Volume 8 Number 3
The Taxonomic Report
OF THE INTERNATIONAL LEPIDOPTERA SURVEY
ISSN 2643-4776 (print) / ISSN 2643-4806 (online-)
Designation of a Neotype for Oeneis melissa (Fabricius, 1775)
and a Lectotype for Oeneis polixenes (Fabricius, 1775)
(Lepidoptera: Nymphalidae: Satyrinae)
CRISPIN s. GUPPY
5 Boss Road, Whitehorse, YT Y1A 5S9 Canada, [email protected]
ABSTRACT. The Oeneis melissa (Fabricius, 1775) “neotype” designations of Lukhtanov and Eitschberger (2000;
2001) do not meet several critical requirements of the ICZN and are therefore invalid. In addition, the locality data is too vague
to be taxonomically useful, their “neotype” specimen is a specimen of the taxon generally known as O. melissa semplei, and
acceptance of their specimen as neotype would change the meaning of the taxon Oeneis melissa. Hence, I reject their neotype
designation. A neotype Oeneis melissa (Fabricius, 1775) is designated from Nain, Labrador with careful consideration of the
Articles of the International Code of Zoological Nomenclature. The ‘barcode’ mtDNA (COl gene) structure for the neotype is
provided.
The original number of type specimens of Oeneis polixenes (Fabricius, 1775) is unknown and a holotype was not
designated explicitly or through implication; therefore, the type specimens are syntypes. There is one specimen that has been
identified as a syntype of O. polixenes in the Natural History Museum in London (formerly the British Museum of Natural
History), and no other extant specimens are known. I have expressly and deliberately designated the specimen in the collection
of the Natural History Museum in London, as the lectotype of Oeneis polixenes (Fabricius, 1775) (ICZN Article 74.7.3) to fix a
specific phenotype for the name.
Additional key words: Taxonomy, nomenclature.
INTRODUCTION
The two butterflies Oeneis melissa and Oeneis polixenes (Nymphalidae: Satyridae) were described
by Johann Christian Labricius in 1775 (Labricius 1775, pp. 484 and 513). The original descriptions are
provided below in Ligure 1. The type(s) of Oeneis melissa were from the Joseph Banks collection.
18 November 2019
Fig. 1: Transcriptions and Translations of Original Descriptions of Oeneis polixenes and Oeneis melissa.
DISCUSSION
1. JOSEPH BANKS AS THE COLLECTOR OF THE TYPE SPECIMENS
For O. polixenes , the stated type locality of “America boreali” (= northern America) is minimally
helpful in identifying where the type specimen(s) were collected; anywhere in northeastern North
America could have been the source of the specimen(s). For O. melissa , the stated type locality of “insula
Terre neuve Americae” (= Newfoundland; for which “Terre-neuve” is the modern French language name)
must have been an error, because Oeneis melissa has not otherwise been found on the island of
Newfoundland (Layberry et al , 1998).
Joseph Banks may either have collected the type specimens himself, or they may have been given
to him. According to his diaries (in: Lysaght, 1971) and his biography by Lysaght (1971), he visited
Newfoundland and Labrador in 1766 aboard the ship Niger. The primary purpose of Niger’s voyage was
to construct a blockhouse at Chateau Bay on the Labrador coast. Banks stayed in St. John’s,
Newfoundland for a month commencing 11 May, with snow still on the ground, to 11 June. Neither O.
polixenes nor O. melissa would have been in flight by June 11; therefore, they could not have come from
St. John’s.
Banks then sailed to Croque, Newfoundland on June 11, 1766 and collected in the vicinity during
June. He was ill through most of July and kept no diary and did little collecting. O. melissa is unknown
from the island of Newfoundland, and O. polixenes is unknown from the eastern side of Newfoundland
where Croque is located. Hence Banks could not have collected the type specimens at Croque. On 6
August he sailed for Chateau Bay on the Labrador coast, where he remained until 3 October (Lysaght,
1971).
The flight season in Labrador for resident (non-migratory), single-brooded, non-hibernating
butterflies is early June to late August (GBIF database). There are 116 unique combinations of Oeneis
species / locality / date records in Labrador, which provides a reasonable sample size. The latest flight
date for the four species of Oeneis that occur in Labrador (O. jutta , O. polixenes , O. melissa and O. bore)
is August 23, with all records from July 13 onward being for northern Labrador (north of 55°N) for O.
polixenes and O. bore (there are no August records for O. jutta or O. melissa). Chateau Bay is in southern
Labrador at 51.98°N, and therefore Oeneis there can reasonably be expected to have completed their flight
period before the end of July.
2. TYPE LOCALITIES
Pelham (2008) defined the type locality of both O. polixenes and O. melissa as Chateau Bay,
Labrador on the basis of Banks’ visit there. There are several reasons for this being unlikely for O.
melissa :
1. The most southern known locality for Oeneis melissa on the Labrador coast is 200 km to the
north, at Cartwright. Chateau Bay is therefore not within the known range of Oeneis melissa.
2. Habitats near Chateau Bay appear to be a mix of low elevation barren rounded bedrock and
conifer forest, neither of which is suitable habitat for O. melissa (viewed on Google Earth).
3. The flight season for Oeneis melissa in southern Labrador (if it is present) can be expected to
end before August 6.
In contrast, O. polixenes may occur near Chateau Bay, with suitable habitat apparently being
present (dry tundra and bogs), and O. polixenes has been collected on Belle Isle (GBIF database), less
than 35 km off-shore from Chateau Bay, and about 82 km southwest along the coast at LAnse-au-loup
2
(N. Kondla specimens). The dominant habitat on Belle Isle appears to be similar to that near Chateau Bay
(viewed on Google Earth). However, the flight season for O. polixenes in southern Labrador can also be
expected to end before August 6. Specimens of O. polixenes from southern Labrador (Blanc Sablon,
L'Anse-au-loup, L’Asne-au-clair) in the collection of Norbert Kondla are dated June 30 to July 5.
Therefore, it is unlikely that Banks collected the type specimens of either O. melissa or O.
polixenes near Chateau Bay, Labrador, although collection of O. polixenes during a late flight season
cannot be completely ruled out.
After his stay at Chateau Bay, Banks returned to Croque (all butterflies would have ceased flight
by that time), then a week later to St. John’s, and then after another two weeks returned to Europe. Banks
returned to London on 30 January 1767. Commencing in 1768 he sailed for three years on James Cook’s
first voyage, he then visited Iceland in 1772, and in 1773 he made his last voyage abroad to Holland
(Lysaght, 1971). Therefore, it is impossible for Banks to have personally collected the type specimens of
Oeneis melissa or O. polixenes after 1766.
Other possible sources for the O. melissa and O. polixenes types are either Moravian missionaries
based in Greenland (and thence Labrador), or Captain George Cartwright. Both are known to have
provided Banks with natural history specimens from the Labrador coast (Lysaght, 1971).
George Cartwright made his first visit to Labrador in 1766, where he met Banks. When he
returned in 1768, he decided to become a trader on the Labrador coast. There is no indication that he
supplied Banks with natural history specimens in the period 1766 - 1768. from 1770 to 1775 Cartwright
was based at Lodge Bay, Labrador (Cartwright 1792). Lodge Bay is 180 km south of the nearest known
occurrence (Cartwright, NL) of O. melissa , and is therefore far outside the known range of O. melissa. It
is therefore very unlikely that any O. melissa were collected there. Lodge Bay is within the range of O.
polixenes , but there is no evidence one way or the other whether Cartwright collected any specimens
there. It is therefore unlikely that the type specimen(s) of O. melissa and/or O. polixenes were collected
near Lodge Bay 1770-1775, but it cannot be completely ruled out for O. polixenes.
In 1775 George Cartwright founded what is now the modern town of Cartwright. A letter from
Cartwright to Banks (Lysaght, 1971, p. 265-66) dated October 12, 1775 refers to a lack of collecting
equipment for “Elys”, suggesting an intent to collect insects for Banks. However, that letter also makes it
clear that Cartwright had collected very few natural history specimens for Banks to that date, and
apparently he did not collect “Elys” in 1775. It is therefore unlikely that the type specimen(s) of O.
melissa and/or O. polixenes were collected by George Cartwright near Cartwright in 1775, but it cannot
be completely ruled out because both species are known to occur near Cartwright.
The Moravian Missions in Greenland sent their first missionaries to Labrador in 1752 but were not
a major influence until after 1770 (Lysaght, 1971). They were at Davis Inlet in 1765 (where O. melissa is
likely to occur), and founded Nain in 1770 (where O. melissa and O. polixenes are known to occur),
Okkak in 1775 (where O. melissa and O. polixenes are likely to occur), and Hopedale in 1781 (where O.
melissa and O. polixenes are known to occur). Banks had plants in his collection from the latter three
settlements, sent to him by the Moravian missionaries (Lysaght, 1971); however, only Nain was
established prior to the publication of the name melissa. Therefore, Moravian missionaries could have
supplied Banks with the O. melissa and/or O. polixenes type(s), and Nain is the most likely location for
the specimens to have come from. However other locations along the central and northern Labrador coast
cannot be completely ruled out.
3
3. TYPE SPECIMENS
The type specimens of both O. melissa and O. polixenes can reasonably be assumed to have come
from Labrador. The British colonial government of Newfoundland governed the Labrador coast during
the 18th Century, resulting in the modern province of “Newfoundland and Labrador”, hence the error in
the specified type locality for O. melissa is not unreasonable. The type locality of “America boreali” for
O. polixenes could be anywhere in Newfoundland and Labrador.
The type specimen(s) of Oeneis melissa were in the Joseph Banks collection at the time the
species was described by Fabricius (1775). The type(s) of O. melissa are now apparently lost (Zimsen,
1964), and Butler (1869 [1870]) could not find any specimen(s) in the Banksian Collection in the British
Museum. Miller and Brown (1981), Lukhtanov and Eitschberger (2000; 2001), and Pelham (2008) also
considered the original type specimen(s) of Oeneis melissa (Fabricius, 1775) to be lost. At my request,
Kim Goodger, Curator of Butterflies at the Natural History Museum of London, searched the Joseph
Banks insect collection, but was not able to locate any specimen that might be a type of Oeneis melissa.
The only butterfly type specimen in the Banks Collection that is associated with the name “ melissa ” is a
specimen of Precis sinuata (Nymphalidae), the phenotype of which does not approximate the original
description of Oeneis melissa.
The type specimen(s) of Oeneis polixenes were in the Joseph Banks collection at the time the
species was described by Fabricius (1775). Butler (1869 [1870]) recorded one specimen of O. polixenes
(as O. bore) in the British Museum collection, which was noted as “Presented 1845, by Dr. Thienemann”
and therefore is not a type specimen of O. polixenes due to the date. There is apparently only one type
specimen of O. polixenes presently in the Natural History Museum in London (formerly, British Museum
of Natural History).
EXISTING “NEOTYPES” OF OENEIS MELISSA FABRICIUS, 1775
A “neotype” of Oeneis melissa (Fabricius, 1775) has twice been designated by Lukhtanov and
Eitschberger (2000 and 2001) (Figures 2-4). Neither of these neotype designations, separately or
together, fulfills the requirements of Article 75 of the International Code of Zoological Nomenclature
(ICZN 1999). The following requirements (paraphrased for brevity) were not met: Article 75.3.2 A
statement of distinguishing characters for the taxon; Article 75.3.5 Evidence that the neotype is consistent
with the original description; and Article 75.3.6 Evidence that the neotype came from as near as
practicable from the original type locality. The “neotype” is therefore not a neotype under the ICZN,
because it does not meet the requirements for a neotype.
The requirements of the ICZN (1999) should be consistently followed to ensure nomenclatural
stability. The Oeneis melissa “neotype” designations of Lukhtanov and Eitschberger (2000; 2001) do not
meet several critical requirements of the ICZN and are therefore invalid. In addition, the locality data is
too vague to be taxonomically useful.
For the sake of nomenclatural stability, my first thought was to simply re-designate, in a manner
that meets the provisions of the ICZN, the specimen of Lukhtanov and Eitschberger (2000; 2001) as the
neotype of O. melissa. Unfortunately, the original melissa description of “Wings dark brown above,
unspotted. Posterior below white and black variegated” does not correspond to the neotype specimen
selected by Lukhtanov and Eitschberger (2000; 2001). Failure to meet ICZN Article 75.3.5 - evidence
that the neotype is consistent with the original description, and Article 75.3.6 - evidence that the neotype
came from as near as practicable from the original type locality, apparently led Lukhtanov and
Eitschberger (2000; 2001) to designate a specimen of a different taxon as the “neotype” of O. melissa.
4
Fig. 2. Designation of “neotype” of Oeneis melissa Fig. 3. Illustration of “neotype” of Oeneis melissa
(Fabricius, 1775) by Lukhtanov and Eitschberger (Fabricius, 1775) by Lukhtanov and Eitschberger
(2001) - transcription of text: (2000) - transcription of text and copy of images:
Photographs by Ulf Eitschberger & Joerg Nappert 2003, with permission.
Fig. 4. Images of data labels of Oeneis melissa (Fabricius, 1775) “neotype” designated by Lukhtanov and
Eitschberger (2000 and 2001).
Specimens from the north coast of Labrador do match the original description of O. melissa.
Specimens from Nain, Hopedale, and Hebron have “Wings dark brown above, unspotted. Posterior below
white and black variegated”. This is an area that Moravian Missionaries could have obtained specimens
and sent them to Joseph Banks. The neotype designated by Lukhtanov and Eitschberger (2000; 2001) has
a different phenotype and appears to be the taxon generally known as O. melissa semplei , which occurs
from “Quebec, interior Labrador, and Hudson’s Bay” (Layberry et al. 1995). The semplei specimen of
Lukhtanov and Eitschberger (2000; 2001) may be from Smokey Mountain near Labrador City, which is at
this time the most accessible (by a highway) interior Labrador location with melissa habitat. Acceptance
(through re-designating) of the Lukhtanov and Eitschberger (2000; 2001) “neotype” would result in
semplei becoming a synonym of melissa and leave the taxon on the north coast of Labrador without a
name. This is not acceptable, and accordingly I designate below a neotype for Oeneis melissa (Fabricius,
1775).
4. DESIGNATION OF A VALID NEOTYPE FOR OENEIS MELISSA (FABRICIUS, 1775)
The original type specimen(s) of Oeneis melissa (Fabricius, 1775) did not originate from the
nominal type locality of Newfoundland and could have come from various locations. The type(s) came
from somewhere along the Labrador coast, but the exact location cannot be determined (see previous
sections). A name-bearing type of Oeneis melissa (Fabricius, 1775) is necessary to define the nominal
taxon objectively to allow a taxonomic review of the species, and I have determined that there are no
extant specimens identifiable as the type(s) of Oeneis melissa (ICZN Articles 75.1, 75.2, 75.3.4).
5
The vicinity of Nain, Labrador is a reasonable choice for the type locality, and is at least as
probable as any other location along the northern Labrador coast (ICZN Article 75.3.6). I therefore select
a specimen as neotype with the specific locality data of “Nain, Labr.”, which is as near as practical to the
original type locality (ICZN Article 75.3.6) as discussed above.
The selected location of Nain, Labrador for the neotype is consistent with the selection of
Hopedale, Labrador for the neotype of Oeneis taygete Geyer, [1830] by dos Passos (1949). Nain and
Hopedale are only 150 km apart on the coast of Labrador with similar ecological characteristics.
However, Hopedale was founded after the description of O. melissa , and therefore is very unlikely to be
the source of the type(s).
The neotype specimen (a female) and its data labels are illustrated in Figure 5. The neotype
specimen is in the Canadian National Collection of Insects and Arthropods (CNC), Ottawa, Canada
(ICZN Article 75.3.7). The neotype corresponds to the original description of melissa (ICZN Article
75.3.5) in having wing fringes of alternating patches of white and brown scales (“dentate”), the overall
colour of the upperside is “dark brown” and “unspotted”, and the underside of the hindwings is “gray-
marbled” / “white and black variegated”. The data label reads “Nain Labr July 8, 1970”; the collector is
unknown.
Dorsal view
Ventral View
Data labels
Neotvoe Specimen 'barcode' mtDNA structure (COD
I
■ NEOTYPE
ID *,/■< B P[apilioj. N[ymptialis). P[halerata],
Nucleotide Seauence: AACTTTATATTTTATTTTTGGAATTTGAGCAGGCATAGTAG
GAACATCTCTTAGCCTTATTATTCGAACAGAATTAGGTAACCCAGGATCTTTAATTG
G AG ATG ATC A AATTT AT AAT ACT ATTGTT AC AGCTC ATGCTTTT ATCAT AATTTTTTT
TATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTATTCCCCTTATACTT
GGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGACTTTTACCT
CCTTCCTTAATACTATTAATTTCAAGTAGTATTGTTGAAAATGGAGCAGGAACAGG
ATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCTCATAGAGGATCTTCTGTTGA
TTTAGCAATTTTTTCCTTACATTTAGCTGGAATTTCCTCTATTTTAGGAGCTATTAAT
TTT ATT AC AACAATT ATT AAT ATACG AATT AAT AAT AT AAATT ATG ATCAAAT ACCTT
TATTTGTTTGAGCTGTAGGAATTACAGCTTTATTATTATTACTTTCTCTTCCTGTACT
AGCTGGAGCAATTACCATACTTCTTACAGATCGAAATTTAAATACTTCATTTTTTGA
Specimen ID Melissa Fabricius, 1775
nnrinM 7 = Oeneis melissa (Fabricius, 1775)
UU * 1 UO !/ Designated 2019 by C.S. Guppy
Photographs by C.S. Guppy, 2019. Photographs may be reproduced wit
TCCCGCAGGAGGAGGAGATCCTATTTTATACCAACATTTATTT
Fig. 5. Neotype of Oeneis melissa Fabricius, 1775
The distinguishing characters for the taxon (ICZN Article 75.3.2) are the dark brown, unspotted
colour of the dorsum and the “gray-marbled” / “white and black variegated” ventral hindwings. The
‘barcode’ mtDNA nucleotide sequence is also provided in Figure 5. I submitted one leg of the neotype
specimen to the Barcode of Life laboratory at the University of Guelph to obtain the ‘barcode’ - a 658
base pair portion of the cytochrome oxidase I (COI) mtDNA gene, and the data is available through the
public BOLD database. The ‘barcode’ structure is apparently unique to the species “Oeneis melissa ”,
although the structure may be present in more than one subspecies (C.S. Guppy, in prep.).
6
5. DESIGNATION OF A LECTOTYPE FOR OENEIS POLIXENES (FABRICIUS, 1775)
The original number of type specimens of Oeneis polixenes (Fabricius, 1775) is unknown and a
holotype was not designated explicitly or through implication; therefore, the type specimens are syntypes
(ICZN Article 73). There is one specimen that has been identified as a syntype of O. polixenes in the
Natural History Museum in London (formerly the British Museum of Natural History), and no other
extant specimens are known. The BMNH accession number is ‘63 48’, with the original accession number
label still attached to the specimen (Figure 6). The BMNH register indicates that specimen number ‘63
48’ was from ‘America’ and was a Fabrician type. The material was part of the Joseph Banks collection
that came to the museum via the Linnaean Society (John Chainey, pers. comm. Feb. 2015). The current
catalogue number label is BMNH(E) 668188. This specimen of O. polixenes is not that listed by Butler
(1869 [1870]) (John Chainey, pers. comm. Feb. 2015).
There are at least two different phenotypes (potentially different species or subspecies) of O.
polixenes in Labrador, one inhabiting northern tundra habitats and one inhabiting southern Labrador with
at least some populations in bog habitats (C.S. Guppy, in prep.). I expressly and deliberately designate the
specimen shown in Figure 6, in the collection of the Natural History Museum in London, as the lectotype
of Oeneis polixenes (Fabricius, 1775) (ICZN Article 74.7.3) to fix a specific phenotype for the name.
7
CONCLUSION
The Oeneis melissa (Fabricius, 1775) “neotype” designations of Lukhtanov and Eitschberger
(2000; 2001) do not meet several critical requirements of the ICZN and are therefore invalid. In addition,
the locality data is too vague to be taxonomically useful, and their “neotype” specimen is a specimen of
the taxon generally known as O. melissa semplei , and acceptance of their specimen as neotype would
change the meaning of the taxon Oeneis melissa. Hence, I reject their neotype designation.
A neotype Oeneis melissa (Fabricius, 1775) is designated from Nain, Labrador with careful
consideration of the Articles of the International Code of Zoological Nomenclature. A name-bearing type
of Oeneis melissa (Fabricius, 1775) is necessary to define the nominal taxon objectively to allow a
taxonomic review of the species, and I have determined that there are no extant specimens identifiable as
the type(s) of Oeneis melissa (ICZN Articles 75.1, 75.2, 75.3.4). The vicinity of Nain, Labrador is a
reasonable choice for the type locality, and is at least as probable as any other location along the northern
Labrador coast (ICZN Article 75.3.6). A female specimen has been selected as neotype with the specific
locality data of “Nain", which is as near as practical to the original type locality (ICZN Article 75.3.6).
The neotype specimen is in the Canadian National Collection of Insects and Arthropods (CNC), Ottawa,
Canada (ICZN Article 75.3.7). The neotype corresponds to the original description of melissa (ICZN
Article 75.3.5) in having wing fringes of alternating patches of white and brown scales (“dentate”), the
overall colour of the upperside is “dark brown” and “unspotted”, and the underside of the hindwings is
“gray- marbled” / “white and black variegated”. The ‘barcode’ mtDNA (COl gene) structure for the
neotype is provided.
The original number of type specimens of Oeneis polixenes is unknown and a holotype was not
designated explicitly or through implication; therefore, the type specimens are syntypes (ICZN Article
73). There is one specimen that has been identified as a syntype of O. polixenes in the Natural History
Museum in London (formerly the British Museum of Natural History), and no other extant specimens are
known. There are at least two different phenotypes (potentially different species or subspecies) of O.
polixenes in Labrador, one inhabiting northern tundra habitats and one inhabiting southern Labrador with
at least some populations in bog habitats. I have expressly and deliberately designated the specimen in the
collection of the Natural History Museum in London, as the lectotype of Oeneis polixenes (Fabricius,
1775) (ICZN Article 74.7.3) to fix a specific phenotype for the name.
ACKNOWLEDGMENTS
Norbert G. Kondla provided comments and suggestions throughout the many years this paper has
been in progress. Christian Schmidt provided access to the specimens in the Canadian National Museum
of Insects and Arthropods (Ottawa, Canada). Many others have provided specimens of Oeneis and
taxonomic comments for my on-going research on the genus.
LITERATURE CITED
Butler, Arthur Gardiner. 1869 [1870]. Catalogue of diurnal Lepidoptera described by Fabricius in the
collection of the British Museum. London; Taylor & Francis [Order of the Trustees, British Museum],
8vo: v + 303 pp.; 3 pis.
Cartwright, George. 1792. A Journal of Transactions and Events, During a Residence of Nearly Sixteen
Years on the Coast of Labrador; Containing Many Interesting Particulars, Both of the Country and Its
Inhabitants, Not Hitherto Known. 3 vol.: [xxii]; x; x, 287; 505; 248, 15pp. Newark.
Dos Passos, Cyril F. 1949. The distribution of Oeneis tarygete Geyer in North America with descriptions
of new subspecies (Lepidoptera, Satyridae). American Museum Novitates 1399: 1-21.
Fabricius, J.C. 1775. Systerna Entomologiae, sistens insectorum classes, ordines, genera, species, adiectis
synonymis, locis, descriptionibus, observationibus. Officina Libraria Kortii, Flensburgi et Lipsiae
[Flensburg and Leipzig, Germany], 8 vol: pp. xxxii + 832.
International Commission on Zoological Nomenclature [ICZN]. 1999. International Code of Zoological
Nomenclature. Fourth Edition. London: International Trust for Zoological Nomenclature, xxix + 306 pp.
Layberry, R. A., P. W. Hall and J. D. Lafontaine. 1998. The Butterflies of Canada. University of Toronto
Press. 280.
Lukhtanov, Y.A. and U.F.J. Eitschberger. 2000. Butterflies of the world. Part 11: Nymphalidae V, Oeneis.
Kektern: Goeke & Evers and Canterbury: Hillside Books. 12 pp. + pi. A + 26 pi. + pi. B.
Lukhtanov, V.A. and U.F.J. Eitschberger. 2001. Catalogue of the genera Oeneis and Davidina
(Nymphalidae, Satyrinae, Oeneini). Butterflies of the world, Supplement 4. Kektern: Goeke & Evers. 37
pp.
Lysaght, A.M. 1971. Joseph Banks in Newfoundland and Labrador, 1766: His Diary, Manuscripts and
Collections. Berkeley, CA: University of California Press. 512 pp.
Miller, L.D., and F.M. Brown. 1981. A catalogue/checklist of the butterflies of America north of Mexico.
Lepidopterists’ Society Memoir 2: i-vii, 1-280.
Pelham, J.P. 2008. A catalogue of the butterflies of the United States and Canada, with a complete
bibliography of the descriptive and systematic literature. Journal of Research on the Lepidoptera 40: i-
xiv+1-658.
Zimsen, Ellen. 1964. The type material of I. C. Fabricius. Copenhagen: Munksgaard. 656 pp.
9
The Taxonomic Report
is a publication of
The International Lepidoptera Survey (TILS)
The International Lepidoptera Survey is registered as a non-profit Limited Liability Company (LLC) in
the state of Virginia, U.S.A. The Taxonomic Report (TTR) is published for the purpose of providing a
public and permanent scientific record. It appears in digital, open-access form, is regularly disseminated
in hardcopy form to select institutional repositories and is also available as printed copy upon request at
the discretion of authors and/or the editor. Printing and postage costs may apply. Contents are peer-
reviewed but not necessarily through the anonymous review and comment process preferred by some
publishers of serial literature. Copies of all TTR papers are available via the following digital
repositories: Internet Archive (https://archive.org/) . Biodiversity Heritage Library
(https://www.biodiversitvlibrary.org) , Zobodat (https://www.zobodat.at/) and at the archival TTR website:
( http://lepsurvev.carolinanature.com/report.html ).
TILS Purpose
TILS is devoted to the worldwide collection of Lepidoptera for the purpose of scientific discovery,
determination, and documentation, without which there can be no preservation.
TILS Motto
“As a world community, we cannot protect that which we do not know”
Articles for publication are sought
They may deal with any area of research on Lepidoptera, including faunal surveys, conservation topics,
methods, etc. Taxonomic papers are especially welcome. There are no page charges for authors. Before
sending a manuscript, simply write to TTR editor, Harry Pavulaan, 606 Hunton Place NE, Leesburg,
VA, 20176, USA to initiate discussion on how to best handle your material for publication, and to discuss
peer review options; or email to intlepsurvev@ gmail.com .
Visit The International Lepidoptera Survey on the World Wide Web at:
http://lepsurvey.carolinanature.com
&
Join the discussion at our list serves on Yahoo! Groups at:
http://groups.yahoo.com/group/TILS-leps-talk/
http://groups.yahoo.com/group/TILS-moth-rah/
10