C.
endeis as that species. Specimens from south Texas (USA) and eastern Mexico are not C. endeis and
belong to a different species. This species was at times regarded as a subspecies of C. endeis under the
name “pardelina,” which was attributed either to Higgins (Lamas 2004) or to Scott (Pelham 2008).
However, neither Higgins (1960) nor Scott (1986) made the name available. Higgins proposed “form
pardelina forma nov.” for “male specimens of endeis ..., in which the ground-colour is yellow” (Higgins
1960). However, according to Articles 45.6.1 and 45.6.4.1 of the ICZN Code (ICZN [International
Commission on Zoological Nomenclature] 1999), this name is infrasubspecific because it was applied to
an infrasubspecific entity and not “adopted” before 1985, and therefore is unavailable. The glossary of the
ICZN Code defines “infrasubspecific entity” as “... Specimen(s) within a species differing from other
Specimens in consequence of intrapopulation variability (e.g., opposite sexes, ...,” and Higgins applied
the name to male specimens. Scott did not establish this name either because he merely applied it (not
even referencing Higgins) to the subspecies of C. endeis “in the U.S.” without description, definition, or
bibliographic reference to such (fails Art. 13.1). Therefore, this species lacks an available name, and is
new. This new species is generally similar to C. endeis in having brown wings with yellow or white spots,
some in discal bands separated by veins, and two patches of submarginal red spots (sometimes vestigial)
distad of the yellow discal band on the dorsal hindwing, by the apex and tornus. The new species differs
from C. endeis in having a yellow to orange rather than a white discal band of dorsal hindwing (and
frequently on forewing) and typically larger patches of red hindwing spots. Due to phenotypic variability,
definitive identification is provided by DNA, and a combination of the following characters is diagnostic
9
a Chlosyne definita definita|21108A10|ST|USA:TX,Nueces Co.|1884 b Chlosyne definita definita (=schausi)|22036H04|?HT|Mexico:Ver|old res Chlosyne definita definita|21108A10|ST
Chlosyne definita definita|7665|USA:TX,Cameron Co.|1990 Chlosyne definita definita|21108A10|ST|USA:TX,Nueces Co.|1884 Ghlosyne definita definita|7665|USA:TX
nuclear Chlosyne definita definita (=schausi)|22036H04|?HT|Mexico:Verjold Z-chr Chlosyne definita definita|7665|USA:TX,Cameron Co.|1990 mito Chlosyne definita definita|3462|USA:TX
Chlosyne definita definita|3462|USA:TX,Duval Co.|2015 Chlosyne definita definita|7671|Mexico:Coah|1978 4<Ghlosyne definita definita|7669|USA:TX
Chlosyne definita definita|21025G01|Mexico:NL|2007 9004 — Chlosyne definita definita|7667|USA:TX,El Paso Co.|1981 hlosyne definita definita]7668|USA:TX
Chlosyne definita definita|7671|Mexico:Coah|1978 Chlosyne definita definita|7668|USA:TX,Jeff Davis Co.|1987 0.02 Chlosyne definita definita|7667|USA:TX
0004 Chlosyne definita definita]21025F12|Mexico:NL|2007 Chlosyne definita definita]7669|USA:TX,Presidio Co.|1968 ‘a losyne definita definita|21025G01|Mex
Chlosyne definita definita|22088E02|Mexico:Dur|1988 Chlosyne definita definita|21025G01|Mexico:NL|2007 oChlosyne definita definita|7670|Mexico
Chlosyne definita definita|7667|USA:TX,El Paso Co.|1981 Chlosyne definita definita|7670|Mexico:Coah|1978 Rhlosyne definita definita|21025F12|Mex
Chlosyne definita definita|7669|USA:TX,Presidio Co.|1968 Chlosyne definita definita|22088E02|Mexico:Dur|1988 Ghlosyne definita definita]7671|Mexico
ipo’ Chlosyne definita definita|22088E02|Mex
C d definita (=schausi)|22036H04|?HT|Mex
C definita dolosa [not anastasia]|22088C12|HT
o& definita dolosa [not anastasia]|22088D01|PT
C definita dolosa [not anastasia]|22088D10|PT
ae [not definita]|21025F10|Mex
Chlosyne definita definita]7668|USA:TX,Jeff Davis Co.|1987
Chlosyne definita definita|7670|Mexico:Coah|1978
Chlosyne definita dolosa [not anastasia]|22088C12|HT|Mexico:Chih|1984
Chlosyne definita dolosa [not anastasia]|22088D01|PT|Mexico:Son|1987
Chlosyne definita dolosa [not anastasia]|22088D10|PT|Mexico:Son|1987
Chlosyne anastasia [not definita]|21025F10|Mexico:Dur|1981
Chlosyne anastasia [not definita]|22097C01|Mexico:Dur|1981
Chlosyne pardelina [not endeis]|17117C05|HT|USA:TX, Duval Co.|1980
Chlosyne pardelina [not endeis]|19086A10|PT|Mexico:SLP|1988
Chlosyne endeis|22057H07|Mexico:Nay|1985
Chlosyne endeis|22097C03|Mexico:Nay|~1980
Chlosyne melitaeoides|17117C11|USA:TX, Starr Co.|1974
Chlosyne melitaeoides|19086A09|Mexico:SLP|1984
Chlosyne eumeda|17119F01|Mexico:Gro|1910
Chlosyne eumeda]19125H05|Mexico:Mich|1989
Chlosyne erodyle|19125H03|Mexico:Chia|1988
Chlosyne erodyle|19125H04|Mexico:Chia|1988
Chlosyne melanarge|19086A07|09-SRNP-14964|Costa Rica|2009
Chlosyne melanarge|19125G07|Mexico:Oax|1988
Chlosyne marina|19086A08|Mexico:Chia|1988
Chlosyne marina|19125H06|Mexico:Chia|1988
Chlosyne definita definita|3462|USA:TX,Duval Co.|2015
C definita dolosa [not anastasia]|22088D10|PT|Mexico:Son|1987
Chlosyne definita definita]21025F12|Mexico:NL|2007
Chlosyne definita dolosa [not anastasia]|22088C 12|HT|Mexico:Chih|1984
Chlosyne definita dolosa [not anastasia]|22088D01|PT|Mexico:Son|1987
Chlosyne anastasia [not definita]|21025F10|Mexico:Dur|1981
Chlosyne anastasia [not definita]|22097C01|Mexico:Dur|1981
Chlosyne endeis|22057H07|Mexico:Nay|1985
Chlosyne endeis|22097C03|Mexico:Nay|~1980
36° -Chlosyne pardelina [not endeis]|17117CO5|HT|USA:TX, Duval Co.|1980
Chlosyne pardelina [not endeis]|19086A10|PT|Mexico:SLP|1988
Chlosyne melitaeoides|17117C11|USA:TX,Starr Co.|1974
Chlosyne melitaeoides|19086A09|Mexico:SLP|1984
Chlosyne eumeda|17119F01|Mexico:Gro|1910
Chlosyne eumeda|19125H05|Mexico:Mich|1989
Chlosyne erodyle|19125H03|Mexico:Chia|1988
Chlosyne erodyle|19125H04|Mexico:Chia|1988
Chlosyne melanarge|19086A07|09-SRNP-14964|Costa Rica|2009
Chlosyne melanarge|19125G07|Mexico:Oax|1988 losyne melanarge|19086A07|C Rica
Chlosyne marina|19086A08|Mexico:Chia|1988 fnrosyne marina|19125HO6|Mexico
Chlosyne marina]19125H06|Mexico:Chia|1988 hlosyne marina|19086A08|Mexico
anastasia [not definita]]22097C01|Mex
losyne endeis|22057H07|Mexico:Nay
losyne endeis|22097C03|Mexico:Nay
if pardelina [not endeis]|17117CO5|HT|USA:TX
pardelina [not endeis]|19086A10|PT|Mexico
iGhlosyne melitaeoides|19086A09|Mexico
hlosyne melitaeoides|17117C11|USA
iGhlosyne eumeda|17119F01|Mexico
61 Chlosyne eumeda|19125H05|Mexico
Chlosyne erodyle|19125H03|Mexico
Chlosyne erodyle|19125H04|Mexico
igjosyne melanarge|19125G07|Mexico
1
Fig. 6. Phylogenetic trees of selected Chlosyne species inferred from protein-coding regions of a) the nuclear genome
(autosomes), b) the Z chromosome, and c) the mitochondrial genome. Different taxa are shown in different colors: C. definita
(blue, with C. definita dolosa ssp. n. in red), C. anastasia stat. rest. (green), C. pardelina sp. n. (magenta), and C. endeis
(violet). One tree branch was truncated, as indicated by dots.
in the nuclear genome: hm2012952-RA.1:A156G, hm2012952-RA.1:A543T, hm2010701-RA.4:C66T,
hm2018077-RA.9:G69C, hm2006719-RA.4:C78T and in COI barcode: A286C, C451T, 562T, 574C, A625G.
Barcode sequence of the holotype. Sample NVG-17117C06, GenBank OR837724, 658 base pairs:
TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGACTTT TAAT TCGAACAGAATTAGGAAATCCAGGTTCATTAATTGGAGATGATCAAATTTATAATACA
ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTCCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAA
TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATTCTCTTAATTTCCAGAAGAATTGTAGAAAAT GGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC
TCATAGAGGATCTTCTGTTGATTTAGCAATTTTTTCATTACATCTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACTACAATCATTAATATACGAATTAATAATATATCA
TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCCCTTTTACTACTTTTATCTTTACCTGTATTAGCTGGAGCTATTACCATACTTCTAACTGATCGAAATATTAATACAT
CATTTTTTGATCCTGCAGGGGGAGGAGATCCAATCTTATACCAACATTTATTT
Type material. Holotype: o deposited in the Texas A&M University Insect Collection, College Station,
TX, USA [TAMU], illustrated in Fig. 7, bears six labels: five white | TEXAS: | DUVAL COUNTY | Texas
Hwy 16 ca| 15 mi (24 km) S | of Freer at Parrilla Creek |, [ ex larva | (had larval diapause) | 11 Sep 1980 |
Roy O. Kendall | and C. A. Kendall |, | Larval foodplant: | ACANTHACEAE | Carlowrightia | parviflora
(Buckl. | Wasshausen (foliage) |], [ NYMPHALIDAE: | Chlosyne endeis | pardelina | co Higgins, 1960 |
det. Roy O. Kendall | [M. & B. No. 601.b] |, [ DNA sample ID: | NVG-17117C06 | c/o Nick V. Grishin ],
and one red [ HOLOTYPE o& | Chlosyne pardelina | Grishin ]. Its pupal case and the last instar caterpillar
exuvium are in a gelatine capsule pinned under the specimen. The date given on the label refers to
eclosion. Paratypes: 299: 19 the same data as the holotype, but eclosed on 13-Sep-1980 (NVG-
17117C05) and 12 Mexico: San Luis Potosi, Rte 80, 2-7 mi NW Ciudad del Maiz, 16-Jul-1988, D.
Mullins leg. (NVG-19086A 10, USNMENT 01314130) [USNM].
Type locality. USA: Texas, Duval Co., SH16 ca. 15 mi south of Freer at Parrilla Creek, GPS 27.6478,
—98.6572.
Fig. 7. Holotype of Chlosyne pardelina sp. n. in dorsal (left) and ventral (right) views, data in text.
10
Etymology. In the interest of stability, the name used by Higgins and Scott is kept. In Spanish, the word
pardelina refers to any small, spotted, or mottled bird, and it fits the general appearance of this species.
The name is a feminine noun in apposition.
Distribution. South Texas and northeastern Mexico.
Chlosyne anastasia (Hemming, 1934) is a species distinct from
Chlosyne definita (E. Aaron, [1885])
Melitaea anastasia Hemming, 1934, a replacement name for Melitaea beckeri Godman, [1901] (type
locality Mexico: Durango, Durango City), which is a junior primary homonym of Melitaea artemis var.
beckeri Herrich-Schaffer, 1851 (type locality in Spain), currently treated as a subspecies of Chlosyne
definita (E. Aaron, 1885) (type locality in USA: Texas, Nueces Co.) is genetically distant from it with
Fs/COI barcode difference of 0.27/3% (20 bp). The COI barcode difference is large because the
mitochondrial DNA of M. anastasia is closest (0.3%, 2 bp between the COI barcodes, likely due to
introgression) to Chlosyne endeis (Godman & Salvin, 1894) (type locality in Mexico: Nayarit) (Fig. 6c), a
Species more distant from M. anastasia according to the nuclear genome tree (Fig. 6a). Because of this
genetic differentiation, we propose that Chlosyne anastasia (Hemming, 1934), stat. rest. is a species
distinct from Chlosyne definita (E. Aaron, [1885]). Both C. definita and C. anastasia stat. rest. have been
recorded from the state of Durango, where the former is known from the north, and the latter is
documented from the south (Fig. 6). Chlosyne anastasia stat. rest. does not occur in the United States.
Chlosyne definita dolosa Grishin, new subspecies
http://zoobank.org/0CE8273D-D38A-47D7-A73E-A 15A3354B0CC
(Figs. 6 part, 8)
Definition and diagnosis. Before this work, western populations of Chlosyne definita (E. Aaron, 1885)
(type locality in USA: Texas, Nueces Co.), including those in northwestern Mexican states of Sonora and
Chihuahua have been placed within the subspecies Chlosyne definita anastasia (Hemming, 1934) (type
locality Mexico: Durango, Durango City) due to their phenotypic similarity in having less extensive dark
markings and narrower white band and spots on wings venter. Genomic trees reveal that C. d. anastasia is
not monophyletic, and the populations near its type locality are genetically differentiated at the species
level (1.e., C. anastasia stat. rest., see above) (Fig. 6), but more northern populations differ from them by
3.3% (22 bp) in COI barcode and are closer related to the nominotypical C. definita (COI barcode
difference of 0.6% 4 bp). Therefore, we regard these northwestern Mexico populations as conspecific
with C. definita, but due to their phenotypic and genetic differences propose that they constitute a distinct
subspecies. This new subspecies is phenotypically more similar to C. anastasia stat. rest. and differs
from it in the following characters: the central white band on the ventral hindwing is less broad but
broader than in the nominotypical subspecies; black markings are more extensive but less expressed than
in the nominotypical subspecies, e.g., the basal white band on the ventral hindwing is typically cut
through (or even cut short) by black overscaling around vein 1A+2A. Due to phenotypic variability,
definitive identification is provided by DNA, and a combination of the following characters is diagnostic
in the nuclear genome: hm2010867-RA.6:C66T, hm2010867-RA.6:G87A, hm2003966-RA.6:T1521C, hm200
3966-RA.6:C4239T, hm2014195-RA.2:A709G and in COI barcode: A40G, 169T, A205T, T283C, T475T.
Barcode sequence of the holotype. Sample NVG-22088C12, GenBank OR837725, 658 base pairs:
TACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTGGGAACATCTTTAAGACTTTTAATTCGAACAGAATTAGGAAATCCAGGTTCATTAATTGGAGATGATCAAATTTATAATACA
ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAA
TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATCCTATTAATTTCCAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC
TCATAGAGGATCATCTGTTGATTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATCACCACAATCATTAATATACGAGTTAATAATATATCA
TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTCTTTTACTACTTTTATCTTTACCTGTATTAGCTGGAGCAATTACAATACTTCTAACTGATCGAAATATTAATACAT
CATTCTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: & deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida
Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 8, bears four printed (text
11
Fig. 8. Holotype of Chlosyne definita dolosa ssp. n. in dorsal (left) and ventral (right) views, data in text.
in italics handwritten) labels: three white [| Chihuahua, Mex. | 19.4 miles E. of | Tomochic Oak-Pine | July
29, 1984. | ca 7000' Leg D. Mullins |, | J. D. Turner ex | Malcolm Douglas | colln. | MGCL Accession | #
2009-26 |, [ DNA sample ID: | NVG-22088C12 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ¢@ |
Chlosyne definita | dolosa Grishin ]. Paratypes: 292 Mexico, Sonora, 5 mi NW of Yecora, plateau edge,
25-Jul-1987, M. Smith leg. (NVG-22088D10) and 28/29-Jul-1987 (NVG-22088D01) [MGCL].
Type locality. Mexico: Chihuahua, 19.4 mi E of Tomochic, elevation ca. 7000".
Etymology. In Latin, do/osus means cunning, deceitful, crafty, or sly. The name is given for the deceitful
nature of this subspecies, which was hidden behind the name Chlosyne anastasia before it was revealed
by genomic sequence comparison. The name is a feminine adjective.
Distribution. Northwestern Mexico, recorded from the states of Sonora and Chihuahua.
Chlosyne bollii (W. H. Edwards, 1878) is a species distinct
from Chlosyne theona (Ménétriés, 1855)
Our previous genomic analysis demonstrated that Chlosyne chinatiensis (Tinkham, 1944) (type locality in
USA: Texas, Presidio Co.) is a species distinct from Chlosyne theona (Ménétriés, 1855) (type locality in
Nicaragua) (Zhang et al. 2020) in agreement with Cassie et al.(2001). Sequencing of additional specimens
across the range from Arizona and Texas to Costa Rica reveals that Melitaea bollii W. H. Edwards, 1877
(type locality USA: Texas, Bexar Co., San Antonio), currently regarded as a subspecies of C. theona (Fig.
a Chlosyne chinatiensis|22059D09|USA:TX,Jeff Davis Co.|2022 b C chinatiensis|22059D09|USA:TX,Jeff Davis Co.|2022 Cc C chinatiensis|7664|Mexico:NL|1977
Chlosyne chinatiensis|22064E09|USA:TX, Brewster Co.|2014 oC Chinatiensis|22064E09|USA:TX, Brewster Co.|2014 g4c theona minimus|22097D11|Belize
nuclear **—= Chlosyne chinatiensis|3246|USA:TX,Hudspeth Co.|1998 Z-chr C chinatiensis|7663|Mexico:NL|1977
3 C chinatiensis|3246|USA:TX,Hudspeth Co.|1998 mito
C chinatiensis|697|USA:TX, Brewster Co.|2009 —_—_——-
om © chinatiensis|22097D02|USA:TX,Culberson Co.|1980
C chinatiensis|7664|Mexico:NL|1977
C chinatiensis|7663|Mexico:NL|1977
C theona bollii X chinatiensis|19072B01|USA:TX, Brewster Co.|1994
- C bollii [not theona]|22042C02|HT|USA:TX, Bexar Co.|old
2" C bollii [not theona]|5209|USA:TX,Starr Co.|2015
C bollii [not theona]|22065F11|USA:TX,Uvalde Co.|2003
C bollii [not theona]|22097D01|USA:TX, Val Verde Co.|1981
C bollii [not theona]|22104C12|USA:TX, Terrell Co,|1978
Chlosyne chinatiensis|697|USA:TX,Brewster Co.|2009
Chlosyne chinatiensis|22097D02|USA:TX,Culberson Co.|1980
Chlosyne chinatiensis|7664|Mexico:NL|1977
Chlosyne chinatiensis|7663|Mexico:NL|1977
Chlosyne theona bollii X chinatiensis|19072B01|USA:TX, Brewster Co.|1994
Chlosyne bollii [not theona]|22042C02|HT|USA:TX, Bexar Co.|old
Chlosyne bollii [not theona]|22065F10|USA:TX,Hidalgo Co.|2006
Chlosyne bollii [not theona]|22065F05|USA:TX, Brewster Co.|2005
Chlosyne bollii [not theona]|22065F11|USA:TX,Uvalde Co.|2003 J 499
Chlosyne bollii [not theona]|22065F08|USA:TX,Medina Co.|2007
Chlosyne bollii [not theona]|22097D01|USA:TX,Val Verde Co.|1981
Chlosyne bollii [not theona]|22104C12|USA:TX, Terrell Co.|1978
Chlosyne bollii [not theona]]22104C11|USA:TX,Val Verde Co.|1981
Chlosyne bollii [not theona]|5209|USA:TX, Starr Co.|2015
Chlosyne theona thekla|9728|USA:AZ,Cochise Co.|2017
Chlosyne theona thekla|15099A01|LT|USA:AZ,Pima Co.|old
Chlosyne theona thekla|22097F02|USA:AZ,Yavapai Co.|1995
Chlosyne theona thekla|22057H12|USA:AZ,Navajo Co.|1985
Chlosyne theona thekla|10947|USA:TX,Jeff Davis Co.|2018
Chlosyne theona brocki|22097D06|Mexico:Son|1986
Chlosyne theona brocki|22097D05|Mexico:Son|1984
Chlosyne theona mullinsi|22097E07|Mexico:Hid|1986
Chlosyne theona mullinsi|22097E10|Mexico:Oax|1979
Chlosyne theona minimus|22097E02|Guatemala|1969
Chlosyne theona minimus|22097D11|Belize|1992
Chlosyne theona theona|22097C09|Nicaragua|1969
Chlosyne theona costaricensis|22097D08|Costa Rica|1978 0.003
Chlosyne theona costaricensis|22097D07|Costa Rica|1969
9 chinatiensis|22059D09|USA:TX, Jeff Davis
1 fe chinatiensis|697|USA:TX, Brewster
chinatiensis|22064E09|USA:TX, Brewster
7€ chinatiensis|3246|USA:TX,Hudspeth
i chinatiensis|22097D02|USA:TX,Culberson
theona bollii X chinatiensis|19072B01|USA
il ¢ bollii [not theona]|22065F10|USA:TX, Hidalgo
s& bollii [not theona]|22104C12|USA:TX, Terrell
9€ bollii [not theona]|22042C02|HT|USA:TX, Bexar
4C bollii [not theona]|22065F11|USA:TX,Uvalde
0.02
C bollii [not theona]|22104C11|USA:TX, Val Verde Co.|1981
C bollii [not theona]|22065F10|USA:TX,Hidalgo Co.|2006
C bollii [not theona]|22065F05|USA:TX, Brewster Co.|2005
C bollii [not theona]|22065F08|USA:TX,Medina Co.|2007
C theona thekla|9728|USA:AZ,Cochise Co.|2017
C theona thekla|10947|USA:TX,Jeff Davis Co.|2018
C theona thekla]22057H12|USA:AZ,Navajo Co.|1985
C theona thekla|22097F02|USA:AZ, Yavapai Co.|1995
C theona thekla|15099A01|LT|USA:AZ,Pima Co.|old
C theona brocki|22097D05|Mexico:Son|1984
C theona brocki|22097D06|Mexico:Son|1986
C theona mullinsi|22097E10|Mexico:Oax|1979
C theona mullinsi|22097E07|Mexico:Hid|1986
C theona minimus|22097D11|Belize|1992
C theona minimus|22097E02|Guatemala|1969
C theona theona|22097C09|Nicaragua|1969
C theona costaricensis|22097D07|Costa Rica|1969
C theona costaricensis|22097D08|Costa Rica]1978
9€ bollii [not theona]|5209|USA:TX,Starr Co.
30 C bollii [not theona]|22065F08|USA:TX,Medina
C bollii [not theona]|22097D01|USA:TX, Val Verde
o bollii [not theona]|22104C11|USA:TX, Val Verde
bollii [not theona]|22065F05|USA:TX, Brewster
&& theona thekla|22057H12|USA:AZ,Navajo
gaC theona thekla|22097F02|USA:AZ, Yavapai
7€ theona thekla]10947|USA:TX,Jeff Davis
C theona thekla|15099A01|LT|USA:AZ,Pima
theona mullinsi|22097E07|Mexico:Hid
14 theona mullinsi|22097E10|Mexico:0ax
10d C theona brocki|22097D05|Mexico:Son
C theona minimus|22097E02|Guatemala
joe theona theona|22097C09|Nicaragua
€,theona costaricensis|22097D08|C Rica
C theona costaricensis|22097D07|C Rica
otheona brocki|22097D06|Mexico:Son|1986
theona thekla|9728|USA:AZ,Cochise Co.|2017
“Oo
a
0.003
Fig. 9. Phylogenetic trees of selected Chlosyne species inferred from protein-coding regions of a) the nuclear genome
(autosomes), b) the Z chromosome, and c) the mitochondrial genome. Different taxa are shown in different colors: C.
chinatiensis (green), C. bollii stat. rest. (red), C. theona (blue, with nominotypical subspecies in violet color), and a hybrid
specimen C. bollii (father) x C. chinatiensis (mother) (olive, highlighted in yellow). One tree branch was truncated, as
indicated by dots.
12
9 red) forms a prominent clade that is sister to C. chinatiensis in the tree from autosomes (Fig. 9a) and in
the mitochondrial genome tree (with some possible introgression, Fig. 9c) (i.e., not monophyletic with
Chlosyne theona), but is sister to C. theona in the Z chromosome tree (Fig. 9b). All other subspecies of C.
theona we sequenced (including a nominotypical specimen from Nicaragua, NVG-22097C09) clustered
together and were not strongly separated from each other despite large geographic distances between
these populations, e.g., Chlosyne theona thekla (W. H. Edwards, 1870) (type locality in USA: AZ, Pima
co.) and Chlosyne theona costaricensis (Austin & M. Smith, 1998) (type locality in Costa Rica), and their
phenotypic distinction. The genetic differentiation of C. theona bollii from C. chinatiensis and all other
sequenced C. theona subspecies is at the level characteristic of distinct species, 1.¢., Fst/Gmin/COI barcode
difference of 0.62/0.001/0.6% (4 bp, they essentially share mitochondrial DNA) (C. chinatiensis) and
0.46/0.003/1.2% (8 bp) (C. theona). Therefore, we propose that Chlosyne bollii (W. H. Edwards, 1878),
stat. rest. is a species distinct from Chlosyne theona (Ménétriés, 1855).
A natural hybrid between Chlosyne bollti (W. H. Edwards, [1878])
and Chlosyne chinatiensis (Tinkham, 1944)
Sequencing of a suspected hybrid between Chlosyne bollii (W.
H. Edwards, [1878]), stat. rest. (type locality USA: Texas,
Bexar Co., San Antonio) and Chlosyne chinatiensis (Tinkham,
1944) (type locality in USA: Texas, Presidio Co.), a female
NVG-19072B01 collected in USA: Texas, Brewster Co., along
FM2627 25 mi SE of USH385 on 23-Mar-1994 by Steve M.
Spomer (Fig. 10) places it in different positions in the three trees
(Fig. 9 olive) thus confirming its hybrid origin. In the nuclear
genome tree constructed from autosomes (Fig. 9a), this
Specimen is sister to C. chinatiensis, suggesting that it has a
significant fraction of C. chinatiensis genes. In the Z
chromosome tree (Fig. 9b), this specimen is within C. bollii,
suggesting that its Z chromosome, which in females is inherited
from the father (in butterflies, ZZ are males and ZW are
females), came from C. bol/ii. In the mitochondrial genome tree
(Fig. 9c), the specimen is placed within C. chinatiensis,
suggesting that its mitochondrial DNA, which is inherited from |
the mother, came from C. chinatiensis. Therefore, we confirm Fig. 10. Chlosyne bollii (father) = C.
this female as a natural interspecies hybrid and conclude that its | ¢//7aensis (mother) hybrid in dorsal (top)
father was C. bollii, and its mother was C. chinatiensis. SGV CIAL COU OWN) WIE WS TE DEVE POMEL
Family Riodinidae Grote, 1895 (1827)
Euselasia satyroides Lathy, 1926 and Eurygona modesta H. Bates, 1868
belong to the genus Eugelasia Grishin, 2021
Genomic trees reveal that Euselasia satyroides Lathy, 1926 (type locality in Argentina) is sister to
Eugelasia brevicauda (Lathy, 1926) (type locality in Bolivia) and, therefore, originates within the genus
Eugelasia Grishin, 2021 (type species Eurygona eugeon Hewitson, 1856) (Fig. 11). Although we have not
sequenced Eurygona modesta H. Bates, 1868, currently in the genus Euselasia Hiibner, 1819 (type
species Euselasia gelaena Hiibner, 1819, which is a junior subjective synonym of Papilio gelon Stoll,
1787), it is phenotypically similar to E. satyroides and its relatives (Santos et al. 2014). Therefore, we
propose the following new combinations: Eugelasia satyroides (Lathy, 1926) and Eugelasia modesta (H.
Bates, 1868).
13
Methone noctula|18072D12|12-SRNP-56637|Costa Rica|2013 [Jp
Methone cecilia|18121F11|Guyana|2000
Eurylasia euryone|19035C10|Guyana|2000
Myselasia mys|19036A12|Guyana|2006
Erythia labdacus reducta|19036C07|Bolivia|2003
Erythia thucydides|19036D09|Brazil:RJ|1994
Methone noctula|18072D12|12-SRNP-56637|Costa Rica
Methone cecilia|18121F11|Guyana|2000
Eurylasia euryone|19035C10|Guyana|2000
Myselasia mys|19036A12|Guyana|2006
Erythia labdacus reducta|19036C07|Bolivia|2003
Erythia thucydides|19036D09|Brazil:RJ|1994
Pelolasia pelor|19035A12|Peru:MD|1991
» Pelolasia cataleuca|19035C02|Mexico:Ver|1910
Pelolasia leucophryna [not Euselasia]|22034A12|ST|Costa Rica
Marmessus lisias|19036G05|Guyana|2001
Maculasia albomaculiga|19035D07|Ecuador:Pastaza|1988
Euselasia gelon|19035G06|French Guiana|1988
Euselasia phedica|19035E11|Guyana|2000
cof Ugelasia brevicauda|19036F09|Brazil:RO|1991
Eugelasia satyroides [not Euselasia]|22074H01|Argentina
Eugelasia eugeon|19036F 10|Guyana|2000
mito
Pelolasia pelor|19035A12|Peru:MD|1991
joe Clolasia cataleuca|19035C02|Mexico:Ver|1910
Pelolasia leucophryna [not Euselasia]|22034A12|ST|Costa Ricalold
Marmessus lisias|19036G05|Guyana|2001
Maculasia albomaculiga|19035D07|Ecuador:Pastaza|1988
Euselasia gelon|19035G06|French Guiana|1988
Euselasia phedica|19035E11|Guyana|2000
of Ugelasia brevicauda|19036F09|Brazil:RO|1991
Too-ugelasia satyroides [not Euselasia]|22074H01|Argentina|1973
0.03 Eugelasia eugeon|19036F 10|Guyana|2000
0.03
Fig. 11. Phylogenetic trees of selected Euselasiini species inferred from protein-coding regions of a) the nuclear (autosomes)
and b) the mitochondrial genomes. Different genera are colored differently, and species transferred between genera are labeled
in different colors: Eurygona leucophryna comb. nov. (magenta) and Eugelasia satyroides comb. nov. (orange).
Eurygona leucophryna Schaus, 1913 belongs to the genus Pelolasia Grishin, 2021
Genomic sequencing of a syntype of Eurygona leucophryna Schaus, 1913 (type locality in Costa Rica:
Cachi) reveals that it is sister to Pelolasia cataleuca (R. Felder, 1869) (Fig. 11) in the genus Pelolasia
Grishin, 2021 (type species Eurygona pelor Hewitson, 1853). This close relationship with P. cataleuca
was mentioned in the original description of E. leucophryna (Schaus 1913). Thus, we propose Pelolasia
leucophryna (Schaus, 1913), comb. nov.
Erythia paracheles Grishin, new species
http://zoobank. org/E7TE4D9E8-760B-4D0F-BFC7-DD0060AC7FBB
(Figs. 12, 13 part)
Definition and diagnosis. Genomic analysis reveals that an orange female from central Panama (Figs. 12,
13 orange) initially identified as an aberration of Erythia aurantiaca (Salvin & Godman, 1868) (type
locality in Guatemala) is instead sister to but genetically differentiated from Erythia cheles (Godman &
Salvin, 1889) (type locality in Panama: Chiriqui, holotype sequenced as NVG-21123B03) (Fig. 13), e.g.,
COI barcode difference of 4.4% (29 bp). We sequenced two specimens of E. cheles (the holotype and
another female, NVG-19036F06), and they are genetically close to each other (Fig. 13 blue). However,
due to strong genetic differentiation, the orange female represents a distinct species that, according to our
investigation, does not have a name. The female of this new species differs from its relatives in the nearly
uniform orange coloration of the dorsal side of wings, only with a hint of the brown outer margin, more
developed by the apex of the forewing, and is similarly orange, only slightly yellower, on the ventral side,
with a thin postdiscal darker orange band on both wings and no other markings. In females of other
species, the apex of the dorsal forewing and usually the outer margin are largely brown, and there are at
1cm
Fig. 12. Holotype of Erythia paracheles sp. n. in dorsal (left) and ventral (right) views, data in text.
14
Erythia cheles|21123B03|HT|Panama:Chiriqui|1886 b mitochondrial
100 » Erythia cheles|19036F06|Panama:Herrera|1978
Erythia paracheles [not aurantiaca or cheles]|19036F07|HT|Panama|1976
Erythia borrosa|19036HO9|HT|Panama:Panama|1973
Erythia aurantiaca|22074G04|Mexico:Ver|1963
5p Erythia aurantiaca|22074G01|Guatemala|1992
Erythia aurantiaca|22074G02|Belize|1990
Erythia teleclus|19036D07|Peru:MD|2011
Erythia labdacus labdacus|22074E04|Suriname|2002
Erythia midas crotopina|22074F09|Ecuador:Sucumbios|1990
peythia cheles|21123B03|HT|Panama:Chiriqui|1886
rythia cheles|19036F06|Panama:Herrera|1978
Erythia paracheles [not aurantiaca or cheles]|19036F07|HT
Erythia borrosa|19036HO9|HT|Panama:Panama|1973
toy aurantiaca|22074G04|Mexico:Ver|1963
gythia aurantiaca|22074G01|Guatemala|1992
Erythia aurantiaca|22074G02|Belize|1990
Erythia teleclus|19036D07|Peru:MD|2011
Erythia labdacus labdacus|22074E04|Suriname|2002
0.02 Erythia midas crotopina|22074F09|Ecuador:Sucumbios
a nuclear
Fig. 13. Phylogenetic trees of selected Erythia species inferred from protein-coding regions of a) the nuclear (autosomes) and
b) the mitochondrial genomes. Different species are colored in different colors: E. cheles (blue), E. paracheles sp. n. (orange),
E. borrosa sp. n. (magenta), and E. aurantiaca (violet).
least traces of black submarginal spots on the ventral hindwing. While it remains unclear whether this
Specimen is an aberration, we are confident that it is a species distinct from both E. cheles and E.
aurantiaca due to its prominent genetic differentiation, and, therefore, it is described as a new species. To
confidently identify this new species despite the unknown phenotypic variation, we provide a diagnostic
combination of DNA characters in the nuclear genome: cne1 1073.6.7:T54C, cne3970.3.2:TII1C, cne20880.
1.4:A84G, cne10214.9.8:A66G, cne4577.3.8:C18T, cne1935.4.1:C1113C (not T), cne1935.4.1:C1558C (not
A), cne84.2.2:C1860C (not T), cne15258.2.1:A612A (not T), cnel4561.1.14:C79C (not T) and in the COI
barcode: T16C, 88C, T142C, T169C, T250C, T361C, T391A, T400C, A577G, T619C.
Barcode sequence of the holotype. Sample NVG-19036F07, GenBank Sane AS: 658 base pairs:
AACTTTATATTTTATCTTTGGAATTT Sea Nae TAGTAGGAACATCATTAAGACTATTAATTCGAATAGAATTAGGAATTTCAGGCTCTTTTATTGGAGATGATCAAATTTATAATACT
ATTGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCCATTATAATCGGAGGATTTGGAAATTGACTAGTCCCCCTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAA
TAAATAACATAAGATTTTGATTATTACCCCCCTCATTAATACTTTTAATTTCAAGAAGAATTGTCGAAAACGGAGCAGGAACAGGATGAACTGTGTACCCCCCACTATCATCTAATATCGC
TCACAGAGGATCATCAGTTGATT TAGCAATTTTTTCCTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAACTTTATCACAACAATTATTAATATACGAGTAAATAATATAATA
TTCGATCAAATATCCCTATTTATCTGAGCTGTTGGTATTACAGCTCTATTACTTTTACTATCATTACCAGTTT TAGCAGGAGC1 TATTACTATGCTATTAACTGATCGAAATTTAAATACAT
CATTTTTTGATCCCGC1 r'GGAGGAGGAGATCCAAI TTCTTTACCAACATTTATTT
Type material. Holotype: ° deposited in the National Museum of Natural History, Washington, DC,
USA [USNM], illustrated in Fig. 12, bears four printed labels: three white [ Riodinidae? 3/28/76 | Las
Cruces Trail, CZ |, [DNA sample ID: | NVG-19036F07| c/o Nick V. Grishin ], [ USNMENT | {QR
Code} | 00939912 ], and one red [ HOLOTYPE 2 | Erythia paracheles | Grishin ].
Type locality. Panama: Canal Zone, Las Cruces Trail.
Etymology. The prefix “para” means alongside, near, beyond, or similar to. This new species is sister to
E. cheles and is similar to it. The name is treated as a masculine noun in apposition.
Distribution. Currently known only from the holotype collected in central Panama.
Erythia borrosa Grishin, new species
http://zoobank. org/86B3 96F7-EF80-4EC8-AE29-A4D674DCDDDE
(Figs. 13 part, 14)
Definition and diagnosis. Genomic phylogeny inferred from all sequenced specimens of Euselasiini
Kirby, 1871 (1867) reveals that a specimen from central Panama (Figs. 13 magenta, 14) is sister to the
clade of Erythia cheles (Godman & Salvin, 1889) (type locality in Panama: Chiriqui) with Erythia
paracheles sp. n. (type locality in Panama: Canal Zone) and therefore represents a species distinct from
them (Fig. 13), also being strongly differentiated genetically, e.g., COI barcode difference of 4.9% (32 bp)
from E. cheles and 5.9% (39 bp) from E. paracheles. These three species form a clade sister to Erythia
aurantiaca (Salvin & Godman, 1868) (type locality in Guatemala). Even in wing patterns, the specimen
from Panama appears different from the named taxa, and these differences, supported by genetic
differentiation, suggest that this specimen belongs to a new species. Males of this new species differ from
their relatives in a diffuse boundary between brown framing along wing margins and orange interior on
the dorsal side: brown overscaling partially extends into orange areas. The brown/orange boundary is
sharper and could even be rather crips in closely related species, or orange areas are more restricted on
forewing to the area between the inner margin and discal cell. The costal area of the dorsal hindwing is
brown from its base, and the discal cell is largely orange but brown towards the costa; the dorsal hindwing
has a brown batch at the apex and a brown margin of decreasing width and disappearing towards the
tornus; the submarginal area is browner than the brighter orange discal area from costa to mid-wing. The
15
Fig. 14. Holotype of Erythia borrosa sp. n. in dorsal (left) and ventral (right) views, data in text.
ventral side of the wings is pearly-pinkish with a posdiscal pale-brown line on all wings (close to a
submarginal row of spots on the hindwing) and orange-brown narrow marginal framing. Due to
unexplored phenotypic variation, definitive identification is provided by DNA, and a combination of the
following characters is diagnostic in the nuclear genome: cne5785.3.5:A96T, cne7688.1.2:T150G, cne3970.
3.2:G96A, cne254625.2.3:G270A, cnel10780.4.1:T1347A, cne4782.4.3:T282T (not C), cne3195.11.14:A54A
(not G), cne563.4.3:G216G (not A), cne563.4.3:G219G (not A), cne3970.3.2:TI11T (not C) and in COI
barcode: T4C, T56T, T197T, T202C, T206T, T274C, T550C.
Barcode sequence of the holotype. Sample NVG-19036H09, GenBank OR837727, 658 base pairs:
AACCTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAATAGAACTAGGAATTTCAGATTCTTTTATTGGAGATGATCAAATTTATAACACT
ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGT CCCATTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAA
TAAATAATATAAGATTTTGATTATTACCCCCCTCATTAATTCTCTTAATTT CAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACTGTGTACCCCCCACTATCATCTAATATTGC
TCATAGAGGATCATCAGTTGATTTAGCTATTTTCTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAGTAAATAATATAATA
TTTGATCAAATATCTCTATTTATTTGAGCTGTAGGAATTACAGCATTATTACTCTTATTATCATTACCAGTT TTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATCTAAATACAT
CATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTCTTTATCAACATTTATTT
Type material. Holotype: & deposited in the National Museum of Natural History, Washington, DC,
USA [USNM], illustrated in Fig. 14, bears four printed (2™ and 3" lines on the 1‘ label handwritten)
labels: three white [ Panama:Panama | Cerro Campana | 800m. 17.III.1973 | G. B. Small ], [ DNA sample
ID: | NVG-19036H09 | c/o Nick V. Grishin |], [USNMENT | {QR Code} | 01544858 |, and one red
| HOLOTYPE co | Erythia borrosa | Grishin ].
Type locality. Panama: Panama Province, Cerro Campana, elevation 800 m.
Etymology. In Spanish, borrosa means blurry or fuzzy. The name refers to edges between brown and
orange in this species that lack the sharpness of its relatives, and brown gradually dissolves into orange, or
orange is overscaled with brown towards the margins. The name is a Latinized feminine adjective.
Distribution. Currently known only from the holotype collected in central Panama.
Mesosemia nesti Hewitson, 1858, Mesosemia acuta Hewitson, 1873,
and Mesosemia eurythmia Stichel, 1915 belong to the genus Ectosemia Grishin, 2021
Genomic sequencing of Mesosemia nesti Hewitson, 1858 (type locality in French Guiana)—the species
transferred to Semomesia Westwood, 1851 (type species Papilio croesus Fabricius, 1777) in Callaghan
and Lamas (2004)—and Mesosemia acuta Hewitson, 1873 (type locality in Brazil, possibly Rio de
Janeiro) reveals that they are not monophyletic with Mesosemia Hibner, 1819 (type species Mesosemia
philoclessa Hiibner, 1819) that includes Semomesia as its junior subjective synonym, but instead originate
within the genus Ectosemia Grishin, 2021 (type species Papilio eumene Cramer, 1776) (Fig. 15).
Therefore, we propose the following new combinations: Ectosemia nesti (Hewitson, 1858) and
16
Ectosemia acuta (Hewitson, 1873). Although we have not sequenced Mesosemia eurythmia Stichel, 1915
(type locality in Brazil: Amazonas), we tentatively place it in Ectosemia due to wing pattern similarities:
Ectosemia eurythmia (Stichel, 1915), comb. nov.
Ectosemia eumene [TS of Ectosemia]|19037H07|Guyana
Ectosemia attavus [not eumene]|19037H08|Ecuador:Pastaza
ctosemia erinnya|21126C01|PLT|Ecuador:Archidonalold
etosemia erinnya (=furia) [not eumene]|18121H06|Peru
ihcetosemia erinnya (=furia) [not eumene]|21126B11|LT|Bolivia
Ectosemia erinnya|21126B12|LT|Peru:Pozuzolold
Ectosemia acuta [not Mesosemia]|]19037H12|Brazil:RJ
Ectosemia nesti [not Semomesia]|18122A01|French Guiana
Ectosemia steli|19037H11|Peru:Cusco|2015
Mesosemia tullius[TS of Perophthalma]|18122A10|Guyana
Mesosemia philocles [TS of Mesosemia]|19037D02|Guyana
Mesosemia croesus [TS of Semomesia]|19038A04|Guyana
Mesosemia icare [TS of Leucochimona]|19038A05|Guyana
Mesosemia idotea [TS of Mesophthalma]|18122B01|Brazil:RO
Endosemia ulrica [TS of Endosemia]|19037H06|Guyana
Endosemia macella|19037H10|Brazil:RO|1991
Hyphilaria nicia|19121G01|Guyana|2000
Napaea eucharila]18072F01|13-SRNP-1135|Costa Rica|2013
;gEctosemia eumene [TS of Ectosemia]|19037HO7|Guyana|2000 . :
* Ectosemia attavus [not eumene]|19037H08|Ecuador:Pastaza|1969 b mitochondrial
7gq_Ectosemia erinnya|21126C01|PLT|Ecuador:Archidonalold
séctosemia erinnya (=furia) [not eumene]|18121H06|Peru|1995 0.04
Ectosemia erinnya (=furia) [not eumene]|21126B11|LT|Boliviajold
Ectosemia erinnya|21126B12|LT|Peru:Pozuzo|lold
Ectosemia acuta [not Mesosemia]|19037H12|Brazil:RJ|1994
Ectosemia nesti [not Semomesia]|18122A01|French Guiana|1988
Ectosemia steli]19037H11|Peru:Cusco|2015
Mesosemia tullius [TS of Perophthalma]|18122A10|Guyana|1999 96
Mesosemia philocles [TS of Mesosemia]|19037D02|Guyana|2001
Mesosemia croesus [TS of Semomesia]|19038A04|Guyana|2000
Mesosemia icare [TS of Leucochimona]|19038A05|Guyana|2001
Mesosemia idotea [TS of Mesophthalma]|18122B01|Brazil:RO|1996
Endosemia ulrica [TS of Endosemia]|19037H06|Guyana|2000
Endosemia macella]19037H10|Brazil:RO|1991
Hyphilaria nicia|19121G01|Guyana|2000
Napaea eucharila|18072F01|13-SRNP-1135|Costa Rica|2013
a_ionuclear
Fig. 15. Phylogenetic trees of selected Mesosemiini species inferred from protein-coding regions of a) the nuclear (autosomes)
and b) the mitochondrial genomes. Different genera of Mesosemiina are colored in different colors: Ectosemia (blue, with
Ectosemia acuta comb. nov. and Ectosemia nesti comb. nov. labeled in red; Ectosemia attavus stat. nov. in magenta; and
Ectosemia erinnya in cyan), Mesosemia (violet), and Endosemia (olive). TS - type species.
Mesosemia eumene furia Stichel, 1910 is a Junior subjective synonym
of Ectosemia erinnya (Stichel, 1910)
Genomic analysis of syntypes of Mesosemia eumene erinnya Stichel, 1910 (type locality in Ecuador and
Peru, sequenced as NVG-21126B12 and NVG-21126C01), currently a valid species of Ectosemia
Grishin, 2021 (type species Papilio eumene Cramer, 1776) and Mesosemia eumene furia Stichel, 1910
(type locality in Bolivia and Peru, sequenced as NVG-21126B11) kept in the same status since its
description and, as a consequence of being a subspecies of the type species (Zhang et al. 2021) of
Ectosemia, transferred in this genus, reveals that they are genetically close (Fig. 15), do not segregate into
separate clades, and most likely are conspecific. Therefore, we propose that Mesosemia eumene furia
Stichel, 1910, syn. nov. is a junior subjective synonym of Ectosemia erinnya (Stichel, 1910). To define
these taxa objectively and to clarify their type localities, their lectotypes are designated below.
First, N.V.G. hereby designates a syntype in the MFNB collection, a female with the following six
printed (but 4" handwritten) labels, the 1%‘ red, 4° greenish-gray, and others white: [ Typus ], [ Stid Peru |
Pozuzo | e.c.H.Stichel |, [ 2266 |, [ erinnya | Stich. ], [ ex coll. | H. STICHEL |, and [ DNA sample ID: |
NVG-21126B12 | c/o Nick V. Grishin | as the lectotype of Mesosemia eumene erinnya Stichel, 1910. The
lectotype is a specimen in good condition with half of its right antenna broken off, and some scales
rubbed off near the middle of the forewing outer margin. The type locality of Ectosemia erinnya becomes
Peru: Pozuzo. According to our genomic analysis, the lectotype is conspecific with the paralectotype
(NVG-21126C01) from Ecuador: Archidona (Fig. 15).
Second, N.V.G. hereby designates a syntype in the MFNB collection, a male with the following
six printed (but 4" handwritten) labels, the 1% red, 4°" greenish-gray, and others white: [ Typus ], [ Bolivia
La Paz | Farinas | e.c.H.Stichel |, [ 2265 ], [ furia| Stich. |, [| ex coll. | H. STICHEL |, and [ DNA sample ID:
| NVG-21126B11 | c/o Nick V. Grishin | as the lectotype of Mesosemia eumene furia Stichel, 1910. The
lectotype lacks the abdomen, and outer-marginal segments of the right forewing are chipped off from the
middle to the tornus. The type locality of M. e. furia becomes Bolivia: La Paz, Farinas.
Mesosemia eumene race attavus J. Zikan, 1952 is a species distinct
from Ectosemia eumene (Cramer, 1776)
The genomic comparison reveals that Mesosemia eumene race attavus J. Zikan, 1952 (type locality in
Brazil: Amazonas, Sdo0 Gabriel da Cachoeira municipality, Rio Negro), currently a subspecies of
Ectosemia eumene (Cramer, 1776) (type locality in Suriname), is strongly differentiated genetically from
the latter (Fig. 15), e.g., COI barcode difference of 4.4% (29 bp). These genetic and also pronounced
phenotypic differences in wing patterns (narrower dark brown dorsal hindwing bands) and shapes (more
17
convex outer hindwing margin) suggest that Ectosemia attavus (J. Zikan, 1952), stat. nov. is a species
distinct from Ectosemia eumene (Cramer, 1776).
Cremna telarania Grishin, new species
http://zoobank. org/8EFIOAA2F-9A47-4201-9E26-C 1507FDC9IFDO
(Figs. 16, 17 part)
Definition and diagnosis. Genomic sequencing of Cremna E. Doubleday, 1847 (type species Papilio
actoris Cramer, 1776) reveals a clade consisting of a pair from Bolivia (Fig. 16) distinct from other
species in the C. actoris group (Fig. 17): COI barcode difference of 1.8% (12 bp) with a syntype of
Cremna meleagris Hopffer, 1874 (type locality in Peru: Chanchamayo), a junior subjective synonym of
Cremna heteroea H. Bates, 1867 (type locality in Brazil: Amazonas), sister to the clade representing the
new species. This new species differs from its relatives in smaller size, paler wings (especially beneath),
more prominent cream-colored marginal spots above, and boomerang-shaped, narrower on the dorsal side
postdiscal (in addition to submarginal) spots on both wings (weak on dorsal forewing in the female).
These spots are broader and rounder in other species and are crescent-shaped only in Cremna calitra
Hewitson, 1869 (type locality in Ecuador), a species with mostly larger spots on the dorsal side, but
smaller spots along the outer wing margins (especially on the hindwing) and on the ventral side.
Barcode sequence of the holotype. Sample NVG-22112E04, GenBank OR939283, 658 base pairs:
AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGTTCATCTTTAAGTATTTTAATTCGTATAGAATTAGGAATACCTGGTTCTCTTATTGGAGATGATCAAATTTATAATACT
ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGTAATTGATTAGT TCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCACGTA
TAAATAATATAAGTTTTTGACTTTTACCCCCCTCTTTATTCCTTTTAATTTCGAGAAGAATTGTCGAAAATGGAGCAGGTACAGGATGAACTGTCTACCCCCCTTTATCTTCTAATATTGC
TCACAGAGGCTCTTCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCCGGTATTTCTTCTATTTTAGGTGCTATTAATTTCAT TACAACTATTATCAATATACGTATTAATAATTTATCA
TTTGATCAAATACCTTTATTTGTTTGATCAGTTGGTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAACTTAAATACTT
CTTTTTTCGACCCAGCAGGAGGAGGAGACCCTATTCTTTATCAACATTTATTT
Fig. 16. Cremna telarania sp. n. in dorsal (above) and ventral (below) views, data in text:
a) holotype & NVG-22112E04 and b) paratype 9 NVG-22112E11.
18
Cremna actoris|22112E06|Suriname|old
Cremna actoris|22112F01|Suriname|1898-9
Cremna actoris|22112E07|"Corityba S.Paulo"|old
Cremna actoris|22112F03|French Guianalold
a nuclear
Cremna heteroea|22112E02|Brazil:AM|old
Cremna heteroea|22112E12|Peru:Pozuzolold
Cremna heteroea|22112E05|Peru:Chmlold
Cremna telarania|22112E04|HT|Bolivia|1890
Cremna heteroea|22112D10|Ecuador:Macas|old
Cremna heteroea|22112E01|Peru:Iquitos|1895
Cremna heteroea (=meleagris)|21125A12|ST|Peru:Chmlold
Cremna actoris|22112E06|Surinamel|old
gemna actoris|22112F01|Suriname|1898-9
sfremna actoris|22112E07|"Corityba S.Paulo"|old
Cremna actoris|22112F03|French Guianalold
&remna heteroea|22112D10|Ecuador:Macas|old
geremna heteroea|22112E01|Peru:lquitos|1895
Cremna heteroea|22112E02|Brazil:AM|old
'?° Cremna heteroea|22112E12|Peru:Pozuzo|old
geremna heteroea|22112E05|Peru:Chmlold
Cremna heteroea (=meleagris)|21125A12|ST|Peru:Chm
Gremna telarania|22112E04|HT|Bolivia|1890
Cremna telarania|22112E11|PT|Bolivia|1890
Cremna calitra|23013G05|Ecuador|old
Cremna telarania|22112E11|PT|Bolivia|1890
Cremna calitra|23013G05|Ecuador|old
0.004
0.009
Fig. 17. Phylogenetic trees of selected Cremna species inferred from protein-coding regions of a) the nuclear (autosomes) and
b) the mitochondrial genome: C. te/arania sp. n. (red), C. heteroea (blue), C. actoris (green), and C. calitra (violet).
Type material. Holotype: o& deposited in the Museum fiir Naturkunde, Berlin, Germany [MFNB],
illustrated in Fig. 16a, bears five rectangular labels, the first two handwritten and others printed: four
white | Bolivia | Torochita | 90. Garl. |, [ meleagris | Hopff. |, [| Coll. | Satudinger ], [ DNA sample ID: |
NVG-22112E04 | c/o Nick V. Grishin ], and one red [ HOLOTYPE co | Cremna telarania | Grishin ].
Paratype: 12 with the same data as the holotype (NVG-22112E11, GenBank barcode OR939284, Fig.
16b).
Type locality. Bolivia: La Paz Department, Mapiri.
Etymology. In Spanish, la telarafia means spider web. The name is given for the cobweb wing pattern of
this species. The name is a feminine noun in apposition.
Distribution. Currently known only from the La Paz Department in Bolivia.
Cremna dentata (Stichel, 1910) is a species distinct
from Cremna radiata (Godman & Salvin, 1886)
Genomic analysis reveals that Voltinia radiata dentata Stichel, 1910 (type locality in Colombia),
currently treated as a junior subjective synonym of Cremna radiata (Godman & Salvin, 1886) (type
locality Costa Rica: Irazt), is genetically differentiated from it at the level characteristic of distinct species
(Fig. 18), e.g., COI barcode difference of 2.6% (17 bp) in the presence of phenotypic distinction
(Lukhtanov et al. 2016): C. dentata typically has longer white rays between veins on wings. Therefore, we
propose that Cremna dentata (Stichel, 1910), stat. nov. is a species distinct from Cremna radiata
(Godman & Salvin, 1886).
790 Cremna radiata|19038B11|Costa Rica|old — [ mitochondrial
100 Cremna radiata|22075B04|Costa Rica|1971 —
Cremna dentata [not radiata]|18078C12|T|Colombia|old 0.02
Gremna radiata|22075B04|Costa Rica|1971
100 Cremna radiata|19038B11|Costa Ricalold
Cremna dentata [not radiata]|18078C12|T
a nuclear
0.02
so remna theata|19038B10|Panama|1977
Cremna theata|18078C11|T|Colombia|old
Cremna heteroea|18122B08|Guyana|2000
Cremna alector|18122B07|Brazil:RJ|1995
Napaea beltiana|18122B10|10-SRNP-70958|Costa Rica
Napaea mellosa|19038B03|Ecuador|1999
iggremna theata|19038B10|Panama|1977
Cremna theata|18078C11|T|Colombial|old
Cremna heteroea|18122B08|Guyana|2000
Cremna alector|18122B07|Brazil:RJ|1995
Napaea mellosa|19038B03|Ecuador|1999
Napaea beltiana|18122B10|Costa Rica|2010
Fig. 18. Phylogenetic trees of selected Cremna and Napaea species inferred from protein-coding regions of a) the nuclear
(autosomes) and b) the mitochondrial genomes: C. radiata (blue), C. dentata stat. rest. (red), and their sister C. theata (green).
Cremna pupillata Stichel, 1915 is a species distinct
from Cremna alector (Geyer, 1837)
Genomic analysis reveals that specimens identified as Cremna alector (Geyer, 1837) (type locality in
Brazil) partition into two genetically differentiated clades suggestive of species level (Fig. 19): e.g., their
COI barcodes differ by 3.6% (24 bp). Upon phenotypic inspection, we find that specimens in one clade
have white spots by forewing costa in the postdiscal blue band, and specimens in the other clade lack
them, among other differences discussed by Hall (2005). While syntypes of C. alector are likely lost,
original illustrations of this species show the lack of spots (Geyer 1837). Inspecting these illustrations, we
19
conclude that they are detailed enough to depict the spots if they were present. The lectotype of Cremna
alector pupillata Stichel, 1910 (type locality in Brazil: Espirito Santo, sequenced as NVG-21125A10) has
the spots and thus, according to our genomic results, is a species different from C. alector, represented by
two specimens without spots from Linhares, Espirito Santo in Brazil (Fig. 19). Therefore, we propose that
Cremna pupillata Stichel, 1915, stat. nov. is a species distinct from Cremna alector (Geyer, 1837).
Cremna alector|22075B08|Brazil:ES|1973
Cremna alector|22075B09|Brazil:ES|1972
Cremna pupillata [not alector]|21125A10|LT|Brazil:ES|old
Cremna pupillata [not alector]|18122B07|Brazil:RJ|1995
Cremna heteroea|18122B08|Guyana|2000
Cremna theata|19038B10|Panama|1977
Cremna radiata|22075B04|Costa Rica|1971
iGremna alector|22075B08|Brazil:ES|1973
Cremna alector|22075B09|Brazil:ES|1972
Cremna pupillata [not alector]|21125A10|LT|Brazil:ES
Cremna pupillata [not alector]|18122B07|Brazil:RJ
Cremna heteroea|18122B08|Guyana|2000
Cremna theata|19038B10|Panama|1977
Cremna radiata|22075B04|Costa Rica|1971
A Zchromosome b mitochondiral
0.02
Fig. 19. Phylogenetic trees of selected Cremna species inferred from protein-coding regions of a) the Z chromosome and b) the
mitochondrial genome: C. alector (blue) and C. pupillata stat. nov. (red).
A Species list of Napaeina J. Hall, 2003 assigned to genera
The list below is mostly based on previously published results (Callaghan and Lamas 2004; Hall 2005;
Seraphim et al. 2018; Zhang et al. 2021) guided by the genome-level phylogeny (Fig. 20) and is given to
correct some ambiguities and mistakes. For example, Zhang et al. (2021) gave an erroneous combination
Napaea sanarita (Schaus, 1902) (type locality in Brazil: Rio de Janeiro) while correctly resurrecting the
genus Eucorna Strand, 1932 of which Eucora sanarita Schaus, 1902 is the type and the only species
@ nuclear Hyphilaria anthias|18122B04|Guyana|1999 Db Zchr. Hyphilaria anthias|18122B04|Guyana
00
90
100
100
100
100
100
100
Hyphilaria nicia|19121G01|Guyana|2000
Hyphilaria parthenis|18122B05|Peru|1995
Eucorna sanarita|18122C01|Brazil:RJ|1996
Cremna alector|22075B09|Brazil:ES|1972
Cremna pupillata|18122B07|Brazil:RJ|1995
yoo Cremna radiata|22075B04|Costa Rica|1971
Too Cremna dentata|18078C12|T|Colombia|old
Cremna theata|19038B10|Panama|1977
Cremna actoris|22112F01|Suriname|1898-9
; Cremna heteroea|22112E02|Brazil:AM|old
“ Cremna telarania|22112E04|HT|Bolivia|1890
Cremna calitra]23013G05|Ecuador|old
Napaea sylva|18122B09|Ecuador|2014
100
100
N. beltiana|18122B10|10-SRNP-70958|C. Rica|2010
Napaea danforthi|20112A07|Mexico:Son|2003
N. umbra|18122C04|90-SRNP-2859|C. Rica|1991
vo apaea maya|19038C02|Belize|1995
100 Napaea totonaca|19038C01|Mexico:SLP|1982
ooNapaea rufolimba|19038B07|Costa Rica|1977
Napaea tumbesia|18122C03|Peru|1996
i Napaea fratelloi|18122B11|Guyana|1989
09 100
N. eucharila|18122B12|10-SRNP-72877|C. Rica|2010
Napaea phryxe|18122C05|Brazil:Bahia|1991
Napaea agroeca|18122C02|Brazil:RJ|1995
N. frustatoria (=tfrustatoria)|21125B04|ST|Fr. Guianalold
00
100
Hyphilaria nicia|19121G01|Guyana
Hyphilaria parthenis|18122B05|Peru
Eucorna sanarita|18122C01|Brazil:RJ
Cremna alector|22075B09|Brazil:ES
“Cremna pupillata|18122B07|Brazil:RJ
> Cremna radiata|22075B04|Costa Rica
ol sodCremna dentata|18078C12|T|Colombia
Cremna theata|19038B10|Panama|1977
100 Cremna actoris|22112F01|Suriname
eeCremna heteroea|22112E02|Brazil:AM
f@remna telarania|22112E04|HT|Bolivia
Cremna calitra|23013G05|Ecuador|old
Napaea sylva|18122B09|Ecuador|2014
N. beltiana|18122B10|10-SRNP-70958|CR
Napaea danforthi|20112A07|Mexico:Son
N. umbra|18122C04|90-SRNP-2859|CR
“Napaea maya|19038C02|Belize|1995
56- Napaea totonaca|19038C01|Mexico:SLP
,Napaea rufolimba|19038B07|Costa Rica
Napaea tumbesia|18122C03|Peru|1996
‘Pp, Napaea fratelloi|18122B11|Guyana|1989
28 NY. eucharila|18122B12|10-SRNP-72877|CR
+4. N. frustatoria (=#frustatoria)|21125B04|ST
Napaea phryxe|18122C05|Brazil:Bahia
p9Napaea agroeca|18122C02|Brazil:RJ
100
94 4ofl->, Napaea cebrenia|18122C06|Brazil:PR|1991 72 Napaea cebrenia|18122C06|Brazil:PR
700 ©Napaea zikani|19038B04|Brazil:RJ|1959 es $4 Napaea zikani|19038B04|Brazil:RJ|1959
55 Napaea elisae|19038B06|Brazil:RJ|1979 72 Napaea melampia|22112B06|Brazil:BA
100
100
94
100
0.02 ee
100
100
100
10-4 100 Napaea joinvilea|19038B02|Brazil:SC|1976
Napaea melampia|22112B06|Brazil:BA|old
Napaea merula|22039F12|Ecuador|2005
Napaea mellosa|19038B03|Ecuador|1999
Napaea gynaecomorpha|19038B05|Ecuador|1994
100
"Napaea" thasus|18122B06|Brazil:MT|1983
olthomiola eburna|22039F11|Ecuador|2016
too Ithomiola candidata|18122D03|Ecuador|1999
Ithomiola oweni|18122D04|Costa Rica|2004
Ithomiola cribralis]}18122D02|Panama|1977
oo 'thomiola bajotanos|19038C05|Peru|2016
Ithomiola tanos|18078CO9|HT|Bolivia|1896
Ithomiola nepos|18122C11|Brazil:SC|1990
Ithomiola orpheus|18122C10|Peru|1992
50 thomiola callixena|22039F09|Ecuador|2014
Ithomiola buckleyi|22039F10|Peru:San Martin
Ithomiola floralis floralis]18122C09|Guyana|2000
Ithomiola theages theages|19121G02|Panama|1978
38
0.02
rir elisae|19038B06|Brazil:RJ|1979
apaea joinvilea|19038B02|Brazil:SC
; Napaea mellosa|19038B03|Ecuador|1999
i Napaea gynaecomorpha|19038B05|Ecuador
Napaea merula|22039F 12|Ecuador|2005
"Napaea" thasus|18122B06|Brazil:MT
;dghomiola eburna|22039F 11|Ecuador|2016
todthomiola candidata|18122D03|Ecuador
Ithomiola oweni|18122D04|C Rica|2004
Ithomiola nepos|18122C11|Brazil:SC|1990
Ithomiola orpheus|18122C10|Peru|1992
98, Jghomiola callixena|22039F09|Ecuador|2014
ovo Ithomiola buckleyi|22039F10|Peru:S Martin
Ithomiola floralis floralis|18122C09|Guyana
jogithomiola theages theages|19121G02|Pan
100 'thomiola cribralis|18122D02|Panama|1977
id¢homiola bajotanos|19038C05|Peru|2016
Ithomiola tanos|18078CO9|HT|Bolivia|1896
100
Fig. 20. Phylogenetic trees of Napaeina species inferred from protein-coding regions of a) the nuclear genome (autosomes) and
b) the Z chromosome. Different genera are colored in different colors: Hyphilaria (cyan), Eucorna (magenta), Cremna (green),
Napaea (blue, with “Napaea” thasus in orange), and /thomiola (purple).
20
(Rosa et al. 2023). We note that Cremna calitra Hewitson, 1869 (type locality in Ecuador) belongs to
Cremna E. Doubleday, 1847 (type species Papilio actoris Cramer, 1776), not Napaea Hubner, 1819 (type
species Cremna eucharila Bates, 1867) (Fig. 20).
Assignment of species to genera follows our study (Zhang et al. 2021), and we attempt arranging
Species in the list to maximize the phenotypic similarity of the neighbors but without disrupting a
phylogenetic order given by genomic trees (Fig. 20): i.e., a strongly supported clade in the trees is a
continuous segment in the list. We start with Hyphilaria, but the order of the entire list can be reversed.
We put Cremna and Napaea next to each other because species in these genera are similar (Hall 2005).
To maintain phylogenetic order, the considerations above necessitate placing /thomiola last. Finally, we
situate Eucorna next to Cremna instead of it being last in the list because Eucorna looks more different
from Jthomiola than from Cremna. Similar arguments were applied within each genus. Further
suggestions about the order to optimize similarity in appearance between neighbors are encouraged.
Only valid names of genera and species are given below; for subspecies, see the Butterflies of
America website (Warren et al. 2023); for synonyms and taxonomic discussions, see other publications
(Callaghan and Lamas 2004; Hall 2005). Type genus (for family-group names) or type species (for genus-
group names) names are given in parenthesis, and names of type species are underlined.
Tribe Mesosemiini Grote, 1898 (Mesosemia Hiibner, [1819])
Subtribe Napaeina J. Hall, 2003 (Napaea Hiibner, [1819])
Genus Hyphilaria Hubner, [1819] (Ayphilaria nicia Hubner, [1819])
Hyphilaria anthias (Hewitson, 1874)
Hyphilaria nicia Hubner, [1819]
Hyphilaria parthenis (Westwood, 1851)
Genus Eucorna Strand, 1932 (Eucora sanarita Schaus, 1902)
Eucorna sanarita (Schaus, 1902)
Genus Cremna E. Doubleday, 1847 (Papilio actoris Cramer, 1776)
Cremna alector (Geyer, 1837)
Cremna pupillata Stichel, 1915, stat. nov.
Cremna radiata (Godman & Salvin, 1886)
Cremna dentata (Stichel, 1910), stat. nov.
Cremna theata (Stichel, 1910)
Cremna actoris (Cramer, 1776)
Cremna heteroea H. Bates, 1867
Cremna telarania Grishin, sp. n.
Cremna calitra Hewitson, 1869
Genus Napaea Hubner, [1819] (Cremna eucharila Bates, 1867)
Napaea sylva (Moschler, 1877)
Napaea beltiana (H. Bates, 1867)
Napaea dramba (J. Hall, Robbins & Harvey, 2004) [fossil]
Napaea danforthi A. Warren & Opler, 1999
Napaea umbra (Boisduval, 1870)
Napaea loxicha (RG. Maza & J. Maza, 2016)
Napaea maya (J. Maza & Lamas, 2016)
Napaea necaxa (RG. Maza & J. Maza, 2018)
Napaea totonaca (RG. Maza & J. Maza, 2016)
Napaea rufolimba J. Hall, 2005
Napaea tumbesia J. Hall & Lamas, 2001
Napaea fratelloi J. Hall & Harvey, 2005
Napaea eucharila (H. Bates, 1867)
Napaea frustatoria Brévignon, 2019
Napaea phryxe (C. Felder & R. Felder, 1865)
Napaea agroeca Stichel, 1910
Napaea cebrenia (Hewitson, [1873])
Napaea zikani Stichel, 1923
Napaea elisae (J. Zikan, 1952)
Napaea joinvilea J. Hall & Harvey, 2005
Napaea melampia (H. Bates, 1867)
Napaea mellosa J. Hall & Harvey, 2005
Napaea gynaecomorpha J. Hall, Harvey & Gallard, 2005
Napaea merula (Thieme, 1907)
21
Genus “new genus 1” Seraphim et al. 2018
“Napaea” thasus (Stoll, 1780) comb. nov. [placed in its possible sister genus for now just to have a genus name]
Genus Ithomiola C. Felder & R. Felder, 1865 U/thomiola floralis C. Felder & R. Felder, 1865)
Ithomiola eburna (J. Hall & Harvey, 2005)
Ithomiola candidata (Hewitson, 1874)
Ithomiola oweni (Schaus, 1913)
Ithomiola calculosa J. Hall & Harvey, 2005
Ithomiola theages (Godman & Salvin, 1878)
Ithomiola cribralis (Stichel, 1915)
Ithomiola neildi (J. Hall & Willmott, 1998)
Ithomiola bajotanos J. Hall, 2005
Ithomiola tanos (Stichel, 1910)
Ithomiola nepos (Fabricius, 1793)
Ithomiola orpheus (Westwood, 1851)
Ithomiola callixena (Hewitson, 1870)
Ithomiola buckleyi J. Hall & Willmott, 1998
Ithomiola floralis C. Felder & R. Felder, 1865
Lasaia peninsularis Clench, 1972 is a species distinct
from Lasaia sula Staudinger, 1888
Genomic analysis reveals that Lasaia sula peninsularis Clench, 1972 (type locality Mexico: Yucatan,
Pisté) is genetically differentiated from Lasaia sula Staudinger, 1888 (type locality in Honduras) at the
level characteristic of distinct species (Fig. 21) with Fst/Gmin/COI barcode difference of 0.52/0.005/1.5%
(10 bp), with the barcode difference computed between lectotypes of both names. Therefore, we propose
that Lasaia peninsularis Clench, 1972, stat. nov. is a species distinct from Lasaia sula Staudinger, 1888.
Genus Subgenus ) Lasaia peninsularis [not sula]|3243|USA:TX,Cameron Co.|2003
“7 “asaia peninsularis [not sula]|4026|USA:TX,Cameron Co.|2015
7, Lasaia peninsularis [not sula]|15099E04|HT|Mexico:Yuc|1952
106 Lasaia peninsularis [not sula]]19027B06|Mexico:Yuc|1960
Lasaia sula|18054E11|LT|Honduras|1887
by ‘° Lasaia sula|19027B07|Panama|1977
Lasaia Lasaia pseudomeris|19027C03|Peru:Loreto|1995
108 Lasaia arsis|19027B05|Peru:Cusco|2011
Lasaia moeros|19027C01|Peru:Cusco|2000
A Lasaia sessilis]}19027C02|Costa Rica|1980
Lasaia maria maria|19027C04|Mexico:Que|1982
Lyropteryx (Lyropteryx) lyra cleadas|18072C11|16-SRNP-46105|Costa Rica|2016
Lyropteryx ‘oa LYropteryx (Lyropteryx) apollonia apollonia|19025E03|Peru:Cusco|2014
199 Lyropteryx (Lyropteryx) terpsichore terpsichore|19025E07|Brazil:Mato Grosso|1969
Lyropteryx - Lyropteryx (Lyropteryx) melaniae [not Melanis]|21123F11|T|Brazil:SC|old
Lyropteryx (Necyria) ingaretha|19025F05|Costa Rica|1965
| 100] Lyropteryx (Necyria) duellona beltiana|19025F04|07-SRNP-45881|Costa Rica|2007
Lyropteryx (Necyria) bellona westwoodi|19025F02|Peru:San Martin|1990
[os Ancyluris paramba|19025F12|Panama|1981
| 100 J Ancyluris mira thaumasia|19025G06|Peru:Cusco|2013
Ancyluri Ancyluris formosissima|19025G09|Peru:Cusco|2011
a Melanis pixe|5148|USA:TX,Hidalgo Co.|2015
TOO Melanis melandra|21123G01|Brazil:AM|old
Melanis xenia|19027E06|Brazil:DF|1969
Melanis boyi|21123F10|T|Brazil:PA|old
, Melanis alena|21127F06|Brazil:RJ|old
Isapis Melanis cinaron|19027C11|Peru:Cusco|2011
Isapis (Isapis) gait Abba tails See O Us ave tel tee
100
Isapis ‘iat seaa) oustila eat Tpeineheliaopaces rer Amazonas|1999
Themone pais|19026C01|Guyana|2000
Paraphthonia (Paraphthonia) molione|19129E04|Ecuador:Napo|2016
“Paraphthonia (Parapanara) diadocis [not Lyropteryx]|18076G08|T|Brazil:AM|1891
Paraphthonia Paraphthonia
09100 Parapanara subgen. n
76 = TBACReler esthema|19026C03|Peru:Cusco|2016
002 sD ide > Brachyglenis dodone|19026C04|Costa Rica|1977
Brachyglenis “*“Brachyglenis dinora|19026C05|Panama|2001
; Brachyglenis drymo|19026C06|Brazil:SC|1982
Siseme “re Siseme pallas|19027F03|Venezuela|1978
Siseme pseudopallas|19027F05|Peru:San Martin|1998
Fig. 21. The phylogenetic tree of selected Riodinini species inferred from protein-coding regions of the nuclear genome
(autosomes). Taxa discussed in the text are shown in different colors, and those transferred between genera (green arrows
indicate the direction of transfer) are labeled in a color different from the rest of the genus. Genus-group names (genera in bold
italics and subgenera in italics) are shown by corresponding branches. Levels in the tree that approximately correspond to
genus and subgenus are labeled on top. New subgenera are highlighted in yellow.
22
Necyria Westwood, 1851 is a subgenus of Lyropteryx Westwood, 1851
Although traditionally treated as distinct (and monophyletic) genera for more than 170 years, Lyropteryx
Westwood, 1851 (type species Lyropteryx apollonia Westwood, 1851) and Necyria Westwood, 1851
(type species Necyria bellona Westwood, 1851) are genetically (Fig. 21) and phenotypically close. COI
barcodes of their type species differ by 2.7% (18 bp), which is typical for closely related sister species,
not different genera, and both genera are characterized by lyre- or harp-like wing patterns resulting from
metallic overscaling between the veins complemented with red spots or stripes. A novice cannot easily
assign a species to a genus by wing patterns. For all these reasons, we propose to treat these monophyletic
groups as subgenera. Necyria and Lyropteryx were proposed in the same work issued on the same day
(Westwood 1851), and being the first revisers, we give precedence to Lyropteryx because this name is
more descriptive of a butterfly appearance: its wing (atépvé - pteryx) resembles the musical instrument
lyre (A0pa - lyra). Therefore, we propose that Necyria Westwood, 1851, stat. nov. is a subgenus of
Lyropteryx Westwood, 1851.
Lymnas melaniae Stichel, 1930 belongs to the genus Lyropteryx Westwood, 1851
and not Melanis Hiibner, [1819]
Genomic phylogeny reveals that Lymnas melaniae Stichel, 1930 (type locality in Brazil: Santa Catarina),
currently in the genus Melanis Hibner, [1819] (type species Papilio melander Stoll, 1780), is not
monophyletic with it and instead is a close sister to Lyropteryx Westwood, 1851 (type species Lyropteryx
apollonia Westwood, 1851) (Fig. 21): COI barcode difference of 2.3% (15 bp), which is typical for
closely related congeners. To restore the monophyly of Melanis, we transfer L. melaniae to the genus
Lyropteryx, forming a new combination Lyropteryx melaniae (Stichel, 1930), comb. nov.
Eurygona? pulcherrima Herrich-Schiaffer, [1853] and Themone poecila H. Bates, 1868
belong to the genus /sapis E. Doubleday, 1847 and not Themone Westwood, 1851
Eurygona? pulcherrima Herrich-Schaffer, [1853] (type species in Suriname) and Themone poecila H.
Bates, 1868 (type locality Brazil: Amazonas, Ega [= Tefé]) currently placed in the genus Themone
Westwood, 1851 (type species Helicopis pais Hiibner, [1820]) are not monophyletic with it and instead
form a clade together with /sapis E. Doubleday, 1847 (type species Papilio agyrtus Cramer, 1777) and are
close to it genetically (Fig. 21). To restore monophyly of Themone, we transfer the two species to [sapis
forming new combinations /sapis pulcherrima (Herrich-Schaffer, [1853]), comb. nov. and /sapis poecila
(H. Bates, 1868), comb. nov. Furthermore, we note that the clade with these species is sister to Melanis
Hiibner, [1819] (type species Papilio melander Stoll, 1780), and they are closely related to it, 1.e., COI
barcodes of the type species of Melanis and Isapis differ by 7.3% (48 bp). Therefore, /sapis can be
included in Me/anis, a step we are not taking here but proposing for consideration.
Callitera Grishin, new subgenus
http://zoobank.org/261B10A3-E22E-49EA-97B3-466C43 93884E
Type species. Eurygona? pulcherrima Herrich-Schaffer, [1853].
Definition. As shown above, Eurygona? pulcherrima Herrich-Schaffer, [1853] (type locality in
Suriname) belongs to the genus /sapis E. Doubleday, 1847 (type species Papilio agyrtus Cramer, 1777)
and not to Themone Westwood, 1851 (type species Helicopis pais Hiibner, [1820]) (Fig. 21). However, it
is genetically differentiated from the type species of /sapis at the subgenus level, e.g., their COI barcodes
differ by 6.5% (43 bp). Therefore, we propose that the lineage with /sapis pulcherrima represents a new
subgenus. This subgenus differs from its relatives by a combination of the following characters: each
wing is blackish-brown with a yellow stripe by its base beneath (as in the type species of /sapis) and
23
discal white streaks sometimes framed with metallic-green scales on the dorsal side and could be vestigial
on the hindwing. In DNA, a combination of the following characters is diagnostic in the nuclear genome:
cne3301.6.2:T166A, cne3301.6.2:C186T, cnel78.3.20:T1233A, cnel78.3.20:T1632A, cne37196.1.3:A87T
and in COI barcode: T67A, T82C, A211G, 223A, A268T, T625G.
Etymology. The name of the type species, pulcherrima, is a Latin word meaning very beautiful, most
beautiful, or prettiest. The name of the new subgenus is formed from the Greek word KoaAAitepy
(kalliteri), which means most beautiful. The name is a feminine noun in the nominative singular.
Species included. Only the type species.
Parent taxon. Genus /sapis E. Doubleday, 1847.
Matizada Grishin, new subgenus
http://zoobank.org/203DA466-AC54-4A5E-9BC5-44CEQAFDIF2F
Type species. 7hemone poecila H. Bates, 1868.
Definition. As shown above, Themone poecila H. Bates, 1868 (type locality Brazil: Amazonas, Ega
[= Tefé]) belongs to the genus /sapis E. Doubleday, 1847 (type species Papilio agyrtus Cramer, 1777)
and not to Themone Westwood, 1851 (type species Helicopis pais Hiibner, [1820]) (Fig. 21). However, it
is genetically differentiated from the type species of /sapis at the subgenus level, e.g., their COI barcodes
differ by 8.1% (53 bp) and is sister to the clade of two subgenera: /sapis and Callitera subgen. n.
Therefore, we propose that the lineage with /sapis poecila represents a new subgenus. This subgenus
differs from its relatives by a combination of the following characters: each wing is blackish-brown with a
yellow-orange area towards the base and a central yellow spot, which may be vestigial on the dorsal side.
In DNA, a combination of the following characters is diagnostic in nuclear genome: cne792.14.1:C927T,
ene792.14.1:A132T, cne2411.1.1:A348T, cne5004.10.6:A822T, cne5004.10.6:G633A, cne5335.1.1:C114C
(not T), cne5335.1.1:T129T (not C), cne5331.3.1:A53A (not G), cne5331.3.1:T237T (not C), cne573.8.1:
C63C (not G) and in COI barcode: A4C, C81T, T88A, A278A, 421C, A586A.
Etymology. The name of the type species, poecila, typically refers to colorful or variegated markings or
patterns. It 1s derived from the Greek word zouctioc (poikilos), which means varied, diverse, or
multicolored. The name of the new subgenus is formed from the Spanish word matizado, which means
variegated or mottled. The name is treated as a feminine noun in the nominative singular.
Species included. Only the type species.
Parent taxon. Genus /sapis E. Doubleday, 1847.
Lyropteryx diadocis Stichel, 1910 belongs to the genus Paraphthonia Stichel, 1910
and not Lyropteryx Westwood, 1851
Genomic phylogeny reveals that Lyropteryx diadocis Stichel, 1910 (type locality in Brazil: Amazonas)
kept in its original genus is not monophyletic with Lyropteryx Westwood, 1851 (type species Lyropteryx
apollonia Westwood, 1851) and instead is sister to Paraphthonia Stichel, 1910 (type species Monethe
molione Godman, 1903) (Fig. 21). Because Paraphthonia itself is already quite closely related to
Brachyglenis C. Felder & R. Felder, 1862 (type species Brachyglenis esthema C. Felder & R. Felder,
1862) and Themone Westwood, 1851 (type species Helicopis pais Hiibner, [1820]) (Fig. 21): COI barcode
difference of 6.2% (41 bp) and 6.8% (45 bp), respectively, we restore monophyly of Lyropteryx by
including L. diadocis in the genus Paraphthonia to form a new combination Paraphthonia diadocis
(Stichel, 1910), comb. nov. Due to the genetic closeness of these three genera (Paraphthonia,
Brachyglenis, and Themone), it is conceivable to combine them in a single genus Themone, a step we are
not taking here but proposing for consideration.
24
Parapanara Grishin, new subgenus
http://zoobank.org/F41 BC3E1-EAB0-44E4-A4F3-E9C9F8D04775
Type species. Lyropteryx diadocis Stichel, 1910.
Definition. As shown above, Lyropteryx diadocis Stichel, 1910 (type locality in Brazil: Amazonas)
belongs to the genus Paraphthonia Stichel, 1910 (type species Monethe molione Godman, 1903) and not
to Lyropteryx Westwood, 1851 (type species Lyropteryx apollonia Westwood, 1851) (Fig. 21). However,
it is genetically differentiated from the type species of Paraphthonia at the subgenus level, e.g., their COI
barcodes differ by 6.1% (40 bp). Therefore, we propose that the lineage with Paraphthonia diadocis
represents a new subgenus. This subgenus differs from its relatives by a combination of the following
characters: forewing vein R2 originates at the anterior distal corner of the discal cell, the forewing with the
orange-yellow band from mid-costa to near tornus, and the hindwing with metallic-green overscaling
around veins in distal half. In DNA, a combination of the following characters is diagnostic in the nuclear
genome: cne3461.1.26:A146G, cne3461.1.26:A1989G, cne6404.2.4:C87T, cne945.5.1:A342T, cne945.5.1:
T352C, cne3615.3.2:A132A (not G), cne4618.3.1:C31C (not G), cne4618.3.1:C37C (not G), cne6843.7.6:
G489G (not A), cne6843.7.6:T525T (not C) and in COI barcode: TI1O0A, C284T, T286A, A352C, T355A,
A604G.
Etymology. In its appearance, the type species of this subgenus resembles some species from the genus
Panara E. Doubleday, 1847 (type species Papilio jarbas Drury, 1782), and the prefix “para” means
alongside, near, beyond, or similar to. The name is a feminine noun in the nominative singular.
Species included. Only the type species.
Parent taxon. Genus Paraphthonia Stichel, 1910.
Synargis orestessa Hiibner, [1819] is a junior subjective synonym of Synargis soranus
(Stoll, 1781), and Synargis arche (Hewitson, 1865) is a valid species
Synargis orestessa Hiibner, [1819] was proposed as a replacement name for Papilio orestes Cramer, 1780
(type locality in Suriname) preoccupied by Papilio orestes Meerburgh, 1777 (in Papilionidae). Original
illustrations (dorsal and ventral) (Cramer 1775-1780) of P. orestes and a possible syntype specimen in
RMNH that agrees with the illustrations and would simultaneously be a syntype of the replacement name
S. orestessa look more similar to the original illustrations of Synargis soranus (Stoll, 1781) (type locality
in Suriname) and specimens referred to by the name “soranus,” than to specimens of the species currently
referred to by the name “orestessa.” Genomic analysis shows the presence of two species (Fig. 22) that
differ by 3.2% (21 bp) in their COI barcodes: females of one possess broader yellow-orange bands on the
forewing, and of the other have narrower and whiter bands usually separated into spots, among other
differences. For these reasons, we propose that Synargis orestessa Hiibner, [1819], stat. nov. is a junior
subjective synonym of Synargis soranus (Stoll, 1781). The oldest name for the species that was referred
to by the name “orestessa” 1s Nymphidium arche Hewitson, 1865 (type locality in Brazil: Amazonas),
and, hence, Synargis arche (Hewitson, 1865) is a valid species.
Too SYNargis soranus (=orestessa & =forestes)|22014D05|?ST|no datalold [g mito
Synargis soranus|19031G03|Guyana|2001
Synargis arche [not orestessa]|19031G02|Guyana|2001
ae Synargis arche (=pseudomandana) [not orestessa]|18095B05|HT|no datalold
* Synargis arche (=f. cinerea) [not orestessa]|21119G04|Brazil:Paralold
Synargis abaris|19031G05|Guyana|2001
Synargis abaris|19031G04|Peru:MD|2013 —oo
Synargis soranus (=orestessa & =forestes)|22014D05|?ST
yd at Dis soranus|19031G03|Guyana|2001
ipynargis arche [not orestessa]|19031G02|Guyana|2001
ig@ynargis arche (=pseudomandana) [not orestessa]|18095B05|HT
Synargis arche (=f. cinerea) [not orestessa]|21119G04|Brazil
Synargis abaris|19031G05|Guyana|2001
Synargis abaris|19031G04|Peru:MD|2013
a nuclear
100
—— 0.004
Fig. 22. Phylogenetic trees of several Synargis species inferred from protein-coding regions of a) the nuclear (autosomes) and
b) the mitochondrial genomes: S. soranus (red), S. arche stat. rest. (blue), and their sister S. abaris (green).
25
Family Lycaenidae [Leach], [1815]
Nothodanis Hirowatari, 1992 is a subgenus of Danis [Fabricius], 1807
Genomic phylogeny of Polyommatini Swainson, 1827 reveals that Nothodanis Hirowatari, 1992 (type
species Lycaena schaeffera Eschscholtz, 1821) (Fig. 23 cyan) is closely related to its sister genus Danis
[Fabricius], 1807 (type species Papilio danis Cramer, 1775) (Fig. 23 violet), e.g., their COI barcodes
differ by 10.2% (67 bp) and the two diverged from each more recently than most other genera (Fig. 23, on
the right of the green line). Therefore, we propose to treat Nothodanis Hirowatari, 1992, stat. nov. as a
subgenus of Danis [Fabricius], 1807.
a nuclear sod arucus theophrastus|22027C05|Algeria|1982 b mitochondrial
Tarucus theophrastus|22027C06|Algeria|1978
Tarucus clathratus [not Castalius]|20124E10|HT|Celebes|1887
jogesvens rosimon|22027C07|Nepal|1964
astalius rosimon|22027C08|Nepal|1962
Zintha hintza hintza|20127E05|?T|South Africa|old
Tuxentius melaena melaena|20127E06|?T|South Africa|1891
qqrucus theophrastus|22027C05|Algeria|1982
arucus theophrastus|22027C06|Algeria|1978
Tarucus clathratus [not Castalius]|20124E10|HT|Celebes
Gastalius rosimon|22027C07|Nepal|1964
Castalius rosimon|22027C08|Nepal|1962
Zintha hintza hintza|20127E05|?T|South Africajold
Tuxentius melaena melaena|20127E06|?T|South Africa|1891
Tuxentius margaritaceus|20127E07|ST|Kenya|1889
Thaumaina uranothauma deliciosa|22038B01|PNG|1972
Thaumaina evena [was Upolampes]|22027A02|PNG|old
Psychonotis caelius plotinus|22038A10|Papua New Guinea|1978
Perpheres perpheres peri [not Danis]|22027A12|New Guinea
Caleta caleta]22027A04|Celebes|old
Caleta roxus roxus|22027A09|Javalold
Caleta nigropunctata [was Pistoria]|SAMN18674175|PNG
Discolampa ethion|22027A06|no datalold
Nacaduba kurava prominens|22026H03|Sri Lankal|old
Nacaduba cyanea pindus|22038A03|Halmahera IsI.|1984
Danis (Danis) danis|22027A11|Amboina|old
Danis (Danis) regalis]22038A05|Papua|1933
Danis (Nothodanis) schaeffera schaeffera|22038A07|no datalold
0.03 Danis (Nothodanis) schaeffera baladensis|22038A08|New Caledonia
Tuxentius margaritaceus|20127E07|ST|Kenya|1889
Thaumaina uranothauma deliciosa|22038B01|PNG|1972
Thaumaina evena [was Upolampes]|22027A02|PNGl|old
Perpheres perpheres peri [not Danis]|22027A12|New Guinea|1971
Psychonotis caelius plotinus|22038A10|Papua New Guinea|1978
Caleta caleta|22027A04|Celebes|old
> ~Caleta roxus roxus|22027A09|Javalold
Caleta nigropunctata [was Pistoria]|SAMN18674175|PNG
Discolampa ethion|22027A06|no datalold
Nacaduba kurava prominens|22026H03|Sri Lankalold
Nacaduba cyanea pindus|22038A03|Halmahera IsI.|1984
Danis (Danis) danis|22027A11|Amboinal|old
Danis (Danis) regalis|22038A05|Papua|1933
idganis (Nothodanis) schaeffera schaeffera|22038A07|no datalold
Danis (Nothodanis) schaeffera baladensis|22038A08|New Caledonia|1984
Fig. 23. Phylogenetic trees of selected Polyommatini species inferred from protein-coding regions of a) the nuclear
(autosomes) and b) the mitochondrial genomes. Taxa discussed in the text are shown in color. The green line delineates genera.
The sequence of SAMN18674175 is taken from the alignment provided in Kawahara et al. (2023).
Perpheres Hirowatari, 1992 is confirmed as a valid genus
Perpheres Hirowatari, 1992 (type and the only species Thysonotis perpheres (H. H. Druce & Bethune-
Baker, 1893) (Fig. 23 olive) was at times lumped with Danis [Fabricius], 1807 (type species Papilio danis
Cramer, 1775), but is in a clade different from Danis (subtribe Danina Kocak & Seven, 1997) and the
same clade with Castalius Htibner, [1819] (type species Papilio rosimon Fabricius, 1775, subtribe
Castaliina Distant, 1884) (Fig. 23). Therefore, the placement of 7. perpheres in Danis is incorrect and,
because Perpheres is genetically distant from genera that are closest to it (Fig. 23), we confirm Perpheres
as a valid genus in the subtribe Castaliina.
Pistoria Hemming, 1964 is a junior subjective synonym of Ca/eta Fruhstorfer, 1922
Adding DNA segments of Mambara nigropunctata Bethune-Baker, 1908 (type locality in Papua New
Guinea, biosample SAMN18674175), the type species of currently valid genus Pistoria Hemming, 1964,
taken from the alignment provided in Kawahara et al. (2023) (Fig. 23 red) to our genomic datasets of its
relatives, we find that Pistoria nigropunctata originates within Caleta Fruhstorfer, 1922 (type species
Lycaena caleta Hewitson, 1876), rendering it paraphyletic. To restore the monophyly, due to the genetic
closeness of Pistoria nigropunctata and Caleta caleta (COI barcode difference of 5.9%, 39 bp), we
propose that Pistoria Hemming, 1964, syn. nov. is a junior subjective synonym of Caleta Fruhstorfer,
1922.
Upolampes Bethune-Baker, 1908 is a junior subjective synonym
of Thaumaina Bethune-Baker, 1908
Genomic trees reveal that Upolampes Bethune-Baker, 1908 (type species Upolampes striata Bethune-
Baker, 1908, which is a junior subjective synonym of Lycaena evena Hewitson, 1876) (Fig. 24b, Fig. 23
26
orange) and Thaumaina Bethune-Baker, 1908 (type species Thaumaina uranothauma Bethune-Baker,
1908) (Fig. 24a, Fig. 23 green) are closely related to each other despite the remarkable difference in their
wing patterns (Fig. 24): e.g., their COI barcode differ by 6.5% (43 bp) and therefore should be
synonymous. The two names, Upolampes and Thaumaina, were published in the same work issued on the
same date (Bethune-Baker 1908). As the first revisers, we give precedence to Thaumaina (two valid
Species, fewer name changes) over Upolampes (one valid species) and propose that Upolampes Bethune-
Baker, 1908, syn. nov. is a junior subjective synonym of Thaumaina Bethune-Baker, 1908.
Fig. 24. Males of Thaumaina from Papua New Guinea in dorsal (left) and ventral (right) views: a) 7. uranothauma deliciosa
Wind & Clench, 1945, Wau, 5000 ft, 18-22-Apr-1972, R. H. Carcasson leg. (NVG-22038B01) [USNM]; b) 7. evena comb.
nov., Madang, genitalia of this specimen are illustrated on pl. 5, f. 14 in Fruhstorfer (1918) (NVG-22027A02) [ZSMC].
Tarucus clathratus W. Holland, 1891, comb. rest.
Genomic sequencing of the holotype by monotypy: “the type, a male,” per original description (Holland
1891), of Tarucus clathratus W. Holland, 1891 (type locality in Sulawesi, sequenced as NVG-20124E10)
(Fig. 25, Fig. 23 magenta), currently placed in the genus Castalius Htibner, [1819] (type species Papilio
rosimon Fabricius, 1775), reveals that it is not monophyletic with its type species and is in the same clade
with Tarucus F. Moore, 1881 (type species Hesperia theophrastus Fabricius, 1793) (Fig. 23 blue), where
it was originally placed. Therefore, we return it to the genus 7arucus, as originally proposed: Tarucus
clathratus W. Holland, 1891, comb. rest. We note that the photograph of 7. clathratus holotype in the
original description (Holland 1891) (Fig. 25b) on a casual look does not appear particularly similar to
Hoiland abdomen Taken Lex Few;
Colléction ;
Cassidy Zax S Eps
oa
DNA sample ID:
NVG—20124E10
c/o Nick V. Grishin
9. Peninsula, Celebes
li “Coll, Doherty, 1887. «
Fig. 25. Holotype of Tarucus clathratus, data in text: a) photographs taken on 28-Jun-2021 by N.V.G., dorsal (left) and ventral
(right) views of the specimen with its labels (below); labels reduced by one third compared to the specimen; larger scale bar
refers to the specimen, smaller scale bar refers to labels and genitalia vial; b) photograph of the holotype in ventral view
reproduced from pl. 5, f. 8 in Holland (1891).
2
the holotype specimen (Fig. 25a). The photograph shows a specimen with narrower dark bands (likely
overexposed or possibly re-touched) and a different position of antenna (was re-attached later). However,
despite these differences, the wing shape and outline of the spread with the right hindwing closer to the
forewing than the left pair, the position of tails, and the tear along the Rs vein in the middle of the right
hindwing match between the likely holotype and the photograph. The specimen is in CMNH, bears the
label “Holland Collection”, agrees with the original description better than the photograph (broad dark
bands per description), and is labeled in Holland’s handwriting as “Type” in a manner similar to all other
type specimens he described and labeled. Therefore, there is little reason to doubt that the specimen we
sequenced (NVG-20124E10) is the holotype.
Family Hesperiidae Latreille, 1809
Euriphellus colombiensis Grishin, new species
http://zoobank.org/466927D6-598F-4C 73-883 5-F3D4305F40BB
(Figs. 26 part, 27a, c, 28a—b)
Definition and diagnosis. The Z chromosome analysis of Euriphellus Austin, 2008 (type species Papilio
euribates Stoll, 1782) reveals that four specimens from Colombia and Ecuador form a clade sister to
several Euriphellus species that is genetically differentiated from them (Fig. 26a). Therefore, these
specimens belong to species distinct from the rest. The two pairs of specimens are genetically
differentiated from each other, e.g., COI barcode differences of 4.9% (32 bp) between them (possible
introgression with Euriphellus lama (Evans, 1952), Fig. 26b), and belong to two different new species.
The one from western Colombia is described here, and the one from eastern Ecuador is described below.
The new species from Colombia keys to D.4.2(b) in Evans (1952), and differs from its relatives by the
following combination of characters in male: dorsal wing color yellower in hue, forewing without
submarginal hyaline spots in cells M1-M2, M2-M3, or R3-R4, only two yellow hyaline subapical spots in
cells R4a-Rs5 and Rs-Mi, hindwing with six well-developed and nearly collected into a band postdiscal
brown spots on dorsal side, one in each cell between veins RS and 1A+2A, ventrally with prominent
yellow spots, including near the base of cell Sc+R1-RS (Fig. 27a), tegumen narrower in dorsal view,
harpe longer than in relatives, humped along ventral margin, expanded into a keel with several
small teeth on dorsal side and narrows to a point, ampulla with a nearly square process, flattened
along its somewhat irregular dorsoposterior margin (Fig. 28a, b); and female with larger discal
forewing hyaline spots, the spot in cell M3-CuA1 overlaps the spot in cell CuA1-CuAz by most of its
width (Fig. 27c). Due to unknown phenotypic variation, definitive identification is provided by DNA,
and a combination of the following characters is diagnostic in the nuclear genome: aly2582.35.2:G1861A,
aly2582.35.2:C1862G, aly767.18.5:A88T, aly767.18.5:TI17A, aly54.32.1:C215G and in COI barcode:
A181G, T259C, C343T, T364C, T376A, T484T, T553A.
Euriphellus marian|17103G12|Peru:Loreto|1990
> Euriphellus marian|17103G01|Peru:Tingo Maria|1994
7) Euriphellus lama|18083C04|PT|Belizelold mitochondrial
Too Euriphellus lama|17102E11|Guatemalal|old
Euriphellus lama|18083C07|HT|Guatemalal|old
Euriphellus phraxanor (=mutius)|21117A01|ST|Colombia|1881
Euriphellus phraxanor|18052E07|Venezuelal|old
Euriphellus phraxanor (=heras)|15031F06|ST|Venezuela|old
Euriphellus mena|18083C08|HT|Ecuador|old
Euriphellus mena|18082E09|PT|Ecuador|old
Euriphellus mena|21115B04|Ecuador|old
Euriphellus colombiensis|18052E08|HT|Colombia|old
Euriphellus colombiensis|18052E11|PT|Colombia|old
Euriphellus ecuadoricus|18057G01|HT|Ecuador|old
Se ein ecuadoricus|18057G02|PT|Ecuador|old
> Euriphellus euribates|14063D10|Guyana|2000
*“Euriphellus euribates|14063E01|Peru:MD|2013
») Euriphellus polygius|19041H03|Brazil:SC|old
0.007 Euriphellus polygius|22018B11|Brazil:SC|old
500 EUriphellus marian|17103G12|Peru:Loreto
Euriphellus marian|17103G01|Peru:Tingo Maria
Euriphellus lama|18083C04|PT|Belize|old
uriphellus lama|18083C07|HT|Guatemalalold
oéuriphellus lama|17102E11|Guatemalalold
Furiphellus colombiensis|18052E08|HT|Colombia
Euriphellus colombiensis|18052E11|PT|Colombia
E phraxanor (=mutius)|21117A01|ST|Colombia
is phraxanor (=heras)|15031F06|ST|Venezuela
Euriphellus phraxanor|18052E07|Venezuela
a
Z chromosome
yriphellus mena|18083C08|HT|Ecuador|old
idouriphellus mena|21115B04|Ecuador|old
Euriphellus mena|18082E09|PT|Ecuador|lold
Fyriphellus ecuadoricus|18057G02|PT|Ecuador
Euriphellus ecuadoricus|18057G01|HT|Ecuador
Fyriphellus euribates|14063D10|Guyana|2000
Euriphellus euribates|14063E01|Peru:MD|2013
Furiphellus polygius|19041H03|Brazil:SC|old
0.02 Euriphellus polygius|22018B11|Brazil:SClold
Fig. 26. Phylogenetic trees of selected Euriphellus species inferred from protein-coding regions of a) the Z chromosome and b)
the mitochondrial genome: E. marian (violet), E. lama (cyan), E. phraxanor (blue), E. mena (green), E. colombiensis sp. n.
(red), E. ecuadoricus sp. n. (magenta), E. euribates (olive), and E. polygius (black).
28
Fig. 27. Type specimens of Euriphellus: a) E. colombiensis sp. n. & holotype, b) E. ecuadoricus sp. n. & holotype, c) EF.
colombiensis sp. n. ¢ paratype, d) E. ecuadoricus sp. n. ° paratype in dorsal (left) and ventral (right) views, data in text.
29
Fig. 28. Genitalia of holotypes: a—b) Euriphellus colombiensis sp. n. and c—d) Euriphellus ecuadoricus sp. n. in dorsal (a, c)
and left lateral (b, d) views.
Barcode sequence of the holotype. Sample NVG-18052E08, GenBank OR837728, 658 base pairs:
AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATGTTAGGAACTTCTTTAAGTTTACTAATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAAATGATCAAATTTATAATACT
ATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTAATGCCTATTATAATTGGGGGATTCGGAAACTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCTTTTCCACGAA
TAAATAATATAAGATTCTGATTACTTCCCCCTTCTTTAATATTATTAATTTCAAGAAGAATCGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCTCCTTTATCTGCTAACATTGC
CCATCAAGGATCATCAGTTGATTTAGCAATTTTTTCTCTTCACTTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAACTTATCT
TTCGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTACTTCTCTCTTTACCAGTACTAGCAGGTGCAATTACTATATTATTAACAGACCGAAATTTTAATACAT
CTTITTTTTGATCCTICIGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: & deposited in the Museum fiir Naturkunde, Berlin, Germany [MFNB],
illustrated in Fig. 27a, bears four printed labels: 1‘ green, two white [ W.Columb. | Rio Dagua | 600-
1000m | W.Hopp S. | 2 - 5 | (the last line is rotated 90° to the left and printed on the right margin of the
label), [ DNA sample ID: | NVG-18052E08 | c/o Nick V. Grishin ], [ DNA sample ID: | NVG-22111G11 |
c/o Nick V. Grishin |], and one red [ HOLOTYPE c@ | Euriphellus | colombiensis Grishin |. The first NVG
number corresponds to a sampled leg, and the second is for the abdomen DNA extraction followed by
genitalia dissection. Paratype: 12° with the same data as the holotype (NVG-18052E11, GenBank
barcode OR837729, Fig. 27c).
Type locality. Colombia: Rio Dagua, 600—1000 m.
Etymology. The name is given for the country of the type locality. The name is a masculine adjective.
Distribution. Currently known only from Colombia.
Euriphellus ecuadoricus Grishin, new species
http://zoobank.org/462B5465-AC20-4876-93A3-4803BB75CD2C
(Figs. 26 part, 27b, d, 28c—d)
Definition and diagnosis. Genomic analysis of Euriphellus Austin, 2008 (type species Papilio euribates
Stoll, 1782) reveals that four specimens from Colombia and Ecuador form a clade sister to several
Euriphellus species that is genetically differentiated from them (Fig. 26). Therefore, these specimens
belong to species distinct from the rest. The two pairs of specimens are genetically differentiated from
each other, e.g., COI barcode differences of 4.9% (32 bp) between them, and belong to two different new
species. The one from eastern Ecuador is described here, and the one from western Colombia is described
above. The new species from Ecuador keys to D.4.2(b) in Evans (1952), and differs from its relatives by
the following combination of characters in males: wings not as rounded as in Euriphellus mena (Evans,
30
1952) (type locality in Ecuador), dorsal wing color redder in hue, forewing may be with small
submarginal hyaline spots in cells Mi-M2, M2-M3, and R3-R4, and larger hyaline subapical spots in cells
R4-Rs and Rs-Mj), hindwing with five weaker-developed and separated postdiscal brown spots on dorsal
side, one in each cell between veins RS and CuAg, ventrally with prominent yellow spots, but not near the
base of cell Sc+Ri-RS (Fig. 27b), tegumen broader in dorsal view, harpe shorter than in Euriphellus
colombiensis sp. n., only weakly humped along ventral margin, no dorsal keel, and narrows to a point,
ampulla with a rounded thumb-like process with somewhat irregular margins (Fig. 28c, d); and female
with smaller discal forewing hyaline spots, the spot in cell M3-CuA1 offset distad from the spot in cell
CuAi-CuA2 not overlapping with it (Fig. 27d). Due to unknown phenotypic variation, definitive
identification is provided by DNA, and a combination of the following characters is diagnostic in the
nuclear genome: aly331.26.8:C109A, aly331.26.8:G267A, aly331.26.8:T291C, aly536.154.1:A618G, aly536.
154.1:T631C and in COI barcode: A28G, T91A, A229G, C343A, G474A, A538G, T544A, T607C, T634C.
Barcode sequence of the holotype. Sample NVG-18057G01, GenBank OR837730, 658 base pairs:
AACTTTATATTTTATTTTTGGAATTTGGGCAGGAATACTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAACTCCCGGTTCATTAAT TGGAAATGATCAAATTTATAATACT
ATTGTTACAGCCCATGCTTTTATTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTACCATTAATATTAGGAGCCCCAGATATGGCTTTTCCACGAA
TAAACAATATAAGATTTTGATTACTTCCACCTTCTTTAATATTATTAATTT CAAGAAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCACCTTTATCTGCTAATATTGC
BSN WS EC ts ak NG i eat pT AER BAe Cae Ong ea hates ii pS a ee GaCh Ce a re aan en gS Ubi amer ne ake Se eur a ag ah ae tik i ly ear a
TTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTGCTTCTATCTTTACCTGTATTAGCAGGTGCAATTACTATATTATTAACAGACCGAAATTTTAATACAT
CCTTTTTTGATCCTTCTGGAGGAGGAGACCCTATTTTATATCAACATTTATTT
Type material. Holotype: & deposited in the Zoologische Staatssammlung Miinchen, Germany [ZSMC],
illustrated in Fig. 27b, bears five printed labels: four white [| Canelos | Ecuador or. |, [ Collection |
v.Rosen |, [ DNA sample ID: | NVG-18057G01 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-
23012A09 | c/o Nick V. Grishin |, and one red [ HOLOTYPE co | Euriphellus | ecuadoricus Grishin |. The
first NVG number corresponds to a sampled leg, and the second is for the abdomen DNA extraction
followed by genitalia dissection. Paratype: 1° with the same data as the holotype (NVG-18057G02,
GenBank barcode OR837731, Fig. 27d).
Type locality. Ecuador: Canelos.
Etymology. The name is given for the country of the type locality. The name is a masculine adjective.
Distribution. Currently known only from Ecuador.
Goniurus proteoides Plétz, 1881 is a junior subjective synonym of Urbanus proteus
domingo (Scudder, 1872) and not of Urbanus proteus proteus (Linnaeus, 1758)
Genomic analysis of a syntype of Goniurus proteoides Plotz, 1881 (type locality in North America, NVG-
15029D03) currently considered a junior subjective synonym of Urbanus proteus proteus (Linnaeus,
1758) (type locality in America) (Mielke 2005) reveals that it is not monophyletic with the latter and
instead placed within specimens of Urbanus proteus domingo (Scudder, 1872) (type locality in Haiti), in
agreement with Evans (1952) (Fig. 29). Therefore, we regard Goniurus proteoides Plétz, 1881 as a junior
subjective synonym of Urbanus proteus domingo (Scudder, 1872) and not of Urbanus proteus proteus
rbanus proteus proteus :TX,Hidalgo Co. rbanus proteus proteus :FL,Levy Co.
a Urb 3841|USA:TX,Hidalgo Co.|2015 Urb p p 4697|USA:FL,Levy Co.|2015
Urbanus proteus proteus|4371|USA:TX,Chambers Co.|2015 Beppnds proteus proteus|22063G04|USA:AL, Baldwin Co.|2018
nuclear Urbanus proteus proteus|15038C02|?NT|USA:NC,Craven Co.|1959 mito rbanus proteus proteus|4371|USA:TX,Chambers Co.|2015
Urbanus proteus proteus|22063G04|USA:AL, Baldwin Co.|2018
Urbanus proteus proteus|4894|USA:FL,Miami-Dade Co.|2015
Urbanus proteus proteus|10211|USA:TX,Dallas Co.|2017
Urbanus proteus proteus|4697|USA:FL,Levy Co.|2015
Urbanus proteus domingo|15099B09|Barbados|1985
Urbanus proteus domingo|10308|Jamaica|2017
Urbanus proteus domingo|19071A09|Dominican Republic|1981
U. proteus domingo (=proteoides) [not nominal]|15029D03|LT|no datalold
Urbanus proteus domingo|19069D10|Bahamas:North Caicos|1984
Urbanus proteus domingo|19069D11|Cuba, Guantanamo|1965
Urbanus proteus domingo|19069D12|Cuba, Sierra Maestra|1929
Urbanus cubanus|18057F12|HT|Cuba:Havana|2014
Urbanus cubanus|21126H02|PT|Cubalold
Urbanus velinus|19064C10|Venezuela|1979
Urbanus velinus|19126B09|Peru:MD|2019
0.004 Urbanus velinus|5697|Guyana|1999
erie proteus proteus|15038C02|?NT|USA:NC,Craven Co.|1959
rbanus proteus proteus|4894|USA:FL,Miami-Dade Co.|2015
33rbanus proteus proteus|10211|USA:TX,Dallas Co.|2017
rbanus proteus domingo|19069D12|Cuba,Sierra Maestra|1929
Hibanus proteus domingo|19069D10|Bahamas:North Caicos|1984
rbanus proteus domingo|19071A09|Dominican Republic|1981
9. proteus domingo (=proteoides) [not nominal]|15029D03|LT
Urbanus proteus domingo|10308|Jamaica|2017
qa. proteus proteus|3841|USA:TX,Hidalgo Co.|2015
tbo'§rbanus proteus domingo|15099B09|Barbados|1985
Urbanus proteus domingo|19069D11|Cuba,Guantanamo|1965
Peeenne cubanus|18057F12|HT|Cuba:Havana|2014
rbanus cubanus|21126H02|PT|Cuba|old
rbanus velinus]19064C10|Venezuela|1979
bbanus velinus|19126B09|Peru:MD|2019
—— 0.008 Urbanus velinus|5697|Guyana|1999
Fig. 29. Phylogenetic trees of selected Urbanus species inferred from protein-coding regions of a) the nuclear genome
(autosomes) and b) the mitochondrial genome: U. proteus (blue branches) with U. proteus proteus (blue labels) and U. proteus
domingo (specimens from Cuba are labeled in magenta, the lectotype of Goniurus proteoides in orange, and others in violet),
U. cubanus sp. n. (red), and their sister U. velinus (green).
31
(Linnaeus, 1758). In agreement with this conclusion, Godman (1907), who inspected the unpublished
drawing t[afel].33 by Plétz of G. proteoides, wrote that he had its “Specimens from the Lesser Antilles in
the G. & S. coll.” To stabilize nomenclature, N.V.G. hereby designates the sole syntype curated in the
MENB collection, a male with the following five labels, the 2"¢ handwritten and others printed, the 1% red
and others white: [ Type |, [ proteoides | Pl. 104], [ Coll. H—Sch ], [ {QR Code} http://coll.mfn-
berlin.de/u/ | e1£97d |, and [ DNA sample ID: | NVG-15029D03 | c/o Nick V. Grishin | as the lectotype of
Goniurus proteoides Plétz, 1881. The type locality of G. proteoides is in the Antilles (unclear if the
Greater or the Lesser). Sequencing additional specimens of U. p. domingo across its range may pinpoint
the type locality more precisely.
Urbanus (Urbanus) cubanus Grishin, new species
http://zoobank.org/E13 11827-75D9-4699-8E88-D7A3 17D9792A
(Figs. 29 part, 30, 31la—e)
Definition and diagnosis. The nuclear genome tree reveals a prominent clade of two specimens from
Cuba (Fig. 29 red) initially identified as Urbanus proteus domingo (Scudder, 1872) (type locality in
Fig. 30. Urbanus (Urbanus) cubanus sp. n. in dorsal (left) and ventral (right) views, data in text:
a) holotype ? NVG-18057F12 and b) paratype @ NVG-21126H02.
32
cubanus _ cubanus
HT PT
domingo
1mm a b Cc ie f g
Latent
Fig. 31. Female genitalia of Urbanus (Urbanus) cubanus sp. n.: a—c) holotype NVG-18057F12 and d—e) paratype NVG-
21126H02, data in text, and f-g) Urbanus (Urbanus) proteus domingo NVG-23012A04 from Cuba: Havana, 3-Mar-1927
[ZMSC] in ventral (a, b, d, f) and right ventrolateral (c, e, g) views. Complete genitalia with ductus and corpus bursae are
shown in a) and reduced two times (as indicated by smaller scale) compared to other images. Blue arrows point at the antrum.
Haiti) that is sister to all other Urbanus proteus (Linnaeus, 1758) (type locality in America) we sequenced
(Fig. 29 blue branches), and is placed approximately halfway between U. proteus and its sister species
Urbanus velinus (Pl6tz, 1881) (type locality in Brazil: Bahia) (Fig. 29 green). The two specimens are
strongly differentiated genetically from U. p. domingo (Fig. 29 violet, orange, and magenta labels),
including two other specimens from Cuba (southeastern region) (Fig. 29 magenta labels): Fst/Gmin/COI
barcode difference of 0.51/0.00/0.8% (5 bp, barcodes are similar between the two species). Therefore, these
two specimens represent a species distinct from U. proteus. This new species keys to C.13.1(b) in Evans
(1952) and differs from its closest relative U. proteus in broader and straighter ventral hindwing dark
brown bands and a darker area by mid-costa, hyaline spot in forewing cell CuA;-CuAg2 closer aligned with
the spot in discal cell rather than shifted distad, absent or small submarginal hyaline spots in forewing
cells Mi-M2 and M2-M3, and narrower antrum (Fig. 31 blue arrows). Due to unexplored phenotypic
variation, definitive identification is provided by DNA, and a combination of the following characters is
diagnostic in the nuclear genome: aly103.33.9:A90G, aly103.33.9:T160C, aly103.33.9:G162C, aly207.9.6:
A180G, aly103.50.3:T60C and in COI barcode: C220C, T322C, T385C, T610C, C616T.
Barcode sequence of the holotype. Sample NVG-18057F12, GenBank OR837732, 658 base pairs:
AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTT TAAT TGGAGATGATCAAATTTATAATACT
ATTGTAACAGCTCATGCTTTCATTATAATTTTCTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGACTAGT TCCATTAATAATAGGT GCCCCTGATATAGCTTTC
TAAATAATATAAGATTTTGATTATTACCCCCTTCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGTACCGGATGAACAGTCTATCCCCCTCTTTCATCTAATATTG
CCACCAAGGAGCTTCCGTTGACCTAGCAATTTTTTCTCTTCATCTTGCTGGAATT TCATCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT
TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTCTCTTTACCTGTATTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT
CATTCTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: ¢ deposited in the Zoologische Staatssammlung Miinchen, Germany [ZSMC],
illustrated in Fig. 30a, bears six labels: four white, the 3 greenish [ CUBA, La Habana, | Boyeros, Finca
La | Chata (23.036 N, - | 82.376 W), July 9 2014 | R. Nufiez leg. J], [ RNA-1-171 ], [BC ZSM Lep
92903 |, [ DNA sample ID: | NVG-18057F12 | c/o Nick V. Grishin ], [DNA sample ID: | NVG-
23012A03 | c/o Nick V. Grishin ], and one red [ HOLOTYPE @ | Urbanus (Urbanus) | cubanus Grishin ].
The first NVG number corresponds to a sampled leg, and the second is for the abdomen DNA extraction
followed by genitalia dissection. Paratype: 19 Cuba, Gundlach leg., Coll. Thieme, genitalia vial NVG-
22111G12 (NVG-21126H02, GenBank barcode OR837733, Fig. 30b) [MFNB].
Type locality. Cuba: Havana, Boyeros, Finca La Chata, GPS 23.036, —82.376.
Etymology. The name is given for the country of the type locality. The name is a masculine adjective.
A
A
Distribution. Cuba; currently confirmed from the northwestern region (Havana).
33
Comment. The ground color difference between the holotype and paratype (darker brown vs. paler
reddish-brown, Fig. 30) is due to fading with age: the paratype was collected more than a century ago.
Quadrus (Zera) difficilis (Weeks, 1901) is confirmed as a species
distinct from Quadrus (Zera) zera (A. Butler, 1870)
Although Quadrus (Zera) difficilis (Weeks, 1901) (type locality in Bolivia) is treated as a distinct species
and not a subspecies of Quadrus (Zera) zera (A. Butler, 1870) (type locality in Venezuela), on the
Butterflies of America website (Warren et al. 2023), this taxonomic opinion has not been substantiated
numerically. Genomic sequencing of several specimens of both taxa reveals prominent genetic
differentiation between them (Fig. 32), e.g., Fs/COI barcode difference of 0.30/2.7% (18 bp), thus
confirming Quadrus (Zera) difficilis (Weeks, 1901) as a species-level taxon.
Quadrus (Zera) zera|19086F06|Panama|1982 D mitochondrial
Quadrus (Zera) zera|20054A12|Panama|2013
Quadrus (Zera) zera|19086F09|Ecuador|1990 —
Quadrus (Zera) zera|19086F08|Venezuela|1985 ne
Quadrus (Zera) difficilis (=concolor)|18078F11|HT|Panama|1887
Quadrus (Zera) difficilis]18011E12|Peru|2014
Quadrus (Zera) difficilis]18087D06|Bolivia|old
Quadrus (Zera) difficilis|19086F11|Brazil:MT|1978
Quadrus (Zera) teresa|19086F10|Brazil:RJ|old
Quadrus (Zera) teresa|22018E11|Paraguaylold
Quadrus (Zera) belti|19086F05|Panama|1968
Quadrus (Zera) belti|19086F04|Panama|1968
Quadrus (Zera) zera|20054A12|Panama|2013
97 Quadrus (Zera) zera|19086F06|Panama|1982
oQuadrus (Zera) zera|19086F09|Ecuador|1990
Quadrus (Zera) zera|19086F08|Venezuela|1985
Quadrus (Zera) difficilis (=concolor)|18078F11|HT
Quadrus (Zera) difficilis]18011E12|Peru|2014
°Quadrus (Zera) difficilis|18087D06|Bolivialold
Quadrus (Zera) difficilis}19086F 11|Brazil:MT|1978
Quadrus (Zera) teresa|22018E11|Paraguaylold
Quadrus (Zera) teresa|19086F10|Brazil:RJ|old
Quadrus (Zera) belti]19086F05|Panama|1968
Quadrus (Zera) belti|19086F04|Panama|1968
a nuclear
Fig. 32. Phylogenetic trees of selected Quadrus (Zera) species inferred from protein-coding regions of a) the nuclear genome
(autosomes) and b) the mitochondrial genome: Q. zera (blue) and Q. difficilis (red).
Bolla subgisela Strand, 1921 is a junior subjective synonym
of Staphylus melangon epicaste Mabille, 1903 and not of Bolla eusebius (Plétz, 1884)
Genomic analysis of the holotype of Bolla subgisela Strand, 1921 (type locality in Colombia), currently
regarded as a junior subjective synonym of Bolla eusebius (Pl6tz, 1884) (type locality in Central America)
reveals that it is not monophyletic with Bolla Mabille, 1903 (type species Bolla pullata Mabille, 1903
treated as a junior subjective synonym of Staphylus imbras Godman and Salvin, 1896), but instead is
placed within specimens of Staphylus melangon (Mabille, 1883) (type locality in South America) and
away from Staphylus tucumanus (P16tz, 1884) (type locality in Argentina), a sister species of S. melangon
(Fig. 33). Therefore, B. subgisela is conspecific with S. melangon. The phylogenetic analysis we used
does not differentiate between subspecies of S. melangon (Fig. 33), and we assign B. subgisela to
subspecies by a combination of wing pattern characters and locality. Only Staphylus melangon epicaste
Mabille, 1903 (type locality in Brazil) possesses brown ventral hindwing without dominant white
overscaling toward tornus and inner margin, similar to B. subgisela, and it is the only subspecies
documented from Colombia (Evans 1953). Therefore, we propose that Bolla subgisela Strand, 1921 is a
junior subjective synonym of Staphylus melangon epicaste Mabille, 1903.
a nucieal Bolla eusebius|15033G09|T|Central America|old b pieppiailtcale
Bolla imbras|21054A07|Mexico:Ver|1972
Staphylus lizeri|18058D05|Peru:Cuzco|2013
Staphylus musculus|22046G08|Brazil:RS|1954
Staphylus melangon melangon|18058D07|Brazil:MT|old
Staphylus melangon epicaste|18058D08|Brazil:SP|1959
Staphylus melangon epicaste (=subgisela) [not Bolla eusebius}|20082F09|HT|Colombialold
Staphylus melangon melangon|21055A01|Brazil:MG|1971
Staphylus melangon epicaste|18058D11|Brazil:RO|1991
) otaphylus tucumanus|22046G10|Argentinalold
Staphylus tucumanus|22101D01|Argentina|~1970
Staphylus ascalaphus|18058F06|Panama|1975
Bolla eusebius|15033G09|T|Central America|old
Bolla imbras|21054A07|Mexico:Ver|1972
Staphylus lizeri|18058D05|Peru:Cuzco|2013
Staphylus musculus|22046G08|Brazil:RS|1954
Staphylus melangon melangon|21055A01|Brazil:MG|1971
graphylus melangon melangon|18058D07|Brazil:MT|old
taphylus melangon epicaste|18058D11|Brazil:RO|1991
Beaphylus melangon epicaste|18058D08|Brazil:SP|1959
Staphylus m. epicaste (=subgisela) [not Bolla eusebius]|20082F09|HT
Staphylus tucumanus|22101D01|Argentina|~1970
Staphylus tucumanus|22046G10|Argentinalold
Staphylus ascalaphus|18058F06|Panama|1975
12
0.02
Fig. 33. Phylogenetic trees of selected Bolla (violet) and Staphylus inferred from protein-coding regions of a) the nuclear
genome (autosomes) and b) the mitochondrial genome: S. melangon (blue, with Bolla subgisela Strand, 1921, which 1s a junior
subjective synonym of S. m. epicaste, in magenta) and its sister species S. tucumanus (green).
34
Gorgythion marginata Schaus, 1902 is a species distinct
from Gorgythion begga (Prittwitz, 1868)
Gorgythion marginata Schaus, 1902 (type locality in Peru) (Fig. 34 red) currently regarded as a junior
subjective synonym of Gorgythion begga pyralina (Moschler, 1877) (type locality in Suriname) (Fig. 34
blue, part) is genetically differentiated from it and generally from Gorgythion begga (Prittwitz, 1868)
(type locality in Brazil: Rio de Janeiro) at the species level (Fig. 34), e.g., Fs/COI barcode difference of
0.26/2.9% (19 bp). Therefore, we propose that Gorgythion marginata Schaus, 1902, stat. rest. is a
species-level taxon distinct from Gorgythion begga (Prittwitz, 1868).
Gorgythion begga pyralina|15043E10|Surinam|2002 b
Gorgythion begga pyralina|4978|French Guiana|1993 2 :
Gorgythion begga begga|15033E06|ST|Brazil:RJjold Mitochondrial
bo COrgythion begga begga (=beggoides) [not plautia]|15101B07|ST|Trinidad|old
**Gorgythion begga begga|4981|Brazil:RJ|1995
Gorgythion guyanus|15043F10|HT|Guyana|1993 a
Gorgythion marginata [not begga]|15101C03|ST|Peruljold
Gorgythion marginata [not begga]|15101F06|ST|Perulold
Gorgythion marginata [not begga]|4974|Peru|1983
Gorgythion beggina beggina|15033E07|ST|Bolivialold
Gorgythion beggina beggina|15033E08|ST|Bolivialold
Gorgythion beggina escalophoides|15043F03|Argentina|1986
Gorgythion beggina escalophoides|4994|Argentina|1978
Gorgythion plautia|4977|Guyana|1999
Gorgythion plautia|4984|Brazil:RO|1991
oo COrgythion canda|4992|Brazil:MT|1990
Gorgythion canda|21015C08|Paraguay|1922
Gorgythion vox|4970|Mexico:Chiapas|1973
Gorgythion vox|4972|EI Salvador|1967
[00 Gorgythion alcandra|4989|Ecuador:Loja|1975
Gorgythion alcandra|15043E02|Ecuador,Loja|1974
Gorgythion begga pyralina|15043E10|Surinam|2002
'@orgythion begga begga (=beggoides) [not plautia]|15101B07|ST
sGorgythion begga begga|4981|Brazil:RJ|1995
orgythion begga pyralina|4978|French Guiana|1993
Gorgythion begga begga|15033E06|ST|Brazil:RJ|old
Gorgythion guyanus|15043F10|HT|Guyana|1993
7p @orgythion plautia|4977|Guyana|1999
Gorgythion plautia|4984|Brazil:RO|1991
ifeorgythion canda|4992|Brazil:MT|1990
orgythion canda|21015C08|Paraguay|1922
Gpraytnion vox|4970|Mexico:Chiapas|1973
orgythion vox|4972|EI Salvador|1967
Gorgythion marginata [not begga]|15101C03|ST|Perulold
{fgorgythion marginata [not begga]|15101F06|ST|Perulold
Gorgythion marginata [not begga]|4974|Peru|1983
Prgythion beggina beggina|15033E08|ST|Bolivia|old
orgythion beggina beggina|15033E07|ST|Bolivialold
“Geraythion beggina escalophoides|4994/Argentina|1978
orgythion beggina escalophoides|15043F03|Argentina
feraythion alcandra|4989|Ecuador:Loja|1975
orgythion alcandra|15043E02|Ecuador,Loja|1974
a
Z chromosome
0.007
Fig. 34. Phylogenetic trees of Gorgythion species inferred from protein-coding regions of a) the Z chromosome and b) the
mitochondrial genome. Different species are shown in different colors: G. begga (blue, with G. beggoides syntype labeled in
orange), G. guyanus sp. n. (magenta), G. marginata stat. rest. (red), G. beggina (violet), G. plautia (cyan), G. canda (olive),
G. vox (green), and G. alcandra (black).
Gorgythion beggoides Schaus, 1902 is a junior subjective synonym of
Gorgythion begga begga (Prittwitz, 1868), not of Gorgythion plautia (Méschler, 1877)
Gorgythion beggoides Schaus, 1902 (type locality in Trinidad) (Fig. 34 orange) currently treated as a
junior subjective synonym of Gorgythion plautia (Méschler, 1877) (type locality in Suriname) (Fig. 34
cyan) is not monophyletic with it and is instead placed within specimens of Gorgythion begga (Prittwitz,
1868) (type locality in Brazil: Rio de Janeiro) (Fig. 34 blue). Hence, we propose that G. beggoides and G.
begga are conspecific. Due to extensive expression of white scaling around the tornus on the ventral
hindwing, G. beggoides belongs to the nominotypical subspecies and not to Gorgythion begga pyralina
(Moschler, 1877) (type locality in Suriname). Therefore, we propose that Gorgythion beggoides Schaus,
1902 is a junior subjective synonym of Gorgythion begga begga (Prittwitz, 1868), not of Gorgythion
plautia (Méschler, 1877).
Gorgythion guyanus Grishin, new species
http://zoobank.org/75920045-0024-46CF-83F0-F53371D32E59
(Figs. 34 part, 35, 36)
Definition and diagnosis. Genomic analysis of Gorgythion Godman & Salvin, 1896 (type species Helias
pyralina Moschler, 1877) reveals that a specimen from Guyana (NVG-15043F10) (Figs. 34 magenta, 35)
while being sister to Gorgythion begga (Prittwitz, 1868) (type locality in Brazil: Rio de Janeiro) (Fig. 34
blue), is not grouping closely with any of the described species (Fig. 34) and therefore is new. It exhibits
COI barcode differences of 2.4% (16 bp) from Gorgythion begga pyralina (Moschler, 1877) (type locality
in Suriname). This new species keys to E.36.1(a) in Evans (1953) and differs from its relatives in nearly
unmarked dark-brown dorsal hindwing with convex outer margin, rounder than in Gorgythion plautia
(Moschler, 1877) (type locality in Suriname) (Fig. 34 cyan), ventral hindwing without white area towards
tornus, forewing not prominently truncate or produced at the apex, with developed markings and broad
35
4 »
ce wee Oe sl ci HA al
Fig. 35. Holotype of Gorgythion guyanus sp. n. in dorsal (left) and ventral (right) views, data in text.
a Cc
a er er er ee Oe
Fig. 36. Genitalia of Gorgythion guyanus sp. n. holotype in a) dorsal, b) posterolateral, c) left, and d) right lateral views.
pale-brown areas (Fig. 35); left valva broader at the base, and expansion of its ampulla curved inward,
appearing truncate in lateral view (Fig. 36). Due to unknown phenotypic variation, definitive
identification is provided by DNA, and a combination of the following characters is diagnostic in the nu-
clear genome: aly1313.36.6:C75T, aly1497.9.9:A87G, aly361.8.3:TI11C, aly361.8.3:C126T, aly13198.6.3:
G318C, aly1204.4.2:G54G (not A), aly1166.4.2:A30A (not C), aly1166.4.2:T42T (not C), aly770.15.7:A12A
(not G), aly770.15.7:G30G (not A) and in COI barcode: T59C, T172T, A181G, T280T, T463C, T574C.
36
Barcode sequence of the holotype. Sample NVG-15043F10, GenBank OR837734, 658 base pairs:
AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCTTTAAGATTACTAATTCGAACTGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT
ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGGGGATTTGGAAATTGACTTGTTCCATTAATATTAGGAGCCCCTGATATAGCATTCCCCCGAA
TAAATAATATAAGATTTTGACTTTTACCTCCTTCCCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTATCCTCCTCTTTCAGCTAATATTGC
CCATCAGGGGGCATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGAATTAGAAATTTATCT
TTTGATCAAATACCATTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTATTATTATCATTACCTGTTTTAGCAGGTGCTATTACCATATTATTAACAGATCGAAATTTAAATACAT
CATTTTTTGACCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT
Type material. Holotype: co deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida
Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 35, bears five labels: four
white | GUYANA: ESSEQUIBO | Mt. Wokomung, 3500 ft. | XI ,1993; S. Fratello |, [ Genit. Vial No. |
SRS-4628 |, [ Allyn Museum | Acc. 1994-5 ], [DNA sample ID: | NVG-15043F10 | c/o Nick V.
Grishin |, and one red [ HOLOTYPE o& | Gorgythion | guyanus Grishin ].
Type locality. Guyana: Essequibo, Mt. Wokomung, elevation 3500 ft.
Etymology. The name is given for the country of the type locality. The name is a masculine adjective.
Distribution. Currently known only for the holotype collected in Guyana.
Pardaleodes murcia (Pl6tz, 1883) is a species distinct
from Pardaleodes incerta (Snellen, 1872)
Genomic analysis reveals that Hesperia murcia SSpigrdslaouos fan DO DSBOSIA IE aoronnIaNa
(Plétz, 1883) (type locality not specified, syntype *Pardleoge ant 7060 kenya aes
sequenced as NVG-21116G06), currently treated as cot are odes cae yte 7108G06)Sierra Liune|1974
a subspecies of Pardaleodes incerta (Snellen, 1872) sap ardaleodes incerta|19067A03|Kenya|1987_
(type locality in Angola), is not monophyletic with it pa patdaleadesmurca ot cert 2111806 tina data
and is sister to the clade of P. incerta (Stoll, 1781) Pardaleodes murcia not Incertali17108608)Congol 188
together with P ar daleodes edip us (Stoll, 1781) (type J neraslendestbuialenizeGbel|icamereanicls a
locality in South Africa) (Fig. 37), genetically OER eee eo
differentiated from them with Fs/Gmin/COI barcode Dee ieee ena te oe
difference of 0.61/0.00/4.6% (30 bp) (P. incerta) and : spar daleodes pusiella (not cotorl| BOSSE 10|Ugendal 1946
0.64/0.00/5.0% (33 bp) (P. edipus). Therefore, we | Fig. 37. The nuclear genome tree (autosomes) of selected
propose that Pardaleodes murcia (Plétz, 1883), stat. Pardaleodes species: P. edipus (violet), P. incerta (blue), ye
; . ee murcia stat. rest. (red), P. tibullus (cyan), P. bule (olive),
rest. is a species distinct from Pardaleodes incerta
(Snellen, 1872). Sequencing a series of specimens
from additional localities in western Africa and comparing them with genomic sequences of P. murcia
syntypes may help in determining the type locality of this species more precisely.
P. sator (green), and P. pusiella stat. rest. (magenta).
Pardaleodes pusiella Mabille, 1877 is a species distinct
from Pardaleodes sator (Westwood, 1852)
Genomic analysis reveals that Pardaleodes pusiella Mabille, 1877 (type locality in Angola), currently
regarded as a subspecies of Pardaleodes sator (Westwood, 1852) (type locality in Guinea), is genetically
differentiated from it at the species level (Fig. 37): e.g., Fst/Gmin/COI barcode difference of 0.62/0.00/
3.2% (21 bp). Therefore, we propose that Pardaleodes pusiella Mabille, 1877, stat. rest. is a species
distinct from Pardaleodes sator (Westwood, 1852).
Semalea malawi Grishin, 2023 is confirmed as a species-level taxon
Genomic sequencing of Hesperiidae from the CAS collection revealed a second confirmed specimen of
Semalea malawi Grishin, 2023 (type locality in Malawi, holotype sequenced as NVG-19043B12), which
is also a male as the holotype but was collected in northeastern Tanzania (Tanga District, Usambara Mts.,
Amani Malaria Station, elevation 300 ft, 6-Jan-1970, M. E. Irwin & E. S. Ross leg., NVG-22108B02,
37
Fig. 38. Semalea malawi Grishin, 2023: a) the holotype and b) a specimen from Tanzania, data in text.
Semalea rega|18073A03|ST|Sierra Leone|old b
Semalea rega|22108B04|Ghana|1973
Semalea rega|21099B07|Liberia|1956
Semalea rega (=evansi)|18087B08|T|Sierra Leone|1906
Semalea rega|21099B06|Liberia|1955
Semalea rega|19043B10|Nigeria|1973
Semalea rega|21099B08|Liberia|1958
Semalea rega (=sierrae)|18073A01|ST|Sierra Leone|old
Semalea rega (=staudingeri)|20125A08|HT|Cameroon|old
Semalea vibius|7765|Cameroon|1987
- Semalea vibius|18096F03|French Congolold
Semalea vibius|SAMN18587799|Uganda
Semalea vibius|18099F02|Uganda|1940
Semalea vibius|21099B04|Rwanda|1957
» Semalea malawi|22108B02|Tanzania|1970
Semalea malawi|19043B12|HT|Malawi|1940
Semalea rega (=evansi)|18087B08|T
qemalea rega (=sierrae)|18073A01|ST
2Semalea rega|21099B07|Liberia|1956
9Semalea rega|21099B06|Liberia|1955
190 Semalea rega|21099B08|Liberia|1958
5,emalea rega|18073A03|ST|Sierra Leone
sgemalea rega|19043B10|Nigeria|1973
ifemalea rega|22108B04|Ghana|1973
Semalea rega (=staudingeri)|20125A08|HT
ape vibius|7765|Cameroon|1987
emalea vibius|18096F03|French Congo
isemalea vibius|SAMN18587799|Uganda
emalea vibius|21099B04|Rwanda|1957
emalea vibius|18099F02|Uganda|1940
oo 2emalea malawi|22108B02|Tanzania|1970
Semalea malawi|19043B12|HT|Malawi|1940
Semalea rega|18073A03|ST|Sierra Leone|old Cc
Semalea rega (=evansi)|18087B08|T|Sierra Leone|1906
Semalea rega|19043B10|Nigeria|1973
Semalea rega|21099B06|Liberia|1955
Semalea rega|21099B07|Liberia|1956
Semalea rega (=sierrae)|18073A01|ST|Sierra Leone|old
Semalea rega|21099B08|Liberia|1958
; Semalea rega|22108B04|Ghana|1973
Semalea rega (=staudingeri)|20125A08|HT|Cameroonjold
Semalea vibius|18096F03|French Congolold
Semalea vibius|7765|Cameroon|1987
Semalea vibius|18099F02|Uganda|1940
Semalea vibius|21099B04|Rwanda|1957
> Semalea malawi|22108B02|Tanzania|1970
core emalea malawi|19043B12|HT|Malawi|1940
0.006 0. —— 0.009
Fig. 39. Phylogenetic trees of selected Semalea species inferred from protein-coding regions of a) the nuclear genome
(autosomes), b) the Z chromosome, and c) the mitochondrial genome. Different species are shown in different colors: S. rega
(violet), S. vibius (blue), and S. malawi (red). The sequence of SAMN18587799 is taken from the alignment provided in
Kawahara et al. (2023).
CASENT 8568645) (Figs. 38b, 39). Compared to the holotype (Fig. 38a), it is yellower in the hue of paler
scales (forewing patch, ventral overscaling, palpi, and cheeks), with a slightly shorter forewing orange
patch, and has a small orange subapical spot on the forewing, more expressed on the ventral side (Fig.
39b). The COI barcode sequence of this specimen (GenBank OR837735) matches all 7 diagnostic
characters given in the original description (Zhang et al. 2023b) but differs by 5 bp from the holotype.
With this additional specimen, we carried out Fst/Gmin test to obtain the values 0.34/0.000 (with S. vibius
(Hewitson, 1878)) and 0.55/0.000 (with S. rega (Mabille, 1889)) confirming S. malawi as a species.
38
Limochores mystic nino Grishin, new subspecies
http://zoobank.org/E1AE8324-1FFE-4A 14-916D-8BCC85B96105
(Figs. 40 part, 41)
Definition and diagnosis. Genomic sequencing of specimens from the southwesternmost population of
Limochores mystic (W. H. Edwards, 1863) (type locality in USA: NY, Greene Co., Huner) reveals that
they are sister to all other subspecies of L. mystic in the tree inferred from the nuclear genome (autosomes
only) (Fig. 40a), although they fall among other L. mystic populations in the Z chromosome (not shown)
and mitogenome trees (Fig. 40b), and their COI barcodes differ only due to variation. Therefore, this
population is likely conspecific with L. mystic; however, being most divergent from all others, it
represents a separate and new subspecies. In its duller look with more diffuse boundaries between brown
ground color and yellow-orange spots, this subspecies is most similar to Limochores mystic dacotah (W.
Limochores mystic mystic|18042E01|USA:NH,Grafton Co.|2001
97 Limochores mystic mystic|]18042E03|USA:NH,Grafton Co.|2001
Limochores mystic dacotah|PAO133|USA:WY,Goshen Co.|2016
Limochores mystic mystic|18042G01|F|USA:WI,Dunn Co.|2016
gh eka mystic dacotah (=pallida)|15095H03|ST|USA:SD, Brookings Co. |old
Limochores mystic mystic|15098A06|NT|USA:NY,Greene Co.|old
(| imochores mystic nino|22102C07|HT|USA:AZ,Coconino Co.|1988
Limochores mystic nino|22102C08|PT|USA:AZ,Coconino Co.|1988
Limochores mystic dacotah|15098A12|HT|USA:CO,Clear Creek Co.|old
mochores mystic dacotah|PAO149|USA:CO, Jefferson Co.|2016
Limochores sonora utahensis]20063C12|USA:CO,Grand Co.|1995
g,imochores sonora siris|21048H11|USA:WA, Thurston Co.|1993
Limochores sonora siris]21048H12|USA:WA, Thurston Co.|1994
,4imochores sonora flavaventris|15038B08|HT|USA:NV,Humboldt Co.|1987
43 Limochores sonora flavaventris|22076H10|PT|USA:NV,Humboldt Co.|1987
, Limochores sonora utahensis|9320|USA:WY,Park Co.|2017
* Limochores sonora sonora|21089G06|USA:CA, Siskiyou/Trinity Co.|2021
Limochores sonora sonora|PAO447|USA:CA, Sierra Co.|2017
‘°? Limochores sonora longinqua|15038B07|HT|USA:NV,Esmeralda Co.|1979
Limochores sonora longinqua|PAO521|USA:NV,Esmeralda Co.|2017
Limochores mystic mystic|18042G01|F|USA:WI,Dunn Co.|2016 b
Limochores mystic mystic|15098A06|NT|USA:NY,Greene Co.|old
Limochores mystic dacotah|PAO133|USA:WY,Goshen Co.|2016
Limochores mystic mystic|18042E03|USA:NH,Grafton Co.|2001
Limochores mystic mystic|18042E01|USA:NH,Grafton Co.|2001
Limochores mystic dacotah|PAO149|USA:CO, Jefferson Co.|2016
Limochores mystic dacotah|15098A12|HT|USA:CO,Clear Creek Co.|old
Limochores m. dacotah (=pallida)|15095H03|ST|USA:SD, Brookings Co.|old
Limochores mystic nino|22102C07|HT|USA:AZ,Coconino Co.|1988
Limochores mystic nino|22102C08|PT|USA:AZ,Coconino Co.|1988
Limochores sonora siris]21048H11|USA:WA, Thurston Co.|1993
Limochores sonora siris|21048H12|USA:WA, Thurston Co.|1994
Limochores sonora sonora|21089G06|USA:CA, Siskiyou/Trinity Co.|2021
Limochores sonora sonora|PAO447|USA:CA, Sierra Co.|2017
Limochores sonora flavaventris|15038B08|HT|USA:NV,Humboldt Co.|1987
Limochores sonora flavaventris|22076H10|PT|USA:NV,Humboldt Co.|1987
Limochores sonora longinqua|15038B07|HT|USA:NV,Esmeralda Co.|1979
Limochores sonora longinqua|PAO521|USA:NV,Esmeralda Co.|2017
Limochores sonora utahensis|9320|USA:WY,Park Co.|2017
Limochores sonora utahensis|20063C12|USA:CO,Grand Co.|1995
0.005
0.003
Fig. 40. Phylogenetic trees of Limochores mystic (blue, with L. mystic dacotah in cyan and L. mystic nino ssp. n. in magenta)
and Limochores sonora (black, with L. sonora utahensis in violet color) inferred from protein-coding regions of a) the nuclear
(autosomes) and b) the mitochondrial genomes.
Fig. 41. Limochores mystic nino ssp. n. in dorsal (left) and ventral (right) views, data in text: a) holotype c& and b) paratype &.
39
H. Edwards, 1871) (type locality in USA: Colorado, Clear Creek Co.) and differs from it by the following
characters. Males have reduced orange scaling, spots and bands are narrower, e.g., the orange on the
dorsal hindwing is reduced to a band approximately the same width as the brown margin, and the band is
separated from the orange discal cell by a brownish belt. Both sexes have darker ventral sides of wings.
Due to extensive phenotypic variation, definitive identification is provided by DNA, and a combination of
the following characters is diagnostic in the nuclear genome: aly499.49.4:G66C, aly848.2.19:TS1C, aly838.
7.2:C48T, aly838.7.2:T63C, aly1838.42.3:C34T.
Barcode sequence of the holotype. Sample NVG-22102C07, GenBank OR837736, 658 base pairs:
AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT
ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGAT TAGTACCATTAATACTAGGAGCTCCTGATATAGCTTTCCCTCGAA
TAAATAATATAAGATTTTGAATATTACCACCTTCACTAACATTGTTAATTTCAAGAAGAATTGTAGAGAATGGTGCAGGAACAGGTTGAACAGTTTACCCACCTTTATCTTCTAATATTGC
ACATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCCGGAATTTCTTCTATTTTAGGAGCTATTAATTTTAT TACAACAATTAT TAATATACGAATTAAAAATTTATCA
TTTGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCTTTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTACTTACAGATCGAAATTTAAATACTT
CATTTTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT
Type material. Holotype: ¢& deposited the California Academy of Sciences, San Francisco, CA, USA
[CAS], illustrated in Fig. 41a, bears seven printed (text in italics handwritten) labels: six white [ Circle
Bar Draw at | Tillman Ranch, 7100' | Coconino Co. AZ |, [ 9 June 1988 | collected by Kilian Roever ],
| COLLECTION OF | C. D. MacNeill ], [ Polites mystic | ssp. nov. | Det.C.D.MacNeill '98 |, [| DNA
sample ID: | NVG-22102C07 | c/o Nick V. Grishin ], [ {QR Code} CASENT | 8566979 |, and one red
[ HOLOTYPE ¢& | Limochores mystic | nino Grishin ]. Paratype: 12° same data as the holotype (NVG-
22102C08, CASENT 8566980, Fig. 41b) [CAS].
Type locality. USA: Arizona, Coconino Co., Circle Bar Draw at Tillman Ranch, 7100".
Etymology. The name is formed from the name of the county of the type locality [Coco]nino and is a
noun in apposition.
Distribution. Only known from central Arizona, USA. Populations in southwestern Colorado should be
studied to determine their taxonomic identity.
Hesperia pahaska Leussler, 1938 populations in most of New Mexico and the White
Mountains, Arizona are the nominal subspecies, not H. p. williamsi Lindsey, 1940
Genomic trees of Hesperia pahaska Leussler, 1938 (type locality in USA: Nebraska, Sioux Co.) reveal
that a specimen from southeastern New Mexico (Lincoln Co., NVG-22057C03) and specimens from the
White Mountains in Arizona are not in the same clade with Hesperia pahaska williamsi Lindsey, 1940
(type locality in USA: Arizona, Pima Co. Baboquivari Mts., holotype sequenced as NVG-15096B10), a
subspecies they were usually attributed to, but are within specimens of the nominal H. pahaska (Fig. 42).
Therefore, we deduce that populations in most of New Mexico and eastern Arizona are H. pahaska
pahaska, while the specimens from southwestern New Mexico remain to be studied.
Hesperia pahaska hannawackeri Grishin, new subspecies
http://zoobank.org/FC3A2704-0C47-4FEC-8476-2947275E52FD
(Figs. 42 part, 43)
Definition and diagnosis. Populations of Hesperia pahaska Leussler, 1938 (type locality in USA:
Nebraska, Sioux Co.) from southeastern Utah and southwestern Colorado are usually included in
Hesperia pahaska martini MacNeill, 1964 (type locality USA: California, San Bernardino Co., 4.5 mi SE
of Ivanpah). However, they form a distinct clade in the Z chromosome tree and possess a distinct
mitochondrial genome haplotype (Fig. 42 red), representing distinct subspecies. This new subspecies
differs from H. p. martini in better outlined and contrasting with fulvous ground color brown outer
margins, smaller forewing subapical spots, and usually smaller ventral hindwing white spots; from the
nominal Hesperia pahaska by less contrasting with the fulvous colors subapical and submarginal dorsal
forewing spots, which are typically paler in H. p. pahaska, and usually more extensive fulvous areas
penetrating fuscous margins in females on wings above (more similar to H. p. williamsi in this aspect) and
40
Hesperia leonardus leonardus|20067A08|USA:PA,Dauphin Co.|1976
os,esperia leonardus montana|17116D02|USA:CO, Jefferson Co.|1987
Hesperia leonardus pawnee|20067B01|USA:SD,Day Co.|1967
hips pers pahaska pahaska|21048F08|USA:NE, Sioux Co.|1986
. esperia pahaska pahaska|22047D11|PT|USA:NE,Sioux Co.|1917
Hesperia pahaska pahaska|22057C03|USA:NM, Lincoln Co.|2020
7Alesperia pahaska pahaska|22063G11|USA:AZ,Apache Co.|2020
esperia pahaska pahaska|11294|USA:NM,Santa Fe Co.|2018
esperia pahaska pahaska|11633|USA:AZ,Greenlee Co.|2018
Hesperia pahaska hannawackeri|20045F06|HT|USA:UT,San Juan Co.|2016
ee pahaska hannawackeri|20045F05|PT|USA:UT,San Juan Co.|2020
esperia pahaska hannawackeri|22055G10|PT|USA:CO, Delta Co.|1983
édesperia pahaska hannawackeri|22055G09|PT|USA:CO,Mesa Co.|2007
Lot bate pahaska hannawackeri|22055G08|PT|USA:CO,Mesa Co.|2007
speria pahaska hannawackeri|22055G12|PT|USA:CO,Montrose Co.|2016
Hesperia pahaska hannawackeri|22055G11|PT|USA:CO,Montrose Co.|2016
Hesperia pahaska hannawackeri|PAO566|PT|USA:CO,Mesa Co.|2017
Hesperia pahaska williamsi]11128|USA:TX,Jeff Davis Co.|2018
Heepere pahaska williamsi]20067B04|Mexico:Son|2003
esperia pahaska williamsi|20067B02|Mexico:Son|2004
Hecpcns pahaska williamsi]20067B03|Mexico:Son|1998
esperia pahaska williamsi|8279|USA:AZ,Pinal Co.|2017
Hesperia pahaska williamsi|15096B10|HT|USA:AZ,Pima Co.|1923
speria pahaska martini|20067B05|USA:CA, San Bernardino Co.|1959
esperia pahaska martini|21048F11|USA:CA,San Bernardino Co.|1978
esperia pahaska martini|15105D04|HT|USA:CA,San Bernardino Co.|1955
esperia pahaska martini]21048F12|USA:CA,San Bernardino Co.|1981
Hesperia pahaska martini|21048G01|USA:CA,San Bernardino Co.|1978
yob!esperia columbia|PAO38|USA:CA,Monterey Co.|2016
Hesperia columbia|PAO368|USA:CA,Colusa Co.|2017
Hesperia ottoe|22058B12|USA:IL,Winnebago Co.|1979
Hesperia ottoe|22058C01|USA:TX,Hemphill Co.|2022
Hesperia viridis|22068D06|USA:AZ,Greenlee Co.|198
Hesperia viridis]22055H04|USA:CO, Fremont Co.|1996
700 Hesperia metea licinus|20059A02|USA:TX,Wise Co.|2004
Hesperia metea metea|20062G06|USA:NJ,Ocean Co.|1962
hygsperia attalus attalus|12448|USA:KS, Barber Co.|2019
esperia attalus attalus|22058B08|USA:TX,Hemphill Co.|2022
a 55 Hesperia leonardus leonardus|20067A08|USA:PA,Dauphin Co.|1976 b
00 Hesperia leonardus montana|17116D02|USA:CO,Jefferson Co.|1987 H :
Z chr. Hesperia leonardus pawnee|20067B01|USA:SD,Day Co.|1967 mitochondrial
7 Hesperia pahaska pahaska|11294|USA:NM, Santa Fe Co.|2018
rr Hesperia pahaska pahaska|22057C03|USA:NM, Lincoln Co.|2020
Hesperia pahaska pahaska|21048F08|USA:NE,Sioux Co.|1986
188 Hesperia pahaska pahaska|22047D11|PT|USA:NE,Sioux Co.|1917
Hesperia pahaska pahaska|11633|USA:AZ,Greenlee Co.|2018
Hesperia pahaska pahaska|22063G11|USA:AZ,Apache Co.|2020
Hesperia pahaska hannawackeri|20045F05|PT|USA:UT,San Juan Co.|2020
Hesperia pahaska hannawackeri|22055G12|PT|USA:CO,Montrose Co.|2016
Hesperia pahaska hannawackeri|22055G11|PT|USA:CO,Montrose Co.|2016
Hesperia pahaska hannawackeri|20045F06|HT|USA:UT,San Juan Co.|2016
Hesperia pahaska hannawackeri|22055G08|PT|USA:CO,Mesa Co.|2007
Hesperia pahaska hannawackeri|22055GO9|PT|USA:CO,Mesa Co.|2007
190 Hesperia pahaska hannawackeri|22055G10|PT|USA:CO, Delta Co.|1983
Hesperia pahaska hannawackeri|PAO566|PT|USA:CO,Mesa Co.|2017
Hesperia pahaska williamsi|11128|USA:TX,Jeff Davis Co.|2018
rr Hesperia pahaska williamsi|20067B04|Mexico:Son|2003
Hesperia pahaska williamsi|15096B10|HT|USA:AZ,Pima Co.|1923
Hesperia pahaska martini|20067B05|USA:CA,San Bernardino Co.|1959
70 Hesperia pahaska williamsi|20067B02|Mexico:Son|2004
100 $s- Hesperia pahaska williamsi|8279|USA:AZ,Pinal Co.|2017
Hesperia pahaska williamsi|20067B03|Mexico:Son|1998
Hesperia pahaska martini|15105D04|HT|USA:CA,San Bernardino Co.|1955
Hesperia pahaska martini|21048G01|USA:CA,San Bernardino Co.|1978
Hesperia pahaska martini|21048F12|USA:CA,San Bernardino Co.|1981
Hesperia pahaska martini|21048F11|USA:CA,San Bernardino Co.|1978
Too Hesperia columbia|PAO38|USA:CA,Monterey Co.|2016
Hesperia columbia|PAO368|USA:CA,Colusa Co.|2017
Hesperia viridis|22068D06|USA:AZ,Greenlee Co.|198
Hesperia viridis]22055H04|USA:CO,Fremont Co.|1996
100 500 Hesperia attalus attalus|12448|USA:KS, Barber Co.|2019
Hesperia attalus attalus|22058B08|USA:TX,Hemphill Co.|2022
Hesperia metea licinus|20059A02|USA:TX,Wise Co.|2004
Hesperia metea metea|20062G06|USA:NJ,Ocean Co.|1962
400 Hesperia ottoe|22058B12|USA:IL,Winnebago Co.|1979
nese Hesperia ottoe|22058C01|USA:TX,Hemphill Co.|2022
64
100
124
100
100
Fig. 42. Phylogenetic trees of selected Hesperia species, including H. viridis (green) and H. pahaska with its subspecies H. p.
pahaska (violet), H. p. hannawackeri ssp. n. (red), H. p. williamsi (blue), and H. p. martini (cyan) inferred from protein-coding
regions of a) the Z chromosome and b) the mitochondrial genome.
Fig. 43. Hesperia pahaska hannawackeri ssp. n. in dorsal (above) and ventral (below) views, data in text:
a) holotype & NVG-20045F06 and b) paratype 2 NVG-20045F0S.
from Hesperia pahaska williamsi Lindsey, 1940 (type locality in USA: Arizona, Pima Co., Baboquivari
Mts) by generally larger white ventral hindwing spots. Due to extensive phenotypic variation, definitive
identification is provided by DNA, and a combination of the following characters is diagnostic in the
nuclear genome: aly5021.3.8:C60T, aly7690.1.10:C45A, aly7690.1.10:C204T, aly4196.3.1:C333G, aly4196.
3.1:A415G and in COI barcode: T10C, T19C, G101A, 328C, T646C.
41
Barcode sequence of the holotype. Sample NVG-20045F06, GenBank OR837737, 658 base pairs:
AACTTTATACTTTATTTTCGGTATTTGAGCTGGTATATTAGGAACTTCATTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTT TAAT TGGAAATGACCAAATTTATAATACT
AN
ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTCCCACGTA
Cc
TAAATAATATAAGATTTTGAATATTACCACCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGCTGAACTGTTTATCCTCCTTTATCCTCTAATATTG
TCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCACTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAACTTATCT
TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCAGGAGCTATTACTATACTACTTACTGATCGAAATTTAAATACTT
CTTTTTTCGATCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT
Type material. Holotype: o deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida
Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 43a, bears four printed
labels: two white [ Pack Creek Day Use Area | La Sal Mountains | San Juan Co, UT | 2 June 2016 | Robb
Hannawacker |, [ Pahaska Skipper | male | Hesperia pahaska |], [| DNA sample ID: | NVG-20045F06 | c/o
Nick V. Grishin |, and one red [ HOLOTYPE co | Hesperia pahaska | hannawackeri Grishin |. Paratypes:
Socc 29: USA: 19 Utah, San Juan Co., Poison Canyon, el. 8500', 5-Jun-2020, R. Hannawacker leg.
(NVG-20045F05) (Fig. 43b); Colorado: Mesa Co.: 2c'c' Black Ridge Breaks, West Reef, 7050 ft, 24-25-
May-2007, M. S. Fisher leg. (NVG-22055G08 & NVG-22055G09); and lo BLM lands W of Gateway,
Unaweep Seep Natural Area, 10-Sep-2017, Paul A. Opler and Evi M. Buckner-Opler leg. (PAOQ566); 1c
Delta Co., 4.6-7.3 mi. SE of Austin, 6000-6600 ft, 12-Jun-1983, M. S. Fisher leg. (NVG-22055G10); Io
12 Montrose Co., Gunnison Gorge NWA, Wave-Eagle Trail Loop, 6000-6300 ft, 1- and 3-Jun-2016, M.
S. Fisher leg. (NVG-22055G11 & NVG-22055G12).
Type locality. USA: Utah, San Juan Co., La Sal Mountains, Pack Creek Picnic Area.
Etymology. The name honors Robb Hannawacker, the collector of the holotype and a female paratype
from Utah. Robb is a dedicated Lepidopterist and the author of the book on the butterflies of southeastern
Utah. He helped our lab tremendously with genomic studies of butterflies from his region (southeastern
Utah) by collecting specimens and connecting us with others who can help further. The name is a
masculine noun in the genitive case.
Distribution. Southeastern Utah and southwestern Colorado in the USA.
Pseudocopaeodes eunus ash Grishin, new subspecies
http://zoobank. org/9EB3 AEE9-E29D-4684-9A7D-lLEB65A9C6FB5
(Figs. 44 part, 45a)
Definition and diagnosis. Genomic sequencing of Pseudocopaeodes eunus (W. H. Edwards, 1881) (type
locality USA: Kern Co., the bottoms of Kern River, near Bakersfield) populations reveals that specimens
from the Ash Meadows area in southern Nevada are not monophyletic with Pseudocopaeodes eunus
alinea J. Scott, 1981 (type locality in USA: California, San Bernardino Co., Afton Canyon) despite the
similarity in being less marked than other populations, and form a distinct clade with genetic
differentiation larger than for some other P. eunus subspecies (Fig. 44), e.g., their COI barcodes differ by
1.1% (7 bp). Therefore, the Ash Meadows population represents a new subspecies. This subspecies is
most similar to P. e. alinea in appearance and differs from it in having less conspicuous and thinner
Pseudocopaeodes eunus obscurus|21036E07|HT|USA:NV,Carson City|1982 b
Pseudocopaeodes eunus obscurus|21036E08|AT|USA:NV,Carson City|1982
Pseudocopaeodes eunus flavus|21036E05|HT|USA:NV,Churchill Co.|1984
Pseudocopaeodes eunus flavus|21036E06|AT|USA:NV,Churchill Co.|1984
Pseudocopaeodes eunus eunus|PAO663|USA:CA,Inyo Co.|2018
--— Pseudocopaeodes eunus eunus|8050|USA:CA, Inyo Co.|1950
Pseudocopaeodes eunus eunus|20063H02|USA:CA, Inyo Co.|2006
Pseudocopaeodes eunus eunus|20063H01|USA:CA, Inyo Co.|2014
Pseudocopaeodes eunus eunus|21049E04|USA:CA, Kern Co.|1996
Pseudocopaeodes eunus eunus|21049E03|USA:CA,Kern Co.|2002
Pseudocopaeodes eunus eunus|21049E05|USA:CA,San Diego Co.|1976
Pseudocopaeodes eunus eunus (=wrightii)|15097HO2|LT|USA:CA,San Bernardino Co.|old
Pseudocopaeodes eunus alinea|22094B03|PT|USA:CA,San Bernardino Co.|1965
Pseudocopaeodes eunus alinea|22094B02|PT|USA:CA,San Bernardino Co.|1965
Pseudocopaeodes eunus alinea|22094B04|PT|USA:CA,San Bernardino Co.|1961
Pseudocopaeodes eunus obscurus|21036E07|HT|USA:NV,Carson City|1982
ifseudocopaeodes eunus obscurus|21036E08|AT|USA:NV,Carson City|1982
9g Seudocopaeodes eunus flavus|21036E06|AT|USA:NV,Churchill Co.|1984
Pseudocopaeodes eunus flavus|21036E05|HT|USA:NV,Churchill Co.|1984
Pseudocopaeodes eunus eunus|21049E05|USA:CA,San Diego Co.|1976
Rseudocopaeodes eunus eunus|21049E04|USA:CA, Kern Co.|1996
seudocopaeodes eunus eunus|21049E03|USA:CA,Kern Co.|2002
fseudocopaeodes eunus alinea|22094B03|PT|USA:CA,San Bernardino Co.|1965
s4 Pseudocopaeodes eunus eunus (=wrightii)|15097HO2|LT|USA:CA,San Bernardino Co.|old
sf seudocopaeodes eunus eunus|20063H02|USA:CA, Inyo Co.|2006
‘Pseudocopaeodes eunus eunus|PAO663|USA:CA, Inyo Co.|2018
Pseudocopaeodes eunus eunus|8050|USA:CA, Inyo Co.|1950
Pseudocopaeodes eunus eunus|20063H01|USA:CA, Inyo Co.|2014
oPseudocopaeodes eunus alinea|22094B02|PT|USA:CA,San Bernardino Co.|1965
Rseudocopaeodes eunus alinea |22094B01|PT|USA:CA,San Bernardino Co.|1965
Pseudocopaeodes eunus alinea |19061F04|HT|USA:CA,San Bernardino Co.|1965
Pseudocopaeodes eunus alinea|22094B04|PT|USA:CA,San Bernardino Co.|1961
spseudocopaeodes eunus ash [not alinea]|21049E07|HT|USA:NV,Nye Co.|1988
Pseudocopaeodes eunus ash [not alinea]|20063G12|PT|USA:NV,Nye Co.|1984
Pseudocopaeodes eunus ash [not alinea]|21049E06|PT|USA:NV,Nye Co.|1989 "eiaalaal) eae eunus ash [not alinea]|22076FO5|PT|USA:NV,Nye Co.|1987
Pseudocopaeodes eunus ash [not alinea]|20063G12|PT|USA:NV,Nye Co.|1984 seudocopaeodes eunus ash [not alinea]|22076F04|PT|USA:NV,Nye Co.|1987
0.006 Pseudocopaeodes eunus ash [not alinea]|22076F04|PT|USA:NV,Nye Co.|1987 002 | Pseudocopaeodes eunus ash [not alinea]|21049E06|PT|USA:NV,Nye Co.|1989
Pseudocopaeodes eunus alinea|22094B01|PT|USA:CA,San Bernardino Co.|1965
Pseudocopaeodes eunus alinea|19061F04|HT|USA:CA,San Bernardino Co.|1965
Pseudocopaeodes eunus ash [not alinea]|21049E07|HT|USA:NV,Nye Co.|1988
Pseudocopaeodes eunus ash [not alinea]|22076F05|PT|USA:NV,Nye Co.|1987
Fig. 44. Phylogenetic trees of Pseudocopaeodes eunus inferred from protein-coding regions of a) the nuclear genome
(autosomes) and b) the mitochondrial genome. Different subspecies are shown in different colors: P. e. obscurus (violet), P. e.
flavus (green), P. e. eunus (blue), P. e. alinea (cyan), and P. e. ash ssp. n. (red). One tree branch was truncated at dots.
42
stigma and by being paler and whiter on the ventral side of wings (Fig. 45a) instead of yellower in color.
In particular, palpi beneath, cheeks, area by ventral forewing costa at the wing base, forewing apex, and
hindwing overall are whiter (and wing venter redder) than in P. e. alinea, which is yellower (Fig. 45b).
Dorsal hindwing by the apex is usually less dark, and dark scales by the costa are confined mostly to the
base. Definitive identification is provided by DNA, and a combination of the following characters is
diagnostic in the nuclear genome: aly1022.2.1:G558A, aly1781.2.2:C384T, aly1781.2.2:G444A, aly4645.18.
2:C183T, aly4645.18.2:T213A and in COI barcode can be distinguished from other subspecies, except
Pseudocopaeodes eunus obscurus Austin & J. Emmel, 1998 (type locality in USA: Nevada, Carson City):
A214A, T220C, A484A, T514T, 604C.
Barcode sequence of the holotype. Sample NVG-21049E06, GenBank OR837738, 658 base pairs:
AACTTTATATTTTATTTTTGGTATCTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATAGT
ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCAGATATAGCTTTCCCACGAA
TAAATAATATAAGATTTTGAATATTACCCCCATCATTAATATTATTAATCTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGTTGAACTGTTTATCCTCCTTTATCTTCTAATATTGC
TCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCA
TTTGACCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCTTTATTATTATTATTATCTTTACCTGTATTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACCT
CTTTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: & deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida
Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 45a, bears four labels, 1%
handprinted others printed: three white [ASH MEADOWS | NYE CO. NEV. | 2 SEPT. 1989 |
LEG:P.SAVAGE ], [ P Savage colln. | MGCL Acc. | 2006-15 |, [ DNA sample ID: | NVG-21049E06 | c/o
Nick V. Grishin ], and one red [ HOLOTYPE co | Pseudocopaeodes | eunus ash Grishin |. Paratypes:
20h 292 same locality as the holotype: 2ch'ch' 6-Sep-1987, P. Savage colln. (NVG-22076F04 and NVG-
22076F05) [MGCL], 12 7-Sep-1988, P. Savage leg. (NVG-21049E07) [MGCL], and 19 12-Aug-1984 G.
T. Austin leg. (NVG-20063G12, CSU_ENT1028906) [CSUC].
Fig. 45. Holotypes of Pseudocopaeodes: a) P. eunus ash ssp. n. (data in text) and b) P. eunus alinea NVG-19061F04 USA:
CA, San Bernardino Co., Afton Canyon, 9-Sep-1965, Oakley Shields leg. [LACM] in dorsal (left) and ventral (right) views.
43
Type locality. USA: Nevada, Nye Co., Ash Meadows.
Etymology. The name is given for the type locality and the ashier appearance: paler, whiter, ventrally
dusted with white compared to other subspecies. The name is treated as a masculine noun in apposition.
Distribution. Southern Nevada; known only from the Ash Meadows area.
Comments. First, we note that where P. eunus is double-brooded, the two broods differ in appearance.
The first one produces darker specimens with broader dark-framed veins and more conspicuous two pale
rays of the ventral hindwing, thus having a classical P. eunus appearance. The second brood produces
paler specimens. Therefore, wing patterns within the broods should be compared between populations to
reach meaningful conclusions. Second, we see that genetic differentiation between the two subspecies
Pseudocopaeodes eunus obscurus Austin & J. Emmel, 1998 (type locality in USA: Nevada, Carson City)
and Pseudocopaeodes eunus flavus Austin & J. Emmel, 1998 (type locality in USA: Nevada, Churchill
Co.) is limited compared to others (Fig. 44), suggesting that they are not particularly distinct from each
other, despite their phenotypic difference in wing patterns. Thus, wing patterns can differ with very few
genetic changes. Third, we observe the genetic similarity between the lectotype of Copaeodes wrightii W.
H. Edwards, 1882 (type locality USA: California, San Bernardino Co., nr. Victorville) currently treated as
a junior subjective synonym of the nominal P. eunus and the type series of Pseudocopaeodes eunus alinea
J. Scott, 1981 (type locality USA: California, San Bernardino Co., Afton Canyon) (Fig. 44). While
additional analyses are required, it may be that C. wrightii is not a synonym of P. e. eunus, but instead is a
valid subspecies and the same taxon as P. e. alinea, with the latter being its junior subjective synonym.
Pamphila milo W. H. Edwards, 1883 is a junior subjective synonym
of Ochlodes agricola verus (W. H. Edwards, 1881)
The holotype of Pamphila milo W. H. Edwards, 1883 was stated to be from “Mt. Hood, Oregon”, and
later from Thurston Co., Washington, where this species is not known to occur (Pelham 2008; Pelham
2023). Genomic analysis of the holotype (NVG-15036C12) places it within specimens of Ochlodes
agricola verus (W. H. Edwards, 1881) (type locality USA: California, Kern Co., Havilah) from Kern Co.,
California that include the lectotype of the latter
Ochlodes agricola agricola|20063F05|Mexico:BC|1970
Ochlodes agricola agricola|20063F06|Mexico:BC|1970
(NVG-15096F09) (Fig. 46). Therefore, we propose
that Pamphila milo W. H. Edwards, 1883 is a junior
subjective synonym of Ochlodes agricola verus (W.
H. Edwards, 1881), and not of Ochlodes agricola
nemorum (Boisduval, 1852) (type locality in USA:
California, Plumas Co.) as currently treated. While
sequencing of additional specimens of Ochlodes
agricola (Boisduval, 1852) (type locality in USA:
California, Marin Co.) for population analysis is
needed for confident conclusions, our phylogenetic
Ochlodes a. agricola (=yreka)|15098B03|HT|USA:CA,S.Fran. Co.|old
Ochlodes agricola agricola|PAO338|USA:CA, Stanislaus Co.|2017
Ochlodes agricola agricola|20063E12|USA:CA, Stanislaus Co.|1970
Ochlodes agricola agricola|PAO339|USA:CA, Stanislaus Co.|2017
Ochlodes agricola agricola|20063E09|USA:CA,San Benito Co.|2006
Ochlodes agricola agricola|20063E11|USA:CA,Monterey Co.|2003
Ochlodes agricola agricola|20063E08|USA:CA,Sonoma Co.|2013
Ochlodes agricola agricola|PAO401|USA:CA,Sonoma Co.|2017
Ochlodes agricola agricola|20063E10|USA:CA,Mendocino Co.|2013
Ochlodes agricola nemorum|20063F02|USA:CA,Sierra Co.|2005
Ochlodes agricola nemorum|21049B06|USA:CA,Plumas Co.|1997
Ochlodes agricola nemorum|21049B07|USA:CA, Shasta Co.|2002
Ochlodes agricola nemorum|PAO23|USA:CA, Sierra Co.|2016
Ochlodes agricola verus|20063F01|USA:CA, Tulare Co. bead,
Ochlodes agricola verus|20063F03|USA:CA, Tulare Co.|20
Ochlodes agricola verus (=milo) [not fanoranit soaeBUN HOSES
Ochlodes agricola verus|20063D01|USA:CA,Kern Co.|2005
Ochlodes agricola verus|15096FO09|LT|USA:CA, Kern Co.|old
Ochlodes agricola verus|20063F04|USA:CA,Kern Co.|2006
. The nuclear genome tree (autosomes) of Ochlodes
analysis tentatively suggests that the type locality of | agricola subspecies: O. a. agricola (blue), O. a. nemorum
P. milo might have been in Kern Co., California, (green), Menu ores i ce a
possibly even “Havilah”’, together with O. a. verus. ee - nmi
Hesperia amanda P\é6tz, 1883 is a nomen dubium
Suggested as a probable variation of Hesperia ottoe W. H. Edwards, 1866 (type locality in USA: Kansas)
by Godman (1907) and placed as a junior subjective synonym of Ochlodes sylvanoides napa (W. H.
Edwards, 1865) (type locality in USA: Colorado, Clear Creek Co.) by Evans (1955), Hesperia amanda
Pl6tz, 1883 (type locality not stated and unknown) was described in an identification key from at least one
male with a forewing length of 13 mm (Plétz 1883). Relevant parts of the key are translated and
combined here as: “Upperside reddish-yellow. Forewing with a diagonal, wide, dark brown stigma that
44
starts broad in cell 1 and narrows in cell 3, and a
brown longitudinal spot in cell 5. Forewing margin
widely brown. Hindwing margin less _ wide,
especially on the inner margin, narrow and pale
brown. Hindwing underside reddish-yellow with a
faded yellow band”. Published on plate 180 (row 1,
images 4 and 5 from the left) illustration of H.
amanda in Draudt (1921-1924) (Fig. 47) is,
according to our reading of Evans (1955), paler than
inspected by Evans copy of Plétz’s original drawing U
tlafel]. 617. Indeed, Draudt’s illustration agrees well : $ | |
with the original description and likely reflects the | _ an 4. 2 a mand:
appearance of this species. In our opinion, H. amanda
amanda is conspecific neither with H. ottoe nor with | Fig. 47. Hesperia amanda trom pl. 1801 [4, 5] in Draudt
O. s. napa largely because the stigma in H. amanda (1921-1924), a paler copy of Pl6tz’s unpublished drawing.
extends into cell 3 (1.e., M3-CuA1), forewing brown streak distad of the discal cell is confined to the cell 5
(i.e., Mi-Mz2), and the inner margin of dorsal hindwing is only narrowly brown, with a paler-brown outer
margin by the tornus. These characters do not match the former two species. The stigma reaches into cell
3 in many Indo-Australian Hesperiidae, but we are not able to associate H. amanda with any species
known to us. Therefore, we propose to treat this name as nomen dubium, pending further research.
|
Ochlodes napa (W. H. Edwards, 1865) and Ochlodes santacruza J. Scott, 1981
are Species distinct from Ochlodes sylvanoides (Boisduval, 1852)
Genomic analysis of specimens identified as Ochlodes sylvanoides (Boisduval, 1852) (type locality in
USA: California, Plumas Co.) reveals their partitioning into three prominent clades genetically
differentiated at the level typical for distinct species (Fig. 48 green, red with magenta, and blue). The first
clade (Fig. 48 green) corresponds to populations from the Islands of the California coast: Santa Cruz
Island and Santa Catalina Island. The senior name for these populations is Ochlodes sylvanoides
santacruza J. Scott, 1981 (type locality USA: California, Santa Barbara Co., Santa Cruz Island). The
second clade (Fig. 48 red and magenta, two clades in mitochondrial genome tree Fig. 48b, likely due to
introgression) includes populations from the eastern part of the range (Colorado, southeastern Utah, and
Arizona) and is currently represented by one name, Ochlodes sylvanoides napa (W. H. Edwards, 1865)
a Ochlodes santacruza santacruza [not sylvanoides]|22038H08|PT|CA,Santa Cruz Is.|1967 b mito Ochlodes santacruza santacruza [not sylvanoides]|22038H08|PT|CA, Santa Cruz Is.
Ochlodes santacruza santacruza [not sylvanoides]|22097HO5|PT|CA, Santa Cruz Is.|1979 ,Qchlodes santacruza santacruza [not sylvanoides]|22097H11|CA, Santa Cruz Is.|1978
nuclear
Ochlodes santacruza santacruza [not sylvanoides]|22097HO6|PT|CA, Santa Cruz Is.|1979
Ochlodes santacruza santacruza [not sylvanoides]|22097H08|CA, Santa Cruz Is.|1978
Ochlodes santacruza santacruza [not sylvanoides]|22097H11|CA,Santa Cruz Is.|1978
Ochlodes santacruza santacruza [not sylvanoides]|22097H04|PT|CA,Santa Cruz Is.|1979
Ochlodes santacruza catalina [not sylvanoides]|19061E07|HT|CA,Santa Catalina Is.|1981
Ochlodes santacruza catalina [not sylvanoides]|21049C05|CA, Santa Catalina Is.|1940
Ochlodes santacruza catalina [not sylvanoides]|22097H01|CA,Santa Catalina Is.|1981
Ochlodes santacruza catalina [not sylvanoides]|22076F12|PT|CA, Santa Catalina Is.]1970
Ochlodes santacruza catalina [not sylvanoides]|22098A01|PT|CA,Santa Catalina Is.|1981
Ochlodes santacruza catalina [not sylvanoides]|19061E08|AT|CA,Sta Cat. Is.|1981
Ochlodes santacruza catalina [not sylvanoides]|22076F11|PT|CA,Santa Catalina Is.|1978
Ochlodes napa napa [not sylvanoides]|PAO263|USA:CO,Larimer Co.|2016
Ochlodes napa napa [not sylvanoides]|15098B02|NT|CO,Clear Creek Co.|old
Ochlodes napa napa [not sylvanoides]|20045F10|USA:UT,San Juan Co.|2020
Ochlodes napa napa [not sylvanoides]|20045FO9|USA:UT,Grand Co.|2016
Ochlodes napa kaibab|21113C07|HT|USA:AZ,Coconino Co.|2021
Ochlodes napa kaibab|21113C06|PT|USA:AZ,Coconino Co.|2021
Ochlodes sylvanoides sylvanoides|20063G05|USA:CA, Tulare Co.|2012
Ochlodes sylvanoides sylvanoides|PAO931|USA:CA,Plumas Co.|2019
Ochlodes sylvanoides sylvanoides|20063G07|USA:CA, Santa Clara Co.|1970
Ochlodes sylvanoides bonnevilla|22076G04|USA:NV,Elko Co.|1998
Ochlodes sylvanoides sylvanoides|22094E01|USA:CA,Santa Cruz Co.|2001
Ochlodes sylvanoides sylvanoides|22101H06|USA:CA,Santa Cruz Co.|1982
Ochlodes sylvanoides sylvanoides|22094D11|USA:CA, Santa Cruz Co.|2001
Ochlodes sylvanoides orecoasta|21049C01|USA:OR,Clatsop Co.|1993
Ochlodes sylvanoides orecoasta|21049B12|USA:OR,Clatsop Co.|1993
Ochlodes sylvanoides orecoasta|19061E06|HT|USA:OR,Clatsop Co.|1966
Ochlodes sylvanoides omnigena|21049C03|USA:NV,Lander Co.|1998
chlodes santacruza santacruza [not sylvanoides]|22097H04|PT|CA,Santa Cruz Is.
2x Ochlodes santacruza santacruza[not sylvanoides]|22097H06|PT|CA, Santa Cruz Is.
Qchlodes santacruza santacruza [not sylvanoides]|22097H05|PT|CA, Santa Cruz Is.
Ochlodes santacruza santacruza [not sylvanoides]|22097H08|CA, Santa Cruz Is.|1978
Ochlodes santacruza catalina [not sylvanoides]|22076F11|PT|CA,Santa Catalina Is.
Ochlodes santacruza catalina [not sylvanoides]|22076F12|PT|CA,Santa Catalina Is.
Ochlodes santacruza catalina[not sylvanoides]|19061E08|AT|CA,Sta Cat. Is.
\fichlodes santacruza catalina (not sylvanoides}|22098A01|PT|CA, Santa Catalina Is.
chlodes santacruza catalina [not sylvanoides]|19061E07|HT|CA,Santa Catalina Is.
Ochlodes santacruza catalina [not sylvanoides]|21049C05|CA, Santa Catalina Is.|1940
Ochlodes santacruza catalina [not sylvanoides]|22097H01|CA,Santa Catalina Is.|1981
<Qchlodes napa napa [not sylvanoides]|20045F09|USA:UT,Grand Co.|2016
iQchlodes napa napa [not sylvanoides]|20045F 10|USA:UT,San Juan Co.|2020
ape oges napa napa [not sylvanoides]|PAO263|USA:CO,Larimer Co.|2016
chlodes napa napa [not sylvanoides]|15098B02|NT|CO,Clear Creek Co.|old
Qghlodes napa kaibab|21113C07|HT|USA:AZ,Coconino Co.|2021
Ochlodes napa kaibab|21113C06|PT|USA:AZ,Coconino Co.|2021
Ochlodes sylvanoides sylvanoides|PAO931|USA:CA,Plumas Co.|2019
Ochlodes sylvanoides orecoasta|21049B12|USA:OR,Clatsop Co.|1993
'P°Ochlodes sylvanoides orecoasta|19061E06|HT|USA:OR,Clatsop Co.|1966
sk chlodes sylvanoides orecoasta|21049C01|USA:OR,Clatsop Co.|1993
Q¢hlodes sylvanoides sylvanoides|20063G07|USA:CA, Santa Clara Co.|1970
Ochlodes sylvanoides sylvanoides|22094D11|USA:CA,Santa Cruz Co.|2001
enone sylvanoides omnigena|21043CO03|AT|USA:NV,Lander Co.|1978
, Ochlodes sylvanoides omnigena|15038B06|HT|USA:NV,Lander Co.|1978
Qenioces sylvanoides sylvanoides|22094E01|USA:CA,Santa Cruz Co.|2001
chlodes sylvanoides sylvanoides|22101H06|USA:CA,Santa Cruz Co.|1982
Ochlodes sylvanoides sylvanoides|20063G05|USA:CA, Tulare Co.|2012
Ochlodes sylvanoides omnigena|15038B06|HT|USA:NV,Lander Co,.|1978 °Ochlodes sylvanoides bonnevilla|22076G04|USA:NV,Elko Co.|1998
Ochlodes sylvanoides sylvanoides (=francisca)|21116A05|ST|"Mexico"|old Ochlodes sylvanoides bonnevilla|19061E04|HT|USA:NV,Elko Co.|1966
Ochlodes sylvanoides omnigena|21043CO3|AT|USA:NV,Lander Co.|1978 [ Ochlodes sylvanoides sylvanoides (=francisca)|21116A05|ST|"Mexico"|old
Ochlodes sylvanoides bonnevilla|22076G03|USA:NV,Elko Co.|1980 sdchlodes sylvanoides bonnevilla|22076G03|USA:NV,Elko Co.|1980
Ochlodes sylvanoides bonnevilla|19061E04|HT|USA:NV,Elko Co.|1966 0.007 Ochlodes sylvanoides omnigena|21049C03|USA:NV,Lander Co.|1998
Fig. 48. Phylogenetic trees of selected Ochlodes species, including O. santacruza (green) and O. napa with its subspecies O. n.
napa (red) and O. n. kaibab ssp. n. (magenta), and O. sy/vanoides (blue) inferred from protein-coding regions of a) the nuclear
(autosomes) and b) the mitochondrial genome.
45
(type locality in USA: Colorado, Clear Creek Co.). The third clade (Fig. 48 blue) comprises all other
populations (Oregon, mainland California, Nevada) and includes the nominotypical subspecies O.
sylvanoides sylvanoides. Fst/Gmin/COI barcode difference among these clades are: 0.43/0.003/2.1% (14
bp) (O. s. sylvanoides vs. O. s. napa), 0.33/0.01/1.7% (11 bp) (O. s. sylvanoides vs. O. s. santacruza), and
0.54/0.008/2.6% (17 bp) (O. s. napa vs. O. s. santacruza). Therefore, we propose that Ochlodes napa (W.
H. Edwards, 1865), stat. rest. and Ochlodes santacruza J. Scott, 1981, stat. nov. are species distinct from
Ochlodes sylvanoides (Boisduval, 1852) and form a new species-subspecies combination: Ochlodes
santacruza catalina J. Emmel & T. Emmel, 1998, comb. nov.
Ochlodes napa kaibab Grishin, new subspecies
http://zoobank. org/OCF5A2B5-E6B9-460A-999F-S500EFEFE3921
(Figs. 48 part, 49)
Definition and diagnosis. Genomic sequencing reveals that specimens of Ochlodes napa (W. H.
Edwards, 1865), stat. rest. (type locality in USA: Colorado, Clear Creek Co.) from the southwestern part
of the range are genetically differentiated from the rest (Fig. 48) with the COI barcode difference of 2.0%
(13 bp). This difference is large because they possess mitochondrial genomes (and therefore COI
barcodes) more similar to Ochlodes sylvanoides (Boisduval, 1852) (type locality in USA: California,
Plumas Co.) than to O. napa (Fig. 48b). Due to this genetic differentiation, these populations from
Coconino Co. in Arizona represent a distinct taxon that currently does not have a name and therefore is
new. We consider it to be a subspecies of O. napa because genetic differentiation in the nuclear genome is
not prominent (Fig. 48a), and we are not aware of this new taxon being sympatric with O. napa. This new
subspecies is characterized by a darker appearance, sharper edges of brown areas likely caused by reduced
fulvous overscaling over the brown areas, especially near their edges (e.g., the brown spot distad of the
discal cell on forewing), and submarginal spots in cells Mi-M2 and Mo2-Ms3 are better separated from
fulvous areas of the forewing. Its females tend to have more developed fulvous areas in the forewing
Fig. 49. Ochlodes napa kaibab ssp. n. in dorsal (above) and ventral (below) views, data in text:
a) holotype @ NVG-21113C07 and b) paratype ? NVG-21113C06.
46
discal cell and wing bases above. Due to extensive phenotypic variation, definitive identification is
provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome:
aly1500.7.2:A162T, aly1500.7.2:T170A, aly3598.15.2:G447A, aly3598.15.2:C459T, aly378.20.4:A390G
and in COI barcode: A217A, A256C, T439C, T505C, T583T, T616C.
Barcode sequence of the holotype. Sample NVG-21113C07, GenBank OR837739, 658 base pairs:
AACTTTATACTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTAT TAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGTGATGATCAAATTTATAATACT
ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGT TCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAA
TAAATAATATAAGCTTTTGAATATTACCTCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTATATCCTCCTTTATCTTCTAATATTGC
TCACCAAGGATCTTCTGTTGATT TAGCAATTTTTTCTCTTCATTTAGCTGGTATTTCATCTATTCTAGGAGCTATCAATTTTATTACAACAATTATTAATATACGAATTAAAAACTTATCA
TTTGATCAAATACCCTTATTCGTATGATCAGTAGGTATTACAGCATTATTATTATTATTATCTTTACCTGTCTTAGCAGGTGCTATTACAATATTACTTACTGATCGAAATTTAAATACTT
CTTTTTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Type material. Holotype: co deposited in the McGuire Center for Lepidoptera and Biodiversity, Florida
Museum of Natural History, Gainesville, FL, USA [MGCL], illustrated in Fig. 49a, bears four printed
labels: three white [ South Canyon Spring | Kaibab Plateau, AZ | 30 July 2021 | Robb Hannawacker ],
| Woodland Skipper | Ochlodes sylvanoides | male |, [ DNA sample ID: | NVG-21113C07 | c/o Nick V.
Grishin ], and one red [ HOLOTYPE o& Ochlodes napa | kaibab Grishin ]. Paratype: 1° same data as the
holotype (NVG-21113C06) (Fig. 49b).
Type locality. USA: Arizona, Coconino Co., Kaibab Plateau, South Canyon Spring.
Etymology. The name is a noun in apposition taken from the type locality of this species.
Distribution. Northern Arizona, USA. Populations in southeastern Utah are the nominal subspecies, and
those in southwestern Utah should be studied to determine their identity.
Lectotype designation for Hesperia erratica Pl6tz, 1883
Hesperia erratica Plotz, 1883 (type locality in Guatemala), currently a junior subjective synonym of Lon
zabulon (Boisduval & Le Conte, [1837]) (type locality in North America, possibly USA: Georgia), was
described from an unstated number of specimens from Guatemala (Pl6tz 1883). One specimen, shown in
Fig. 50a, is curated in the MFNB collection as a syntype of H. erratica. We determine that this specimen
is indeed a syntype. First, it agrees with the original description, which we translate as: “Yellow on both
sides, all wings dark at the base and outer margin. Hindwing underside straw-yellow, at the base pale-
brown with yellow spot, cell 1b is overscaled with pale-brown. Three such spots are in an oblique line in
cell lc, 2, and 3, one spot in the discal cell near the brown base, and a patch in the corner of cell 6. In cell
7 at the apex, there is a small brown spot, like the previous ones, and in cell 6, the narrow uneven border
begins, ending at vein 1b. Upperside dark-yellow, forewing with brown-powdered [refers to the following
list], the apical spots ending at the costal margin, such long spot in cells 4 and 5, and a dark brown cross
vein. Hindwing with a brown costal margin, narrow in cells 4 and 5, then rapidly widening outer border,
and a broad inner margin. Fringes of the forewing light brown, and of the hindwing yellow.” The
description does not mention a diffuse discal spot in hindwing cell 5 (1.e., Mi-Mz2) beneath, present in the
syntype, but all its other characters are in very good agreement with the description.
Second, according to its labels, this candidate syntype specimen from the Weymer collection was
seen by Plétz, who identified it at the time as “zabulon Bd.” (“best[immt]. v[on]. Pl6étz’). Subsequently,
Pl6tz likely changed his mind because, in his publication with the key describing H. erratica, he placed it
after his “zabulon”’, which was actually Lon hobomok (T. Harris, 1862) (type locality in USA:
Massachusetts) (Pl6tz 1883). This is also corroborated by the opinion of Godman (1907), who inspected
the original Plétz drawings of “zabulon” (t[afel]. 655) “from Buffalo” and concluded that they “represent
A. hobomok.” Thus, Pl6tz’s “zabulon” was L. hobomok, and Pl6tz probably proposed the name erratica
for the true L. zabulon, represented by this specimen, after he realized that two species were involved (see
specimen labels below). Third, the specimen bears a label with “Erratica Plotz il.” in Weymer’s
handwriting, meaning that this name was given to Weymer by Pl6tz before publication of the name
(therefore “1. I.”, for “in litteris”). Fourth, Godman (1907), who inspected Plétz original drawing of H.
erratica (tlafel]. 656), identified it as male “Atrytone zabulon” in accord with the identity of the syntype.
We were not able to find other syntypes, and to stabilize nomenclature, N.V.G. hereby designates
the sole syntype in the MFNB collection, a male with the following seven printed (but 2", 3", and 4"
47
handwritten) labels, the 1‘ red and others white: [ Typus ], [ zabulon Bd. | n° 92 best. v. Plétz | ist mogl
and. Art |, [ Erratica Plotz 11. | taf. 656. Guatemala |, [ Erratica Pltz | il. | Guatemala |, [ Coll. Weymer ],
| {QR Code} http://coll.mfn-berlin.de/u/ | 44a0bc |, and [ DNA sample ID: | NVG-18052B03 | c/o Nick V.
Grishin | as the lectotype of Hesperia erratica Plétz, 1883. The last two lines on the 2™ label are
abbreviated and should read “n® 92 bestimmt von Pl6tz | ist méglicherweise andere Art’, which we
translate as “n® 92 identified by Pl6tz | is possibly a different species”, an indication that Plétz would
change his opinion about the determination of this specimen as “zabulon.” The COI barcode sequence of
H. erratica lectotype, sample NVG-18052B03, GenBank OR837740, 658 base pairs, is:
AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAATTGGAACTTCTCTTAGATTACTAATTCGAACTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACT
ATCGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTCTTATACTAGGAGCTCCTGATATAGCATTTCCACGAA
TAAATAACATAAGATTTTGATTATTACCTCCATCATTAACATTATTAATTT CAAGAAGAATTGTCGAAAATGGTGCTGGTACTGGATGAACAGTTTACCCCCCTTTATCAGCAAATATTGC
TCACCAAGGTTCTTCCGTAGATT TAGCAATCTTTTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAACTTTAT TACAACAATTATTAATATACGAATTAGAAATTTATCT
TTTGATCAAATACCATTATTTATTTGAGCTGTAGGAATTACAGCATTATTATTACTACTTTCTTTACCTGTT TTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATT TAAATACAT
CTTTCTTTGACCCAGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
brrahite Mof. ve fel? ra http://coll.mfn-berlin.de/u/
tal Lib Gusfenet Bertie 44a0bc
wae Ss 8
ee. went — ane
5
5 Yu
3 S
a
6 2
—~ oy
a
ll
DNA sample ID:
NVG—18052B03
c/o Nick V. Grishin
1cm
Fig. 50. Primary type specimens of Lon in dorsal (left) and ventral (right) views, data in text: a) lectotype of Hesperia erratica,
which is a specimen of Lon zabulon; b) holotype of Lon co sp. n.; and c) holotype of Lon ma sp. n. Larger scale bar refers to
specimens and smaller scale bar refers to labels, which are reduced in half compared to specimens.
48
Hesperia erratica Plétz, 1883 (type locality in the USA, not Guatemala) is confirmed
as a junior subjective synonym of Lon zabulon (Boisduval & Le Conte, [1837])
Genomic tree of specimens identified as Lon zabulon (Boisduval & Le Conte, [1837]) (type locality in
North America, possibly USA: Georgia) reveals that the lectotype of Hesperia erratica Plétz, 1883 (type
locality in Guatemala, sequenced as NVG-18052B03, Fig. 50a) is in the clade with specimens from the
USA (Fig. 51 violet) and not with specimens from Mexico and Central America, including El Salvador
and Costa Rica (Fig. 51 blue, a species different from L. zabulon, see below). Therefore, we confirm H.
erratica aS a junior subjective synonym of L. zabulon but propose that its type locality given as
‘Guatemala’ in the original description and on the lectotype labels was erroneous and should be corrected
to the USA. Sequencing of L. zabulon specimens across the range will allow us to determine the type
locality more precisely.
Even from the wing patterns of the lectotype, as also hinted in the original description of H.
erratica, it is more likely to be from the United States than Guatemala. First, orange-yellow on the dorsal
forewing is more extensive than in Central American specimens, i.e., the triplet of subapical spots is
connected to the doublet of submarginal spots (Fig. 50a), while in Central American specimens, they are
typically well-separated from each other (Fig. 50b). This character is also described for H. erratica by
Pl6tz (1883) as a “long spot in cells 4 and 5”, meaning that there is a yellow background (1.e., “upperside
dark-yellow’’) that is formed by subapical and submarginal yellow spots together with the rest of the wing
(except the marginal brown border) and there is a separate brown spot on this background. Instead,
specimens from Central America would be described as having 3 yellow subapical and 2 submarginal
spots on a brown background by the apex. Second, the ventral hindwing brown border by the outer
margin is described by Pl6tz as “narrow uneven” (Fig. 50a), which is more typical for specimens from the
US. This border is usually broader and more even in Central American specimens (Fig. 50b).
Looking more into the discrepancy about the type locality, we find that only two species of
Hesperiidae proposed by Pl6tz have the type locality listed as “Guatemala.” In addition to H. erratica, the
second one is Achlyodes gorgona Pl6tz, 1884, a junior subjective synonym of Gesta invisus (Butler & H.
Druce, 1872). A possible syntype of A. gorgona is from the Méschler collection (now in MFNB). It was
collected in Guatemala in 1884 according to its dedicated locality/collector/date green label, which is
likely correct. The type(s) of H. erratica would have been from an earlier collection event because the
name was published in 1883. Moreover, unlike A. gorgona, it lacks a dedicated locality label. Therefore,
it is unclear whether the type locality in Guatemala is accurate for H. erratica. Localities for the
Specimens collected in the US were known to be incorrect or missing. At least two mistakes have been
documented. First, Goniloba parumpunctata Herrich-Schaffer, 1869 (type locality not stated in the
original description, but later assumed to be in South America, possibly Venezuela), which is a junior
subjective synonym of Lerema accius (J. E. Smith, 1797) (type locality in USA: Georgia) had the locality
of the lectotype (male) and at least one female paralectotype deduced to be in eastern US by genomic
sequence comparison (Zhang et al. 2023a). Second, Pyrgus argina Pl6étz, 1884 (type locality given as
“Brisbane” [Australia]), which is a junior subjective synonym of Amblyscirtes hegon (Scudder, 1863)
(type locality in USA: New Hampshire, White Mountains), is only known from the USA (Evans 1949).
Lon zabulon|20059G01|USA:MD
dogn zabulon|9209|USA:AR
bon zabulon (=erratica)|18052B03|LT
Lon zabulon|SAMN18587728|USA:FL
Lon co|22056F05|PT|Mexico:Tam
son co|18115B03|HT|Mexico:Gro
Lan co|22056E08|PT|Mexico:Oax
iposton co|18115B04|PT|Mexico:Oax
Loon co|18115B02|PT|Mexico:Pue
idgon co|19068D12|PT|Mexico:Ver
5 gon co|18115B05|PT|Mexico:Chia
Lon co|18115B06|PT|EI Salvador
Lon co|18115B07|PT|Costa Rica
Lon ma|18115B09|HT|Panama|1976
Lon ma|18115B08|PT|Panama|1981
“y, Lon zabulon|20059G01|USA:MD,Montgomery Co.|1999 b
2z— Lon zabulon|SAMN18587728|USA:FL,Alachua Co.
Lon zabulon|9209|USA:AR,Montgomery Co.|2017
Lon zabulon (=erratica)|18052B03|LT|USA|old
Lon co|18115B02|PT|Mexico:Pue|1975
Lon co|22056E08|PT|Mexico:Oax|1989
Lon co|18115B03|HT|Mexico:Gro|1982
Lon co|19068D12|PT|Mexico:Ver|1987
Lon co|18115B04|PT|Mexico:Oax|1992
Lon co|18115B05|PT|Mexico:Chia|1959
Lon co|22056F05|PT|Mexico:Tam|1965
Lon co|18115BO06|PT|E! Salvador|1972
Lon co|18115B07|PT|Costa Rica|1985
Lon ma|18115BO09|HT|Panama|1976
Lon ma|18115B08|PT|Panama|1981
“yz, Lon zabulon|20059G01|USA:MD,Montgomery Co.|1999 ©€©
Lon zabulon|SAMN18587728|USA:FL,Alachua Co.
Lon zabulon|9209|USA:AR,Montgomery Co.|2017
Lon zabulon (=erratica)|18052B03|LT|USA|old
Lon co|18115B02|PT|Mexico:Pue|1975
Lon co|22056E08|PT|Mexico:Oax|1989
Lon co|18115B03|HT|Mexico:Gro|1982
Lon co|19068D12|PT|Mexico:Ver|1987
Lon co|18115B05|PT|Mexico:Chia|1959
Lon co|18115B04|PT|Mexico:Oax|1992
Lon co|18115BO06|PT|EI Salvador|1972
Lon co|22056F05|PT|Mexico:Tam|1965
Lon co|18115B07|PT|Costa Rica|1985
Lon ma]18115B09|HT|Panama|1976
Lon ma|18115B08|PT|Panama|1981
0,002 0.002
Fig. 51. Phylogenetic trees of selected Lon species inferred from protein-coding regions of a) the nuclear genome (autosomes),
b) the Z chromosome, and c) the mitochondrial genome: L. zabulon (violet), L. co (blue), and L. ma (red). The sequence of
SAMN18587728 is taken from the alignment provided in Kawahara et al. (2023).
49
Lon co Grishin, new species
http://zoobank.org/AA859D 18-CFC6-47F8-9032-AB5B6D79EB69
(Figs. 50b, 51 part, 52)
Definition and diagnosis. Genomic trees of specimens identified as Lon zabulon (Boisduval & Le Conte,
[1837]) (type locality in North America, possibly USA: Georgia) reveal their partitioning into three
clades: from the USA, which is L. zabulon in accord with its phenotype and the type locality, and two
others that do not have names (Fig. 51). One of these clades consists of specimens from Mexico and
Central America (Fig. 51 blue) and differs from L. zabulon by Fst/Gmin/COI barcode of 0.49/0.01/3% (20
bp) thus representing a new species. This species differs from L. zabulon in reduced orange-yellow areas
on wings, e.g., broader brown borders and a smaller, disconnected triplet of subapical spots and a doublet
of submarginal spots on forewing; ventral hindwing with broader and more even outer border and larger
spots (Fig. 50b); the process of aedeagus is more robust (Fig. 52a, e-j). Definitive identification is
provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome:
aly596.8.5:A189G, aly596.8.5:A192T, aly806.32.1:T876C, aly806.32.1:A1101G, aly1097.21.1:G46A and in
COI barcode: T82C, G101A, T292C, C376T, T457C, T478C.
Barcode sequence of the holotype. Sample NVG-18115B03, GenBank OR837741, 658 base pairs:
AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGTACAGAATTAGGTAACCCTGGATCTTTAATTGGGAATGATCAAATTTATAATACT
ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCTGATATAGCTTTTCCTCGAA
TAAATAATATAAGTTTTTGAATATTACCCCCCTCACTAACATTATTAATCT CAAGAAGAATTGTAGAAAACGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTATCATCTAATATTGC
TCATCAAGGATCTTCAGTTGATT TAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATCATTAATATACGAAT TAAAAACTTAATG
TTTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATT TAAACACTT
CATTTTTTGATCCAGCAGGGGGAGGAGATCCAATTTTATATCAACACTTATTC
Type material. Holotype: & deposited the National Museum of Natural History, Washington, DC, USA
_—— s
a
%
4.4.2
Fig. 52. Genitalia of Lon co sp. n. paratypes, data in text: a-b) NVG-22056F05 complete genital capsule (right valva tilted
ventrad) and e—p) NVG-22056E08 partly disassembled: c) left valva, c) right valva, e-j) aedeagus, k) tegumen and uncus, I)
genital ring (uncus, tegumen, vinculum, and saccus rotated to align with the pane of the ring), m—p) juxta. Views: dorsal (a, e,
m), left lateral (b, f; n), ventral (g, k, 0), right ventrolateral (h), right lateral (c, d, 1), and posterior (j, 1, p). Directions: posterior
on the right (a, b, e-1, m—o), posterior on the left (c, d), posterior on top (k), dorsal on top (b, c, d, f, j, 1, n, p), ventral on top (i).
50
k
m
[USNM], illustrated in Fig. 50b, bears six printed labels: five white [ MEX:Guerrero, | 5-7 km NW |
Taxco, [X-14-82 | 1850-1900 m ], [ J. A. Powell | J. A. Chemsak | collectors |], [ Poanes zabulon |
(Boisduval & Le Conte) | & | det. J. M. Burns 1992 ], [ DNA sample ID: | NVG-18115B03 | c/o Nick V.
Grishin |], [ USNMENT | {QR Code} | 01531551 ], and one red [HOLOTYPE ¢& | Lon co | Grishin ].
Paratypes: 8¢'c: Mexico: Io Tamaulipas, 11 km NW Gomez Farias, 6 km W Rancho Cielo, el. 5200-
5500 ft, 9-Jul-1965, genitalia vial NVG231115-03 (NVG-22056F05) [TMMC]; 1o& Veracruz, 10 km W
Coscomatepec, el. 1800 m, 12-Aug-1987, Brown & Powell leg, genitalia vial J. M. Burns X-2953 (NVG-
19068D12, USNMENT 01559668) [USNM]; Ich Puebla, 6 mi N Chapulco, el. 7000', 4-Oct-1975, J.
Powell, T. Eichlin & T. Friedlander leg. (NVG-18115B02, USNMENT 01531550) [USNM]; Oaxaca, 5-
10 mi N of Oaxaca, el. 6000-7000 ft, J. Kemner leg.: 1h 22-Aug-1992 (NVG-18115B04, USNMENT
01531552) [USNM] and 1¢ 30-Aug-1989, genitalia vial NVG23 1115-02 (NVG-22056E08) [TMMC]; Ico
Chiapas, 12 km S of Las Casas, 26-28-Mar-1959, T. C. Emmel leg. (NVG-18115B05, USNMENT
01531553) [USNM]; 1o& El Salvador, 2 mi down from Cerro Verde summit, 20-Aug-1972, C. F. & S.
Hevel leg. (NVG-18115B06, USNMENT 01531554) [USNM]; Ic Costa Rica, Puntarenas Prov., Monte-
verde, el. 1300 m, 18-May-1985, J. A. Chemsak leg. (NVG-18115B07, USNMENT 01531555) [USNM].
Type locality. Mexico: Guerrero, 5—7 km NW of Taxco.
Etymology. The name is the last syllable of the country name of the type locality: [Mexi]co. The name is
a noun in apposition.
Distribution. Mexico to Costa Rica.
Lon ma Grishin, new species
http://zoobank.org/74F97D 16-BF2C-414A-B090-BEDAEED53343
(Figs. 50c, 51 part)
Definition and diagnosis. Genomic trees of specimens identified as Lon zabulon (Boisduval & Le Conte,
[1837]) (type locality in North America, possibly USA: Georgia) reveal their partitioning into three
clades: from the USA, which is L. zabulon in accord with its phenotype and the type locality, and two
others that do not have names (Fig. 51). One of these clades (Fig. 51 blue) is described as a new species
above. The second clade consists of specimens from Panama (Fig. 51 red) and differs from L. zabulon by
Fs/Gmin/COI barcode of 0.50/0.009/2.3% (15 bp) and from L. co sp. n. by 0.47/0.008/3.2% (21 bp), thus
representing a new species. This species differs from L. zabulon in being brighter colored and more
orange; the orange-yellow patch on dorsal hindwing smaller, more like a patch than the entire hindwing
being orange with brown borders, brown border wider; beneath brown spots larger; and from L. co sp. n.
in more extensive orange-yellow areas on the forewing, e.g., submarginal and subapical forewing spots
larger, on ventral side subapical triplet of spots more orange, like submarginal doublet, not yellower than
it; and the absence of pale ray along dorsal hindwing 1b vein that is usually expressed in L. co sp. n. and
L. zabulon. Definitive identification is provided by DNA, and a combination of the following characters is
diagnostic in the nuclear genome: aly525.115.3:G328A, aly2336.10.2:C108T, aly2336.10.2:G116A, aly923.
19.4:T246G, aly923.19.4:C393T and in COI barcode: T79C, T169C, T206C, A349G, A577G.
Barcode sequence of the holotype. Sample NVG-18115B09, GenBank OR837742, 658 base pairs:
AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGTACAGAATTAGGCAATCCTGGATCTTTAATCGGAGATGATCAAATTTATAACACT
ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTACCACTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAA
TAAATAATATAAGTTTTTGAATATTACCCCCTTCACTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTGTCATCTAATATTGC
TCATCAAGGATCCTCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTAATG
TTTGACCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATGTTACTTACTGATCGAAATTTAAATACTT
CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACACTTATTC
Type material. Holotype: & deposited in the National Museum of Natural History, Washington, DC,
USA [USNM], illustrated in Fig. 50c, bears four printed (date handwritten) labels: three white
| PANAMA: Chiriqui | Volcan Baru 1800 m | 5 Dec.'76 | leg. S. S. Nicolay |], [ DNA sample ID: | NVG-
18115B09 | c/o Nick V. Grishin |, [ USNMENT | {QR Code} | 01531557 |, and one red [ HOLOTYPE ¢&
| Lon ma | Grishin |. Paratype: 1c Panama, Chiriqui, Volcan Baru, el. 1759 m, GPS 8.683, —82.500, 14-
Feb-1981, G. B. Small leg. (NVG-18115B08, USNMENT 01531556) [USNM].
Type locality. Panama: Chiriqui, Volcan Bart, elevation ca. 1800 m.
51
Etymology. The name is the last syllable of the country name of the type locality: [Pana]ma. The name ts
a noun in apposition.
Distribution. Currently known only from Chiriqui, Panama.
Neotype designation for Cobalus vitellina Herrich-Schaffer, 1869
Cobalus vitellina Herrich-Schaffer, 1869 was described within the identification key from an unstated
number of specimens without locality data (Herrich-Schaffer 1869). The description was rather general
and can apply to several species. Our translation from German of relevant segments assembled from the
Herrich-Schaffer key is: “forewing cell 3 with a pale spot before its middle, discal cell unmarked;
hindwing above with three yellow spots in cells 3—5, on the underside with a continuous yellow band.”
Primary types for several names proposed in the same work are curated in MFNB. These types came from
the Herrich-Schaffer collection (label “Coll. H.—Sch.”) through the Staudinger collection (label “Coll.
Staudinger’) and frequently bear identification labels in Herrich-Schaffer handwriting. To confidently
infer the taxonomic identity of C. vitellina, we searched for such specimens in MFNB that agreed with the
original description. We were not able to find syntypes of C. vitellina and turned to additional resources,
such as publications and specimens collected around the time of C. vitellina description identified as this
Species or agreeing with the original description.
According to Godman (1907), Pl6tz illustrated “nearly all” species described by Herrich-Schdaffer.
While these drawings are not located to this day, Godman found specimens in his collection that, in his
opinion, matched each drawing closely and obtained drawing copies of species he could not identify
(1907). While there is no certainty that Plétz illustrated Herrich-Schaffer syntypes and not some other
Specimens determined by him or by Herrich-Schaffer to be these species, we use Ploétz’s (1883)
description of C. vitellina, which he placed in the genus Hesperia Fabricius, 1793 (type species Papilio
comma Linnaeus, 1758), to learn more about this taxon. Pl6tz’s description of his drawings (rather than
actual specimens) is more detailed than Herrich-Schaffer’s and gives “Mexico” as the locality. We
translate the description from German as: “Ventral side red-brown, forewing with basal half black,
hindwing infused with rust-red, past the middle with a distorted rust-yellow band, which in cell Ic
projects a ray towards the fringe. Dorsal side brown, forewing with deep red-yellow spots in cells 1-3 and
6-8; a small dot in cell 4. Hindwing with 3 yellow spots in cells 3—5 and yellow fringes. Antenna half as
long as the forewing.” Both this description and Godman’s (1907) assessment, which noted that Pl6étz
illustrated both a male and female from Mexico, agree with H. vitellina being either conspecific with or
closely related to Lon melane (W. H. Edwards, 1869) (type locality in USA: California). Moreover,
Draudt (1921-1924) frequently used (inferior) copies of Pl6étz’s drawings as illustrations (Nakahara et al.
2022), and his figures of melane (plate 182e) might be copied from Pl6tz’s H. vitellina, which Draudt
synonymized with L. melane. The dorsal side shows a female, which is either an atypical specimen or not
this species (instead reminding of Buzyges rolla (Mabille, 1883)) because the spots in cells M3-CuA, and
CuAj-CuA2 are nearly aligned with each other (in Lon species, these two spots do not overlap in most
Specimens), unless this is an imperfection of the reproduction from the original. The ventral side is of a
male and is identifiable as L. melane or its close relative.
Furthermore, we found two specimens of interest in MFNB. The first specimen (NVG-
21116G04), from the Mdéschler collection collected in Mexico in 1876 and identified by Méschler as
“vitellina’, agrees with all characters of this taxon presented above, except that the three spots on the
dorsal hindwing are barely visible. This specimen cannot be a syntype because it was collected after the
description of C. vitellina. The second specimen (NVG-22091C05) is from Herrich-Schaffer’s collection,
also from Mexico, and bears the identification label “marmorosa HS” in Herrich-Schaffer’s handwriting.
This specimen is one of those Godman (1900) mentioned within his treatment of “Atrytone melane” and
identified as such. It is probably not a syntype of C. vitellina either because it possesses four (or even
five), and not three, as per the original description, yellow spots on the dorsal hindwing. This is a boldly
patterned specimen with a very wide ventral hindwing orange-yellow band occupying nearly a third of the
wing area, and it is possible that Herrich-Schaffer viewed it as a new species that he planned to call
52
1cm
Fig. 53. Neotype of Cobalus vitellina Herrich-Schaffer, 1869 in dorsal (left) and ventral (right) views, data in text.
“marmorosa”’, a name that was never published. Nevertheless, both specimens (NVG-21116G04 and
NVG-22091C05) fall within the current concept of “Paratrytone melane vitellina” as outlined by Evans
(1955) and have not been questioned since (Mielke 2005).
Not finding syntypes, we proceeded with the neotype designation because there was an
exceptional need to clarify both the taxonomic identity and the type locality of C. vitellina. Although the
name has been consistently applied to the Mexican subspecies of L. melane, the potential for
destabilization of nomenclature arises due to the existence of additional species in this group in Mexico
and Central America (see below) unless the name C. vitellina is objectively defined by the neotype that
also provides details about the type locality. A number of Hesperiidae species from Mexico described in
the second half of the 19 century were likely based on specimens from Oaxaca, possibly collected by
Deppe in 1824—1829. Therefore, we selected a neotype from Oaxaca. Hereby, N.V.G. designates a
specimen in USNM illustrated in Fig. 53 (DNA sample NVG-18115F05) as the neotype of Cobalus
vitellina Herrich-Schaffer, 1869. This neotype corroborates the current application of the name for a
relative of L. melane from Mexico, as stated by Plotz (1883) and Godman (1907), supported by Evans
(1955), and followed since in all literature (Mielke 2005).
This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is
designated to clarify the taxonomic identity of Cobalus vitellina Herrich-Schaffer, 1869, which is
necessary because additional species are present among its close relatives, and to define the type locality
that was not stated in the original description; 75.3.2. The characters to differentiate this taxon from others
were given in the original description (Herrich-Schaffer 1869), further elaborated by Plétz (1883). We
regard them as follows: forewing brown with orange yellow spots in cells R3-R4, R4a-Rs, Rs-Mi, M3-CuAi,
CuAi-CuA2, and CuA2-1A+2A, and a dot in cell Mo-Ms3, discal cell unmarked; forewing beneath with
nearly black basal half; hindwing above brown with three yellow spots in cells Mi-M2, M2-M3, and M3-
CuA1; hindwing beneath rust-colored with a continuous orange-yellow band; antenna about half of the
forewing in length; 75.3.3. The neotype specimen is a male bearing three labels: [ MEXICO: OAXACA |
c. 3 mi. E La| Trinidad, 8500 ft | 3-VIII-1992 | J. Kemner |], [ DNA sample ID: | NVG-18115F05 | c/o
Nick V. Grishin |, [ USNMENT | {QR Code} | 01531599 | and illustrated in Fig. 53; the neotype has a
tear along SC vein from costa on the right forewing; 75.3.4. We carefully searched for syntypes of C.
vitellina in the MFNB collection (see above) because most of the Herrich-Schaffer Hesperiidae types are
in this collection, and a study by Hauser et al. (2003) did not locate the syntypes in Stuttgart. We also
checked the ANSP collection, where several Herrich-Schaffer types of Caribbean taxa are curated. We
failed to find syntypes of C. vitellina among Hesperiidae holdings in these collections and, therefore,
believe that they were lost; 75.3.5. The neotype closely agrees with the original description of C. vitellina
in all characters, as evidenced by comparing the neotype illustrated in Fig. 53 with the characters for this
taxon given in the original description (Herrich-Schaéffer 1869) and listed above (75.3.2.); 75.3.6. The
neotype is from Mexico: Oaxaca, ca. 3 mi E of La Trinidad, 8500 ft, and the type locality was not
specified in the original description but was stated as “Mexico” by Plétz (1883); 75.3.7. The neotype is in
53
the National Museum of Natural History, Washington, DC, USA (USNM). The COI barcode sequence of
C. ageete neotype: sample NVG-18115F05, GenBank OR837743, 658 base pairs, is:
AACCTTATATTTTAT TTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGAI ['TACTAATTCGTACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAACACT
ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTCCCATTAATATTAGGTGCCCCTGATATAGCTTTCCCCCGAA
TAAATAATATAAGTTTTTGAATATTACCCCCCTCATTAACATTATTAATTT CAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTATCATCTAATATTGC
ACACCAAGGCTCTTCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATACGAATTAAAAATTTAATG
TTTGATCAAATACCTTTATTCGTATGATCTGTAGGTATTACAGCCTTATTATTACTTTTATCTTTGCCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACTT
CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Lon melane melane|15039A05|LT|USA:CA
Lon melane melane|15039A05|LT|USA:CAl|old b Z-chr ¥ pepe aunts
on melane melane :
Lon melane melane|17111G12|USA:CA, Yolo Co.|1994
Lon melane melane|17111HO01|USA:CA,San Luis Obispo Co.|1994
Lon melane melane|22058D03|USA:CA,Los Angeles Co.|1987
Lon melane melane|22094E08|USA:CA,Los Angeles Co.|2009
Lon melane melane|22094E06|USA:CA,San Mateo Co.|1971
Lon melane melane|22094E09|USA:CA,Napa Co.|1977
Lon melane melane|22094E07|USA:CA,Madera Co.|1982
Lon melane sur|22101HO9|PT|Mexico:BCS|1941
Lon melane melane|22094E06|USA:CA,San Mateo Co. C tito
Lon melane melane|22094E09|USA:CA,Napa Co.|1977
Lon melane melane|17111G12|USA:CA, Yolo Co.|1994 jon melane melane|22094E08|USA:CA
Lon melane melane|22058D03|USA:CA,Los Angeles Co. gon melane melane|22094E06|USA:CA
Lon melane melane|22094E07|USA:CA,Madera Co. melane qyon melane melane|22094E09|USA:CA
Lon melane melane|22094E08|USA:CA,Los Angeles Co. ialarte Lon melane melane|17111HO1|USA:CA
a nuclear
melane
Lon melane melane|17111HO1|USA:CA,San Luis Obispo Co.
Lon melane sur|22101H10|HT|Mexico:BCS|1941
Lon melane sur|22101HO9|PT|Mexico:BCS|1941
Lon melane melane|15039A05|LT|USA:CA|old
Lon vitellina|20059C10|USA:TX,Brewster Co.
Lon vitellina|20063G11|Mexico:Dur|1981
Lon vitellina|20063G08|Mexico:Chih|1994
Lon vitellina|18115F04|Mexico:Hid|1990
Lon vitellina]18115F07|Mexico:Ver|1992
Lon vitellina]20063G09|Mexico:Coah|2003
Lon vitellina|19013A11|Mexico:NL|1979
Lon vitellina|21116G04|Mexico|1876
Lon vitellina]20063G10|Mexico:NL|2007
Lon vitellina|18115FO5|NT|Mexico:Oax|1992
Lon chia|18115F06|PT|Mexico:Chia|1988
Lon chia|18115F08|PT|Mexico:Chia|1992
Lon chia]22105HO5|HT|Mexico:Chia|1969
Lon chia|22056D01|PT|Mexico:Chia|1987
Lon chia|20062F09|PT|Mexico:Chia|1988
Lon chia|18115FO9|PT|EI Salvador|1972
Lon melane melane|22058D03|USA:CA
Lon melane melane|17111G12|USA:CA
sur Lgn melane sur|22101HO9|PT|Mexico:BCS
Lon melane sur|22101H10|HT|Mexico:BCS
Lon vitellina]18115F04|Mexico:Hid|1990
Lon vitellina|20063G08|Mexico:Chih|1994
Lon vitellina|18115F05|NT|Mexico:Oax|1992
Hion vitellina|20059C10|USA:TX, Brewster Co.
Lon vitellina]21116G04|Mexico|1876
Lon vitellina]19013A11|Mexico:NL|1979
ton vitellina|20063G11|Mexico:Dur|1981
Von vitellina|18115F07|Mexico:Ver|1992
Yon vitellina|20063G09|Mexico:Coah|2003
Lon vitellina|20063G10|Mexico:NL|2007
5¢0n Chia|18115F06|PT|Mexico:Chia|1988
son chia]20062F09|PT|Mexico:Chia|1988
Lon melane sur|22101H10|HT|Mexico:BCS|1941
Lon vitellina|20059C10|USA:TX,Brewster Co.|2005
Lon vitellina]21116G04|Mexico|1876
Lon vitellina]18115FO07|Mexico:Ver|1992
Lon vitellina]20063G10|Mexico:NL|2007
Lon vitellina|19013A11|Mexico:NL|1979
Lon vitellina|20063G08|Mexico:Chih|1994
Lon vitellina|20063G09|Mexico:Coah|2003
Lon vitellina]18115F04|Mexico:Hid|1990
Lon vitellina|20063G11|Mexico:Dur|1981
Lon vitellina]18115FO5|NT|Mexico:Oax|1992
Lon chia|18115FO6|PT|Mexico:Chia|1988
Lon chia|18115F08|PT|Mexico:Chia|1992
Lon chia|22056D01|PT|Mexico:Chia|1987
Lon chia|20062F09|PT|Mexico:Chia|1988
Lon chia|22105HO5|HT|Mexico:Chia|1969
Lon chia|18115FO9|PT|EI Salvador|1972
Lon poa|18115F10|Costa Rica: Alajuela Prov.|1988 Lon poa|18115F10|Costa Rica: Alajuela Prov.|1988 Lon poa|21108F06|Costa Rica: Cartago Prov.|old
Lon poa|21108F06|Costa Rica: Cartago Prov.|old Lon poa|21108F06|Costa Rica: Cartago Prov.|old Pn poa|18115F 10|Costa Rica: Alajuela Prov.|1988
Lon poa|18115F11|Panama: Chiriqui|1979 0.002 Lon poa|18115F11|Panama: Chiriqui|1979 0.006 Lon poa|18115F11|Panama: Chiriquil1979
hon chia|18115F08|PT|Mexico:Chia|1992
9%,on chia|22056D01|PT|Mexico:Chia|1987
Lon chia]22105HO5|HT|Mexico:Chia|1969
Lon chia|18115FO9|PT|EI Salvador|1972
0.003
Fig. 54. Phylogenetic trees of selected Lon species inferred from protein-coding regions of a) the nuclear genome (autosomes),
b) the Z chromosome, and c) the mitochondrial genome. Different taxa are shown in different colors: L. melane (blue, with L.
melane sur ssp. n. in cyan), L. vitellina (violet), L. chia sp. n. (red), and L. poa (green). The names of new taxa by
corresponding tree branches are highlighted in yellow.
Lon vitellina (Herrich-Schiaffer, 1869) and Lon poa (Evans, 1955)
are Species distinct from Lon melane (W. H. Edwards, 1869)
Genomic trees reveal that Cobalus vitellina Herrich-Schaffer, 1869 (type locality in Mexico: Oaxaca) and
Paratrytone melane poa Evans, 1955 (type locality Costa Rica: Mount Pods), currently treated as
subspecies of Lon melane (W. H. Edwards, 1869) (type locality in USA: California, likely San Francisco
Bay area), are genetically differentiated from it at the species level (Fig. 54), e.g., Fst/Gmin/COI barcode
difference from L. melane of 0.57/0.002/3.2% (21 bp) for C. vitellina and 0.66/0.001/2.3% (15 bp) for P.
melane poa. TYherefore, we propose that Lon vitellina (Herrich-Schaffer, 1869), stat. rest. and Lon poa
(Evans, 1955), stat. nov. are species distinct from Lon melane (W. H. Edwards, 1869).
Lon melane sur Grishin, new subspecies
http://zoobank.org/A41D2EC4-85A8-4728-AD8E-233BF09A90DB
(Figs. 54 part, 55)
Definition and diagnosis. Genomic sequencing of the two specimens from Baja California Sur, Mexico,
identified as a possible subspecies or a distinct geographical segregate of “Paratrytone melane” in
previous works (Powell 1958; MacNeill 1962; Brown et al. 1992) reveals that they are indeed closely
related to Lon melane (W. H. Edwards, 1869) (type locality in USA: California, likely San Francisco Bay
area) (Fig. 54): e.g., their COI barcodes differ by 0.3—0.6% (2—4 bp), and, therefore, we consider them to
be conspecific with it. However, the BCS specimens differ from the nominotypical ZL. melane in reduced
fulvous overscaling at wing bases above, smaller orange spots on the forewing, more diffuse and
brownish instead of orange dorsal hindwing spots, and weakly spotted more uniformly colored ventral
hindwing. Therefore, they represent a distinct subspecies, which is new. A more detailed description of
this subspecies was given by MacNeill (1962: 110-111), who called it “Paratrytone melane subsp.”
without proposing a formal name. Definitive identification is provided by DNA, and a combination of the
following characters is diagnostic in the nuclear genome: aly770.31.1:A393C, aly3721.1.4:G45A, aly93.14.
4:C408T, aly322.23.3:A87G, aly65.5.1:T199C and in COI barcode: T56C, T379A, T418C, T530C, C646C.
54
Fig. 55. Holotype of Lon melane sur ssp. n. in dorsal (left) and ventral (right) views, data in text.
Barcode sequence of the holotype. Sample NVG-22101H10, GenBank OR837744, 658 base pairs:
AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGACTATTAATTCGTACAGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT
ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGT CCCATTAATATTAGGTGCCCCTGATATAGCTTTCCCTCGAA
TAAATAATATAAGTTTTTGAATACTACCCCCTTCATTAACATTATTAATTT CAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCTTTATCATCTAATATTGC
TCATCAAGGCTCTTCAGTTGATT TAGCAATCTTTTCACTTCATTTAGCTGGAATCTCATCTATTTTAGGAGCTATTAACTTTATTACAACAATTATCAATATACGAATTAAAAATT TAATG
TTTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCCCTATTATTACTTTTATCTTTACCCGTTTTAGCTGGAGCTATTACTATATTACTTACCGATCGAAATT TAAATACTT
CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTT
Type material. Holotype: & deposited in the California Academy of Sciences, San Francisco, CA, USA
[CAS], illustrated in Fig. 55, bears eight labels: seven white [ La Laguna, | Sierra Laguna, | L.Cal.X-14-
41 |, [ melane Edw. | Det. by | F H Rindge ], [ Ross & Bohart | Collectors |, [ co ], | melane subspecies ],
| DNA sample ID: | NVG-22101H10 | c/o Nick V. Grishin |, [| {QR Code} CASENT | 8566940 |, and one
red [ HOLOTYPE oc | Lon melane | sur Grishin |. Paratype: Ic same data as the holotype (NVG-
22101H09, CASENT 8566939).
Type locality. Mexico: Baja California Sur, Sierra de La Laguna.
Etymology. The name, a masculine noun in apposition, is the last word in the type locality state name,
also meaning that this is the southernmost subspecies of L. melane.
Distribution. Mountains of the Cape region in Baja California Sur, Mexico.
Lon chia Grishin, new species
http://zoobank.org/E4498D7B-4A5E-44 1 1-9CB0-E336A A043 11F
(Figs. 54 part, 56)
Definition and diagnosis. The genomic tree reveals that specimens identified as Lon poa (Evans, 1955)
(type locality Costa Rica: Mount Poas), stat. nov. partition into two clades (Fig. 54). One clade includes
specimens from Costa Rica and Panama, being the true LZ. poa by locality and phenotype. The other clade
is genetically differentiated from the first one with Fs/Gmin/COI barcode difference of 0.41/0.004/0.9% (6
bp) and represents a new species. This species keys to “Paratrytone melane poa” M.23.1(c) in Evans
(1955) and is distinguished from the true L. poa by less extensive yellow overscaling on the ventral side
of wings, in particular, on the hindwing; this overscaling is whiter, and the ground color in redder and
browner than yellower. As a result, there is less contrast between the darker inner half and subapical half
of the ventral forewing, which is paler in the apical half and contrasting dark brown towards the inner
margin in L. poa. Definitive identification is provided by DNA, and a combination of the following
characters is diagnostic in the nuclear genome: aly3177.11.6:A36C, aly3177.11.6:A39G, aly128.24.1:
C189T, aly128.24.1:A235C, aly318.14.6:G672A and in COI barcode: T4C, T346C, TS505C, A550A, 586T.
Barcode sequence of the holotype. Sample NVG-22105H05, GenBank OR837745, 658 base pairs:
AACCTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCCTTAAGATTATTAATTCGTACAGAATTAGGTAATCCTGGATCTTTAAT TGGAGATGATCAAATTTATAACACT
ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAGT CCCATTAATATTAGGTGCCCCTGATATAGCTTTCCCCCGAA
TAAATAATATAAGTTTTTGAATATTACCCCCCTCATTAACATTATTAATTT CAAGAAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTACCCCCCCTTATCATCTAATATTGC
ACACCAAGGCTCTTCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAACTTTATTACAACAATTAT TAATATACGAAT TAAAAATTTAATG
TTTGATCAAATACCTTTATTCGTATGATCTGTAGGTATTACAGCCTTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACTGATCGAAATT TAAATACTT
CATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Dye
1cm
Fig. 56. Holotype of Lon chia sp. n. in dorsal (left) and ventral (right) views, data in text.
Type material. Holotype: & deposited in the California Academy of Sciences, San Francisco, CA, USA
[CAS], illustrated in Fig. 56, bears five labels, the first two handwritten, others printed: four white
| Rancho Belen, Chis. | Mex. IV-17-69 | Robert Wind ], [P. m. poa], [DNA sample ID: | NVG-
22105H05 | c/o Nick V. Grishin |, [ {QR Code} CASENT | 8568431 |, and one red [ HOLOTYPE @ |
Lon chia | Grishin ]. Paratypes: 5¢'ch 19: Mexico, Chiapas: 1o& Comitan, Laguna Chamula, el. 7100 ft,
13-May-1987, C. J. Durden leg. (NVG-22056D01) [TMMC]; San Cristobal, La Almolonga, ca. 7500 ft:
Ilo 3-May-1988, J. Kemner leg. (NVG-18115F06, USNMEND 01531600) [USNM]; 1c 9-Jul-1988, C. J.
Durden leg. (NVG-20062F09) [TMMC]; Io 5-Jul-1992, J. Kemner & A. Vasquez leg. (NVG-18115F08)
[USNM]; 1o& Guatemala, Quiche department, above Chichicastenango, 11-Jan-1990, C. J. Durden leg.
(NVG-22056C06) [TMMC]; and 19 El Salvador, 2 mi down from Cerro Verde summit, 20-Aug-1972, G.
F. & S. Hevel leg. (NVG-18115F09, USNMENT 01531603) [USNM].
Type locality. Mexico: Chiapas, ca. 20 km S of San Cristobal, Rancho Belén.
Etymology. Like poa formed from “Mt. Poas”, the name chia is formed from Chiapas, for the type
locality of this species. The name is a noun in apposition.
Distribution. Confirmed from Mexico: Chiapas, Guatemala, and El Salvador.
Lerodea? rupilius Schaus, 1913 is a subspecies of
Atrytonopsis edwardsi W. Barnes & McDunnough, 1916
Lerodea? rupilius Schaus, 1913 (type locality given as “Guapiles” [Costa Rica] in the original description)
was regarded as nomen dubium by Burns (1983), who concluded that its syntype in USNM was “phony”:
it differed in some aspects from the original illustration in Schaus (1913) and was labeled from “Guadljara
Atrytonopsis edwardsi edwardsi|11277|USA:TX,Jeff Davis Co.|2018 b
Atrytonopsis edwardsi edwardsi|15101B09|LT|USA:AZ,Pima Co.
Atrytonopsis edwardsi edwardsi|11795|USA:TX,Jeff Davis Co.|2018 mite
Atrytonopsis edwardsi edwardsi|21108F05|Mexico:Son|1961
Z chr
Atrytonopsis edwardsi edwardsi|15101B09|LT|USA:AZ,Pima Co.|old
Atrytonopsis edwardsi edwardsi|21108F05|Mexico:Son|1961
Atrytonopsis edwardsi edwardsi|17114C03|USA:TX,Jeff Davis Co.|1972
Atrytonopsis edwardsi edwardsi|22065A03|USA:TX,Jeff Davis Co.|2004
; Atrytonopsis edwardsi rupilius [not nom. dub.]|15101C11|LT|Mexico:Jallold
Atrytonopsis edwardsi rupilius [was edwardsi]|19042C08|Mexico:Jal|1966
Atrytonopsis ovinia (=zaovinia)|15101D01|HT|Mexico:Pue|1911
Atrytonopsis ovinia|19042C06|Mexico:Pue|1964
Atrytonopsis ovinia|19042C07|Mexico:Pue|1964
Atrytonopsis ovinia|19042C05|Mexico:Gro|1956
Atrytonopsis ovinia|20062E11|Mexico:Oax|1988
Atrytonopsis ovinia|18118H11|Mexico:Oax|1992
Atrytonopsis ovinia|19024G02|Costa Rica|1993
Atrytonopsis ovinia]18119A01|Mexico:Chia|1975
Atrytonopsis ovinia]19042C04|Mexico:Gro|1958
Atrytonopsis ovinia]18118H12|Mexico:Chia|1992
0.002
0.02
Atrytonopsis edwardsi edwardsi|11277|USA:TX,Jeff Davis Co.
Atrytonopsis edwardsi edwardsi|11795|USA:TX,Jeff Davis Co.
Atrytonopsis edwardsi edwardsi|22065A03|USA:TX,Jeff Davis Co.
Atrytonopsis edwardsi rupilius [not nom. dub.]|15101C11|LT|Mex:Jal
iAtrytonopsis ovinia (=zaovinia)|15101D01|HT|Mexico:Pue|1911
Atrytonopsis edwardsi edwardsi|17114C03|USA:TX,Jeff Davis Co.
Atrytonopsis edwardsi rupilius [was edwardsi]|19042C08|Mexico:Jal
Atrytonopsis ovinia|19042C06|Mexico:Pue|1964
Atrytonopsis ovinia|19042C07|Mexico:Pue|1964
Atrytonopsis ovinia|19042C05|Mexico:Gro|1956
jAtrytonopsis ovinia|19042C04|Mexico:Gro|1958
Atrytonopsis ovinia|20062E11|Mexico:Oax|1988
iooAtrytonopsis ovinia|18118H11|Mexico:Oax|1992
Atrytonopsis ovinia|18119A01|Mexico:Chia|1975
Atrytonopsis ovinia|18118H12|Mexico:Chia|1992
Atrytonopsis ovinia|19024G02|Costa Rica|1993
100
Fig. 57. Phylogenetic trees of Atrytonopsis edwardsi (blue, with A. e. rupilius in red) and Atrytonopsis ovinia (violet) inferred
from protein-coding regions of a) the Z chromosome and b) the mitochondrial genome.
56
Mex” and not from “Guapiles.” However, our inspection of the syntype reveals that it agrees closely with
the original description and bears labels in a style typical of all syntypes by Schaus. One of them is the
identification label in his handwriting with this species’ name and the word “type.” It is difficult for us to
imagine that this specimen is not a true syntype, provided that all other species Schaus proposed based on
USNM material have extant syntypes in the collection. However, illustrations of specimens were not
known to be particularly accurate, and we hypothesize that there was a mistake in stating the locality of a
syntype in the original description: Guadljara was erroneously replaced with Guapiles in the publication
(Schaus 1913), maybe because both words start with “Gua”. Therefore, we regard this female “type,”
possibly the only specimen Schaus based his description of L. rupilius on, as a true syntype. To stabilize
nomenclature, N.V.G. hereby designates this specimen in the USNM collection bearing the following four
labels, 3" red and others white: [ Guadljara | Mex ], [ Lerodea ? | rupilius | type Schs ], [ Type | No. 16817
| U.S.N.M. J, [ GENITALIA NO. | X-1060 | J. M. Burns 1981 | as the lectotype of Lerodea ? rupilius
Schaus, 1913.
Morphologically, Burns (1983) identified the lectotype of L. rupilius as Atrytonopsis edwardsi W.
Barnes & McDunnough, 1916 (type locality in USA: Arizona, Pima Co.), therefore, ZL. rupilius is not a
junior subjective synonym of AZtrytonopsis ovinia zaovinia Dyar, 1913 (type locality in Mexico:
Puebla)—currently a junior subjective synonym of Atrytonopsis ovinia (Hewitson, 1866), (type locality in
Nicaragua)—as treated by Evans (1955). Genomic analysis confirms this assessment and places the
lectotype as sister to another specimen from Mexico: Jalisco (Fig. 57), thus also confirming the type
locality as Mexico: Jalisco, Guadalajara. The two specimens from Jalisco (Fig. 57 red) are genetically
differentiated from A. edwardsi specimens collected in the USA: Arizona and Texas and Mexico: Sonora
(Fig. 57 blue), forming a separate clade. Due to this genetic differentiation, we propose that L. rupilius is
a subspecies of Atrytonopsis edwardsi W. Barnes & McDunnough, 1916: Atrytonopsis edwardsi rupilius
(Schaus, 1913), comb. nov., stat. nov. Despite a large gap in their distributions, we note that neither COI
barcodes nor the whole mitochondrial genomes differentiate these subspecies, and we also see
mitochondrial introgression from A. ovinia to A. edwardsi (Fig. 57b, red and violet within the blue clade).
Vidius tanna (de Jong, 1983) comb. nov.
Genomic sequencing of the holotype of Cobalopsis tanna de Jong, 1983 (type locality in Suriname),
currently kept in its original genus, reveals that it is not monophyletic with Cobalopsis Godman, 1900
(type species Pamphila edda Mabille, 1891, which is a junior subjective synonym of Hesperia autumna
Pl6tz, 1882) and instead originates within Vidius Evans, 1955 (type species Narga vidius Mabille, 1891)
(Fig. 58). Therefore, we transfer this species from Cobalopsis to Vidius forming a new combination
Vidius tanna (de Jong, 1983), comb. nov.
a Vidius vet ee ieee ae b ro idius vidius|18043G12|PLT|Brazil:SP|old
Vidius vidius|18012H08|Brazil:PR|old ; idius vidius|18012H08|Brazil:PR|old
nuclear , Vidius similis|21046H12|Brazil:MG|1975 mitochondrial .Yjidius similis[21046H12|Brazil:MG|1975
=" Vidius similis]22108D08|Brazil:SC|1973 Vidius similis|22108D08|Brazil:SC|1973
50 Vidius dagon|19018G12|Brazil:GO|1956 0.02 fidius dagon|19018G12|Brazil:GO|1956
Weoius dagon|19017F01|Brazil:GO|1969
Nidius fraus|19018G08|Guatemalal|old
Vidius fraus|19018G09|Costa Ricalold
Vidius catocala|15036G03|LT|no datalold
Vidius catocala|21047H03|Peru|1981
idius cocalus|21047HO7|Peru:MD|1981
idius cocalus|21047H08|Peru:MD|1981
Wisius pompeoides|21047H05|Brazil:MG|1970
idius pompeoides|21047H06|Peru:Loreto|1971
Vidius tanna [not Cobalopsis]|22011B07|HT|Suriname
Nastra Ilherminier|3491|USA:TX,Hardin Co.|2015
Nastra perigenes|17111E06|USA:TX,Cameron Co.|1963
yeaa em autumna|15035A06|ST|Panama|1876
Obalopsis autumna|22109A04|Mexico:Ver|1973
1@obalopsis nero|19021C12|Panama|1979
Cobalopsis nero|19021D02|French Guiana|1993
gbalopsis valerius|17099E10|Guyana|1999
obalopsis valerius|19021D07|Panama|1973
1@aobalopsis dictys|19019H01|Panama|1979
Cobalopsis dictys|21013C10|Guatemala|old
* Vidius dagon|19017F01|Brazil:GO|1969
oo Vidius fraus|19018G08|Guatemalalold
idius fraus]|19018G09|Costa Ricalold
> Vidius catocala|15036G03|LT|no data|old
° Vidius catocala|21047H03|Peru|1981
) Vidius cocalus|21047H0O7|Peru:MD|1981
*Vidius cocalus|21047H08|Peru:MD|1981
oWidius pompeoides|21047H05|Brazil:MG|1970
Vidius pompeoides|21047H06|Peru:Loreto|1971
Vidius tanna [not Cobalopsis]|22011B07|HT|Suriname|1963
Nastra Iherminier|3491|USA:TX,Hardin Co.|2015
Nastra perigenes|17111E06|USA:TX,Cameron Co.|1963
Cobalopsis autumna|15035A06|ST|Panama|1876
**Cobalopsis autumna|22109A04|Mexico:Ver|1973
> Cobalopsis nero|19021C12|Panama|1979
° Cobalopsis nero|19021D02|French Guiana|1993
Cobalopsis valerius|17099E10|Guyana|1999
Cobalopsis valerius|19021D07|Panama|1973
Cobalopsis dictys|19019H01|Panama|1979
Cobalopsis dictys]21013C10|Guatemala|old
100
100
Fig. 58. Phylogenetic trees of Vidius (blue, with V. tanna comb. nov. in red) and Cobalopsis (violet) inferred from protein-
coding regions of a) the nuclear (autosomes) and b) the mitochondrial genomes.
ih
ACKNOWLEDGMENTS
This study is a direct continuation of the work we initiated with the late Paul A. Opler, our close
collaborator on genomic projects. We are most grateful to Paul and his wife Evi for participating in these
projects, sharing knowledge, discussions, insights, critiques, and numerous specimens they collected for
genomic research, which we used in this and future studies. We acknowledge Ping Chen and Ming Tang
for their excellent technical assistance. We are grateful to David Grimaldi and Courtney Richenbacher
(AMNH: American Museum of Natural History, New York, NY, USA), Jason Weintraub (ANSP: The
Academy of Natural Sciences of Drexel University, Philadelphia, PA, USA), Blanca Huertas, David Lees,
Alberto Zilli, and Geoff Martin (BMNH: Natural History Museum, London, UK), Chris Grinter, Denise
Montelongo, David Bettman, Vince Lee, and the late Norm Penny (CAS: California Academy of
Sciences, San Francisco, CA, USA), Jim Fetzner, Bob Androw, Vanessa Verdecia, Cat Giles, and the late
John Rawlins (CMNH: Carnegie Museum of Natural History, Pittsburgh, PA, USA), the late Paul Opler,
Chuck Harp, and the late Boris Kondratieff (CSUC: Colorado State University Collection, Fort Collins,
CO, USA), Jason Dombroskie (CUIC: Cornell University Insect Collection, Ithaca, New York, USA),
Crystal Maier and Rebekah Baquiran (FMNH: Field Museum of Natural History, Chicago, IL, USA),
Weiping Xie and Giar-Ann Kung (LACM: Los Angeles County Museum of Natural History, Los
Angeles, CA, USA), John R. MacDonald and Richard L. Brown (MEM: Mississippi Entomological
Museum, Starkville, MS, USA), Théo Léger, Viola Richter, Christoph L. Hauser, and Wolfram Mey
(MFNB: Museum fiir Naturkunde, Berlin, Germany), Andrei Sourakov, Andrew D. Warren, Debbie
Matthews-Lott, Riley J. Gott, and Keith R. Willmott (MGCL: McGuire Center for Lepidoptera and
Biodiversity, Florida Museum of Natural History, Gainesville, FL, USA), Rodolphe Rougerie (MNHP:
Muséum National d'Histoire Naturelle, Paris, France), Matthias Nuss and Manuela Bartel (MTD: Museum
fir Tierkunde, Dresden, Germany), Larry F. Gall (PMNH: Peabody Museum of Natural History, Yale
University, New Haven, CT, USA), Rob de Vos (RMNH: Naturalis Biodiversity Center, Leiden,
Netherlands), Martin Wiemers and Christian Kutzscher (SDEI: Senckenberg Deutsches Entomologisches
Institut, Miincheberg, Germany), Michael Falkenberg (SMNK: Staatliches Museum fiir Naturkunde,
Karlsruhe, Germany), Edward G. Riley, Karen Wright, and John Oswald (TAMU: Texas A&M
University Insect Collection, College Station, TX, USA), Alex Wild (TMMC: University of Texas
Biodiversity Center, Austin, TX, USA), Jeff Smith and Lynn Kimsey (UCDC: Bohart Museum of
Entomology, University of California, Davis, CA, USA), Robert K. Robbins, John M. Burns, and Brian
Harris (USNM: National Museum of Natural History, Smithsonian Institution, Washington, DC, USA),
and Axel Hausmann, Andreas Segerer, and Ulf Buchsbaum (ZSMC: Zoologische Staatssammlung
Miinchen, Germany), for granting access to the collections under their care, sampling specimens, and
stimulating discussions; to Dave Ahrenholz, Rich Bailowitz, Brian Banker, Gian C. Bozano, Jim P.
Brock, Ernst Brockmann, Bill R. Dempwolf, Mike Fisher, Howard Grisham, Cris S. Guppy, Robb
Hannawacker, Steve M. Spomer, and Mark Walker for specimens and leg samples, to Gerardo Lamas and
Jonathan P. Pelham for discussions, advice, helpful suggestions, patiently answering numerous questions,
and sharing their research files, to Ernst Brockmann for the help with deciphering abbreviations in
German, and to Bernard Hermier and Gerardo Lamas for critical review of the manuscript and many
helpful corrections. We are indebted to the California Department of Fish and Game for collecting permit
SC13645, Texas Parks and Wildlife Department (Natural Resources Program Director David H. Riskind)
for the research permit 08-02Rev, to U. S. National Park Service for the research permits: Big Bend
(Raymond Skiles) for BIBE-2004-SCI-0011 and Yellowstone (Erik Oberg and Annie Carlson) for YELL-
2017-SCI-7076, and to the National Environment & Planning Agency of Jamaica for the permission to
collect specimens. We acknowledge the Texas Advanced Computing Center (TACC) at The University of
Texas at Austin for providing HPC resources. This study was supported in part by the HHMI Investigator
funds and by grants from the National Institutes of Health GM127390 and the Welch Foundation I-1505
to N.V.G.
58
LITERATURE CITED
Bachtrog, D., K. Thornton, A. Clark, and P. Andolfatto. 2006. Extensive introgression of
mitochondrial DNA relative to nuclear genes in the Drosophila yakuba species group. Evolution
60(2): 292-302.
Bethune-Baker, G. T. 1908. Descriptions of new species of butterflies of the division Rhopalocera from
Africa and from New Guinea. Proceedings of the Zoological Society of London 1908: 110-126.
Brown, J. W., H. G. Real, and D. K. Faulkner. 1992. Butterflies of Baja California. Faunal survey,
natural history, conservation biology. The Lepidoptera Research Foundation, Inc.; Beverly Hills. v
+ 129 pp., 8 pls., 9 figs., maps.
Burns, J. M. 1983. Superspecies Atrytonopsis ovinia (A. ovinia plus A. edwardsi) and the nonadaptive
nature of interspecific genitalic differences (Lepidoptera: Hesperiidae). Proceedings of the
Entomological Society of Washington 84(3): 547-567.
Burns, J. M., D. H. Janzen, M. Hajibabaei, W. Hallwachs, and P. D. Hebert. 2008. DNA barcodes
and cryptic species of skipper butterflies in the genus Perichares in Area de Conservacion
Guanacaste, Costa Rica. Proceedings of the National Academy of Sciences of the United States of
America 105(17): 6350-6355.
Callaghan, C. J., and G. Lamas. 2004. Riodinidae. /n: Lamas, G. (Ed.). Checklist: Part 4A.
Hesperioidea - Papilionoidea. Association for Tropical Lepidoptera; Scientific Publishers;
Gainesville. 439 pp.
Cassie, B., J. Glassberg, A. Swengel, and G. Tudor. 2001. North American Butterfly Association
(NABA) checklist & English names of North American butterflies. Second Edition. North
American Butterfly Association; Morristown, NJ. 37 pp.
Cong, Q., J. Shen, D. Borek, R. K. Robbins, P. A. Opler, Z. Otwinowski, and N. V. Grishin. 2017a.
When COI barcodes deceive: complete genomes reveal introgression in hairstreaks. Proceedings
of the Royal Society B: Biological Sciences 284(1848): 20161735.
Cong, Q., J. Shen, W. Li, D. Borek, Z. Otwinowski, and N. V. Grishin. 2017b. The first complete
genomes of metalmarks and the classification of butterfly families. Genomics 109: 485—493.
Cong, Q., J. Shen, J. Zhang, W. Li, L. N. Kinch, J. V. Calhoun, A. D. Warren, and N. V. Grishin.
2021. Genomics reveals the origins of historical specimens. Molecular Biology and Evolution
38(5): 2166-2176.
Cong, Q., J. Zhang, and N. V. Grishin. 2019a. Genomic determinants of speciation. bioRxiv
BIORXIV/2019/83 7666.
Cong, Q., J. Zhang, J. Shen, X. Cao, C. Brevignon, and N. V. Grishin. 2020. Speciation in North
American Junonia from a genomic perspective. Systematic Entomology 45(4): 803-837.
Cong, Q., J. Zhang, J. Shen, and N. V. Grishin. 2019b. Fifty new genera of Hesperiidae (Lepidoptera).
Insecta Mundi 0731: 1—56.
Cramer, P. 1775-1780. De uitlandsche Kapellen voorkomende in de drie Waereld-Deelen Asia, Africa
en America. Papillons exotiques des trois parties du monde I'Asie, |'Afrique et l'Amérique. S.J.
Baalde; Utrecht, Barthelemy Wild and J. Van Schoonhoven & Comp.; Amsteldam.
Davey, J. W., M. Chouteau, S. L. Barker, L. Maroja, S. W. Baxter, F. Simpson, R. M. Merrill, M.
Joron, J. Mallet, K. K. Dasmahapatra, and C. D. Jiggins. 2016. Major improvements to the
Heliconius melpomene genome assembly used to confirm 10 chromosome fusion events in 6
million years of butterfly evolution. G3 (Bethesda) 6(3): 695-708.
Draudt, M. W. K. 1921-1924. B. Grypocera, breitképfige Tagfalter. /n: Seitz, A. (Ed.). Die Gross-
Schmetterlinge der Erde. Alfred Kernen; Stuttgart, pp. 833-1011, 1046-1139, pls 113B, 160-193.
Evans, W. H. 1949. A catalogue of the Hesperiidae from Europe, Asia, and Australia in the British
Museum (Natural History). The Trustees of the British Museum (Natural History); London. xix +
502 pp., 53 pls.
Evans, W. H. 1952. A catalogue of the American Hesperiidae indicating the classification and
nomenclature adopted in the British Museum (Natural History). Part II. Pyrginae. Section I. The
59
Trustees of the British Museum (Natural History); London. v + 178 pp., pls. 10—25.
Evans, W. H. 1953. A catalogue of the American Hesperiidae indicating the classification and
nomenclature adopted in the British Museum (Natural History). Part III. Pyrginae. Section 2. The
Trustees of the British Museum (Natural History); London. v + 246 pp., pls. 26—53.
Evans, W. H. 1955. A catalogue of the American Hesperiidae indicating the classification and
nomenclature adopted in the British Museum (Natural History). Part IV. Hesperiinae and
Megathyminae. The Trustees of the British Museum (Natural History); London. v + 499 pp., pls.
54-88.
Fruhstorfer, H. 1918. Revision der Gattung Castalius auf Grund der Morphologie der
Generationsorgane. Tijdschrift voor Entomologie 61(1/2): 17-44.
Geyer, C. 1837. 5: 43, pl. 196, figs. 983-984. Jn: Hiibner, J. (Ed.). Zutrage zur Sammlung exotischer
Schmetterlinge, bestehend in Bekanntmachung einzelner Geschlechter neuer oder seltener
nichteuropdischer Arten. Jacob Hiibner; Augsburg.
Godman, F. D. 1900. sections on Hesperiidae. /n: Godman, F. D., and O. Salvin (Eds.). Biologia
Centrali-Americana. Insecta. Lepidoptera-Rhopalocera. Dulau & Co., Bernard Quaritch; London,
pp. 2(157): 485-500, pls. 93-94.
Godman, F. D. 1907. Notes on the American species of Hesperiidae described by Pl6tz. Annals and
Magazine of Natural History (7)20(16): 132-155.
Hall, J. P. W. 2005. A Phylogenetic Revision of the Napaeina (Lepidoptera: Riodinidae: Mesosemiini).
The Entomological Society of Washington; Washington, DC. 236 pp. + 8 pls.
Hauser, C. L., D. Bartsch, J. Holstein, and A. Steiner. 2003. The Lepidoptera type material of G. A.
W. Herrich-Schaffer in the Staatliches Museum fiir Naturkunde, Stuttgart. Stuttgarter Beitrage zur
Naturkunde, Ser. A. 657: 1-78.
Hebert, P. D., A. Cywinska, S. L. Ball, and J. R. deWaard. 2003. Biological identifications through
DNA barcodes. Proceedings of the Royal Society B: Biological Sciences 270(1512): 313-321.
Herrich-Schaffer, G. A. W. 1869. Prodromus systematis lepidopterorum. Correspondenz-Blatt des
zoologisch-mineralogischen Vereines in Regensburg 23(12): 184-204.
Higgins, L. G. 1960. A revision of the Melitaeine genus Chlosyne and allied species (Lepidoptera:
Nymphalidae). Transactions of the royal entomological Society of London 112(14): 381—467.
Holland, W. J. 1891. Asiatic Lepidoptera. List of the diurnal Lepidoptera taken by Mr. William Doherty
of Cincinnati in Celebes, June and July 1887, with descriptions of some apparently new forms.
Proceedings of the Boston Society of Natural History 25: 52-82.
ICZN [International Commission on Zoological Nomenclature]. 1999. International code of
zoological nomenclature. Fourth edition. International Trust for Zoological Nomenclature;
London. xxx + 306 pp.
Kawahara, A. Y., C. Storer, A. P. S. Carvalho, D. M. Plotkin, F. L. Condamine, M. P. Braga, E. A.
Ellis, R. A. St Laurent, X. Li, V. Barve, L. Cai, C. Earl, P. B. Frandsen, H. L. Owens, W. A.
Valencia-Montoya, K. Aduse-Poku, E. F. A. Toussaint, K. M. Dexter, T. Doleck, A. Markee,
R. Messcher, Y. L. Nguyen, J. A. T. Badon, H. A. Benitez, M. F. Braby, P. A. C. Buenavente,
W. P. Chan, S. C. Collins, R. A. Rabideau Childers, E. Dankowicz, R. Eastwood, Z. F. Fric,
R. J. Gott, J. P. W. Hall, W. Hallwachs, N. B. Hardy, R. L. Hawkins Sipe, A. Heath, J. D.
Hinolan, N. T. Homziak, Y. F. Hsu, Y. Inayoshi, M. G. A. Itliong, D. H. Janzen, I. J.
Kitching, K. Kunte, G. Lamas, M. J. Landis, E. A. Larsen, T. B. Larsen, J. V. Leong, V.
Lukhtanov, C. A. Maier, J. I. Martinez, D. J. Martins, K. Maruyama, S. C. Maunsell, N. O.
Mega, A. Monastyrskii, A. B. B. Morais, C. J. Muller, M. A. K. Naive, G. Nielsen, P. S.
Padron, D. Peggie, H. P. Romanowski, S. Safian, M. Saito, S. Schroder, V. Shirey, D. Soltis,
P. Soltis, A. Sourakov, G. Talavera, R. Vila, P. Vlasanek, H. Wang, A. D. Warren, K. R.
Willmott, M. Yago, W. Jetz, M. A. Jarzyna, J. W. Breinholt, M. Espeland, L. Ries, R. P.
Guralnick, N. E. Pierce, and D. J. Lohman. 2023. A global phylogeny of butterflies reveals
their evolutionary history, ancestral hosts and biogeographic origins. Nature Ecology & Evolution
7(6): 903-913.
60
Lamas, G. 2004. Checklist: Part 4A. Hesperioidea-Papilionoidea. Association for Tropical Lepidoptera;
Scientific Publishers; Gainesville. 439 pp.
Li, W., Q. Cong, J. Shen, J. Zhang, W. Hallwachs, D. H. Janzen, and N. V. Grishin. 2019. Genomes
of skipper butterflies reveal extensive convergence of wing patterns. Proceedings of the National
Academy of Sciences of the United States of America 116(13): 6232-6237.
Lukhtanov, V. A., A. Sourakov, and E. Zakharov. 2016. DNA barcodes as a tool in biodiversity
research: testing pre-existing taxonomic hypotheses in Delphic Apollo butterflies (Lepidoptera,
Papilionidae). Systematics and Biodiversity 14: 599-613.
MacNeill, C. D. 1962. A preliminary report on the Hesperiidae of Baja California (Lepidoptera).
Proceedings of the California Academy of Sciences (4)30(5): 91-116.
Mayr, E. 1982. Of what use are subspecies? The Auk 99(3): 593-595.
Mielke, O. H. H. 2005. Catalogue of the American Hesperioidea: Hesperiidae (Lepidoptera). Sociedade
Brasileira de Zoologia; Curitiba, Parana, Brazil. xiii + 1536 pp.
Minh, B. Q., M. A. Nguyen, and A. von Haeseler. 2013. Ultrafast approximation for phylogenetic
bootstrap. Molecular Biology and Evolution 30(5): 1188-1195.
Monroe, B. L. 1982. A modern concept of the subspecies. The Auk 99(3): 608-609.
Nakahara, S., A. Zilli, J. V. Calhoun, M. Espeland, P. S. Padron, and N. V. Grishin. 2022. Resolving
two centuries of mistaken identity: Reinterpretation of Papilio marcus Fabricius, 1787
(Lepidoptera: Nymphalidae, Hesperiidae). Zootaxa 5195(3): 241-255.
Nguyen, L. T., H. A. Schmidt, A. von Haeseler, and B. Q. Minh. 2015. IQ-TREE: a fast and effective
stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and
Evolution 32(1): 268-274.
Pelham, J. P. 2008. Catalogue of the Butterflies of the United States and Canada. Journal of Research on
the Lepidoptera 40: 1-658.
Pelham, J. P. 2023. Catalogue of the Butterflies of the United States and Canada. Revised 23 February
2023. <http://www.butterfliesofamerica.com/US-Can-Cat.htm> (Last accessed November 2023).
Plétz, C. 1883. Die Hesperiinen-Gattung Hesperia Aut. und ihre Arten. Stettiner entomologische Zeitung
44(4/6): 195-233.
Powell, J. A. 1958. Additions to the knowledge of the butterfly fauna of Baja California Norte. The
Lepidopterists' News 12(1/2): 26-32.
Rambaut, A. 2018. FigTree, version 1.4.4. Available at http://tree.bio.ed.ac.uk/software/figtree/ (Last
accessed November 2023).
Robbins, R. K., Q. Cong, J. Zhang, J. Shen, R. C. Busby, C. Faynel, M. Duarte, A. R. P. Martins, C.
Prieto, G. Lamas, and N. V. Grishin. 2022. Genomics-based higher classification of the species-
rich hairstreaks (Lepidoptera: Lycaenidae: Eumaeini). Systematic Entomology 47(3): 445-469.
Robbins, R. K., and P. M. Henson. 1986. Why Pieris rapae is a better name than Artogeia rapae
(Pieridae). Journal of the Lepidopterists' Society 40(2): 79-92.
Rosa, A. H. B., N. Seraphim, P. A. Machado, P. E. Gueratto, T. Sobral-Souza, and A. V. L. Freitas.
2023. Eucorna sanarita (Schaus) (Riodinidae: Riodininae): Distribution, systematic position, and
conservation of a threatened brazilian butterfly in the Atlantic Forest biodiversity hotspot. Journal
of Insect Conservation 27(1): 167-179.
Santos, F. L. d., F. M. Dias, L. A. Leite, D. R. Dolibaina, M. M. Casagrande, and O. H. Mielke.
2014. Taxonomic notes on some species of Euselasia Hubner, [1819] from the "Uriiformes"
group, with the description of the immature stages of Euselasia satyroides Lathy, 1926, stat. rev.
(Lepidoptera: Riodinidae: Euselasiinae). Zootaxa 3869(5): 501-522.
Schaus, W. 1913. New species of Rhopalocera from Costa Rica. Proceedings of the zoological Society of
London 1913(3): 339-367.
Scott, J. A. 1986. The Butterflies of North America: A Natural History and Field Guide. Standford
University Press; Stanford, CA. xii + 583 pp.
Seraphim, N., L. A. Kaminski, P. J. Devries, C. Penz, C. Callaghan, N. Wahlberg, K. L. Silva-
Brandao, and A. V. L. Freitas. 2018. Molecular phylogeny and higher systematics of the
61
metalmark butterflies (Lepidoptera: Riodinidae). Systematic Entomology 43(2): 407-425.
Shen, J., Q. Cong, D. Borek, Z. Otwinowski, and N. V. Grishin. 2017. Complete genome of Achalarus
lyciades, the first representative of the Eudaminae subfamily of skippers. Current Genomics 18(4):
366-374.
Shen, J., Q. Cong, L. N. Kinch, D. Borek, Z. Otwinowski, and N. V. Grishin. 2016. Complete genome
of Pieris rapae, a resilient alien, a cabbage pest, and a source of anti-cancer proteins.
F1000Research 5: 2631.
Warren, A. D., K. J. Davis, E. M. Stangeland, J. P. Pelham, K. R. Willmott, and N. V. Grishin.
2023. Illustrated Lists of American Butterflies. [23-VI-2023] <https://www.butterfliesofamerica.
com/>.
Westwood, J. O. 1851. 2(48): 431-442, pls. 72-73. In: Doubleday, E. (Ed.). The genera of diurnal
Lepidoptera: comprising their generic characters, a notice of their habits and transformations, and
a catalogue of the species of each genus. Longman, Brown, Green & Longmans; London.
Zhang, J., Q. Cong, J. M. Burns, and N. V. Grishin. 2022a. Checking the checkered taxonomy of
Pl6tz's checkered skippers (Hesperiidae: Pyrgini). The Taxonomic Report of the International
Lepidoptera Survey 10(5): 1-31.
Zhang, J.. Q. Cong, and N. V. Grishin. 2023a. Thirteen new species of butterflies (Lepidoptera:
Hesperiidae) from Texas. Insecta Mundi 0969: I-58.
Zhang, J., Q. Cong, J. Shen, E. Brockmann, and N. V. Grishin. 2019a. Genomes reveal drastic and
recurrent phenotypic divergence in firetip skipper butterflies (Hesperiidae: Pyrrhopyginae).
Proceedings of the Royal Society B: Biological Sciences 286(1903): 20190609.
Zhang, J., Q. Cong, J. Shen, and N. V. Grishin. 2022b. Taxonomic changes suggested by the genomic
analysis of Hesperiidae (Lepidoptera). Insecta Mundi 0921: 1-135.
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2019b. Changes to North American
butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8(2): 1-11.
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2019c. Genomics of a complete butterfly
continent. bioRxiv BIORXIV/2019/829887.
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2020. Genomic evidence suggests further
changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8(7):
1-40.
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2021. Genomics-guided refinement of
butterfly taxonomy. The Taxonomic Report of the International Lepidoptera Survey 9(3): 1-54.
Zhang, J., Q. Cong, J. Shen, L. Song, and N. V. Grishin. 2022¢c. Genomic DNA sequencing reveals
two new North American species of Staphylus (Hesperiidae: Pyrginae: Carcharodini). The
Taxonomic Report of the International Lepidoptera Survey 10(4): I-13.
Zhang, J., Q. Cong, J. Shen, L. Song, and N. V. Grishin. 2023b. Butterfly classification and species
discovery using genomics. The Taxonomic Report of the International Lepidoptera Survey 11(3):
1-93.
Zhang, J., Q. Cong, J. Shen, L. Song, P. A. Opler, and N. V. Grishin. 2023c. Additional taxonomic
refinements suggested by genomic analysis of butterflies. The Taxonomic Report of the
International Lepidoptera Survey 11(1): 1-25.
Zhang, J., D. R. Dolibaina, Q. Cong, J. Shen, L. Song, C. G. C. Mielke, M. M. Casagrade, O. H. H.
Mielke, and N. V. Grishin. 2023d. Taxonomic notes on Neotropical Hesperiidae (Lepidoptera).
Zootaxa 5271(1): 91-114.
Zhang, J., J. Shen, Q. Cong, and N. V. Grishin. 2019d. Genomic analysis of the tribe Emesidini
(Lepidoptera: Riodinidae). Zootaxa 4668(4): 475—488.
62
The Taxonomic Report
is a platinum open access peer-reviewed publication of
The International Lepidoptera Survey (TILS)
The International Lepidoptera Survey is registered as a non-profit Limited Liability Company (LLC) in
the state of Virginia, U.S.A. The Taxonomic Report (TTR), ISSN 2643-4776 (print) / ISSN 2643-4806
(online) is published for the purpose of providing a public and permanent scientific record. Articles are
peer-reviewed but not necessarily through the anonymous editor-mediated review process. Typically, the
authors are encouraged to solicit reviews of their manuscripts from knowledgeable lepidopterists before
submission. TTR appears in digital, open-access form, is disseminated as a hardcopy to select institutional
repositories, and is available as printed copy upon request at the discretion of authors and/or the editor.
Printing and postage charges may apply. An initial run of 25 copies is printed on paper to meet ICZN
Code recommendation 8B. All published TTR articles are freely available at the archival TTR website
(http:/lepsurvey.carolinanature.com/report.html) and via the following digital repositories:
Internet Archive (https://archive.org/)
Biodiversity Heritage Library (https://www.biodiversitylibrary.org)
Zobodat (https://www.zobodat.at/)
Zenodo (https://zenodo.org)
Digital Commons (https://digitalcommons.unl.edu)
TILS Purpose
TILS is devoted to the worldwide collection of Lepidoptera for the purpose of scientific discovery,
determination, and documentation, without which there can be no preservation.
TILS Motto
“As a world community, we cannot protect that which we do not know”
Articles for publication are sought
Manuscripts may deal with any area of research on Lepidoptera, including faunal surveys, conservation
topics, life histories and foodplant records, matters of nomenclature, descriptions of new taxa, methods,
etc. Taxonomic papers are particularly welcome. There are no publication charges for authors. Before
submitting a manuscript, email TTR editor, Harry Pavulaan, 606 Hunton Place NE, Leesburg, VA,
20176, USA at [email protected] (cc: to [email protected] if you do not receive a reply
within one week) to initiate discussion on how to best handle your material for publication, and to discuss
peer review options.
Visit The International Lepidoptera Survey on the World Wide Web at:
http://lepsurvey.carolinanature.com
&
Join the discussion at our list serve on Groups.1o at:
https://groups.io/g/TILS
You can subscribe by sending an email to: [email protected]
&
Join The International Lepidoptera Survey on Facebook at:
https://www.facebook.com/groups/1072292259768446
63
BHL
i
Blank Page Digitally Inserted