Volume 8 Number 7 6 November 2020
The Taxonomic Report
OF THE INTERNATIONAL LEPIDOPTERA SURVEY
ISSN 2643-4776 (print) / ISSN 2643-4806 (online)
Genomic evidence suggests further changes of butterfly names
Jing Zhang’, Qian Cong’, Jinhui Shen’, Paul A. Opler’ and Nick V. Grishin'*”
"Howard Hughes Medical Institute and Departments of Biophysics and Biochemistry, University of Texas Southwestern
Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390-9050, USA;
*Institute for Protein Design and Department of Biochemistry, University of Washington,
1959 NE Pacific Street, HSB J-405, Seattle, WA, 98195, USA;
* Department of Agricultural Biology, Colorado State University, Fort Collins, CO 80523-1177, USA.
“Corresponding author: [email protected]
ABSTRACT. Further genomic sequencing of butterflies by our research group expanding the coverage of species and
specimens from different localities, coupled with genome-scale phylogenetic analysis and complemented by phenotypic
considerations, suggests a number of changes to the names of butterflies, mostly those recorded from the United States and
Canada. Here, we present evidence to support these changes. The changes are intended to make butterfly classification more
internally consistent at the genus, subgenus and species levels. I.e., considering all available evidence, we attempt to assign
similar taxonomic ranks to the clades of comparable genetic differentiation, which on average is correlated with the age of
phylogenetic groups estimated from trees. For species, we use criteria devised by genomic analysis of the genetic
differentiation across suture zones and comparison of sympatric populations of closely related species. As a result, we resurrect
4 genera and | subgenus from subgeneric status or synonymy, change the rank of 8 currently used genera to subgenus,
synonymize 7 genus-group names, summarize evidence to support 19 taxa as species instead of subspecies and 1 taxon as
subspecies instead of species, along with a number of additional changes. One new genus and one new subspecies are
described. Namely, the following taxa are treated as genera Tharsalea Scudder, 1876, Helleia Verity, 1943, Apangea Zhdanko,
1995, and Boldenaria Zhdanko, 1995. Tetracharis Grote, 1898 is a valid subgenus (not a synonym of Anthocharis Boisduval,
Rambur, [Duménil] & Graslin, [1833]) that consists of Anthocharis cethura C. Felder & R. Felder, 1865 (Miller, 1764),
Anthocharis midea (Hubner, [1809]), and Anthocharis limonea (A. Butler, 1871). The following are subgenera: Speyveria
Scudder, 1872 of Argynnis Fabricius, 1807; Aglais Dalman, 1816 and Polygonia Hubner, [1819] of Nymphalis Kluk, 1780;
Palaeonympha Butler, 1871 of Megisto Hubner, [1819]; Hyponephele Muschamp, 1915 of Cercyonis Scudder, 1875; Pyronia
Hubner, [1819] and Aphantopus Wallengren, 1853 of Maniola Schrank, 1801 and Pseudonymphidia Callaghan, 1985 of
Pachythone. Lafron Grishin, gen. n. (type species Papilio orus Stoll, [1780], parent subfamily Lycaeninae [Leach], [1815]) is
described. Dipsas japonica Murray, 1875 is fixed as the type species of Neozephyrus Sibatani & Ito, 1942. The following taxa
are junior subjective synonyms: Falcapica Klots, 1930 of Tetracharis Grote, 1898; Habrodais Scudder, 1876, Favonius
Sibatani & Ito, 1942, Neozephyrus Sibatani & Ito, 1942, Quercusia Verity, 1943, Chrysozephyrus Shirdzu & Yamamoto, 1956,
and Sibataniozephyrus Inomata, 1986 of Hypaurotis Scudder, 1876; Plesioarida Trujano & Garcia, 2018 of Roeberella Strand,
1932; Papilio temenes Godart, 1819 (lectotype designated herein) of Heraclides aristodemus (Esper, 1794), Speyeria hydaspe
conquista dos Passos & Grey, 1945 of Argynnis hesperis tetonia (dos Passos & Grey, 1945), and Erycides imbreus Plotz, 1879
of Phocides polybius polybius (Fabricius, 1793). The following are revised genus-species combinations: Pachythone lencates
(Hewitson, 1875) Pachythone flocculus (Brévignon & Gallard, 1993), Pachythone floccus (Brévignon, 2013), Pachythone
heberti (P. Jauffret & J. Jauffret, 2007), Pachythone marajoara (P. Jauffret & J. Jauffret, 2007) and Cissia cleophes (Godman
& Salvin, 1889). The following species are transferred between subgenera: Anthocharis lanceolata Lucas, 1852 belongs to
Anthocharis Boisduval, Rambur, [Duménil] & Graslin, [1833] instead of Paramidea Kuznetsov, 1929 and Danaus eresimus
(Cramer, 1777) belongs to Danaus Kluk, 1780, and not to Anosia Hubner, 1816. The following taxa are distinct species rather
than subspecies (of species shown in parenthesis): Heraclides ponceana (Schaus, 1911) (not Heraclides aristodemus (Esper,
1794)), Colias elis Strecker, 1885 (not Colias meadii W. H. Edwards, 1871), Argynnis irene Boisduval, 1869 and Argynnis
nausicaa W. H. Edwards, 1874 (not Argynnis hesperis W. H. Edwards, 1864), Coenonympha california Westwood, [1851] (not
Coenonympha tullia (Muller, 1764)), Dione incarnata N. Riley, 1926 (not Dione vanillae (Linnaeus, 1758)), Chlosyne
coronado (M. Smith & Brock, 1988) (not Chlosyne fulvia (W. H. Edwards, 1879)), Chlosyne chinatiensis (Tinkham, 1944)
(not Chlosyne theona (Ménétriés, 1855)), Phocides lilea (Reakirt, [1867]) (not Phocides polybius (Fabricius, 1793)),
I
Cecropterus nevada (Scudder, 1872) and Cecropterus dobra (Evans, 1952) (not Cecropterus mexicana (Herrich-Schaffer,
1869)), Telegonus anausis Godman & Salvin, 1896, (not Telegonus anaphus (Cramer, 1777)), Epargyreus huachuca Dixon,
1955 (not Epargyreus clarus (Cramer, 1775)), Nisoniades bromias (Godman & Salvin, 1894) (not Nisoniades rubescens
(Moschler, 1877)), Pholisora crestar J. Scott & Davenport, 2017 (not Pholisora catullus (Fabricius, 1793)), Carterocephalus
mandan (W. H. Edwards, 1863) and Carterocephalus skada (W. H. Edwards, 1870) (not Carterocephalus palaemon (Pallas,
1771)), Amblyscirtes arizonae H. Freeman, 1993 (not Ambiyscirtes elissa Godman, 1900), and Megathymus violae D. Stallings
& Turner, 1956 (not Megathymus ursus Poling, 1902). Resulting from these changes, the following are revised species-
subspecies combinations: Heraclides ponceana bjorndalae (Clench, 1979), Heraclides ponceana majasi L. Miller, 1987,
Argynnis irene dodgei Gunder, 1931, Argynnis irene cottlei J. A. Comstock, 1925, Argynnis irene hanseni (J. Emmel, T.
Emmel & Mattoon, 1998), Argynnis nausicaa elko (Austin, 1984), Argynnis nausicaa greyi (Moeck, 1950), Argynnis nausicaa
viola (dos Passos & Grey, 1945), Argynnis nausicaa tetonia (dos Passos & Grey, 1945), Argynnis nausicaa chitone W. H.
Edwards, 1879, Argynnis nausicaa schellbachi (Garth, 1949), Argynnis nausicaa electa W. H. Edwards, 1878, Argynnis
nausicaa dorothea (Moeck, 1947), and Argynnis nausicaa capitanensis (R. Holland, 1988), Argynnis zerene atossa W. H.
Edwards, 1890, Dione incarnata nigrior (Michener, 1942), Chlosyne coronado pariaensis (M. Smith & Brock, 1988),
Cecropterus nevada aemilea (Skinner, 1893), Cecropterus nevada blanca (J. Scott, 1981), Telegonus anausis annetta (Evans,
1952), Telegonus anausis anoma (Evans, 1952), Telegonus anausis aniza (Evans, 1952), Epargyreus huachuca profugus
Austin, 1998, Carterocephalus mandan mesapano (Scudder, 1868) and Carterocephalus skada magnus Mattoon & Tilden,
1998. American Coenonympha subspecies placed under C. tullia other than Coenonympha tullia kodiak W. H. Edwards, 1869,
Coenonympha tullia mixturata Alpheraky, 1897 and Coenonympha tullia yukonensis W. Holland, 1900 belong to C. california.
Heraclides ponceana latefasciatus Grishin, ssp. n. is described from Cuba. Argynnis coronis carolae dos Passos & Grey, 1942
is considered a subspecies-level taxon. Unless stated otherwise, all subgenera, species, subspecies and synonyms of mentioned
genera and species are transferred together with their parent taxa, and others remain as previously classified.
Key words: taxonomy, classification, genomics, phylogeny, biodiversity.
ZooBank registration: http://zoobank.org/9A8DCBC8-A9D5-4083-B640-BA5101827478
INTRODUCTION
DNA-based phylogenies (Zuckerkandl and Pauling 1965) revolutionized the way we view animal
classification and taxonomy, including butterflies (Mutanen et al. 2010). Previously relying on several
carefully selected gene markers, DNA methods have evolved towards sequencing and comparison of
whole genomes. Genome-scale approaches aim at utilizing all DNA of an organism and thus are most
comprehensive and accurate, frequently revealing inconsistencies between phylogeny and current
classification (Kawahara and Breinholt 2014; Espeland et al. 2018; Allio et al. 2019; Li et al. 2019; Zhang
et al. 2019a; Zhang et al. 2019b). Our research group genome-sequenced all butterfly species recorded
from the United States and Canada (USC) (Zhang et al. 2019d) and proposed refinements to butterfly
taxonomy (Zhang et al. 2019c). Currently we are working on extending our genomic datasets to cover
subspecies and populations, in addition to species from other parts of the world. Review of these datasets
suggests additional changes based on the analysis of phylogenetic trees and genetic variation between and
within species. Here, we present these results after explaining the general logic and methods behind them.
Total DNA is extracted from a leg (or other parts of a butterfly), fragmented into short pieces
(unless the specimen is old and DNA is already degraded) and sequenced in 150 base pair (bp) segments.
Thus, every fragment of DNA present in the sample is getting sequenced, resulting in the coverage of the
entire genome, both nuclear and mitochondrial, coding and non-coding (Zhang et al. 2019a). Because this
approach can sequence very short DNA (e.g. 25-50 bp), even very old specimens with degraded DNA
yield usable data (Cong et al. 2019a). In this work, we mostly use DNA sequences of protein-coding
genes, which are computationally selected from the total pool of DNA sequences to match a known
protein set of a butterfly. Butterflies typically have nearly 15 thousand genes, and the total number of base
pairs that we get for phylogenetic analysis is about 10 million (Cong et al. 2015; Zhang et al. 2019d). For
comparison, a good dataset of gene markers typically covers less than 10 thousand base pairs. Due to the
vast size of genomic datasets, phylogenies resulting from them are usually reliable. Reliability of each
node in the tree is indicated by a number next to that node, the closer it is to 1, the more reliable is the
node. Furthermore, the genotype encodes phenotype, thus, all the features of wing patterns and
2
morphology of butterflies and their life stages (including caterpillar foodplant preferences) are encoded in
these genomic sequences. For this reason, the genomic dataset we sequence may be the best
representation of a butterfly (richer than a pinned adult specimen that we visually inspect), given a
meaningful approach to analyze these genomes.
Armed with genome-scale phylogenetic trees, we have ventured to propose taxonomic changes.
The majority of the changes discussed below deal with a change of rank in the classification. For genus-
group names, we have changed the rank of taxa from genus to subgenus, or move between valid names
and synonyms. For species-group names, mainly we have changed the rank of subspecies to species. The
reason for these changes is to bring these categories in better agreement with their definitions, although
such definitions are never precise and are continuously being refined with additional knowledge gained.
A genus is defined as a monophyletic group (a clade in an accurate phylogenetic tree) of related
species that is below the level of a tribe or subtribe. Currently, there are no objective criteria for grouping
Species into genera. However, the genus level is probably more important than any other classification
level above species, because a species name contains a genus name as the first word. Therefore, for its
optimal practical use, a genus should be defined neither too stringently to encompass only a small group
of very close relatives, nor should it be too broadly defined to include too distant relatives. Subjectively,
taxonomists follow their own intuition about where to draw a boundary of a genus. Our thoughts on the
criteria for a genus are discussed in the Taxonomic Appendix to Li et al. (2019) and the Introduction in
Grishin (2019). First, a genus should be a major and prominent phylogenetic group (i.e., it is best if the
phylogenetic tree branch leading to the last common ancestor of the genus is longer than the nearby
branches). Secondly, genetic diversity is a function of the time since the origin of a genus. Theoretically, a
genus may be defined as all ancestors of a species that lived at some given point in the past. Practically
this definition can be applied through a narrow slice across a time-calibrated phylogenetic tree at a
specific time point (Talavera et al. 2012; Li et al. 2019). While it is not possible to establish a distance
cutoff using COI barcodes (or any other gene markers) when defining a genus due to the reasons
explained by Trujano-Ortega et al. (2020), a comparison of COI distances may be instructive and should
be used as evidence combined with other considerations. Provided these general criteria, it is also best if
most genera are in agreement with how they are currently defined (mostly using phenotypic
considerations, such as similarity in appearance), to avoid additional name changes. Further examples of
how we apply these principles to specific cases are given in the Discussion section below.
Meaningful groups of species within a genus can be given a rank of subgenus. Subgenera are
useful to define clades that are not as prominent as a genus, but represent groups of very close relatives,
mostly recognizable immediately by their appearance as such. Although frequently frowned upon and
synonymized or treated as a genus instead, a subgenus is one of just eight levels of the ICZN Code
hierarchy of names (ICZN 1999). The number of levels in a phylogenetic tree is larger than these eight
categories. Therefore, it seems wasteful to ignore the level that 1s aimed at refining the classification and
indicating phylogenetic substructure within a large and diverse genus. We use subgenus category freely
and suggest that many groups currently viewed as genera may be subgenera instead: it seems more
valuable to stress their relatedness by uniting them in a broader genus, yet indicating their distinction by
keeping them as subgenera. We believe that the consistency criterion is of importance here as well. Le.,
groups defined as subgenera in one lineage should correspond to subgenera of comparable genetic
differentiation and time of origin in another lineage.
Species definitions (~concepts) have been extensively addressed in the literature (Mallet 1995).
Comparing many species concepts that have been proposed (Aldhebiani 2018), our view is closest to what
Claridge (2017) described as a "broadly based biological species concept", which seems similar to the
"genomic integrity species definition" of Sperling (2003). I.e., species are defined by some reproductive
barrier, which is not absolute but porous (Mallet et al. 2016); hybrids are characterised by lower fitness
and usually are eliminated from the population, thus allowing each species to maintain its genetic
uniqueness (=integrity) that persists in time despite on-going hybridization with other species. This
definition does not include phenotypic distinction between species, and allows for a possibility of
"cryptic" species that look superficially indistinguishable, but are to some extent reproductively isolated
3
from each other. Equally, this definition does not exclude hybrid species, 1.e. those that originate by a
significant gene influx of one species into a population of another that occurred over a relatively short
period of time. If this population that experienced the influx persists in time and is reproductively isolated
from both of its parent species to the extent comparable to isolation in other related species, then it can be
called a hybrid species, in particular, if it expands its range and further diversifies.
Traditionally, species are defined by morphological distinctiveness. Morphological distinctiveness
accumulates with time as a result of reproductive isolation, but it does not necessarily contribute to it.
Therefore, using a morphological consideration does not provide direct evidence of reproductive isolation
and thus speciation. On the contrary, using genomic DNA sequences, we can study reproductive isolation
directly and look for segments of DNA from different species in a species' genome under study. Presence
of such segments would indicate hybridization and the fraction of such segments would indicate the
extent of hybridization. Thus, analysis of genomic sequences may be the best practical approach to
species definition available today.
We carried out a study to devise genomic criteria for distinguishing different species from
populations of the same species (Cong et al. 2019b). We studied sister butterfly populations across a
central Texas suture zone. Suture zones are geographic boundaries common for many pairs of closely
related species (counterparts) (Remington 1968). This central Texas suture zone is old (Newton 2003),
therefore pairs that attained species status across it are likely to be more strongly isolated reproductively
than more recently speciated pairs. Therefore, our criteria obtained using this old zone are likely to be
conservative. We analyzed transcriptomes (mostly protein-coding RNA) of 25 pairs of western and
eastern counterparts around the central Texas suture zone. Some of these counterparts were different
species like Heraclides cresphontes (Cramer, 1777) and H. rumiko Shiraiwa & Grishin, 2014, others were
populations of the same species from the north and south Texas, e.g. Hylephila phyleus (Drury, 1773).
We found that two DNA-based measures best separate distinct species from conspecific
populations. These measures were fixation index (Fst) and the extent of gene flow (measured by Gmin),
both computed on the sex Z chromosome-encoded genes. Male butterflies have two Z chromosomes,
while females have one Z and one W, which is a special female chromosome. Fst is frequently used in
population genomics. Fst compares DNA divergence of specimens within each population (or species) to
DNA divergence between populations (species). Fst ranges between 0 and 1. If Fst between two
populations is low, near 0, then these populations are similar to each other. If Fst is high, above 0.5, then
these two populations differ and are likely to be different species. Gmin is the fraction of segments of a
different population (species) in a genome of a given population (species), thus it gives an estimate of
gene exchange between populations or species (Geneva et al. 2015). Values of Gmin near 0 indicate the
lack of gene exchange between populations suggesting that these populations are different species. Higher
Gmin corresponds to more gene exchange and the lack of reproductive barrier meaning conspecificity.
These two measures (Fst and Gmin) partition the 25 pairs of counterparts into two distinct and
well-separated groups: the one corresponding to little genetic isolation and thus being the same species,
and the other characterized by higher Fst (more than 0.2) and smaller Gmin (less than 0.06, 1.e. about 6%),
which corresponds to distinct species. Studies on human populations show that maximal Fst between
human populations is about 0.2 (Nelis et al. 2009) and our species (Homo sapiens) has about 1.5% - 2.1%
genes introgressed from Neanderthals (Homo neanderthalensis) (Wall and Yoshihara Caldeira Brandt
2016). Therefore, our criteria applied to humans confirm that modern humans are the same species, but
Neanderthal was a distinct species.
In this work, we compute Fst/Gmin on population pairs that we test for a possibility that they
represent distinct species. When the values are, for instance 0.45/0.01, then it is most likely that we are
dealing with distinct species (Fst is above 0.2 and Gmin is below 0.06). However, if the values we get are
0.16/0.2, then these populations are conspecific (Fst is below 0.2 and Gmin is above 0.06). These criteria
are useful, but they should not be taken absolutely and separately from other evidence. While large Fst
values above 0.5 and small Gmin values below 0.01 are more definitive indicators of speciation, when
they are closer to the "gray zone" (e.g. Fst is between 0.18 and 0.25 and Gmin between 0.03 and 0.07)
further evidence is necessary. Additional problem may arise with siblings that are low in genetic diversity,
4
because their genomes are various recombinations of their parents' genomes, or with inbred populations,
for a similar reason. Inclusion of these closely related individuals elevates Fst due to low diversity within
siblings or inbred populations. To avoid this undesirable effect, we used specimens from different
localities when possible.
We also analyzed COI barcode divergence, which for distinct species is typically above 2% in the
presence of phenotypic distinctiveness (Hebert et al. 2003) and inspect genomic trees. It should be taken
into account that less than 2% barcode divergence has been reported for distinct species (Burns et al.
2007). Conversely, due to introgression, conspecific individuals may differ in their barcodes by more than
2% (Zakharov et al. 2009; Cong et al. 2017).
Furthermore, distinct species usually form distinct and well-supported clades (support values near
1 by these clades) in phylogenetic trees. Branches supporting distinct species are typically longer than
internal branches within a subtree of conspecific specimens. Each terminal branch in the tree is usually
long, because of individual variation and uniqueness of each specimen, and also because sequencing
errors and contaminations (not being common for any pair of specimens) tend to be reflected in the
terminal branch. For conspecific populations, specimens may be intermixed in the trees, or support values
for separation of populations are smaller (closer to 0 than to 1), due to significant gene exchange between
these populations, when some genes cluster individuals differently from other genes.
Yet another advantage of genomic analysis is its robustness to small number of specimens
analyzed. Phenotypic analysis must rely on a large number of specimens to gauge the range of variation,
which is shaped by the interactions of genotype with the environment. DNA variation is not affected by
the environment, and each specimen contains two genomes: from mother and from father, which in turn
contain information from "grandparents". Therefore, even a couple of specimens from distant localities
(i.e. no close kinship) is sufficient to estimate intraspecific variation with reasonable accuracy.
For brevity, we do not review phenotypic differences between most of the taxa we deal with, and
interested readers should consult other publications. All these taxa have been previously described and
their phenotypic characters given elsewhere. These characters do not contribute to our decision to change
ranks of these taxa, although they may be looked at as complementary supporting evidence that increases
confidence in the results. The evidence presented here is based on genomic analysis. The data we offer are
new and they allow us to interpret known phenotypic differences between these taxa from a different and
complementary perspective. The purpose of this work is to propose taxonomic changes that are gleaned
from genomic data, so that the new name combinations can be used in other publications. A more detailed
evolutionary analysis of genomic data will be published elsewhere.
The taxonomic rearrangements we propose are supported by genome-scale phylogenetic trees, Fst
and Gmin statistics, and sometimes complemented by phenotypic considerations. The sections are
presented in standardized format. The taxonomic act is the title of each section. Relevant genera,
subgenera and their type species, are specified. When the species are listed with their original genus
name, author names are given without parenthesis. For each species and subspecies with revised rank,
type locality is given. A section is usually illustrated with a small segment of a nuclear genomic tree (or
other trees as stated in the text) including taxa necessary to support the conclusions. Previous, not newly
proposed, genus-species and species-subspecies combinations are used in the figures (per Pelham 2020
<http://www.butterfliesofamerica.com/US-Can-Cat.htm>, version revised 7 August 2020, except those
name changes adopted before this publication based on our genomic results). New name combinations are
given in the text. Taxa of major focus are shown in red, other taxa of interest are shown in blue, magenta
or green. The section ends with a conclusion and in many cases with a list of species with revised genus-
Species or species-subspecies name combinations. The sections are ordered by family and typically in
their taxonomic order from Zhang et al. (2019d) (except in Nymphalidae, where the arrangement was
altered to better fit larger images on pages while keeping them next to relevant text). Finally, whole
genome shotgun datasets we obtained and used in this work are available from the NCBI database
<https://www.ncbi.nlm.nih.gov/> as BioProject PRJNA672791, and BioSample entries of the project
contain the locality and collection data of the specimens sequenced.
Family Papilionidae Latreille, [1802]
Heraclides ponceana (Schaus, 1911) is a species
distinct from Heraclides aristodemus (Esper, 1794)
Initially proposed as a species and currently treated as a subspecies of Heraclides aristodemus (Esper,
1794) (type locality Haiti), Papilio ponceana Schaus, 1911 (type locality USA: Florida, Miami) shows
profound genetic differentiation from H. aristodemus by a magnitude characteristic of species-level taxa.
Phylogenetic trees reveal partitioning of the taxa previously placed in H. aristodemus into two prominent
clades, including the tree constructed from proteins encoded by the Z chromosome (Fig. 1). The Fst
between H. a. ponceana and H.
GaraRaes aristodemus ‘temenes' Ce eet
. 7 : 2 —— raclides aristodemus ‘temenes'|14101H 03IMICuba Guantanamo|1900
aristodemus populations 1S 0.43, ane Heraclides Siecotents eo cee FL,Key Largo|1i972
hi h : di h x 0.28 -—— as eee eer Sie lesa Rll Upper Key ae
ee Heraclides aristodemus bjorndalae|15021409|M|Bahamas, Great Inagua Islan
whic In icates t cir strong r Heraclides areas Blomdalae|275 Seen sie bala North Caicos Island|1990
: * 4s : : Heraclides aristodemus temenes ub
differentiation, and Gmin 1S 0.02, o i ih otebadlc pa aristodemus Perea eee
hi h l h : fa an eraclides ce ta Hehe 18079F08 St IMiCabalprior to aes
; Heraclides aristodemus aristodemus|2882|M|Dominican Republic:Pedernale to El Ace|2013
whic suggests OW gene CXC ange roa Heraclides aristademus aristodemus|2880|M|Dominican Republic: Padernales, road ae El Ace|2013
h f h = Heraclides aristodemus temenes|18079F07|ST|M|Cubalprior to 1819|MNHP
between them. COI barcodes of the
Fig. 1. Heraclides ponceana (red: new ssp., magenta) and H. aristodemus (blue).
two also differ by 3.2% (~21
different base pairs). Moreover, it 1s possible (see below) that H. a. ponceana and H. aristodemus are (or
were) sympatric in Cuba. Therefore, we reinstate Heraclides ponceana (Schaus, 1911) as a species-level
taxon. Due to their genetic and morphological similarities, we consider Heraclides ponceana bjorndalae
(Clench, 1979) (type locality Bahamas: Great Inagua Island) and Heraclides ponceana majasi L. Miller,
1987 (type locality Bahamas: Crooked Island) to be subspecies of H. ponceana, new combinations.
Papilio temenes Godart, 1819 is a junior subjective synonym
of Heraclides aristodemus (Esper, 1794)
The short version of the original description of Papilio temenes Godart, 1819 (page 21) is: "Dessus des
ailes d'un brun-noirdtre, avec deux bandes jaunes, maculaires, disposées en sautoir sur les supérieures: les
inférieures en queue: le dessous de celles-ci jaunatre, avec une bande bleue, flexueuse, sur le milieu"
(Godart 1819). It can be translated word-for-word as: "Above the wings of a blackish-brown, with two
bands yellow, macular, arranged in sautoir [=crosswise] on the forewings: the hindwings [end] in tail: the
underside of these [hindwings, not tails] yellowish, with a band blue, flexuous, in the middle", and
interpreted as: "Wings above blackish-brown, forewings with two yellow macular bands that cross each
other, hindwings with tails, underside of hindwings yellowish with a blue flexuous band in the middle."
Perhaps the most significant word here is "sautoir" defined in Dictionary.com as "A ribbon, chain, scarf,
or the like, tied around the neck in such a manner that the ends cross over each other" (Dictionary.com
LLC 2020), and by Merriam-Webster dictionary as "a chain, ribbon, or scarf worn about the neck with the
ends forming a St. Andrew's cross in front" (Merriam-Webster 2020). It is important because this
character (crosswise vs. more parallel arrangement of yellow forewing bands) is diagnostic of H.
aristodemus (crosswise) vs. H. ponceana (more parallel, images in Warren et al. (2016)). Today, the name
temenes is applied to a broad-banded form of H. ponceana that flies in Cuba (see below). Here we argue
that this is a misidentification, and the Godart's temenes is H. aristodemus instead.
We see that, although the Godart's description of P. temenes is brief, two of its details agree better
with H. aristodemus than with the broad-banded subspecies of H. ponceana from Cuba: crisscrossing
bands and blue flexuous band. In the broad-banded subspecies, the outer band is more parallel to the inner
band and does not give an impression of crossing it. And the blue spots on the hindwing underside look
more like a row of lunules than an irregular blue band. In H. aristodemus, forewing bands indeed give an
impression of crossing bands, and the blue spots on the hindwing below look like an irregular blue band.
Furthermore, an extended description of P. temenes on page 63 states that the forewing bands are narrow
and macular ("étroites, maculaires") (Godart 1819), instead of being broad and continuous. Besides this
6
additional detail, the extended description reiterates other points of the short description. We note that
some H. aristodemus females may have broader and more continuous yellow bands that are more similar
to those in H. ponceana (Fig. 2e), but the P. temenes description does not mention this possibility,
simplifying the application of the name.
Next, we inspected all potential syntypes of P. temenes, two specimens in Paris, France (Fig. 2ab)
and one (only photograph inspected) in Edinburg, UK (Bland 2019). These 3 specimens closely agree
with the original description of P. temenes, carry historical labels and labels indicating their type status
("type", "co-type", or "?co-type") and therefore are likely to be true syntypes of this taxon. These
Specimens phenotypically are H. aristodemus and not H. ponceana, differing from the broad-banded
subspecies from Cuba. Furthermore, we sequenced two syntypes in Paris (one labeled "TYPE", the other
labeled "CO-TYPE") and they are H. aristodemus by genomic DNA (Fig. | blue), in agreement with their
wing patterns. In conclusion, our analysis of the original description and the likely syntypes leaves little
doubt about the identity of P. temenes as H. aristodemus, which is a species different from the broad-
banded H. ponceana "temenes" found on Cuba today (Fig. 1 red).
temenes
temenes
MNHP
,{ MUSEUM DE PARIS
DNA sample ID:
NVG-18079F08
c/o Ni ishin
temenes
temenes
FMNH ZMHB
DNA sample ID; S
NVG-14102A07 Rveeisnsned
Nick V. Grishii ji
c/o Nick V. Grishin c/o Nick V. Grishin
Tipi/e ar) ato aemes
Soon ‘Camenes
temenes
LACM
DNA sample !D:
ZMHB
DNA sample ID;
NVG-15029C11
c/o Nick V. Grishin
latefasciatus ssp. n.
kV. Grishin
AMNH
ie DNA sample ID: 1
NVG-14101H10 ‘ estion
c/o Nick V. Grishin
latefasciatus ssp. n.
latefasciatus ssp. Nn.
Fig. 2. Heraclides aristodemus (a—e) and H. ponceana (f-h). Green arrows point at equivalent positions in different specimens.
Due to misapplication of the name temenes to a taxon different from that in the original description
and for the future stability of the name, we designate the syntype in the Muséum National d'Histoire
Naturelle, Paris, France (MNHP) shown in Fig. 2a and possessing all the characters stated in the original
description, with the following 4 rectangular white (Some faded to brownish) labels: printed red || TYPE ||;
7
framed, lined and printed with green, first line handwritten in black || Anc. Collection | MUSEUM DE
PARIS ||; printed, with a square barcode on the right side || MNHN, Paris | EL63126 ||; printed || DNA
sample ID: | NVG-18079F07 | c/o Nick V. Grishin ||, the lectotype of Papilio temenes Godart, 1819. The
red, rectangular, printed label || LECTOTYPE < | Papilio temenes | Godart, 1819 | designated by Grishin
|| will be added to this specimen. This specimen was chosen as the lectotype because it is labeled "type"
rather than "co-type", and it yielded genomic dataset of a good quality for a specimen that old.
It appears that Oberthtir (1897) was the first to incorrectly apply the name P. temenes to the broad-
banded subspecies of H. ponceana from Cuba, inconsistently with the original description and now with
the identity of the lectotype of P. temenes. Oberthiir illustrated one such specimen. While we have not
investigated the reasons behind Oberthiir's mistake, we note that it has been followed in subsequent
literature. Interestingly, we found 3 century-old H. aristodemus (i.e. true P. temenes) specimens labeled
"Cuba", in ZMHB and FMNH (Fig. 2c—e). Further studies may answer the question whether both species
(H. aristodemus and H. ponceana) co-occurred in Cuba, or the old records from Cuba were mislabeled.
In summary, we conclude that Papilio temenes Godart, 1819, syn. n., is a junior subjective synonym
of Heraclides aristodemus (Esper, 1794). The type locality of temenes should remain as stated on page 63
(Godart 1819): "Antilles & dans l'Amérique septentrionale", i.e., "West Indies and North America", which
is not necessarily Cuba. It remains to be investigated whether H. aristodemus has been found or still
occurs in Cuba. In any case, as detailed above, the broad-banded subspecies of H. ponceana from Cuba
does not have a name, and it is described here as new.
Heraclides ponceana latefasciatus Grishin, new subspecies
http://zoobank. org/C835D721-548C-4822-9280-E241A1C94866
(Figs. 1, 2fh)
Definition. This taxon differs from H. aristodemus in that the outer band of yellow spots on the forewing
is more parallel to the inner band (and the outer margin) rather than approaching the inner band at an
angle and giving an appearance of crossing the inner band; on the hindwing below there are more
prominent red spots and more crescent-shaped blue spots that are better separated from each other, rather
than forming a continuous band. This subspecies differs from all other H. ponceana subspecies by broader
yellow central bands on both wings, less extensive brown coloration on the forewings below, a paler basal
area and the lack of red spotting in the postdiscal area on hindwing above.
Type locality. Cuba: Guantanamo province, Rio Seco, San Carlos Estate.
Distribution. Known only from Cuba.
Etymology. The broad yellow bands are the most distinctive feature of this subspecies. The name is
formed from the Latin words /atus (wide, broad) and fascia (band, stripe). The name is an adjective.
Type material. Holotype male (Fig. 2g), deposited in the American Museum of Natural History, New
York, NY, USA (AMNH), with the following 4 rectangular white (some faded to brownish) labels:
printed, the date crossed out || San Carlos Est. | Guantanamo | Cuba. 4-8-8 ||; handwritten || May 1 '00
||; printed with the numbers handwritten || Am. Mus. Nat. Hist. | Dept. Invert. Zool. | No. 20976 ||; printed
|| DNA sample ID: | NVG-14101H09 | c/o Nick V. Grishin ||. The red, rectangular, printed label ||
HOLOTYPE < | Heraclides ponceana | latefasciatus Grishin || will be added to this specimen. Ten
paratypes (when known, localities are given in parenthesis after specimen numbers): 5 males (NVG-
14101H10 in AMNH and NVG-14106A11 (Matanzas), NVG-14106A12 (Santiago), NVG-14106B01
(Guantanamo) & NVG-14106B02 in USNM) and 5 females (NVG-14114B09 & NVG-14114B10 in
LACM and NVG-14106B03 & NVG-15104A01 (both from Santiago) & NVG-15104A02 in USNM).
Barcode sequence of the holotype. aacattatatTTTaTTTTTGGTGTTTGAGCAAGAATATTAGGAACTTCTCTTAGTTTATTA
ATTCGAACTGAATTAGGAACTCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACCATTGTTACAGCTCATGCTTTTATTATAATTTTTT
TTATGGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCATTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAA
TATAAGATTTTGACTTTTACCTCCTTCTTTAACTCTTTTAATTTCAAGTATAATTGTCGAAAATGGAGCTGGAACTGGATGAACTGTTTATCCT
8
CCCCTTTCTTCTAATATTGCTCATGGAAGAAGTTCAGTAGATTTAGTTATTTTTTCTCTTCATTTAGCGGGTATTTCTTCAATTTTAGGAGCAA
TTAATTTTATTACTACTATTATTAACATGCGAATTAATAGAATATCCTTTGATCAAATACCTTTATTITGTTTGAGCTGTAGGAATTACAGCTTT
ATTATTACTCTTATCCTTACCCGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTTICATTCTTTGATCCTGCAGGA
GGAGGAGATCCTATTCTATACCAACACTTATTT
Instead of proposing a new name for the Cuban broad-banded subspecies of H. ponceana, we entertained
a possibility to request ICZN to designate one such specimen as the neotype of P. temenes, consistent
with the current usage of this name, but contrary to the original description and the identity of three extant
syntypes. However, we decided against this route for the following reasons. First, the name H. a. temenes
is not in very wide use being applied to an uncommon endemic of a single island to warrant a special
consideration by ICZN. Second, it seems most fair to respect original research that lead to creation of this
name, and the original identity of this species that is quite clear even from its description alone (see
above). Third, it is conceivable that the true P. temenes occurred (or even still occurs) in Cuba, and further
research may show that it is not a synonym, but a valid subspecies of H. aristodemus, in which case it will
be without a name if the neotype is designated to preserve the current usage of "temenes" as a subspecies
of H. ponceana. It would create a nuisance situation when the original P. temenes would need a new
name. Finally, a valid name that is suggestive of a diagnostic character (/atefasciatus) has an advantage of
being easier to attribute to the taxon (compared to temenes) and thus may be easier to remember.
Family Pieridae Swainson, 1820
Colias elis Strecker, 1885 is a species
distinct from Colias meadii W. H. Edwards, 1871
Previously considered a subspecies of Colias meadii W. H. Edwards, 1871 (type locality USA: Colorado),
Colias elis Strecker, 1885 (type locality
4 : : 7 Colias nastes streck atl 114D02 2|ii|cansda: ‘Alberta|2003
Canada: Alberta) is not monophyletic with — Gclige ned Ui MAC YuLoe Rey ator) 199
7p 1 1 038 Colias tanianens a ie Pay olM CafadarNWt Schulte take eepies Lane
o meadii In the genomic trees (Fig. 3, Lye Callas Johansen TFT Ped F|Canado Northwast Territories| 1988
Ithough with low su ort) including the - ee eer siaiaosoro7 EFieiesnadaral ‘alberta|priar to 4885]FMNH
a g Pp a g a . a Sul tea ae Ca me eae eae eres ra fen
~ a a
tree constructed from Z chromosome- : Colee monies s03sF12 ae anaemia se dec Mtns. Jasper Ph|1986
t : of = molids Pea eS eC eae Le Re adaiAB Prospect Mountain mo
. — A 6
encoded genes. The identity of the C. elis Golias meadilembiensial 19063 me WY Park cor] 2607
ialebia- supecHeds by «A Piige | iNet a aeeeateerenee paneer ee
Clade 1S SUppO ec iy Cc sequence OF 1s Collas meadil ress ea ru 4:CO,Clear Creek Co.,Loveland Pass|2016
Syntype from the Field Museum National Sanaa eer iumech i Ladeaaoe| veh ALCO Route Co) Mul Pass|1998
? YP - Eglas gigantea mM ay 2744004 Co ge aneCe ape eee eland P 20
: : : a a ee
History collection (Fig. 3). Furthermore, C. — Callas occid fentals ouanseeltsltia CA, Colita Co, ae Camp|2017
elis and C. meadii show genetic differences om Colas alexandra apache aap Oe
Collas vitabundal|1so04 IFlCan ye 016
that are larger than a number of other on “Colas er hylel S421 MUSA: eet Co. SUSE Nona Park|2017
@ li S ecies airs e C li ri h ] W — cole durytheme|6530/F (Usa, cane ea wc Bas" SSE Florissant|2016
ee Na at cm ra ae oe —oieleaci tte yBbes lees ag cal
Collas interior dornteldi|1 06281 1/MiU SA:MT Missoula Co, {1994
H. Edwards, 1876 (type locality Canada: i Coliag sh inneri[17114D BF IUSA “WY, Fremont C
whe 7 Colias behrii|18038A05|M|USA:CA,Mono Co, W008
British Columbia) and Colias eurytheme
Boisduval, 1852 (type locality USA:
California). Fst/Gmin statistics for the comparison of C. elis and C. meadii are 0.40/0.03, but those for C-
meadii meadii and C. meadii lemhiensis are 0.18/0.14 (can be used as a control of conspecific taxa).
Therefore, we reinstate Colias elis Strecker, 1885 as a species-level taxon.
Fig. 3. Colias elis (red), C meadii (blue) and others w/ patch (magenta).
Tetracharis Grote, 1898 is a valid subgenus that includes Anthocharis cethura C.
Felder & R. Felder, 1865 (Miiller, 1764), Anthocharis midea (Hiibner, [1809]), and
Anthocharis limonea (A. Butler, 1871)
The genomic tree of representative species of Anthocharis Boisduval, Rambur, [Duménil] & Graslin,
[1833] (type species Papilio cardamines Linnaeus, 1758) including all type species of available genus-
9
group names considered subgenera or junior subjective synonyms of Anthocharis revealed an unexpected
but highly confident clade consisting of Anthocharis cethura C. & R. Felder, 1865 (type locality USA:
California, Los Angeles Co.), Anthocharis sadinthocharis sara sara[5638|USA:CA,San Diego Co.
: . é ; au Enea ane sulla. a aS CQ, Peele ey a
midea (Hiibner, [1809]) (type locality USA: aAnthocharis. igncealata ianosolata|PACGSIUSA, :CA,Sierra Co.
Georgia, Wilmington Island) and Anthocharis ee ee
limonea (A. Butler, 1871) (type locality anthecharis Himoriea]2949[Me icon Mewes Go me
M 1 Fi 4 d Th ] d 1 : Bi aenerieecel hnus| 190 ia bapan Korea
exico) (Fig. red). e clade is puchion tagisiis0 39HO6lSpain
sonides Epler Ae ala B rae |on. CO,Grand Co,
unexpected, because currently A. cethura is etichloe lottalPAOs9 11USAINV Elk
placed in the subgenus Anthocharis, while the Fig. 4. Subgenera Anthocharis (blue), Tetracharis (red)
other two species are placed in the subgenus and Paramidea (green) with Euchloe as outgroups.
Paramidea Kuznetsov, 1929 (type species: Anthocharis scolymus Butler, 1866). Curiously, neither of
these species in the red clade are monophyletic with the type species of subgenera they are currently
assigned to: A. (Anthocharis) cardamines 1s in the blue clade (Fig. 4) and A. (Paramidea) scolymus 1s in
the green clade. Therefore, the current classification is incorrect. Out of genus-group names that are
available for the red clade, Tetracharis Grote, 1898 (type species Anthocharis cethura C. & R. Felder,
1865) is older than Falcapica Klots, 1930 (type species Papilio genutia Fabricius, 1793, which is a junior
homonym of Papilio genutia Cramer, 1779, the oldest available name for this species is Mancipium
midea Hiibner, [1809]). As a result, we treat Tetracharis as a valid subgenus, new status, that includes
three species: A. cethura, A. midea, and A. limonea, making Falcapica its junior subjective synonym.
Anthocharis lanceolata Lucas, 1852 belongs to subgenus Anthocharis Boisduval,
Rambur, |[Duménil] & Graslin, [1833] instead of Paramidea Kuznetsov, 1929
Our genome-level phylogeny strongly supports the placement of Anthocharis lanceolata Lucas, 1852
(type locality "Californie") as sister to the Anthocharis sara Lucas, 1852 (type locality "Californie")
Species group, which belongs to the subgenus Anthocharis Boisduval, Rambur, [Duménil] & Graslin,
[1833] (type species Papilio cardamines Linnaeus, 1758) (Fig. 4, blue). The A. sara group taken together
with A. /anceolata is sister to the subgenus Jetracharis (type species Anthocharis cethura C. & R. Felder,
1865) and thus is not monophyletic with Anthocharis scolymus Butler, 1866, the type species of
Paramidea Kuznetsov, 1929. In other words, Paramidea Kuznetsov, 1929 is sister to a clade formed by
subgenera Anthocharis and Tetracharis. Therefore, A. lanceolata does not belong to Paramidea, but
instead is in the subgenus Anthocharis. Apparently, the falcate shape of the forewing vs. rounded
forewing apex is not a character that indicates phylogenetic groupings within the genus Anthocharis and
has originated more than once.
Family Lycaenidae [Leach], [1815]
Tharsalea Scudder, 1876, Helleia Verity, 1943, Apangea Zhdanko, 1995 and
Boldenaria Zhdanko, 1995 are genera distinct from Lycaena [Fabricius], 1807
Discovering non-monophyly of Lycaena [Fabricius], 1807 (type species Papilio phlaeas Linnaeus, 1760)
in a pioneering DNA-based phylogenetic analysis (van Dorp 2004) but stopping short of imminent
taxonomic lumps or splits, de Jong and van Dorp (2006) concluded: "we propose that first the
interrelationships as suggested by the present study are confirmed by further genetic markers." We
accepted this challenge and used not some further markers, but all protein-coding genes in 34 Lycaeninae
Species, including the type species of 22 out of 28 available genus-group names (two of which share valid
name of the type species with another genus-group name). The results confirm that Lycaena is not
monophyletic (Fig. 5). Notably, Jophanus Draudt, 1920 (type and the only species Chrysophanus (’?)
pyrrhias Godman & Salvin, 1887) originates within Lycaena and is sister to most other American species
10
with strong support. This placement is unexpected due to the prominent phenotypic similarities between
Iophanus and Melanolycaena Sibatani, 1974 (type species Melanolycaena altimontana Sibatani, 1974).
Even using genitalic morphology, /ophanus
pyrrhias (type locality Guatemala) was
associated with the (largely) Palearctic clade
(Fig. 5 blue) by Klots (1936) who wrote:
‘pyrrhias ... relation-ship is undoubtedly with
the Palaearctic rather than with the Nearctic
series, and is possibly rather ancient." As the
genomic tree suggests, Klots was incorrect on
both counts: /. pyrrhias is a relatively recent
offshoot of the (largely) Nearctic clade (Fig. 5
red). To the contrary, Melanolycaena is sister
to Lycaena boldenarum White, 1862 (type
locality New Zealand) and they form a clade
that is sister to all other Lycaeninae we have
Lycaena boldenarum|19079D11|New Zealand|1979
Melee saan altimontana|19079E02|Papua New Guineal|1973
Heliophorus senal190/79E03|Pakistan|1976
Heliophorus epicles|19079D12|Malaysia:Pahang|1991
Heliophorus yunnani|19079E05|China:Yunnan|1996
, Heliophorus gloria] 19079E01|Myanmar: racimllaae
Heliophorus tamu 19079E04|Himalayalold
Lycaena pang|19093B812|China:Sichuan|i902
Lycaena helle|19079D10|Russia:Siberia,Sayan Mountains|1970
, Lycaena phlaeas ursadental17115HO5|USA: WY, Park Co.J1997
1 yeaena phlaeas Sal ts a insist ag
p98 Lycaena alciphron|19093B11|Ukraine,Kiev|1969
Lycaena cupreus lapidicola|PAQ475|USA: C4,Mono Co,|2017
Lycaena aoelides|17066G09|PT|Tajikistan| 199g|
Lycaena thersamon|19079D07 |Tajikistan:Pamir|1988
7 Lycaena tityrus|PAOEO2|France|2017
Lycaena virgaureae|PAOEDS|Switzerland|2017
Lycaena dispar|19079D006|Ukraine,Kiev|1967
Iophanus pyrrhias| 17066G11|Guatemalal 1967
Lycaena caspius|19079E06|Iran,Schakuh|old
Lycaena hermes|6685|US54:C4,San Diego Co,|2011
Lycaena arota virginiansis|PAO449|USA: cA, ae Co,|2017
2 Lycaena rubidus|P40126|US4:WY,Laramie Co, |201
o4¥caena xanthoides|17114D11|USA: CA,Santa piers Co,|2007
PEycaena editha|PAO60|US4:C4,Sierra Co, |2016
Lycaena ae esa SA: T%, Paneetl Ca, aaaee
Lycaena hyllus|P&O286|(US54:C0,4dams Co,|2016
, Lycaena hareronaa|fa4q/Use: WY, Park Co.|2017
Lycaena gorgon gorgon|P40346|USA:CA,Santa Cruz ae |2017
0.94-, Lycaena nivalis browni/6459|US5A4:CO, Grand Co,J2016
‘Lycaena epixanthe epixanthe|6686| Canada: Quebec|2011
Lycaena mariposa penroseae|9440(USA:WY,Park Co,|2017
sequenced, including Heliophorus Geyer,
Lycaena helloides|19077B11/US4:C4,5an Benito Co. ji991
1 ; 1 iy = d F114b12/¢ dat B k|1983
[1832] (type species Heliophorus belenus olgieaena dospassosil17114012|Canada:New Brunswick|1
Geyer, [1832], considered to be a junior Fig. 5. Lycaena (blue), Tharsalea (red), Jophanus (green), Helleia
subjective synonym of Polyommatus epicles | (magenta), Apangea, (cyan), Melanolycaena (purple), Heliophorus
Godart, [1824]). Thus, we were impressed by (orange-brown) and Boldenaria (black).
the intuition of Sibatani (1974) who stated in the last sentence of his work: "the possibility is not
completely ruled out that the New Guinean Melanolycaena and the coppers of New Zealand are
monphyletic [sic!]." Indeed, Melanolycaena 1s sister to Boldenaria Zhdanko, 1995 (type species Lycaena
boldenarum White, 1862) from New Zealand (Fig. 5), despite phenotypic dissimilarities. For these
reasons, genomic phylogeny implies that the division of Lycaeninae into two sections (Lycaena and
Heliophorus) as suggested by Eliot (1973) was indeed tentative and needs to be revised because these
sections are not monophyletic.
Here, armed with genomic data for ~80% of the available genus-group names, we attempt such a
revision. One solution to restore monophyly is to treat the whole subfamily as a single genus Lycaena that
subsumes Melanolycaena and Heliophorus among others. This super-lumping solution may be in
agreement with relatively low genetic diversification among all these species. Indeed, Lycaeninae
experienced some of the slowest evolutionary rates among Lycaenidae as revealed by relatively shorter
branches within the Lycaeninae clade compared to others (Zhang et al. 2019d). The difference in COI
barcodes between distantly related Lycaeninae species ranges from about only 5% (35 bp, L. boldenarum
and L. phlaeas, a difference common for closely related congeners) to about 8% (53 bp, Heliophorus sena
Kollar, 1844 and Lycaena pang Oberthiir, 1886, a difference typical for distantly related congeners). This
high similarity in COI underscores the idea that it is meaningless to impose a strict cutoff on divergence
values due to the differences in evolutionary rates in different lineages. However, even American species
of Lycaena are estimated to have diverged over 20 million years ago (Zhang et al. 2019d), which is larger
than for a typical diverse genus; 1.e., it is larger than the divergence between Anthocharis and Euchloe
Hiibner, [1819] (Pieridae) and about the same as between Vanessa [Fabricius], 1807 and Nymphalis Kluk,
1780 (Nymphalidae). Furthermore, Heliophorus has been traditionally maintained as a genus-level taxon.
Therefore, we reject the super-lumping solution of a monotypic subfamily Lycaeninae.
The opposite extreme would be to find a meaningful level closest to the leaves of the tree that defines
genera. Ideally, there would be situations in the tree where many lineages diverge at about the same level
(i.e. at the same distance from the root, meaning at about the same time in the past) and then stay as single
lineages for some time (i.e. form longer branches). This rapid diversification immediately followed by a
relative lack of further diversification creates a level in the classification, i.e. the tree looks more like a
bush or a comb than a bifurcating tree at that point. Taking the (largely) Nearctic group (Fig. 5 red), we
see exactly this situation: at its base, this group diversifies into five prominent clades, and then two of
11
these clades diversify further, also at approximately the same time point in the past. These five clades
form a level in the tree and can be used as genera, offering the splitting solution. Notably, every one of
these clades already has a genus-group name (Pelham 2008), including Palearctic Hyrcanana Bethune-
Baker, 1914 (type species Polyommatus caspius Lederer, 1870). Apparently, these clades were also
obvious from phenotypes: that is how they were defined and named to begin with (Scudder 1876; Klots
1936; Miller and Brown 1979). This level of classification can be propagated to other parts of the tree,
although they are currently poorly covered by species. It is a meaningful level that can be chosen to define
genera, but a significant number of such genera will be monotypic (e.g. two out of five in the Nearctic
clade), and excepting knowledgeable aficionados of this group, such genera carry little information about
their interrelationships. Hence, we looked for a compromise between the splitting and lumping solutions.
Inspection of the tree reveals a rapid diversification point between its root and the diversification of
the red clade (Fig. 5): i.e. orange-brown, cyan, magenta, blue and red + green clades diverged at
approximately the same time in the past. This divergence is followed by the lack of immediate further
divergence, creating long and prominent branches in the tree and resulting in a meaningful level for
classification. We have chosen to take this intermediate level to suggest division of Lycaeninae into
genera. Most of these genera are unambiguously apparent from the tree: black, purple, orange-brown,
cyan, magenta, blue and red clades stand for seven genera, all of which have previously proposed names.
Two instances require further elaboration. First, Heliophorus sena (Kollar, [1844]) stands out from the
rest in the genus (Fig. 5 orange). The type species of subgenus Nesa Zhdanko, 1995, it may be a genus-
level taxon. However, it is monophyletic with Heliophorus and we leave it there as a subgenus to
emphasize this relationship, awaiting further studies. Second, Jophanus (Fig. 5 green) is at about the same
divergence from the rest of Nearctic species (Fig. 5 red) as H. sena from other Heliophorus. For now, we
decided to keep this monotypic genus, because it is currently treated as such, and because its earlier
divergence time sets it apart from the rapid diversification of the red clade. The name for the red clade is
Tharsalea Scudder, 1876 (type species Polyommatus arota Boisduval, 1852), as chosen by Klots (1936),
probably because this name was proposed before others in the paper (Scudder 1876).
In summary, we refrain from partitioning Lycaeninae into tribes and revise the status of the
following names treating them as genera: Tharsalea Scudder, 1876, Helleia Verity, 1943 (type species
Papilio helle Denis & Schiffermiiller, 1775), Apangea Zhdanko, 1995 (type species Chrysophanus pang
Oberthiir, 1886) and Boldenaria Zhdanko, 1995. Furthermore, in agreement with previous studies
(Sibatani 1974; van Dorp 2004; de Jong and van Dorp 2006), we conclude that the endemic South African
Species currently placed in Lycaena represent the 9th genus of Lycaeninae that is named next. We are
looking forward to testing this hypothesis with genomic data.
Lafron Grishin, new genus
http://zoobank.org/ODB9D8C5-E666-46A3-822B-50E96448C82A
Type species. Papilio orus Stoll, [1780].
Definition. In male genitalia (Fig. 2 in de Jong and van Dorp 2006), differs from others in the subfamily
Lycaeninae, except Melanolycaena, by a saccus-like pouch on juxta (Sibatani 1974); separated from
Melanolycaena (Fig. 4 in Sibatani 1974) by juxta connected to valva at its more ventral part, as in other
Lycaena. In wing patterns and shape, resembles a sympatric hairstreak Chrysoritis lycegenes (Trimen,
1874) (possible mimicry), i.e. wings are more rounded than most Lycaena and forewing black spots are
closer to the margin, hindwing without tails and patterned more similar to Polyommatinae than to most
Lycaena: pale-brown with darker marginal Iunules and with paler spots usually darker in the middle.
Etymology. The name is a masculine noun in the nominative singular, formed as L[ycaen|a + [A|fr[ica] +
on to indicate African origin of the genus and reach gender agreement with the type species name.
Species included. The type species and Lycaena clarki Dickson, 1971, both from South Africa.
Parent taxon. Subfamily Lycaeninae |Leach], [1815].
12
Lycaeninae genera, subgenera and their available synonyms
Here, we update the Appendix of Sibatani (1974) and suggest the following treatment of Lycaeninae
grouped into nine genera. Placements of Lafron Grishin, gen. n. and Phoenicurusia Verity, 1943 are
provisional due to the lack of both genomic data and unambiguous phenotypic evidence, and follow
published works based on morphology and limited DNA analysis (Klots 1936; Sibatani 1974; van Dorp
2004; de Jong and van Dorp 2006). The list is preliminary and further changes are expected in groups
poorly covered by our genome-based phylogeny. Junior subjective synonyms are preceded by "=".
Unavailable names are not listed. Type species are given in parenthesis with their original genus name.
Genus Lafron Grishin, gen. n. (Papilio orus Stoll, [1780])
Genus Lycaena [Fabricius], 1807 (Papilio phlaeas Linnaeus, 1760)
Subgenus Lycaena [Fabricius], 1807 (Papilio phlaeas Linnaeus, 1760)
Subgenus Thersamolycaena Verity, 1957 (Papilio dispar Haworth, 1802)
Subgenus Heodes Dalman, 1816 (Papilio virgaureae Linnaeus, 1758)
=Loweia Tutt, 1906 (Papilio dorilis Hufnagel, 1766)
=Thersamonia Verity, 1919 (Papilio thersamon Esper, 1784)
=Palaeochrysophanus Verity, 1943 (Papilio hippothoe Linnaeus, 1760)
=Alciphronia Kocak, 1992 (Papilio alciphron Rottemburg, 1775)
=Mirzakhania Kogak, 1996 (Chrysophanus kasyapa F. Moore, 1865)
Genus Helleia Verity, 1943 (Papilio helle Denis & Schiffermuller, 1775)
Genus Tharsalea Scudder, 1876 (Polyommatus arota Boisduval, 1852)
Subgenus Epidemia Scudder, 1876 (Polyommatus epixanthe Boisduval & Le Conte, [1835])
=Hyllolycaena L. Miller & F. Brown, 1979 (Papilio hyllus Cramer, 1775)
=Hellolycaena Kocak, 1983 (=Polyommatus thoe Guérin-Méneville, [1832], which is Papilio hyllus Cramer, 1775)
Subgenus Chalceria Scudder, 1876 (Chrysophanus rubidus Behr, 1866)
=Gaeides Scudder, 1876 (Chrysophanus dione Scudder, 1868)
Subgenus T7harsalea Scudder, 1876 (Polyommatus arota Boisduval, 1852)
Subgenus Hermelycaena L. Miller & F. Brown, 1979 (Chrysophanus hermes W. H. Edwards, 1870)
Subgenus Hyrcanana Bethune-Baker, 1914 (Polyommatus caspius Lederer, 1870)
=Sarthusia Verity, 1943 (Polyommatus sarthus Staudinger, 1866)
Subgenus Phoenicurusia Verity, 1943 (Polyommatus phoenicurus var. margelanica Staudinger, 1881)
=Athamanthia Zhdanko, 1983; (Polyommatus athamantis Eversmann, 1854)
Genus Iophanus Draudt, 1920 (Chrysophanus (?) pyrrhias Godman & Salvin, 1887)
Genus Heliophorus Geyer, [1832] (=H. belenus Geyer, [1832], which is Polvommatus epicles Godart, [1824])
Subgenus Heliophorus Geyer, [1832] (=H. belenus Geyer, [1832], which is Polyvommatus epicles Godart, [1824])
=llerda E. Doubleday, 1847 (Polyommatus epicles Godart, [1824])
=Kulua Zhdanko, 1995 (Polyommatus tamu Kollar, 1844)
Subgenus Nesa Zhdanko, 1995 (Polyommatus sena Kollar, 1844) [not a homonym! Nesa Leach, 1818 is a misspelling]
Genus Apangea Zhdanko, 1995 (Chrysophanus pang Oberthtr, 1886)
Genus Melanolycaena Sibatani, 1974 (Melanolycaena altimontana Sibatani, 1974)
Genus Boldenaria Zhdanko, 1995 (Lycaena boldenarum White, 1862)
Habrodais Scudder, 1876, Favonius Sibatani & Ito, 1942, Neozephyrus Sibatani & Ito,
1942, Quercusia Verity, 1943, Chrysozephyrus Shirézu & Yamamoto, 1956, and
Sibataniozephyrus Inomata, 1986 are junior subjective synonyms
of Hypaurotis Scudder, 1876
Inspecting genomic phylogenetic trees of US butterfly species (Zhang et al. 2019d), we noticed a close
relationship between the only two New World genera from the tribe Theclini Swainson, 1830: Hypaurotis
Scudder, 1876 (type species Thecla crysalus W. H. Edwards, 1873) and Habrodais Scudder, 1876 (type
species Thecla grunus Boisduval, 1852). Despite dissimilar wing patterns and colors, divergence between
the type species of these genera is indeed comparable to that of congeners (Fig. 6 top) and is even lower
than the divergence in some compact genera, such as Chlorostrymon Clench, 1961, Ministrymon Clench,
1961 or Electrostrymon Clench, 1961 (Fig. 6 top), and particularly in more diverse genera such as
Strymon Hubner, 1818, Callophrys Billberg, 1820, or Satyrium Scudder, 1876 (Zhang et al. 2019d). COI
barcodes of Hy. crysalus and Ha. grunus are only 4.3% (28 bp) different: divergence similar to that at
13
times reported for different individuals of
the same species (Zakharov et al. 2009;
Kodandaramaiah et al. 2013), strongly
suggesting that these two species are
congeneric. The combination Hypaurotis
grunus has been used previously in
publications (Garth 1934), however, we
failed to find the combination Habrodais
crysalus published. Also, H. crysalus has
a slightly broader distribution and is a
more familiar butterfly. Therefore, among
the two names published in the same work
(Scudder 1876), we use Hypaurotis as
Hy¥paurotis crysalus|17117405|(USA:CO, Douglas Co,.J1993
Habrodais grunus|PAO466/US4:c4 Plumas Co,|2017
Favonius (=Quercusia) quercus|200354)
Chlorastrymon simaethis sarital5161|USA x, Starr Co, 12015
,chlorostrymon maesites|18033F11|USA: Fi Monroe oo |2014
Chlorastrymon feins|tp608 Meco ;Tamatlipas| 197
Ministrymon azia|17119F07|US4:FL,Broward Ca, Coral peringe) tae2
119F06|Mexico: Sonorali9
in =a|10610/USA:TX,Culberson Co, fsa”
Ministrymon SMe eee Were aes Cameron Co (2015
Electrastrymoan aoe ee 5G0 4/USA:FL, Miami-Dade Co, j1982
, Electrostrymon hugon|15115F02|Belize: Cayo 2003
Electrostrymon ioval15115FO7IPanama.Canal Zoneli979
al France: Var|20
BeBe urate eyeeiel eal SA:ca polug)as Ea:
sozephyrus smaragdinus|GU372
Hebrodais grunus|PA Peace AAP ee Co:
Neozephyrus Japonicu ae
Fav ees onlentalis[4B19
Fayo Ug I= Q Quercusia) que 035404|France
Sibataniozep rus Tu isanusl
Thecla Betul 14540
aelM
Fig. 6. Hypaurotis, Habrodais and others. Nuclear genome tree above,
COI barcode dendrogram below. Specimens without locality given are
from GenBank and their accession numbers are indicated.
valid, and Habrodais as its junior subjective synonym, resulting in Hypaurotis grunus (Boisduval, 1852)
and Hypaurotis poodiae J. Brown & Faulkner, 1982, revised and new combinations.
Next, when a genomic dataset of an Old World species Favonius quercus (Linnaeus, 1758) was
included in the Theclinae tree, it clustered closely with Hypaurotis (Fig. 6 top). The COI barcodes of H.
crysalus and F. quercus differ by 4.7% (31 bp). Because we lack genomic data for other genus-group
names from the Thecla section of Eliot (Eliot 1973), we downloaded available COI barcode data from
GenBank (Sayers et al. 2020). We find that while for most species pairs, e. g., H. crysalus and Favonius
orientalis (Murray, 1875), the barcodes are more similar (6%), for others, e. g., H. crysalus and Thecla
betulae (Linnaeus, 1758) (the type species of Thecla Fabricius, 1807) the difference is larger (8.2%). The
COI barcode distance dendrogram computed using BioNJ (Gascuel 1997) as implemented by the
phylogeny.fr server (Dereeper et al. 2008) reveals close clustering of species we propose to place in
Hypaurotis (Fig. 6 bottom, red) and separation of 7. betulae (green) from this cluster. In the absence of
genomic data, this COI barcode analysis of their type species suggest that in addition to Habrodais
Scudder, 1876 and Quercusia Verity, 1943 (type species Papilio quercus Linnaeus, 1758), the following
four genus-group names Sibataniozephyrus Inomata, 1986 (type species Zephyrus fujisanus Matsumura,
1910), Neozephyrus Sibatani & Ito, 1942 (type species given as Thecla taxila Bremer, 1861, which was,
however, a misidentified Dipsas japonica Murray, 1875; according to the Art 70.3.2. of the ICZN Code
the actual taxonomic identity of this species is chosen and japonica is fixed as type species),
Chrysozephyrus Shirézu & Yamamoto, 1956 (type species Thecla smaragdina Bremer, 1861) and
Favonius Sibatani & Ito, 1942 (type species Dipsas orientalis Murray, 1875) are junior subjective
synonyms of Hypaurotis Scudder, 1876, which is a genus distinct from Thecla Fabricius, 1807. In accord
with genetic similarities, all these species are similar in appearance (Eliot 1973). We expect that future
studies will reveal additional synonyms and possibly a subgeneric structure of Hypaurotis.
Finally, even from a practical standpoint of American butterfly knowledge, it seems more instructive
to treat H. crysalus and H. grunus as congeneric emphasizing on their close kinship (despite apparent
phenotypic dissimilarity), instead of placing them in two monotypic (or nearly monotypic) genera that
accentuate their tenuous (but superficial) uniqueness. Finding their close relatives in the Old World places
Hypaurotis among other Holarctic Theclinae genera such as Callophrys and Satyrium and emphasizes
somewhat unusual but recurrent pattern revealing the connection between the Old and the New Worlds.
Family Riodinidae Grote, 1895
Plesioarida Trujano & Garcia, 2018 is a
junior subjective synonym of Roeberella Strand, 1932
Plesioarida Trujano & Garcia, 2018 (type species Apodemia walkeri Godman & Salvin, 1886) was described
as a genus (Trujano-Ortega et al. 2018) and was treated as a subgenus of Apodemia C. Felder & R. Felder,
14
1865 (type species Lemonias
mormo C. Felder & R. Felder,
1859) by Zhang et al. (2019e) to
present a more internally consistent
classification of the tribe Emesidini
Seraphim, Freitas & Kaminski,
2018. Continuing with the genomic
sequencing of Riodinidae, we were
surprised to find that a syntype of
the type species of the genus
Roeberella Strand, 1932, Le.,
Lemonias calvus Staudinger, 1887
(type locality Peru: Chanchamayo),
was in the same clade with 2.
walkeri (type locality Mexico:
Guerrero), rendering Plesioarida
paraphyletic in all three trees that
we routinely construct (Fig. 7).
Statistical support for _ the
placement of Roeberella_ calvus
within the subgenus Plesioarida as
sister to both A. walkeri and
Apodemia hepburni (Godman &
Salvin, 1886) (type — locality
A. h. hypoglauca
2 NVG-18048C11
NVG-18048C10
nuclear genome
Roeberella calvus|18054E06|ST|M|Peru,chanchamayol|prior to 1887|ZMHB
Apodemia walkeri|4514|M|USA:TX Hidalgo Co.|2015
Apodemia hepburni hepburni|17066E05|/Mexico:Sonora|2003
Apodemia palmerii arizona|10226|USA:A27,Pima Co.|2017
Apodemia murphyi|17066006|M|Mexico:Baja California Sur|2004
Apodemia hypoglauca hypoglauca|18048C11|M|Costa Rica: Guanacaste|1973
Apodemia ares|17114H01 De ceeae Co,,Pine Canyon|1991
podemia arnacis|18045F11|M|Mexico:Gaxaca|1990
Apodemia zela Pee cl ieaeatawen Cruz Co.,Coronado N.F.|2017
Apodemia chisosensis|154|F|USA:TX,Brewster Co.,Big Bend National Park|2004
Apodemia nais|P40145|/U54:C0,Gilpin Co.,Golden Gate Canyon S. P.|2016
Apodemia multiplaga|7635|F|USA:TX,Cameron Co, ,Brownsville|1974
Apodemia virgulti virgulti|15105E04|NT|M|USA:CA,Los Angeles Co.[1951|/CAS
Apodemia mormo mormo|17107E02|M|USA:WA,Kittitas Co.|1990
24 Apodemia mejicanus mejicanus|13383BrockC10|F|USA:AZ Santa Cruz Co./1990
“Apodemia duryi] 7O0|M|USA4&:TX Brewster Co,,Big Bend National Park|2009
Z chromosome Roeberella calvus|18054E06|ST|M|Peru,chanchamayolprior to 1887|ZMHB
Apodemia walkeri[/4514|M|USA:TX Hidalgo Co,[2015
Apodemia hepburni hep urnil 17066605 |Mexico:Sonora|2003
; Apodemia palmerii arizonal10226|USA:AZ,Pima Co,|2017
Apodemia murphyi|17066006|M|Mexico:Baja California Sur|2004
- Apodemia hypoglauca hypoglauca|18048C11|M|Costa Rica:Guanacaste|1973
Apodemia ares|17114H01 a reece Co,,Pine Canyon|1991
Apodemia arnacis|18045F11|M|Mexico:Oaxacal|1990
Apodemia zela cleis|B217|FIUSA:AZ Santa Cruz Co.,Coronado N.F.|2017
Apodemia chisosensis|154|F|USA:TX,Brewster Co.,Big Bend National Park|2004
Apodemia nais|P40145|US54:C0,Gilpin Co,,Golden Gate Canyon S. P.|2016
Apodemia multiplagal7635|[F|USA:TX,Cameron Co,,Brownsville|1974
Apodemia virgulti virgulti|15105E04|NT|M|USA4:CA,Los Angeles Co.|1951/CAS
Apodemia mormo mormo|17107E02|M|USA:WA,Kittitas Co.|1990
= Anodemia mejicanus mejicanus|13383BrockC10|F|USA:AzZ,Santa Cruz Co,|1990
0.01 “Apodemia duryi/7O0|M|USA:TX,Brewster Co.,Big Bend National Park|2009
mitochondrial genome
Roeberella calvus|18054E06|ST|M|Peru,chanchamayol|prior to 1887|ZMHB
Apodemia walkeri|4514|M|USA:TX Hidalgo Co.|2015
Apodemia Dea haraete ines Wiemann Cece ear
Apodemia palmeril arizona|10226|USA:47 Pima Co.|2017
Apodemia murphyi|17066006|M|Mexico:Baja California Sur|2004
4podemia hypoglauca hypoglaucal18048C11|M|Costa Rica: Guanacaste|1973
Apodemia ares|17114H01|/M|USA:NM,Hidalgo Co.,Pine Canyon|1991
Apodemia arnacis|18045F11 M|Mexico:Oaxaca/1990
Apodemia zela cleis|8217|FIUSA‘AZ Santa Cruz Co.,Coronado N.F.|2017
Apodemia chisosensis|154|F|USA:TX,Brewster Co.,Big Bend National Park|2004
Apodemia nais|P40145|/US4:C0,Gilpin Co. ,Golden Gate Canyon S. P.|2016
Bera Mta eee carck Co,,Brownsville| 1974
Te Sbodemia virgulti virgulti|1S5105E04|NT|M|USA:CA,Los Angeles Co,|1951/CAS
Apodemia mormo mormo|17107E02|M|USA:WA,Kittitas Co,|1990
Apodemia mejicanus mejicanus|13383BrockC 10(F|USA:AZ Santa Cruz Co./1990
Apodemia duryi|700|M|USA:TX Brewster Co,,Big Bend National Park|2009
Fig. 7. Subgenus Roeberella (red), and other Apodemia (blue).
A. (Roeberella, =Plesioarida) calvus
A. walkeri
Co
On | syntype;
type species
NVG-18048D04
NVG-18054E06
Fig. 8. Previously unnoticed but apparent phenotypic similarity between Roeberella calvus (c, syntype and the type species
of Roeberella, Peru: Chanchamayo, NVG-18054E06 in ZMHB, here placed in Apodemia), and representative species of the
subgenus Plesioarida (here synonymized with Roeberella): Apodemia walkeri (d, the type species of Plesioarida, Mexico:
Morelos, NVG-18048D04 in USNM) and Apodemia hypoglauca (a, Costa Rica, NVG-18048C11; b, Mexico: Morelos,
NVG-18048C10 both in USNM). Dorsal above, ventral below. This similarity was uncovered by genomic analysis.
15
Mexico: Chihuahua) is strong in the protein coding regions of the entire nuclear genome, Z-chromosome
and mitochondrial genome: 100% of all segment trees contained the clade of these three species. Such a
result was unexpected, because the type species of Roeberella (South American) was not previously
compared with Apodemia (North American), and we suspected a possibility of error or contamination.
However, COI barcodes of R. calvus and A. walkeri differ by only 5.2% (34 base pairs), a difference
smaller than that between 4. walkeri and A. mormo (8.5%, 56 bp). Moreover, R. calvus is phenotypically
similar to Plesioarida species (Fig. 8) and shares a falcate forewing with Apodemia hypoglauca (Godman &
Salvin, 1878) (type locality "Mexico"). The similarities are most prominent in the ventral wing pattern (Fig.
8bc bottom). Interestingly, the wing shape of R. calvus appears more like that of female Plesioarida (Fig.
8b). Dorsally, R. calvus reminds us of an aberrant Plesioarida. Therefore, due to genetic and phenotypic
similarities, we conclude that Plesioarida syn. n. is a junior subjective synonym of Roeberella, and
consequently we place Roeberella as a subgenus (new status) of Apodemia.
We think this find is particularly interesting for several reasons. First, it extends the range of
Apodemia, previously not recorded from South America, to Peru, with all evolutionary and
biogeographical implications of this fact. Second, it underscores the importance of a more comprehensive
phylogenetic analysis before proposing new genus-group names to avoid creation of unnecessary
synonyms (Trujano-Ortega et al. 2018; Trujano-Ortega et al. 2020). Third, it reiterates the power of
genomic approaches and the value of the type concept, both in species and genus-group names.
Sequencing of the syntype of the type species of the genus-group name Roeberella solidifies our
conclusions, eliminating a possibility of misidentification or incorrect inference from a non-type species.
Lemonias lencates Hewitson, 1875 currently placed in Roeberella Strand, 1932
belongs to Pachythone H. Bates, 1868
Genomic sequencing of a specimen of Roeberella lencates (Hewitson, 1875) (type locality not given,
species recorded from Costa Rica to Brazil) and comparisons among the type species of available genus-
group names reveal that R. /encates (Fig. 9, red) is not monophyletic with the type species of Roeberella
Strand, 1932 (Lemonias calvus Staudinger, 1887, type locality Peru: Chanchamayo, a syntype sequenced,
Fig. 9, magenta), but instead belongs to Pachythone erebia peal tal Da a rd eel hde r]2015
. negate strati (=corculum) {Pixus}|19031409|Panamal1981
Pachythone H. Bates, 1868 (type species ’ acy au eee obs, persed See :Grol1977
Pachythone erebia Bates, 1868) (Fig. 9,
blue). The tree includes the type species of
elle menander {Men
all available genus-group names in z ee tg
a ta ey a j aye aaa Emesis tenedia {Tenedia iBo44Hioe Costa Rical2010
Emesidini placed among other Riodinidae 32 ——_Emasis brimo brimo {Brimia}|18045E01 Costa Rica|2008
i ‘i : SO ene se Eee ae 09|Guyana|19
(Fig. 9, taxa currently placed in Apodemia iL oe "Einesis posse (Posasia}|19044603)ho03 3[2000.
° pee Curvie emesia {Curvie}|5245 T
are in green font). Therefore, we transfer R. Roeberella calvus {Roaheralla) |ae0s420¢|st)Perulbetore 1887
. ; + Apodemia walker! {Plesioarida }|4514|USA:TX|201
lencates and a number of its close allies as Snademiamanna mayms fapodemia} 17 107607|USa.wal1990
p 1
Riodina lysippus imiodina| 19026H04|Ecuador|1988
Fig. 9. Emesidini and Pachythone among others. Genus-group names
each species is the type of are given in brackets.
suggested by their phenotypic similarities
from Roeberella to Pachythone, forming the
following new combinations: Pachythone
lencates (Hewitson, 1875), Pachythone flocculus (Brévignon & Gallard, 1993), Pachythone floccus
(Brévignon, 2013), Pachythone heberti (P. Jauffret & J. Jauffret, 2007) and Pachythone marajoara (P.
Jauffret & J. Jauffret, 2007). Furthermore, due to close clustering in the genomic tree (Fig. 9) comparable
to that within other genera (e.g., Periplacis Geyer, 1837 in addition to Emesis Fabricius, 1807 and
Apodemia) and phenotypic similarities in wing patterns (e.g., compare with Pachythone strati (Kaye,
1925) and Pachythone rubigo (H. Bates, 1868)), we suggest that Pseudonymphidia Callaghan, 1985 (type
species Emesis clearista Butler, 1871. Fig. 9, cyan) is a subgenus (new status) of Pachythone (Fig. 9, the
clade labeled with the name in red font highlighted in yellow).
16
Family Nymphalidae Rafinesque, 1815
Speyeria Scudder, 1872 is a subgenus of Argynnis Fabricius, 1807
A close relationship between the New World genus Speyeria Scudder, 1872 (type species Papilio idalia
Drury, 1773) and the Old World genus Argynnis Fabricius, 1807 (type species Papilio paphia Linnaeus
1758) has been suggested (Simonsen 2006; Simonsen et al. 2006). In these studies, Simonsen proposed to
treat Speyeria as a subgenus of pa Argynnis paphia|/PAOQE21|German Bavaria near Graswang|2017
, = Advan iaediet 190) 1c 04| Kora Sepad enor a3 Hae
Argynnis. Although this suggestion abs, nobel “ iiowitzenand Park ca BabeT 2017 Aeniaeny
. 1 eye 8
has been followed in a number of = oye se OLA ae eee 78 017
works (Wells et al. 2011; Scott and see iain al aaa NgArco Scsicurts Mie stay
. . eyera mormoania eurynome ar Qo Bow stone
Fisher 2014), it has not been magppeyena adiaste ent reece NP|2017
: ISpeyeria edwards si[FAG ory CI4d O16,
universally accepted (Pelham 2008; wipeiere sual 9 ae
Onyl
De Moya et al. 2017; Pelham eyeria z
Baan chee a oes eee amet: oe
eye espe ae
), likely due not to scientific see atlantis atlantis] Lehee = So O "ato ee Pel ce
but historical reasons. Several Bo Tet is{tZ SAWS eee co,| four a
generations of American naturalists FL Alcanada: Albe lal iateau Mtn.
were raised being accustomed to nee chariclea cage Ae Bsa ve Co 12003
& aA ot i Balin patarhat ee i Bat Northwest Torntories|1988
the name Speyeria and are less = olen tiga s Aos[usA: ay,c9:)1996,
familiar with the name Argynnis, E polonal ebithats Spitnare cA Si pisligg
thus being resistant to abandonin Boloria Helatiets dau (ese Pane igham £9 a oie
u & & , euptolsta hegesial3374/USA:TX aero een [2015
Speyer la aed se ens Dale: Our ee Fig. 10. Argynnis (blue) and its subgenus Speyeria (red).
nomic studies also support the view
that Speyeria should be considered a subgenus within Argynnis. The two groups are very close to each
other genetically (Fig. 10). The COI barcode difference between the type species of Speyeria and
Argynnis is 8.2%, and the estimated time of divergence is 9.1 Mya according to De Moya et al. (2017)
(Brenthis Hubner, [1819], which is sister to the clade that includes Argynnis and Speyeria diverged from
them 11.1 Mya), but likely about 7.5 Mya according to Chazot et al. (2019), who show that Brenthis
diverged from Argynnis at 9.2 Mya (9.1*9.2/11.1~7.5). This divergence is nearly the same as (or less
than) between the two species of Euptoieta E. Doubleday, 1848 (Fig. 10): COI barcode difference 8.8%,
estimated time of divergence about 8 Mya according to Zhang et al. (2019d). Moreover, Argynnis is also
quite close to Boloria Moore, 1900 (type species Papilio pales [Denis & Schiffermiller], 1775)
(estimated divergence 14.6 Mya (Chazot et al. 2019)), and they together form a more prominent group in
the phylogenetic tree than either of them does separately (Fig. 10). Thus, it is even conceivable to take the
next step and treat Boloria sensu lato as a subgenus of Argynnis. Currently we refrain from their
unification, because the genetic distance between Argynnis and Boloria is still within the limits possible
for distinct genera, and the pronounced phenotypic distinction between these two genera exists making
their visual recognition straightforward. However, butterfly classification would be more inconsistent if
Speyeria stays a genus distinct from Argynnis. Therefore, we agree with Simonsen et al. (2006) and place
Speyeria as a subgenus within Argynnis.
Argynnis irene Boisduval, 1869 and Argynnis nausicaa W. H. Edwards, 1874 are
Species distinct from Argynnis hesperis W. H. Edwards, 1864
Argynnis atlantis W. H. Edwards, 1862 (type locality USA: New York, Green Co., mostly eastern in
distribution) and Argynnis hesperis W. H. Edwards, 1864 (type locality USA: Colorado, Jefferson Co.,
mostly western in distribution) form a species complex that requires further investigation (Dunford 2009).
We obtained whole genome shotgun sequences for nearly all its taxa considered valid by Pelham (2020).
A number of these taxa were represented by their primary type specimens to ensure correct application of
their names (Fig. 11, indicated as HT for holotype and LT for lectotype). Because protein-coding regions
17
of species in the subgenus Speyeria are quite conserved in their sequences, in order to provide better
discrimination between taxa, we used all genomic sequences mapped to Argynnis (Speyeria) diana
Speyerta idalia So oe E aa TU USA: CO,Kit Carson Se tata Speyerta Idalia Se eee ea HEAT Kit Carson Co,|1987
Speyeria nokomis nitocris|18062B01]USA:NM,Catron Co,,Mogollon Mts.[1978 peyernia nokomis nitocris|18062B01| SA:NM,Catron Co.,Mogollon Mts.|1978
Speyeria diana|9Q190)USA:AR Polk Co,.Quachita National Forest|2017 Of Speretia Oe ea aes Polk Co.,Quachita National Forest|2017
Speyerla cybele cybele|9191/USA:AR,Scott Co,,Ouachita National Forest|2017 r peyeria edwardsil| A0218|USA:CO.Larimer Co.,2 miles NNE Virginia Dale|2016
Speyeria aphrodite ethne|/PAO220|USA:CO,Larimer Co.,2 miles NNE Virginia Dale|2016 Spar etia mormonia eurynome|93so|USA:WwYy,Park Co,,¥ellowstone National Park|2017
peyerla mormonia eurynome|9380|USA:WY,Park Co.,¥ellowstone National Park|2017 peyeria cybele cybele|9191/USA‘AR,Scott Co.,Quachita National Forest|2017
Speyeria edwardsii|P40218|US4:CO,Larimer Co,,2 miles NNE Virginia Dale|2016 Speyeria adiaste adiaste|19051HO9|USA:CA,Santa Cruz Co,,Saratoga Gap|1959
Speyeria adiaste adiaste| 1905 1H09/USA:CA,Santa Cruz Co,,Saratoga aaiaaia Speyeria hydaspe rhodope|9433/USA:WY,Park Co. Yellowstone National Park|2017
Speyerla hydaspe Te aaa USA:WY,Park Co. Yellowstone National Park[2017 Speyeria aphrodite ethne|PAO220|USA:CO,Larimer Co.[2016 |
Speyeria carolae|18028402|USA:NV,Clark Co.,Spring Mts.|1967 — Speyeria egleis utahensis|9532/USA:UT,Davis Co.,Wasatch National Forest|2017
Speyeria coronis halcyone|PAO143|USA:WYy,Goshen Co,,Lone Tree Canyon|2016 as Speyeria callippe|9516|USA:UT Davis Co,,Wasatch NF[2O017 .
Speyeria zerene picta|9626|US4:0R,Umatilla Co,,Umatilla NF|2017 aa Speyeria zerene picta|9626/USA:OR,Umatilla Co,,Umatilla National Forest|2017
Speyeria callippe|9516|USA:UT, Davis Co.,Wasatch NF[2017 : ent Speyeria Se ea Gl eee Clark Co.,Spring Mountains|1967
Speyeria eglels utahensis|9532|USA:UT,Davis Co.,Wasatch National Forest|2017 Speyeria coronis halcyone|P, 0143|USA:WY,Goshen o,,Lone Tree Canyon|2016
- Speyeria hesperis nausicaa|11627|USA4;AzZ,Greenlee Co,|2018 pe; Speyeria hesperis nausicaa|11629|USA:AZ,Greenlee Co,|2018
2 opeyeria hesperis nausicaa|11628|USA:A7,Greenlee Co,[2018 35 Speyeria hesperis nausicaa|11628|USA:AZ Greenlee Co.|2018
=" Speyeria hesperis PSUS ee Eee et ee alee oe Co,J2018 0.87 3 Speyeria hesperis Palaibee| | lped yee Greenlee este
2 Speyeria hesperis nausicaa|18037HO4|USA‘AZ Apache Ca,/2005 ; peyeria hesperis nausicaa|1803 HO4[USALAZ pache Co,/2005
Speyeria hesperis dorothea|19043HO9|HT|USA:NM,Sandoval Co.|before 1947 Speyeria hesperis capitanensis| See eee! USA:NM,Lincoln a ig 1988
peyerla hesperis capitanensis|19043G12|HT|USA:NM,Lincoln Cao.|before 1988 Speyerla hesperis capitanensis|19082G06|USA:NM,Otero Co,|198
Speyeria hesperis capitanensis|19082G06|USA:NM,Otero Ca.[1981 Speyeria hesperis Boro esta aa Wave Sandoval Co,|before 1947
= Speyeria hesperis schellbachi|19061C09|H [USA:AZ, Coconino Co.|1947 Speyeria hesperis schellbachi|19061C09| |USA:AZ,Coconino Co.|1947
pee?) «6S Peyeria hesperis electa|18037HOS|USA:CO,La Plata Co.,Rockwood Rd.|1983 Gees Speyeria hesperis electa|18037HO5|USA:CO,La Plata Co.,Rockwood Rd.|1983
: Speyerla hesperis electa|19083F10/US54:C0,Eagle Co,|1968 : peyeria hesperis elacta|19083F10/USA:CO,Eagle Co.,3 mi NE Basalt|1968
3 Speyeria hesperis tetonia (=wasatchia)|19044B10|HT|USA:UT,Utah yee 1945 5 Speyeria hesperis tetonia [ueaate Oa Tee UT Utah Co,|before 1945
Speyeria hydaspe rhodope (=conquista)|19043HOS|HT|locality unclear|before1945 : Speyeria hesperis tetonia|19044B08|HT|USA:WY,Teton €o,,Teton Mts. |before 1945
Speyeria hesperis Fae eat ie ARE Taton Co.,Teton Mts.|/before 1945 “i Speyeria hydaspe rhodope (=conquista)| 19043105 | HT |locality unclear|before 1945
a peyeria hesperis greyiJ19044401 HT|USA:NV, Elko Co.,Ruby Mts. [before 1950 Speyeria hesperis greyi/19044401|/HT|USA:NYV,Elko Co.,Ruby Mts.|before 1950
a Speyerla hesperis greyiJ/19113G04|USA:NV,Elko Co,,Lamoille ee — Speyerla hesperis greyl/19113G04/USA:NV,Elko Co,,Lamoille Canyon|1969
0.96
sey «Speyeria hesperis greyi[19113G02|USA:NV,Elko Co,,Lamoille Canyon[1972 Speyeria hesperis greyi/19113G03/USA:NV,Elko Co,,E, Humboldt Mts,|1971
er Speyeria hesperis greyiJ19113G03|/USA:NV,Elko Co,,E. Humboldt Mts.)1971 —= Speyeria hesperis qreyi[19113G02|USA:NV,Elko Co.,Lamoille Can cue (fe
Speyeria hesperis viola[19044B09/HT|USAID,Custer Co,,Sawtooth Mts,|before 1945 Speyeria hesperis viola| 19044809] TIUSA:ID,Custer Co,,Sawtooth Mts.|/before 1945
te ane rate hesperis Bee enna | on ok Co.,Ochoco Mts.]1983 Speyeria hesperis hanseni[19061801|HT|US4:C4,Tehama Co,.[1968
4 Speyeria hesperis do Be eOBO LICE HT|USA:OR,Douglas Co.|before 1931 Speyeria hesperis hanseni| 18037H10|USA: CA Mendocino Co,/1974
=“Speyeria hesperis irene/18069B01/LT/USA:CA,Sierra Co.|before 1869 — Speyeria hesperis dodgei/19043HO8|HT|USA:OR Douglas Co,|before 1931
Speyeria hesperis Peter ee NT of rupestris|USA:CA,Mariposa Co,|1984 hoa, Speyeria hesperis irene|18069B01|LT|USA:CA Sierra Co,|before 1869
Speyeria hesperis hanseni[19061B01|HT|USA:CA, ehama Co.|1968 as SPeyerla hesperis irene|19061C04 [invalid NT of rupestris[USA:CA,Mariposa Co.]1984
Speyeria hesperis hanseni|18037H10|US4:C4,Mendacino Co.|1974 i 2 Speyeria hesperis dodgei]/18037HO3|US4&:0R,Crook Co.,Ochoco Mts.|1983
Speyeria hesperis brico|01506C04|HT|Canada:British Columbia,S of McBride|1995 1 Sneyeria hesperis hutchins![19062G05|USA: WA,Okanogan Co,,Brewster|1959
Speyerna hesperis brico]19083E11|Canada:BC,18 mi NW Houston|1979 sz «Sbevyeria hesperis hutchinsi|/19062G04|Canada:Manitoba,The Fadel
#2 Speyeria hesperis hutchinsi|19062604|Canada:Manitoba,The Pas/2002 — Speyeria hesperis dennisi[19083E12| anada:Manitoba,Gnanole| 980
ai Speyeria hesperis dennisi|19083E12|Canada:Manitoba,Onanole| 1980 —asg Speyeria hesperis |uranali9oasAg8|HT USA:SD,Custer Co,,Black Hills|before 1945
ss Speyerla hesperis Sa ea €a./1959 a- Speyerla hesperis hutchins!|19062608|US4:W4,Okanagan Co,,Brewster|1959
1
0.59
Speyeria hesperis hutchinsi|19062608/US4:W4,Okanagan Co,|1959 pa: SHeyeria hesperis hutchinsi[19065C10[/USA:MT,Lincaln Co,[1994
Speyeria hesperis ratonensis/18037H06/USA4;NM,Colfax Co,|199 = Speyerla hesperis beani/18069402|H |Canada‘Albertalbefore 1926
ae Speyeria hesperis ratonensis i i
Speyeria hesperis hesperis|19083012|U
SA:
19061A403/HT|USA:NM,Colfax Co.J1972 rit Aare hesperis FE ee ee an Co,,Brewster|1959
, : : 1 A:CO,Jefferson Co.|1973 ae : : |19083E 1 ston| 1979
ear Speyeria hesperis Steel Er peepee at ee a een ati ee —= Speyeria hesperis Sea eee euene ee) Sees
eyerla hesperis brica 11|Canada:BC,18 mi NW Houston]
| Oo? Speyeria hesperis hutchinsi| 19062 USA: WA, Okanogan Co,|1959 — Speyeria hesperis hesperis|19083D12|USA:CO, Jefferson Co.|197
Her Sneyeria hesperis hutchinsi[19065C10|USA:MT,Lincaln Co.[1994 St Speyeria hesperis SE ee ae ne Colfax pode
—— Speyeria hesperis lurana|/19044408]H JUSA:SO,Custer Co,|before 1945 Speyerla hesperis ratonensis|18037HO6|US :NM,Colfax Co,,1996
— Speyeria atlantis sorocko|19044B07|HT|USA:CO,Clear Creek Co,|1989 Speyeria atlantis atlantis|19065CO5|USA:NY,Hamilton Co.|1977
sag SPeyeria atlantis atlantis] 19065C04|USA:ME,Chester|1982 — Speyeria atlantis hollandi[19062G02|Canada:Manitoba,Sandilands|1956
sar «USpeyeria atlantis atlantis?|19065C07/USA: WV, Tucker Co.J1985 ae Speyerla atlantis hollandi|19062G06|Canada:Manitoba,The Pas|2002
<= Speyeria atlantis atlantis|19065C05|USA:NY,Hamilton Co,/1977 ““Spayeria atlantis atlantis|i9065C03|Canada:Ontario|2013 |
Speyeria atlantis atlantis|19065CO06|USA:NY Hamilton Co.|1977 am Speyeria atlantis hollandi|19062G01/Canada:Manitoba ill ill 1954
Speyeria atlantis pahasapa|19043G08|/HT|USA:SD,Pennington Co.|before 1998 22' Speyeria atlantis soracko/19044B07/HT|USA:CO,Clear Creek Co.|before 1998
Speyeria atlantis SOS OOo eae ereet Co.,Catskills|before1862 nas SPeveria atlantis canadensis|19065C0 Waele ae else da 1981
a5 _ Speyerla atlantis canadensis|19043G611)HT|Canada:Newfoundland|before 1935 ee peyerna atlantis canadensis|19043G11|HT|Canada:Newfoundland|before 1935
-" Speyeria atlantis eee ee ee eee eel 1981 ed oes atlantis Soe neaaeae eee A:NY Hamilton Co,|1977
4, Speyeria atlantis hollandi|19062G06|Canada:Manitoba,The Pas|2002 Loar peyena atlantis hollandi[01506C03|HT|Canada:Manitoba,Riding Mts.|1934
nies atlantis Baa eee ee eee a cents a dela a — Speyeria atlantis atlantis|19055D05|LT|USA:NY,Green Co.,Catskills|betare 1862
peyeria atlantis hollandi|19062G01|Canada:Manitoba,Vivian|1954 aa7 SPeyeria atlantis Bee een HT[USA:SD Pennington Co.|before 1998
Speyeria atlantis hollandi|19062G02|Canada:Manitoba,Sandilands|1956 bo Speyeria atlantis ollandi]19065C09 USA:MT,Lincaln Co.[1994
val Speyeria atlantis hollandi[O1506C03|HT|Canada:Manitoba,Riding Mts.|1934 b jis speyeria atlantis atlantis?|19065CO07|USA:\ WY, Tucker Co.]1985
Speverila atlantis hollandi|19065CO09|USA:MT,Lincoln Co,J1994 —"Speyeria atlantis atlantis|19065C04/USA:ME,Chester|1982
Fig. 11. Argynnis irene (red), hesperis (magenta), atlantis (blue) and nausicaa (green).
Trees constructed from nuclear genomic regions from (a) autosomes and (b) Z chromosome.
reference genome (Zhang et al. 2019d). Furthermore, we considered the autosomes and Z chromosome
separately due to their distinct roles in evolution and differences in resistance to introgression (Cong et al.
2019b). The trees constructed from concatenated coding and non-coding regions of autosomes (Fig. | la)
and Z chromosome (Fig. 11b) revealed evolutionary complexities of the taxa included. First, as expected,
the entire group consisting of A. hesperis (Fig. 11 green, red and magenta) and A. atlantis (Fig. 11 blue) is
monophyletic in both trees. Second, in both trees, A. hesperis is paraphyletic with respect to A. atlantis,
and a clade composed of south-central subspecies of A. hesperis (Fig. 11, green), including 4. hesperis
nausicaa W. H. Edwards, 1874 (type locality USA: Arizona, Graham Co.) is sister to all other taxa
combined. Third, the position of the clade consisting of northern and eastern subspecies of A. hesperis
that include the nominotypical subspecies (Fig. 11 magenta) is different in autosome and Z chromosome
trees. In the autosome tree (Fig. 11a), this clade is sister to A. atlantis, and in the Z chromosome tree (Fig.
11b), it is sister to the clade of western subspecies of A. hesperis that include A. hesperis irene
(Boisduval, 1869) (type locality USA: California, Sierra Co.).
Thus, the trees reveal four groups of taxa in this complex, and applying the oldest name in each
group, we call them atlantis, hesperis (sensu stricto), irene and nausicaa. To probe whether these groups
are species, we used the Fst/Gmin Z chromosome tests (Cong et al. 2019b) obtaining the following
Statistics. First, traditionally treated as distinct species, atlantis and hesperis groups show differences
consistent with their species-level distinction: 0.23/0.07, albeit marginally (Fst for distinct species is
typically above 0.2, with 0.5 and above indicating strong differentiation, and Gmin is less than 0.1, with
0.02 and below indicating strong isolation). Second, the differences between the atlantis and nausicaa
groups are even more pronounced than those for atlantis and hesperis: 0.36/0.026, which is in agreement
with the nausicaa group being sister to the clade consisting of the three other groups in both autosome
and Z chromosome trees (Fig. 11). Third, the differences between hesperis and nausicaa are of about the
same magnitude as for others: 0.26/0.05, indicating that A. nausicaa is a distinct species rather than a
18
group of subspecies within paraphyletic A. hesperis. Fourth, the hesperis and irene groups did not reveal
species-level differences in the Z chromosome: 0.13/0.13, suggesting that they may be conspecific, which
is in agreement with their close clustering together in the Z chromosome tree (Fig. 1 1b).
Although the irene group is not strongly different from the hesperis group in Z chromosome, it is
placed differently in the autosome tree: as sister to both hesperis and atlantis groups, rendering the
species A. hesperis that includes irene paraphyletic. While a species paraphyletic in a tree built from
concatenated genomic alignments is not inconceivable due to the possibility of extensive introgression
from some other species in a part of the species range, such a situation calls for further investigation.
Analysis of the trees built from various segments of the nuclear genome revealed that some segments in
the hesperis group are similar to the atlantis group, while other segments are similar to the irene group.
Hence, we hypothesize that A. hesperis is a hybrid species of A. irene and A. atlantis, because it shares
20% and 67% of its autosome-linked genome, and 71% and 20% of its Z-linked genome with the latter
two species respectively, while it possesses only 0.17% of unique polymorphisms, compared to 0.5% and
0.28% unique polymorphisms in A. irene and A. atlantis, respectively. We see that a significant fraction
of the A. hesperis genome is shared with either A. irene or A. atlantis, and the number of unique mutations
in the A. hesperis lineage is smaller than that compared to either of its putative parental species,
suggesting a hybrid origin of A. hesperis. Consequently, we consider A. irene (consisting of four
westernmost subspecies presently associated with A. hesperis, Fig. 11) to be a species-level taxon, and the
Z chromosome similarity with A. hesperis is therefore explained by the hybrid origin of A. hesperis,
which inherited larger segments of this chromosome from A. irene. This scenario of species originating by
hybridization is not covered by the Fst/Gmin Z chromosome test for species distinction (Cong et al.
2019b). The COI barcodes of A. irene are closer to A. atlantis (2.5%, 17 bp difference) than to A. hesperis
(5%, 33 bp difference), probably because A. hesperis possesses mitogenomes introgressed from A.
nausicaa and does not reveal differences in the barcodes with the latter species. As a side note, the earlier-
named species A. hesperis is likely to a be a hybrid species with one of the parental species being a named
later (A. irene), illustrating that biological reality has little to do with the order species were named in.
Finally, we find (Fig. 11) that the holotype of Speyeria hydaspe conquista dos Passos & Grey, 1945
(type locality USA: New Mexico, Santa Fe Co., presumed to be in error), presently placed as a synonym
of Argynnis hydaspe rhodope W. H. Edwards, 1874, clusters closely with the holotype of Argynnis
hesperis tetonia (dos Passos & Grey, 1945) (type locality USA: Wyoming, Teton Co.) and is therefore
placed as a synonym of tetonia, new placement.
In summary, genomic data suggest that the atlantis-hesperis complex consists of four species: A.
atlantis, A. hesperis, and two others with reinstated status: A. irene and A. nausicaa. The following
subspecies are assigned to 4. irene to form new combinations: Argynnis irene dodgei Gunder, 1931,
Argynnis irene cottlei J. A. Comstock, 1925, and Argynnis irene hanseni (J. Emmel, T. Emmel &
Mattoon, 1998). The following subspecies are assigned to A. nausicaa to form new combinations:
Argynnis nausicaa elko (Austin, 1984), Argynnis nausicaa greyi (Moeck, 1950), Argynnis nausicaa viola
(dos Passos & Grey, 1945), Argynnis nausicaa tetonia (dos Passos & Grey, 1945), Argynnis nausicaa
chitone W. H. Edwards, 1879, Argynnis nausicaa schellbachi (Garth, 1949), Argynnis nausicaa electa W.
H. Edwards, 1878, Argynnis nausicaa dorothea (Moeck, 1947), and Argynnis nausicaa capitanensis (R.
Holland, 1988). The names for other taxa in this complex remain unchanged.
Argynnis zerene atossa W. H. Edwards, 1890, new combination,
is not a subspecies of Argynnis adiaste W. H. Edwards, 1864
Described as a species Argynnis atossa W. H. Edwards, 1890 (type locality USA: California, Kern Co.),
this likely extinct butterfly was placed as a subspecies of Argynnis adiaste W. H. Edwards, 1864 (type
locality USA: California, Santa Cruz Co.) due to its prominent wing pattern similarities, in particular, the
washed out ventral hindwing devoid of silvery spots and reduced black markings above, especially on its
hindwing. To our surprise, none of the trees (concatenated protein-coding regions of the entire nuclear
19
genome, of Z chromosome and mitochondrial genome) placed atossa with adiaste (Fig. 12). Instead, the
atossa Clade originated within Argynnis zerene Boisduval, 1852 (type locality USA: California, possibly
Plumas Co.), which is phenotypically strongly spotted, both in back above and silvery below. Argynnis
adiaste was sister to Argynnis hydaspe Boisduval, 1869 (type locality USA: California, possibly Sierra
Co.) in a clade remote from A. zerene. Using Fst and Gmin statistics, atossa and A. adiaste adiaste are
characterized by 0.48 and 0.012, respectively, indicating strong genetic isolation. However, atossa and A.
zerene show the values Fst=0.13 and Gmin=0.15, which are within the range characteristic of
conspecificity. For comparison, A. adiaste adiaste and A. adiaste clemencei J. A. Comstock, 1925 (type
locality USA: California, San Luis Obispo Co.) exhibit Fst/Gmin of 0.06/0.21, sav less genetic
differentiation from each
other than atossa from A.
zerene. COI barcodes of
atossa and adiaste adiaste
lectotypes differ by 2.7%
(18 bp), but the 4. zerene
myrtleae (dos Passos &
Grey, 1945) holotype and
atossa lectotype differ by
1.2% (8 base pairs). We
think that the evidence
presented here to support
that atossa is not A. adiaste
is strong. However, while
currently we do not have
data to justify it, a
possibility that atossa is a
Species distinct from A.
zerene exists, if A. zerene is
later found to be a complex
of several distinct species.
For the lack of a_ better
option, we place atossa as a
subspecies of A. zerene,
where it fits genetically not
worse than a number of
other A. zerene subspecies,
Speyeria oe omis nitecris|18062B0
peyeria idalia Ri pide tialig|
Speyer Bele cybele| USA: ea
Suen ele cybele
Sbeyeria p ree te ethine spAb
eyerla hesperis ni el
peyeriah atlantis at Bore 130
SRerena mormon HAS
Speyeria é ae iil
oD;
Bn
aa OTe
a NINE Aarginia BBL. le
=
o cnt
key Seach
oa 7
E Virginia Dale
‘Britis pyeeLy Lillooet, Mount McLeal1926
eham aco ad) 5 at Government 1965
="
= "--
1
Ye Sonate Nationa L Pat aude
cnr PUPS C
nou Ee sbo
GO he;
hydaspe minor
5 eyeria hy asp aspen i
peyeria hi eene rhodopela
Speyer hy aspe rhadone ae
S ee ydaspe rhodope|963
hydaspe tehamal[PAo
Speyeria YF aane ydaspe| a 694,
aa ce e hyda
aie viral
Spoysbe hydasps davisi]19
Speyerla adiaste a ee
ncot
Pras
o, Umatilla Nationa Forest x17
fo. Mende alt ra aoe do
Vis
ee Ch, sisi ay ou Peano to 1877
i USA:CAK Gre
umboldt ca. wMcc Sua Mountain pLesss bl1987
Oga
aga ee na
X Mulder cise |1960
nae Santa ee AS Sararena Gap|1959
ta Cruz_C 1982
et
pe 3 anta Cruz Co, rene Gap|19
goa lens adiaste adiaste i anta Cruz Co, santa Cruz Bee 1990
eyerla painete adiaste|19055 santa Cruz Co.,Santa ft Be z\guRt to 1864
speyeria adiaste clemencel|19061 haa ca Co. (Chews Ril
abeyeue adea cleme nace ‘CA,San Luis Obis “Bei ron pxradeade ral ae
laste sence ue FIUSA:CA,San Luis ispo Co, Atascadero|19
‘cs kern/Lo anges es *Cos., syel0 n io
USA: CAKe nfl
onterey Co, che ge ee ctige
lamnsua Co.|1973
CA, goa ee ae »>chews Ridge|1977
CA.Monterey Co. uehe AL 1984
Monterey a ee mil N gel1994
rae Go. 2h we Ridgelao 2
ews aoe 211990
AN Monterey Co.,Chews Ridge[1990
tidnal Forest co
DOnGE
ao
aa
on
Pommp=
7 UN TT
Speyeria adiaste clemenceij 19061
sBgree adiaste clemencel| A
o
Fi
Oo
06
vate a [19
aa adiaste clamencel]19
laste clamencel| 19062
eyeria ue clemence| eee
0 aps yerla adiaste c See ace
De adia clemencei|1
Speyeria ea pe Davis ae
Speveria nae u eee USA:
se[ i004 AD6]
a"
Oe
zou
Cn
Ca
tr
UrOBes
275
oe
ie ==re
Conn
WL T> >
UI
>=:
aes
om
zO0 t-Cb
Mout Park ae to 1942
i Sed ‘Mountains|196
= Ct orig Mountains 1367
ALC Ba uMt, Pinos|prior to 1934
SA. n€o,,Ca scade Mountains|before 1945
n Co. crane ee. Cany on ee
rCo, a miles NNE vis ve Dale|2016
Ei ae chews al rar
Fini a 08 Nationa Paes S016
pres
=
5
peyeria coronis raiere ah
Speyerla coronis coranis|PAQ?
aves Se snydern|JPAO68
era ae ne malcolm
Speyeris zerene ma alealmy PAGS
Speyerla zerene sere ae
=
J houp!
BOS
az
LA
ve
5255
PDE
oe
oxime
oD i
Li
> ape eo
sole
Oo, zd mE of C Ipine gol
an acing Co.,Me cino Pa
USA CA, Sonat Barbara o! ‘or Ventura Cos,,Sierra M) 1922
Speyerla adiaste oe a CA,Kern Co.,le
Speyeria ad adiaste ala eens a o3 SMT ELUs USA: A,Los a al ea 18 jon region|1923
re 043H Mi inols River Pree to 1
og > rene elerleia STIR a
cra elicits zerene fea: u goo ico7 HTMiUs ISAC ells fete a:
myrtleae|190 Off iMlus ACA Sa alprior t
na Speyerla crate BOnrareyS 2 iu a CA, Mann EG can e453 orto Leas
1 Speyerla zerene myrt eee A eae SiS ye) eae CO., cng Co OBE
Speyerla zerene sonomensis|
La op
iF
Speyerla zerene zerene|
Speyerla zerene PAO4
= obeyera adiaste at
re A
3.05
oeataea Ferene iat canal a Thiuse i Co ae:
Bp era zerene gunderi (=cynna ror
ae zZerene picta FH arr ttl is eT en WEI SH an "|
o.,Humboldt bial bejore 1945
eyerla zerene platina ee Ga a Utah Co.,Met. L
a yerla Zerene sinop sine Co Rocky ountain
peyerla zerene Baeoe La04ae bled Bat olumbia a,4spen Gro
Speyerla zerene sinope ee Lee SA: i Gra cana Co,,4. 34 ie mi SE Ha t Su Wiphuy Spa 16
Speyerla zerene pictal9626|MIUSA:OR, Umiauill a Ca, ‘Uimiatil a National Forestl2
ees 1945
Fig. 12. Argynnis zerene atossa (red) is not A. adiaste (cyan), but A. zerene (green).
although it differs strongly from all other 4. zerene subspecies in wing patterns.
The association of atossa with zerene came as a surprise due to their phenotypic dissimilarity. The
reasons behind the wing pattern similarities between atossa and adiaste, and the lack of such similarity
between atossa and zerene remain unclear. We sequenced the primary types of both atossa (in the
Carnegie Museum of Natural History, collected prior to its description in 1890) and fejonica J. A.
Comstock, 1925 (in the Los Angeles County Museum, considered a subjective junior synonym of atossa,
has spots weakly silvered, collected in 1923 in Los Angeles County, California) in addition to a specimen
from Colorado State University collection (collected in 1922 in Sierra Madre Mountains, California).
These specimens were collected in different localities and different years, and handled differently
throughout the years, but they cluster together in all trees, forming a distinct clade within zerene. It does
not seem likely that legs of yet unsequenced population of zerene were glued to all these 3 specimens, or
similar contaminant affected these samples processed in our lab on different days (and for some of them,
years) and sequenced in different lanes and batches. Therefore, we conclude that Argynnis zerene atossa
W. H. Edwards, 1890, new placement, represents an unusual example of phenotypic convergence that
hindered its taxonomic placement, now revealed through genomic sequencing.
20
Argynnis coronis carolae dos Passos & Grey, 1942 is a subspecies-level taxon
Described as a subspecies of Argynnis (Speyeria) coronis Behr, 1864 (type locality USA: California,
possibly Santa Clara Co.), Argynnis coronis carolae dos Passos & Grey, 1942 (type locality USA:
Nevada, Clark Co.) was elevated to species by Emmel and Austin (Emmel and Austin 1998) due to a
number of its unique features, including the isolated locality. Our genomic trees revealed that carolae
forms a compact clade consistent with its isolation, however, not separately, but deep within A. coronis,
sister to Argynnis coronis hennei Gunder, 1934 (type locality USA: California, Ventura Co.) and near the
nominal A. coronis (Fig. 12 magenta inside blue clade). This placement in the tree is geographically
meaningful, but makes it difficult to accept the species status of carolae because it renders coronis non-
monophyletic. Furthermore, Fst/Gmin for carolae vs. coronis are 0.23/0.11. Fst is somewhat elevated due
to genetic closeness of individuals within apparently strongly inbred carolae population, but the gene
flow between carolae and coronis is more than two times higher than the 0.05 threshold characteristic of
different species. The COI barcodes of the A. carolae holotype and A. coronis differ by ~0.5% (3 bp).
Therefore, we reinstate this taxon as a subspecies: Argynnis coronis carolae dos Passos & Grey, 1942.
Aglais Dalman, 1816 and Polygonia Hiibner, [1819]
are subgenera of Nymphalis Kluk, 1780
In agreement with others (Opler and Malikul 1992; Layberry et al. 1998; Savela 2020), we propose that
Aglais Dalman, 1816 (type species Papilio urticae Linnaeus, 1758) and Polygonia Hubner, [1819] (type
species Papilio c-aureum Linnaeus, 1758) are better treated as subgenera of Nymphalis Kluk, 1780 (type
species Papilio polychloros Linnaeus, 1758) rather than as distinct genera. These three distinct
phylogenetic groups are close to each other genetically with genetic distances between them of the same
magnitude as those for taxa considered congeneric in closely related lineages, such as Vanessa
[Fabricius], 1807 (type species Papilio atalanta Linnaeus, 1758) (Fig. 13). The times of divergence
between Nymphalis and Polygonia
Ag aie o|[PAO ae ‘Bavaria,near Grasswan g|2017
1 Ag als Urticae|/PA So eeien cae ee ack Swangl20
and between Nymphalis and Aglais By eahygone neers Fehon 4 aise we ene National Par:|2017
have been estimated as ~7 and ~11 Bol sly onla satyrus saree ee a TelUSA A cANontarey Co,Old Coast Road off SH1/2016
: Polyg s silenus|1711 BOS (M ORY Il Co.J19
Mya, respectively (Chazot et al. ‘Pal lf gahia gracis #6 RN RTE a amin soot Simapanli 94
7 Polygon faunus | ae PAY ener Ca a Ranch Road off pial
2019). COI barcode difference Nie by ane Bn cha snlanid Fu rua Be oie Fathead Lael 12
between N. polychloros and P...c- Nie Piphal ig anuopa (= af NDE: NY Schoharie Ct Ee nail 1857
. ih moval antiopal|® au tero Co,,Lincaln Nehonal Eorest| 36 17
aureum iS 6.7% (44 bp), and Ste nee ea etedie ae ae
b / hl d A Vanessa annabellal9 ates ee foes Nations Forest|2017
etween N. po YC oros anh ISA Ba ales GS Ballas, White Rock Creek|2015
urticae iS 7.9% (52 bp). This eae Dallas Co. qaleee White Rock Lake Par|2017
yico: ax
fanico: Oaxacal 1987
Fig. 13. Were eee and Poweonia (magenta) are Nymphalis (blue).
divergence is comparable to that
between Vanessa annabella (W. D.
Field, 1971) and Vanessa atalanta (Linnaeus, 1758) at 6.2% (41 bp), but smaller than the divergence
between V. atalanta and N. polychloros of 9.7% (64 bp). While it is not possible establish a meaningful
COI cutoff for the genus-level divergence, these numbers comparatively indicate genetic similarity of
these butterflies, and they also loosely correlate with their divergence times. Inspection of the genomic
tree (Fig. 13) reveals that the most prominent internal branches (the longest) are indeed those that support
Vanessa and its sister clade consisting of Nymphalis, Polygonia and Aglais. The clade of the latter three
taxa is compact (Fig. 13), prominent, and genetic divergence within it agrees with the expected
divergence within a genus. Therefore, unification of the three genera under a single genus (Nymphalis)
would be more consistent with how other genera (e.g. Vanessa) are classified. These showy butterflies are
quite diverse in their wing patterns and attracted significant attention, which is likely responsible for their
oversplit classification. Also, we confirm the expected sister relationship between Nymphalis antiopa
21
(Linnaeus, 1758) and N. cyanomelas (E. Doubleday, [1848]) (Fig. 13). In summary, in a move towards a
more consistent classification, we suggest treating Ag/ais and Polygonia as subgenera of Nymphalis.
Coenonympha california Westwood, [1851] is species
distinct from Coenonympha tullia (Miiller, 1764)
In agreement with Kodandaramaiah and Wahlberg (2009), we find substantial genetic differentiation
between European Coenonympha tullia (Miller, 1764) (type locality Denmark: Zealand Island) and North
American Coenonympha california Westwood, [1851] (type locality USA: California, near San
Francisco) (Warren et al. 2016). The latter has frequently been treated as a subspecies of the former
(Pelham 2008; Pelham 2020). Coenonympha tullia See eareaae mie Sweden docehyttan| 1978
Fst/Gmin statistics for C lli = SE PoE naN Wanted ia lay 1909746 Coach ne blicBoh 1976
a oenonympha tullia tullia zech Republic,Bohemia
St Mun Statisucs for : tu la VS. a a Cecsone Hehe tulle octet gue 9SHO3|USA:AK Kodiak Is ones
‘. : . . . — Coenonympha tullia mixturata?| SOB TORTUGA: AK Kotzebuel195
california are 0.22/0.02, indicating oa Coenonymoha tullia yuk conensis| 190981106 |USA:C Canada,Yukon Terr.[1961
4 : Es ae a eee cnenee [19097812 FIUsA, Yukon pers 11903,
— oenonympha tullia california arin Ca
very limited gene exchange between pie Coenonympha tullia ampelos =| 29098H1 i{fusa. CAplumss Co119
h 6 l f l l l t d 88 - een EET tullia Loe ear pee TUS 1A neR 1094 Ea, SLO79/USNM
Er oenonympha tullia eunomia
t ese taxa, typica OF Close yi relate a5 Coenereeche tullla ochraceali9098 a1 {lusAsMt Mt Soy al Co,[198
. . . Coenonympha tullia See aaa n SAWY, Park Co, ‘Yellowstone National Park|2017
species rather than subspecies. This =a Coenonympha tullia er aos Se Canada:Albertal 2003
5 . ; aa Coe ete re la Been 1 0|MiCanada: raigy nes
ha oenonympha tullia benjamini anada:Alberta
differentiation strongly suggests that — Beene nae tullia Benjani, 12098098 /58 A‘NE,Cherry Co,/1985
Womiieieoindeed ; Fa Seen eka err el soossus usa be Meader 95
oenonympha tullia inornata Washington
C. ca ifornia IS imndee a species on ee eacie bee 98D io 2 (USA A, conor Co,J1974
wes 5 0.35 Coéenonympha tullia inornata|19098D04|USA: NY Woe Co,|2005
distinct from C. tullia. Moreover, We — Coenonympha tulllia meisaaci|19098C07|Canada: aa ae
Soenonympha tulls FACE ES ITT ete tees acwetgie soad
‘ Coenonympha tullia nipisiqui anada:New Brunswick,Bathurs
find that the northernmost American a Aeon re tullia Eee 19098D01|M|Canada:New Brunswick| 1952
Co
Cem ne tullia nipisiquit] 19098C12|M|Canada:New Brunswick Mos
taxa from this complex form a clade Fig. 14. Coenonympha tullia (blue and magenta) and california (red).
that is sister to C. tullia (Miller,
1764) and not to C. california Westwood, [1851] (Fig. 14). These populations are currently attributed to
subspecies C. tullia kodiak W. H. Edwards, 1869 (type locality USA: Alaska, Kodiak), C. tullia mixturata
Alpheraky, 1897 (type locality Russia: Kamchatka; it remains to be investigated if this name applies to
the Nearctic taxon) and C. tullia yukonensis W. Holland, 1900 (type locality Canada: Yukon and USA:
Alaska). Compared to European C. tullia, they show Fst/Gmin of 0.14/0.05, which are in the range for
conspecific populations, however with a more limited gene exchange than typical (Gmin is less than 0.1).
Therefore, until further research shows otherwise, we leave these three subspecies with C. tu/lia. Future
genomic studies of Coenonympha tullia viluiensis Ménétries, 1859 (type locality Russia: Vilyuy River)
are also needed, because if it falls in the same clade with the three subspecies of C. tullia from North
America, it would be the oldest name in this clade. And if this clade is found to be a species distinct from
C. tullia, it will be the name of this species. In summary, according to our genomic analysis, both C. tullia
and C. california are present in North America, and all American taxa of the tud/ia complex other than the
northernmost subspecies C. t. kodiak, C. t. mixturata and C. t. yukonensis belong to C. california.
Palaeonympha Butler, 1871 is a subgenus of Megisto Hiibner, [1819]
The New World genus Megisto Hiibner, [1819] (type species Papilio eurytus Fabricius, 1775, a junior
homonym, considered a synonym of Papilio cvmela Cramer, 1777) became monotypic after the transfer
of Euptychia rubricata W. H. Edwards, 1871 : Palaeonympha opalinal19114B02|Taiwan|1957
: oe eee pees pave en ears
(type locality USA: Texas, McLennan Co.) to Mégisto cymala cymela| 8531 |Usa: 1X Harrison ¢o.12017
rood 1 if] ae ma gb |SAlINDS 7454 ee ey Lita ee
Cissia Doubleday, 1848 (type species Papilio ar spilt ideale AMINOS7 45443): st a ee Sat
7 ° ° ° ° ¥o ImMo|qes Pacta Brazil aco rea
t Pais 7Gosic R
clarissa Cramer, [1780], a eee subjective yonthimoides borasta|SAMNO8 Costa Rica AC Wns eaerseieeis
synonym of Papilio penelope Fabricius, 1775) peed sr Cras a co ores Ane
7, t al. 2018). A Pal h [0.8 se Gissia penelope SAMINOS #acsjetuader|2014
( acca Cl al. ). genus ardeonympna — esate AMNO9745454|Brazil:Sao pit 2014
Butler, 1871 was proposed for a newly described Fe a ee eT eA US R Aceene senile Ca 2013
species P. opalina Butler, 1871 from China and _ | Fig. 15. Palaeonympha (red) is Megisto (blue), Cissia (magen-
remained monotypic since. In wing patterns, it ta), Vanima (brown). IDs with "SA" are from NCBI database.
Ze
bears an uncanny resemblance to M. cymela (Fig. 16), and was indeed sister to Megisto both in gene
marker-based (Zacca et al. 2018) and genome-scale phylogenies (Espeland et al. 2019). Genomic
sequencing confirms a close relationship between monotypic Megisto from the New World and monotypic
Palaeonympha from the Old World (Fig. 15 blue and red), closer than many species of Cissia are to each
other (Zacca et al. 2018;
Espeland et al. 2019) and
about the same divergence
as two species of Vanima
Zacca, Casagrande & O.
Mielke (Fig. 15 brown).
The COI barcodes of
cymela and opalina differ
by 8.8% (58 bp), within
the range of many con-
geners. To emphasize this
close kinship between
these two disjunct species
(cymela and opalina)
apparent from their geno- Se
types and phenotypes, we Megisto (Megisto) cymela M. (P.) opalina
propose that, instead of Fig. 16. Megisto opalina (Taiwan, sequenced as NVG-19114B02 & NVG-19114B03)
each being placed in its and M. cymela (USA: OK, Carter Co., Murray Lake, 9-Apr-1999).
own monotypic genus, they are congeneric. We assign a new status of subgenus to Palaeonympha,
resulting in Megisto opalina Butler, 1871, new combination. Thus, Megisto becomes a Holarctic genus,
yet again indicating elaborate connections between the Old and the New Worlds.
NVG-19114B03
Cissia cleophes (Godman & Salvin, 1889) does not belong to Megisto Hiibner, [1819]
Placed in Megisto recently on the basis of morphological similarities (Zacca et al. 2020), Euptychia
cleophes Godman & Salvin, 1889 (type locality Mexico, Guerrero, Fig. 17) is not monophyletic with the
type species of Megisto (Fig. 15
magenta vs. blue) and therefore
does not belong to Megisto,
unless this genus is expanded to
include species placed in other
genera, such as Yphthimoides
Forster, 1964, Vanima and
Cissia. In our tree (Fig. 15),
cleophes falls within Cissia: it is
in the clade with C. penelope,
which is a valid name for the type
species of Cissia. Therefore, because the tree strongly supports that cleophes does not belong to Megisto,
we suggest to leave this species in Cissia (where it may belong and was placed previously, but statistical
support for this clade is weaker) pending genomic analysis of other species from this and nearby clades.
Fig. 17. Cissia cleophes sequenced as NVG-19118BO01.
Hyponephele Muschamp, 1915 is a subgenus of Cercyonis Scudder, 1875
In the genomic tree (Fig. 18), Hyponephele Muschamp, 1915 (type species Papilio lycaon Rottemburg,
1775) is sister to Cercyonis Scudder, 1875 (type species Papilio alope Fabricius, 1793, placed as a
23
subspecies of Papilio pegala Fabricius, 1775), in agreement with previous findings (Pefia et al. 2006).
The tree reveals that the genetic divergence between Hyponephele and Cercyonis is smaller than that
within Erebia Dalman, 1816 (type species Papilio
Cercyonis pegala texana|4506|USA:TX,Wise Co,[2015
‘ : Ik
ligea Linnaeus, 1758). The COI barcodes of H. lycaon 2 ere ee cAMéndocne Co.l2047
. . reyonris stnenele an rransico LoO,[o
and C. pegala ditier by 7.9% (52 bp). We give Hypobephele yeagn(s0 aoe Neth Macescnig 980
1 1 H hele dysd 19115E11|Tajikist 1975
Hyponephele a new status of a subgenus within oe Mariolatelmassia|i9{-U5|Greecel ine
Cercyonis. This change may not be welcomed by the sar — Pyronia {thonus|19113+10[France 2008
F ronia bathseba pain
Old World Lepidopterists who are used to the name Aphantopus hypsrantus Ease ana
Hyponephele applied to its many species, similar to —— grabia vidler|$004[USA;WA (hateom Co,[1980
how uray aaa weleomed sine eaeea ic iaolua Secale ecoe Gas gaCR cane Ce
OW ellis IS not welcomed 1n ers O Include Erebia magdalena|6549/USA4:CO, Park Co.|2016
Speyeria as its subgenus. However, this name change soso olkcoidalla| 798s Vel raise eT
Erebia disal16106E08|Canada:Yukon Territory|2016
highlights the close relationship between the two
; Fig. 18. Cercyonis (blue), Hyponephele (red), Maniola
subgenera (Hyponephe le and Cer Cy ONES ) making (green), Pyronia (magenta), and Aphantopus (cyan).
Cercyonis a Holarctic genus, similar to Erebia
Dalman, 1816 (type species Papilio ligea Linnaeus, 1758) in divergence and distribution. This is yet
another step towards more internally consistent genus-level classification in butterflies.
Pyronia Hiibner, [1819] and Aphantopus Wallengren, 1853
are subgenera of Maniola Schrank, 1801
The genomic tree reveals that Pyronia Hiibner, [1819] (type species Papilio tithonus Linnaeus, 1771) is
not monophyletic (Fig. 18), and Pyronia bathseba (Fabricius, 1793) is sister to Aphantopus Wallengren,
1853 (type species Papilio hyperantus Linnaeus, 1758) with strong support (Fig. 18). Two other Pyronia
Species we sequenced are not monophyletic either: the type species of the genus is sister to Maniola
Schrank, 1801 (type species Maniola lemur Schrank, 1801, which is a junior subjective synonym of
Papilio jurtina Linnaeus, 1758). To restore monophyly, it is possible to break Pyronia into smaller
genera, and these already have names available: Pasiphana de Lesse, 1952 (type species Papilio bathseba
Fabricius, 1793) and Idata de Lesse, 1952 (type species Epinephele ida var. cecilia Vallantin, 1894).
Alternatively, they can be grouped in some ways to form more inclusive monophyletic genera. The tree
(Fig. 18) reveals three clusters of species of equivalent rank. One of these clusters is the genus Erebia.
The other one is the genus Cercyonis as we presently define it (including Hyponephele as a subgenus).
Therefore, it is meaningful to treat the third group as a single genus as well. Hence, we propose that
Aphantopus, Pyronia, Pasiphana and Idata are subgenera of Maniola, new status. It is unfortunate that
genomic data suggest abandoning the familiar Aphantopus and Pyronia as genera, however breaking this
more inclusive but genetically prominent genus Maniola into four or five very small genera is even less
appealing to us.
Dione incarnata N. Riley, 1926 is a species
distinct from Dione vanillae (Linnaeus, 1758)
Inspection of a nuclear genomic tree reveals pronounced divergence between Dione vanillae (Linnaeus,
1758) (type locality South 4 te ees Aelia ae Jeri[4695|USA:FL,Levy Co, ears ceetown|2015 Pot aia
America, probably Surinam) Secon es aaa) UU IU Ma ace cele i ot Giida(@07
fi Jamai d Heliconius erato petivarana[i7117605|M|Mexico:San Luls oie
specimens rom amaica af Dione manetal14114510|USA. TX,Hidalgo Co.,Mission|2014
1 1 Dione 17117B801|[M|Mex san Li Pot 1978
from the USA. (Fig. 19). This i Tae inte pa eM Mexico Sa) ae
divergence is of about the peck vanillae insularis|10272|Jamaica: ae
lone vanillae insularis|10536|Jamaica:3|2017
: EE eT ee eee 2 ot ronda ciy|2017
ione vanillae nigrior iami-Dade Co,,6 mi SW of Florida ity
same magnitude as that 7 Sane vanillae incarnata| 10145|/M|USA: AZ Santa Cruz Co, Pajarito Mtns.|2017
between the distinct species ione vanillae incarnata|3451|M|USA:TX Hidalgo Co,Old Rio Rico Rd, 1.5 air mil2015
Dione moneta Hibner, [1825]
and Dione juno (Cramer, 1779), and somewhat smaller than that between more distant relatives
24
Fig. 19. Dione incarnata (red) and D. vanillae insularis (blue).
Heliconius charitonia (Linnaeus, 1767) and H. erato (Linnaeus, 1758) (Fig. 19). In contrast to their
separation from Dione vanillae insularis (Maynard, 1889) (type locality Bahamas, Fig. 19 blue), the name
currently applied to Jamaican populations, the two USA subspecies: eastern Dione vanillae nigrior
(Michener, 1942) (type locality USA: Florida, Monroe Co.) and western Dione vanillae incarnata N.
Riley, 1926 (type locality Mexico: Durango), cluster closely with each other (Fig. 19 red). The Fst/Gmin
Statistics for the two groups (red vs. blue) are 0.81/0.0002, indicating nearly absent gene exchange
between these groups, the smallest of all sister species we studied in this work. Search of the BOLD
database (Ratnasingham and Hebert 2007) reveals that Jamaican specimens group closely by their COI
barcodes with specimens from other Caribbean Islands (Cuba, Dominican Republic, Puerto Rico), and in
particular with specimens from the Bahamas (the type locality of D. v. insularis. Therefore, Jamaican
populations may indeed be referred to as D. v. insularis. The COI barcode differences between Jamaican
insularis and USA incarnata is 2.9% (19 bp). For these reasons, D. vanillae insularis is apparently a
species distinct from the USA species consisting of subspecies nigrior and incarnata.
These two species (insularis and the USA species) are distinct phenotypically with wing shapes and
patterns, as described by Maynard (1889). In fact, Maynard proposed Agraulis insularis as a species, and
he considered the USA species to be Agraulis vanillae, characterized by longer wings, smaller black
spots, white dots in forewing black spots compared to insularis. However, both the Merian illustration
(1705), which was mentioned in the original description of D. vanillae (Linnaeus, 1758), and the
lectotype specimen (Honey and Scoble 2001) reveal the insularis phenotype (e.g. extended black band on
the forewing, broader wings) that differs from the USA specimens. In his revision, Michener gave a key
to the vanillae complex taxa (Michener 1942). The first doublet separates incarnata with nigrior from all
other taxa, including the nominotypical vanillae. Therefore, the USA specimens are not D. vanillae, but a
Species that may be referred to by the oldest name applicable to North American populations: D.
incarnata, and we currently leave insularis as a subspecies of D. vanillae. Michener also raised the
possibility that incarnata may be a distinct species, based on incarnata specimen from Colombia, in
which case it would be sympatric with D. vanillae. However, these Colombian specimen might have been
mislabeled. Due to the evidence presented here, Dione incarnata N. Riley, 1926, new status, appears to
be a distinct species, with D. incarnata nigrior (Michener, 1942), new combination, being its subspecies.
Danaus eresimus (Cramer, 1777) belongs to subgenus Danaus Kluk, 1780, together
with Danaus plexippus (Linnaeus, 1758), and not to subgenus Anosia Hiibner, 1816
together with Danaus gilippus (Cramer, 1775)
Danaus eresimus (Cramer, 1777) (type locality Suriname) looks superficially similar to Danaus gilippus
(Cramer, 1775) (type locality Brazil: Rio de Janeiro) and at times it is a an to distinguish these two
Species. On_ the contrary, Danaus Danaus plexippus|4849|USA:FL, le Co,SH997 4.8 mi N of SH90|2015
l | (Linnaeus 1758) (t e *Banaus lexipbus Sia IF|USA Hee Ce FMoabl20%6 RR tracks|2015
Pp exIppus 2 yp eresimus mo re is & stair Eo ae Beane sae
: 5 naus eresimus mon eine arr Co,Rio Grande Ci
locality USA: New York, Orleans Co.) pana eresimus mantezum 0 Co,Chihuahua RR tracks|2015
i i i. eens allio ous eee 3 eee ob ola ue esi Rd|20
anaus gilipous thersippus an Diego Ca
is superficially more different from ® CEE POOE thersippus|41 Sa[r [USA XJetferson Ca,5 of Stine Pass|2015
. ; ae naus gilippus berenice|4 SA4:FL,Monroe Co,key West|2015
either D. ereslmus oOf7 D. gilippus Danaus gilippus berenice ale USA‘FL, Levy Ca, Yank eetown|2017
Tirumala formosa morgeni[19095G O/Cameroon|19 1974
(Warren et al. 2016). Due to these
superficial similarities and differences,
traditionally, only the former, as the type species, belonged to Danaus Kluk, 1780, and the latter two
Species were placed in Anosia Hiibner, 1816 (type species Papilio gilippus Cramer, 1775) (Ackery and
Vane-Wright 1984; Pelham 2008; Pelham 2020). However, among these three species, genomic data
(both nuclear and mitochondrial genomes) place D. eresimus as a sister to D. plexippus with high
confidence (Fig. 20), and D. gilippus is a sister to that clade of the two species, in agreement with
previous DNA-based analyses (Zhan et al. 2014; Aardema and Andolfatto 2016). Therefore, we transfer
Danaus eresimus (Cramer, 1777) from the subgenus Anosia where it does not belong, to the subgenus
Danaus in accord with the phylogeny of these three species. This change has already been implemented
25
Fig. 20. Danaus plexippus (blue), eresimus (red) and gilippus (magenta).
by Pelham in the most recent version of the catalogue (2020) after the discussion of our genomic data and
previous works with NVG. Here, we simply formalize this change in a publication.
Chlosyne coronado (M. Smith & Brock, 1988) is a species
distinct from Chlosyne fulvia (W. H. Edwards, 1879)
In the /eanira group, Chlosyne fulvia coronado (M. Smith & Brock, 1988) (type locality USA: Arizona,
Pima Co.) has been a
subspecies-level taxon
since its description
(Smith and Brock 1988).
The genomic tree of the
group revealed _ that
Chlosyne fulvia (W. H.
Edwards, 1879) (type
locality USA: “Western
* NVG-20011F12
AZ: Mohave Co., Peach Springs
°\ 3 : ——=
Texas”) is paraphyletic Chi Pa — Thloslne leanira wright (=pelona)
. osyne : Chlosyne leanira elegans| 1906110
with respect to Chlosyne taxa — Chlosyne leanira leanira|PAO352|C
Chlosyne leanira alma|18034D04
= Chlosyne leanira alma|18034D05|N
& Chlosyne fulvia pariaensis|17
cyneas (Godman es
Salvin, 1878) (type BB - wrightii gsyne fulvia coronadal1/109D02|Hy|AZ:Pima C
oCalineMexics @ [) - elegans ° ss [222 — chiosyne fulvia fulvia| 20011G02|Az:Apache Co.
Ocall Vv C€X1Co: axaca), : leanira Chlosyne fulvia Fula pe teal ee 3
and C. fulvia coronado i —leanira hlosyne fuvia va —
with Chlosyne fulvia
pariaensis (M. Smith &
Brock, 1988) (type
locality USA: Utah,
Kane Co.) form a clade | o — type locality:
more prominent than specimens sequenced
© — type locality:
[ | — alma SS i Chlosyne fulvia fulvia
Chlosyne fulvia f
- Chlosyne cyneas|17
A- pariaensis
A- coronado
@ — fulvia
Chl osyne leanira (C. no specimens sequenced
Felder & R. Felder, type localities are indicated
1860) (type locality by tiny circles placed inside fee
, . specimen symbols, or small
USA: California, Plumas | circles framed with color of taxa
: (if no specimens from these O
Co.) (Fig. 21). The Fst/ localities were sequenced), labeled f é
Gmin statistics for with names of taxa preceded by =
for junior subjective synonyms,
fulvia and coronado are shown in smaller, thinner font :
0.49/0.015, comparable Fig. 21. Chlosyne fulvia and coronado with relatives. Four specimens from Arizona are
to those of fulvia vs. shown (dorsal: right and ventral: left) and are labeled with their DNA sample numbers on the
leanira: 0.40/0.012. COT L.maP that shows the localities of all sequenced specimens from the USA included in the tree.
“Western Texas”
barcodes are 2.7% (18 bp) different between fu/via and coronado, but are 0% between coronado and
pariaensis. Furthermore, according to the map of sequenced specimens (Fig. 21), fulvia and coronado
may be sympatric in north-central Arizona. For all of these reasons, we propose species status for
Chlosyne coronado (M. Smith & Brock, 1988) new status, and Chlosyne coronado pariaensis (M. Smith
& Brock, 1988) new combination, as its subspecies.
Chlosyne chinatiensis (Tinkham, 1944) is a species
distinct from Chlosyne theona (Ménétriés, 1855)
In their revision of the theona group, Austin and Smith (Austin and Smith 1998) placed Melitaea
chinatiensis Tinkham, 1944 (type locality USA: Texas, Presidio Co.) as a subspecies of Chlosyne theona
26
(Ménéetriés, 1855) (type locality Nicaragua). While accepting subspecies-level treatment of chinatiensis,
Pelham (2008) writes: "There is considerable
Chlosyne theona eee ‘Nueva Leon
Chlosyne theona chinatiensis|69/|U54:TX Brewster Co
reason to consider this a distinct species from oss 28 Chiosyne theana chinatiensis|7664]Mexico:Nuevo Leon
Chlosyne > fhean paler S|USAITX Star
theona. More investigation is required." We Te. Area Hat et ae agree fleRia Costa Rica
‘ i : ; : : Chlosyne theona theklal10947IUSA:TX Jeff Davis Co.
carried out our genomic investigation by Fig. 22. Chlosyne chinatiensis (red) and theona (blue).
sequencing of three chinatiensis specimens from
the US and Mexico (Fig. 22) and found that their comparison with theona specimens from across the
range (from Arizona, Texas and Costa Rica) results in the following Fst/Gmin statistics: 0.35/0.019,
indicating genetic differentiation and low gene exchange consistent with chinatiensis being a species-level
taxon. The COI barcodes of C. chinatiensis and C. theona thekla differ by 1.4% (9 bp), but those of C.
chinatiensis and C. theona bolli differ by 0.6% (4 bp). Moreover, C. chinatiensis is sympatric with C.
theona bolli in west Texas, e.g. in the Big Bend National Park. Given this evidence, we reinstate
Chlosyne chinatiensis (Yinkham, 1944) as a species.
Family Hesperiidae Latreille, 1809
Phocides lilea (Reakirt, [1867]) is a species
distinct from Phocides polybius (Fabricius, 1793)
A tree constructed from protein-coding regions of their nuclear genomes reveals that specimens of
Phocides polybius (Fabricius, 1793) (type locality "Indiis", likely Suriname) partition into two distinct
clades (Fig. 23). One of the clades
consists of Phocides polybius lilea
lies (malhiellata)|18094cD9|H ‘TX|priar to 1872|CMNH
albicilia ta)| 1809400 O|HT|F[Guatemalal|old| MTD
: : “8 recast al teties lileali Penaana tien: eee oe
(Reakirt, [1867]) (type locality _Phecides poly ae olybius|4 (a0asHt |M|Wenezuela,Meridalold
: . . 2 d h ae Ea Pena a a4 yoiu us polybius|17098G01|Panama|19 978 .
Mexico: Veracruz, Fig. 3 re ). T € — headed palbios oat Hoehne Cayennelald
other clade includes all other taxa of on See ee mons iawe
. 5 3 . 2 Phocides polybius polybius (=imbreus)|15029809|ST|"South 4merica’|ZMHB
Bis Speeles (ie eae) FSU CTRINS || af Paced ott bangs eunmaca 136Ser 890 ifroendna| onc nae
statistics for the 7. chromosome pleas Bal bius bhanias {-unmacua}l TUneeae ?STIM Necartina 1906|MNHP
. Phaocides pialia Alte (=zancle eius)|18025C09|HT|M|Brazil: SC|before 1932|)4MNH
comparison of these two clades are Phocides yokhara|18031C04)Ecuador|2002
: h ij roo Phocides perillus|1803 BOeIM| Colombia, Bogotalold
0.39/0.021, suggesting that they Fig. 23. Phocides lilea (red) and polybius (blue).
represent two distinct species.
Moreover, COI barcodes of /ilea from Mexico and polybius from Guyana show 3% (20 bp) difference.
Therefore, we conclude that Phocides lilea (Reakirt, [1867]) is a species-level taxon, reinstated status.
Furthermore, we sequenced the only known syntype of an enigmatic taxon Erycides imbreus Pl6étz,
1879 from the ZMHB collection, illustrated in Warren et al. (2016). This specimen is a syntype because it
is a uniquely patterned specimen that carries appropriate labels, agrees with the original description and
looks similar to the unpublished Godman copy of the Plétz illustration (@¢n BMNH, inspected by NVG)
(Godman 1907). It is an unusual specimen lacking an orange bar in the forewing discal cell (usually
extending to costa) typical for P. polybius. Evans (1952) treated this name as a distinct species Phocides
imbreus Plétz, 1879 based on a rather poor illustration of this specimen in Draudt (1921)—it is unlikely
that Evans saw the actual specimen. Mielke & Casagrande (2002) inspected the syntype and synonymized
the name with P. polybius lilea due to general phenotypic similarity and the lack of orange coloring on the
fringe around the hindwing tornus. According to our genomic results (Fig. 23), imbreus is confidently
placed with Phocides polybius polybius, revised placement of a synonym, and is probably an aberrant
specimen of polybius, not lilea, lacking any orange coloration on its wings, not just on the fringe, but also
a forewing orange bar. However, the head of the syntype retains the usual orange patterns including
orange palpi and cheeks. Our revised synonymy is further supported by the label data on the specimen
stating "Am. m.", which probably stands for America meridionalis (South America), where P. /ilea is not
known to occur.
2a
Cecropterus nevada (Scudder, 1872) and Cecropterus dobra (Evans, 1952)
are Species distinct from Cecropterus mexicana (Herrich-Schaffer, 1869)
Genomic analysis of Cecropterus mexicana (Herrich-Schaffer, 1869) (type locality Mexico) reveals a
pronounced divergence between its subspecies (Fig. 24) that was analyzed further. The genomic tree
shows separation between some . eee ee Se ee eee cee re ea
ecropterus mexicana blanca ‘CA,Mono Co. White Mountains|2
of them comparable to that from Cecropterus mexicana blanca|P401152|US4:C4 Mono Co!White one ne gate
: ols — Cecropterus mexicana nevada|l14114409 Sit eee ae Co,,sherman Pass areal2003
Cecropterus diversus (E. Bell, “<— Cecropterus mexicana nevada/14114410 ee ee Co,,sherman Pass areal2003
: ores mexicana BORE thes hl a SC eee aa aaa Pale a Sate
. ecropterus mexicana dobra 2 tNM,Qtero Co,,Lincaln National Forest|2
1927) (type locality USA: 7 Pee peters mexicana mexicana Sasi Logs aro 1 STM Meccole ca B
: : . Cecropterus mexicana mexicanal14114601|M|Mexico:Qaxaca,San Jose Pacifico|1986
California, Plumas Co.). While ser Cecropterus mexicana mexicana|14114412|Mexico:Hidalgo,Cuesta Coloradal1981
; ; : SoRrenty re me: pee ea ae Fe Gage voslaca
ecropterus diversus ‘CA, Madera Ca,[2
Fe ee ee ane ee CESSES AHL eo demo UEP WattHS eo. Sh Lea Panacealt980
: : ecropterus bathyllus -FL,Wakulla Co. mi No of Panacea
(Skinner, 1893) (type locality
Fig. 24. Cecropterus nevada (red), dobra (magenta) and mexicana (blue).
USA: Oregon, Klamath Co.,
male syntype sequenced), C. mexicana blanca (J. Scott, 1981) (type locality USA: California, Mono Co.)
and C. mexicana nevada (Scudder, 1872) (type locality USA: California, Sierra Nevada) group closely
together (all three unified under the name nevada below), C. mexicana dobra (Evans, 1952) (type locality
USA: Arizona, Graham Co.) forms a clade distinct from them and C. mexicana. The Fst/Gmin statistics
for these clades are: mexicana vs. dobra: 0.34/0.021, mexicana vs. nevada: 0.37/0.010, nevada vs. dobra:
0.30/0.055. We see that nevada and dobra exchange genes more frequently with each other than do each
of them with mexicana. Differences between COI barcodes in pairs of these species are: mexicana and
dobra: 1.8% (12 bp), mexicana and nevada: 1.1% (7 bp), nevada and dobra: 1.7% (11 bp). For
comparison, the COI barcodes of aemilea, blanca and nevada are 100% identical. Curiously, in contrast
to nuclear genomes (Fig. 24), mitochondrial genomes (as reflected by barcodes) place mexicana closer to
nevada, and dobra farther away from them, which is yet another example of the peculiarity of
mitochondrial evolution. Deriving further support from genitalic and wing pattern differences mentioned
by Evans (1952), we suggest that Cecropterus nevada (Scudder, 1872), reinstated status, and
Cecropterus dobra (Evans, 1952), new status, are species-level taxa, not subspecies of Cecropterus
mexicana (Herrich-Schaffer, 1869). Then, we treat Cecropterus nevada aemilea (Skinner, 1893) and
Cecropterus nevada blanca (J. Scott, 1981), new combinations, as subspecies of C. nevada.
Telegonus anausis Godman & Salvin, 1896, is a species
distinct from Telegonus anaphus (Cramer, 1777), and
Telegonus anausis annetta (Evans, 1952) is its subspecies
A polytypic species Telegonus anaphus (Cramer, 1777) (type locality Suriname), in addition to nominal,
includes four subspecies (Evans 1952), all of which we sequenced and analyzed. Among them, there is a
single representative of the USA
Telegonus anaphus Eee ectinnd MUSA: TX, Starr Co.,Ft. Ringgold|2014
1
. — Telegonus anaphus annetta|14111HO8|Mexico: Tamaulipas
BOLD Ba SGP SAARI SS aniaia Ey sleds anabrus anaaliso/s0a0Ironaur asl ooo
: Ta elegonus anaphus annetta 2 2| Costa Rica: a - -2
Evans, 1952 (type locality Costa b Telegonus anaphus annetta|17106C09|Costa Rica:ACG/2010|10-SRNP-67024
. 7 ; Telegonus anaphus annetta/19075012|Colombia|1992
Rica). The genomic tree of these : Telegonus anaphus annetta]14113F08|Mexico:Guerrera|1985
Sanus aaa Se ea alee aoa eeeunaiigee
‘ Le elegonus anaphus anoma|MIV -52 rinidad,Point Gourde
taxa reveals a split between the aad se, Telegonus anaphus anausis|19075F06|Puerto Rico|1934
: : — Telegonus anaphus anausis|19075F04|Cuba,Santiagolold
nominotypical T. anaphus and all 2780.- Telegonus anaphus anausis|10688|F|Jamaica,Mandeville|2018
h Fj 25 bl d | d AS ABese FN chien MHOSEHOICeIdoreeee ces 1921
= Telegonus anaphus aniza]18028HO1|Ecuador|1988
others ( 1g. ue vs. re Cla e). = eee Ls ere aE teed ; Pe
1 Da Telegonus anaphus anaphus|19075E11/Brazil:Paraiba|1956
The oldest name 1n the second (red) War Telegonus anaphus etait 86603/HT|BR:Bahial1912|MNHP
. ; * Telegonus anaphus anaphus|19075E10|Brazil:Rondonia/1993
clade is Telegonus anausis Godman Talegonus anaphus anaphus|19087A01|French Guiana,Cayennelold
Telegonus jaira|10323|M|Jamaica|2017
Fig. 25. Telegonus anausis subspecies (red branches) and anaphus (blue).
& Salvin, 1896 (type locality St.
Vincent, Grenada, Dominica, His-
paniola). The Fst/Gmin statistics computed on some of these subspecies are: anaphus vs. annetta
0.40/0.01 and anaphus vs. anausis 0.45/0.009, indicating species-level differentiation. The COI barcodes
28
are 4.3% (28 bp) different between anaphus and annetta, which is larger than a typical difference between
closely related species. Comparing subspecies within the second cluster (Fig. 25 red clade), we were not
able to gather evidence for their change of status to species. For instance, Fst/Gmin of anausis vs. annetta
is 0.16/0.11, which by itself does not justify Central American annetta as a species distinct from the
Caribbean anausis. Therefore, we reinstate Telegonus anausis Godman & Salvin, 1896 as a species and
transfer all (except the nominotypical) subspecies currently placed in 7. anaphus to T. anausis to form the
following new combinations: 7elegonus anausis annetta (Evans, 1952), Telegonus anausis anoma
(Evans, 1952), and Telegonus anausis aniza (Evans, 1952). A curious accident here is that as a result of
genomic work, the name originally proposed (Godman and Salvin 1896) as Telegonus anausis is now
returned to its original combination and status nearly 125 years later.
Epargyreus huachuca Dixon, 1955 is a species
distinct from Epargyreus clarus (Cramer, 1775)
We obtained whole genome shotgun sequences of specimens from all known distinct groups of US
populations currently assigned to Epargyreus clarus (Cramer, 1775) (type locality "Suriname", later
corrected to USA: Virginia, Eparayreus clarus calitornicus|18037E12|USA:CA,Riverside Co,
A 0 ee LePuS aoe Seer eae O4|USA;CA Tulare CO. a. ‘CA,Eldorado C
pargyreus clarus californicus orado Co
Rockingham Co.). A tree made = Epargyreus clarus californicus|1511 Sabai CA,Tulare Co,
‘ ‘ : Epargyreus clarus|19125401|Canada:Ontario
from protein-coding regions of ore Eparayreus clarus clarus|4283|USA:IN Montgomery Co,
O44 pargyreus Game eae seine AYTX,D
: pH Epargyreus clarus clarus|3526[USA:TX, es Santo En,
the Z chromosome (Fig. 26) D3 eT ua Epargyreus clarus clarus|6155/USA: ay ce eae Co,
l 5 F 5 Epargyreus oe 5 igtzanizlusa.in e
= Epargyreus clarus|19124H12|USA MT, tee an ‘Co.
reveals a prominent sp it into ae Epargyreus Carus 19039HO2|(USA:MT, ‘Lincoln Co,
. as Epargyreus clarus|19039HO3/USA:CO, Gunnison ne
two clades (blue and red) with = Epargyreus clarus|19039HO4|USA:CO|Boulde
i E oSrae sts Cte sailed ; ca 130956 07(HTIUSA: Az, Cochise Go,
aoe pargyreus clarus huachuea Z,Cachise Cc
divergence comparable to that — Epargyreus clarus ae ee aa ERA Goren Sonora
2 oF Epargyreus clarus pata ual Tes B/USA:NM,Grant Co
between Epargyreus orizaba Epargyreus clarus profugus| TS038A1 1 [ATUSA: NV,Clark Co.
Epargyreus clarus Se etek AZ Cee Co.
— | f 15116HO8|USA:AZ,M c
Scudder, 1872 and Epargyreus a Epergyreus aaa ee 151461 ‘OIL USALAZ ae Co,
cruza Evans, 1952, shown as Se searsus pa wong | uses Oeanion co
outgroups. The holotypes of Epargyreus cruza|16107G12|Costa Rica: ACG|09-SRNP-73319
both E. clarus huachuca Dixon,
1955 (type locality USA: Arizona, Cochise Co.) and E. clarus profugus Austin, 1998 (type locality USA:
Nevada, Clark Co.) have been sequenced, along with a possible type specimen of E. clarus californicus
MacNeill, 1975 (type locality USA: California, El Dorado Co.). The Fst and Gmin between E. clarus
clarus and E. clarus huachuca are, 0.35 and 0.03 respectively, compared to those of 0.04 and 0.16
between FE. clarus huachuca and E. clarus profugus. The difference in COI barcodes of E. clarus clarus
and E. clarus huachuca is about 2% (~13 bp difference). For these reasons, we suggest that Epargyreus
huachuca Dixon, 1955 is a distinct species, new status, and it includes Epargyreus huachuca profugus
Austin, 1998, new combination, as a subspecies. We found that genetic differentiation between
populations of E. clarus californicus is lower than between others (Fig. 26, a tight cluster of specimens
with shorter terminal branches) suggesting either a recent dispersal or a bottleneck. Whether this genetic
purge resulted in any degree of reproductive isolation of E. clarus californicus from other groups of E.
clarus populations remains to be investigated.
Fig. 26. Epargyreus clarus (blue) and huachuca (red) with outgroups.
Nisoniades bromias (Godman & Salvin, 1894) is a species
distinct from Nisoniades rubescens (Méschler, 1877)
Considered a Junior subjective synonym of Nisoniades rubescens|17116A07|M|Mexico:Tamaulipas|1974
Nisoniades rubescens (Méschler, 1877) (type Co Ere eet pj calomna/1972
0.98
‘ - hag A N d b 4968(M|F he Id
locality Suriname), Pellicia bromias Godman & Nisoniades ephora} 18089603 panama(iged
= Nisoniades mimas|18059612/Peru/1982
Salvin, 1894 (type locality Mexico, Guatemala,
Costa Rica, Panama) reveals 1.2% (8 bp)
Fig. 27. Nisoniades bromias (red) and N. rubescens (blue).
29
difference in COI barcode, which by itself is not large enough to draw definitive conclusions, but it
prompted further investigation. The Fst/Gmin statistics computed on two pairs of specimens from distant
localities (Fig. 27) were 0.27/0.05, suggesting that Nisoniades bromias (Godman & Salvin, 1894),
reinstated status, is a distinct species.
Pholisora crestar J. Scott & Davenport, 2017 is a species
distinct from Pholisora catullus (Fabricius, 1793)
Recently described as a subspecies on the basis of wing pattern differences (Scott et al. 2017), Pholisora
catullus crestar J. Scott & Davenport, 2017 (type locality USA: California, Tulare Co.) was synonymized
with Pholisora catullus (Fabricius, 1793) + Pholisora catullus crestar | 1908302 ipsa CA,Tulare Co, ee a
l li "Indiis". likel a ee le eatullus catuls ee a CaSO Co.120i0| | 2006|/CSUC
(type locality "Indiis", likely eastern US) ee Baa lgcratcanuiiuistca: us| 10424 uADS Mewes Hideiceltobe
by Pelham (2020). As a part of on-going sae Brolasea els cata taie suas Menten psy fp 12042
i ? i hoalisora catullus eatiileeite 7O02(USA:TX,Jeft ae Co,]/2016
olisora mejicanus Olfax La, TREO
genomic sequencing inventory of the apc! Atel Gse NbE cote o eae?
Fig. 28. Pholisora crestar (red) and P. es (blue).
primary type specimens of Hesperiidae,
we obtained and analyzed whole genome shotgun reads of the holotype and two paratypes of crestar.
Surprisingly, their comparison with P. catullus populations from several distant localities revealed
prominent genetic differentiation (Fig. 28). Moreover, one of the crestar paratypes (from CA: Mono Co.,
NVG-17066H12, Fig. 28) apparently is P. catullus, not crestar. Fst/Gmin statistics for the crestar/catullus
comparison are 0.34/0.014, suggesting distinctness of crestar as a species. Gene exchange between
catullus and crestar (0.014) is very low (for conspecific populations it is typically above 0.1), strongly
supporting reproductive isolation between these taxa. Peculiarities of COI barcode evolution in Pholisora
have been reported previously by Pfeiler (2018) and COI barcodes of the crestar holotype and the catullus
specimen from Texas (NVG-3990) differ by 1.7% (11 bp). Due to strong genetic differentiation, we
suggest that Pholisora crestar J. Scott & Davenport, 2017, new status, is a species-level taxon.
Carterocephalus mandan (W. H. Edwards, 1863) and
Carterocephalus skada (W. H. Edwards, 1870) are species-level taxa and
not subspecies of Carterocephalus palaemon (Pallas, 1771)
Proposed as a species, Hesperia mandan W. H. Edwards, 1863 (type locality Canada: Manitoba) has
mostly been considered a subspecies of Carterocephalus palaemon (Pallas, 1771) (type locality Russia:
Samara Oblast) (Pelham 2008). Although it has been recently reinstated as a species (Pohl et al. 2010),
this suggestion was not universally followed (Pelham 2020). Genomic comparison of the Old and New
World palaemon-like populations reveals three clusters in the tree (Fig. 29): two corresponding to the
abovementioned taxa (red and blue), and the third one (green) for Carterocephalus palaemon skada (W.
H. Edwards, 1870) (type locality USA: AK, Kodiak) together with Carterocephalus palaemon magnus
Mattoon & Tilden, 1998 (type locality USA: California, Sonoma Co.). The largest separation is observed
between the Old World C.
Carterocephalus palaemon Me en ee aed Bp eerie Manitoba
- Carterocephalus palaemon mandan|16106E03|US4:MN,Lake of the Woods Co,
palaemon and the New Carterocephalus palaemon mandan|16106E02|USA:MN,Lake of the Woods Co
1 : Cart mee eae ee creed Ms. seatea Beak Fatbanks Nort Ne ton ¢
W arterocephalus palaemon skada oc 5 segrega 8 eton Co.
orld taxa. The Fst/Gmin : Carterocephalus palaemon eee CUS PAOBSIUSA CA,5 eal
ne 7 ; Carterocephalus palaemon magnus|PAO427 Usa ICA, Mendeene Co.
Statistics for the comparison ; Carterocephalus palaemon magnus|17109A05|HT|USA:CA,Sonoma Co.
: . pee ee ale PalaaieD nariis|17067C02|USA;CA,Sé Sonoma ( a Co,
: arterocephalus palaemon magnus
of pairs of these 3 clusters Careeiceenalun palaemon palaemon (=ab, peat soe
ll h l b L_ ey paseo palaemon| 17087808 Germany:Bay
a aoe alus palaemon palaemon
(we Ca t c green C uster iy: Carterocephal alaemo ee vente Rare a| Ruealet Orenburg Prov.
: , P Carterocaphalus silvicola(180 38G04| naga ee jatia
its oldest name: skada) are: Carterocephalus silvicolal 18092F07 |
Caitarnen ah aie Ueda eR eae ewaden
palaemon vs. mandan 0.50/
0.016, palaemon vs. skada
0.56/0.005, and mandan vs. skada 0.36/0.025. All of these numbers indicate strong genetic differentiation
and very low gene exchange between clusters. Analysis of COI barcodes reveals an unusual situation.
30
Fig. 29. Carterocephalus mandan (red), skada (green) and palaemon (blue).
First, barcode difference of palaemon vs. mandan is the same as palaemon vs. skada: 1.5% (10 bp).
Second, mandan barcodes are not much different from skada (0.3%, 2 bp), which can be explained by
introgression, but the mandan neotype and magnus holotype exhibit larger difference of 0.76% (5 bp)
between them. Third, for comparison, two widely sympatric Old World species C. palaemon and
Carterocephalus silvicola (Meigen, 1829) exhibit Fst/Gmin of 0.72/0.0006 (indicating very strong
isolation), but barcode difference between them is only 0.6% (4 bp). A number of similar instances of
distinct butterfly species not strongly different in their barcodes have been documented (Burns et al. 2008;
Cong et al. 2017), thus barcode differences and similarities cannot be considered separately from all other
evidence. In summary, we suggest to reinstate Carterocephalus mandan (W. H. Edwards, 1863) and
Carterocephalus skada (W. H. Edwards, 1870) as species, and additionally propose the following revised
combinations: Carterocephalus mandan mesapano (Scudder, 1868) and Carterocephalus skada magnus
Mattoon & Tilden, 1998.
Amblyscirtes arizonae H. Freeman, 1993 is a species
distinct from Amblyscirtes elissa Godman, 1900
Described as a subspecies of Amblyscirtes elissa Godman, 1900 (type locality Mexico: Guerrero), A. e.
arizonae H. Freeman, 1993 (type locality USA: Arizona, Santa Cruz Co.) has not caused much attention
being invariably kept as a subspecies —_ Amblyscirtes elissa arizonae|15096405|HT|M|USA:47 Santa Cruz Co
7 442 Amblyscirtes elissa arizonae|19064B12|M|USA:A42, Santa Cruz Co. [1986
(Pelham 2008). We sequenced primary *“amblyscirtes elissa arizonae|9685|F|USA:AZ,Santa Cruz Co. |2017
aa Steet or tan IL ‘Sonoral198s
1 ; Amblyscirtes elissa elissa|18083E05|ST|M|Mexico:Guerrero
type specimens of both A. €. arizonde - ay case elissa Sofa ecanace wince :Chiapas|1989
i . lyscirtes elissa elissa|19042G02|M|Mexico:Guerrero|1951
and A, elissa and compared them with = Amblyscirtes elissa elissa]19042603|M|Mexico:Morelos|1942
i ee mag Tale Ses Saeed Mexico:Tamaulipas, ae wrsvile|20
mblyscirtes celia/4501|/M|USA:TX,Cameron Co,E of Brownsville|2015
specimens from other localities. The amply sartes call S096Hos| St Ih|USArTX;Comal Co. CNINH
. . = “amblyscirtes célia|1671|/USA:TX,Travis Co, Platt Lane|2011
genomic tree revealed two prominent Amblyscirtes belli|i8025E02|HTIMIUSA‘TX,Dallas Co
. : : : es ae ‘TX, Dallas Co, ;Dallas|2015 Kl
Amblyscirtes belli[1240|/USA:TX Brazos Co,,Lick Creek Park]2013
clusters with separation similar to that = Sree tes eing|1os72iniUsa vache’ Rael Co,
2 : Amblyscirtes carolina|10672|M|USA:VvA,Chesapeake|1970
between A. belli H. Freeman, 1941 and AMnIgeTtaG carolina 18012C05|M|USA:NC,R aehmand Co.|1984
. — See sce s reversal aan aes (er VA, ;Nansemond a
; = Amblysecirtes reversa|18012C03|F(USA:NC Brunswick Co.[1995
A. celia Skinner, 1895, and between A. 04 “Amblyscirtes reversal 18012C06|M|USA:NC,Cumberland Co.{1984
AnibWEEirhae reversal 10673/M|USA:VA, Virginia Beach| 1971
carolina (Skinner, 1892) and A. reversa Fig. 30. Amblyscirtes arizonae (red), A. elissa (blue) and others.
F. Jones, 1926 (Fig. 30). The Fst/Gmin
statistics for them were 0.60/0.002, implying strong genetic differentiation and virtually no gene exchange
between these taxa. The COI barcodes of A. elissa and A. e. arizonae primary type specimens differ by
2.6% (17 bp). For these reasons, we suggest that Amblyscirtes arizonae H. Freeman, 1993 is a distinct
Species, new status.
Megathymus violae D. Stallings & Turner, 1956 is a species
distinct from Megathymus ursus Poling, 1902
Initially proposed as a species, Megathymus violae D. Stallings & Turner, 1956 (type locality USA: New
Mexico, Eddy Co.) was placed as a
dyggatyms ursus Baus ee hl ee AZ, Pima oak Rincon Mtns.
subspecies of Megathymus ursus
a os ursus ursus|2
athymus ursus ursus ve
siflega ymnus ursus usual ee
i Sado we ta ee core
Arizona, Pinal Co.) by dos Passos Ceapegethymus arsu scart sageeos MU MRAeN ARES GROSS,
(1960). Genomic comparison of a a Oe ga ec See
rae : Qdegathymus Ursus vislael 178) gan A NM Fon ae Co,
specimens of both taxa across their ee eccrine erie iaele USEC El Paso-Co..Franklin Mountains SP
uegathy mus ursus vio 2 i7fosoori TF A Guipersen Co [1955
ranges, including the holotypes, saga aehy mos unas asl sue ek of ca
revealed their prominent separation ae eitedathymus. ar sls Vilas) 2{d Hole sterco o fig Ben 15)8 National Bee
in the tree with the distance close to ofa dathymus Beulshse beulatlog Rest i guitare saalaoas 37
Apache Co.,SE of Holbrook
a Veaet ymus streckert streck ery
Meqathymus cofagqui cofaquili1 SEIE I is Gk. Burke Co. NW of Girar
that between Megathymus yuccae
(Boisduval & Le Conte, [1837]) and
Fig. 31. Megathymus ursus (blue) and violae (red), compared to others.
31
Megathymus beulahae D. Stallings & J. Turner, 1958 (Fig. 31). The Fst/Gmin statistics for comparison of
ursus and violae groups are 0.56/0.001 (note close to 0 gene exchange between these taxa). The COI
barcodes of the WM. ursus and M. violae holotypes differ by 1.8% (12 bp). For these reasons, we reinstate
Megathymus violae D. Stallings & Turner, 1956 as a species-level taxon.
Discussion: genomic trees, branch lengths and genera
Near the end, coming back to the Introduction, we elaborate on and illustrate the reasons behind the
classification decisions that we have chosen to make about genera. Traditionally, species were grouped
into genera by phenotypic characters. For butterflies, these were mostly wing patterns and shapes, and
genitalic morphology. When differences in these phenotypic aspects were deemed to be significant
enough according to a subjective opinion of an individual researcher, they formed a basis for defining a
genus. This system served its purpose until a consensus opinion was formed among taxonomists that each
genus should be monophyletic. It is exceedingly difficult to predict monophyletic taxa from their
phenotypes, and DNA-based phylogenetic trees provide the most reliable inference of monophyletic
groups. Therefore, genera should be defined using phylogenetic trees constructed from DNA sequences.
Each individual feature of an organism can experience rapid evolution and fool researchers into
making incorrect classification decisions. Genitalia that are commonly used in Lepidoptera classification
are prone to such rapid changes as well. For instance, Steinhauser (1989) proposed a genus Thessia on the
basis of unique shape of genitalic valvae. However, even a very short, 654 base pair region of DNA, such
as the COI barcode, reveals the paraphyly of Achalarus Scudder, 1872 (as it was circumscribed at that
time) with respect to Thessia (Pfeiler et al. 2016), suggesting that the unique valva is a result of
accelerated evolution within Achalarus rather than a character originated after Thessia and Achalarus
have (supposedly) diverged from each other. Therefore, a decision to erect the genus Thessia was a
mistake, because Thessia is a subclade within (as it was then defined) Achalarus. Nevertheless, the
barcode DNA region itself is a single feature, and as any other such feature, can experience evolutionary
irregularities. To reduce such mistakes, it is better to use information from as many features as feasible.
Complete genomes offer the ultimate DNA dataset for classification decisions. Genomic analysis suggests
that Achalarus itself is a junior subjective synonym of the subgenus Thorybes Scudder, 1872, and Thessia
is actually a junior subjective synonym of the subgenus Murgaria E. Watson, 1893 (Li et al. 2019).
Genomic trees summarize integral information about the entire organism, not just some of its
features. For this reason, we use them to make decisions about classification of genera. Here, we explain
how we atrive to these decisions using examples from this work and our previous publication (Zhang et
al. 2019c). A maximum likelihood tree constructed using IQ- TREE program (model GTR+I+G) (Minh et
al. 2020) from concatenated protein-coding regions of nuclear genomes is shown in Fig. 32. To best
follow our logic, a reader may close the tree on the right (Fig. 32b, the final result) and look only at the
tree on the left (Fig. 32a), which is the same as the tree on the right, but without the final results being
marked in order not to bias the reader. This tree was constructed without assuming a molecular clock and
reveals differences in evolutionary rates between species: 1.e., species names are placed at difference
distance from the left side of the page (=from the root of the tree). We see that Emesis evolved the fastest
(the farthest from the left), and Ephyriades Hubner, [1819] evolved the slowest (closest to the left). In a
tree, only horizontal (left-to-right) distances matter. Vertical (top to bottom) distances are arbitrary and
are set to place species names evenly along vertical dimension, so that the names do not overlap and are
not too far away from each other to save space.
Tree branches have different lengths. Again, only horizontal branches have evolutionary meaning,
and vertical lines in the tree are set to avoid overlap of names and to connect branches to nodes. The
length of a horizontal branch is proportional to the number of estimated changes in DNA (=fixed
mutations) that happened along the branch. The tree has a scale bar near the bottom (Fig. 32). The length
of that bar, as indicated, corresponds to 6 changes per 100 base pairs (=0.06, or 6%). Using this bar, we
can measure evolutionary distances between taxa in DNA changes. Long branches correspond to many
32
Ephyriades doraiieens ls teO 2407 Ephyriades dominic neers
7 Ephyriades arcas|17095D09 z Ephyriades arcas|17095D09
Ephyriades brunnea]17095E06 Ephyriades brunnical 12033506
Erynnis pelias|18068D08 Erynnis pelias|18068D08
,Erynnis marloyi]17107A11 Erynnis marloyi]17107A11
ge4 Erynnis pathan|18068D01 gaa Erynnis pathan|18068D01
264 Erynnis montanus]18068C09 E |\-°Serynnis montanus|18068C09 :
1$FErynnis tages|18022H04 i>‘Erynnis tages|18022H04 Erynnis
i Erynnis popoviana|18038G02 i Erynnis popoviana|18038G02
Erynnis eclusielos Erynnis eelusibiad
q*_ Erynnis lacustra|18035A07 Q Erynnis lacustra eae ao?
tegynnis brizo|6120 obfynnis brizo]6120
rynnis somnus|8286 rynnis somnus|8286
—oea Erynnis martialis] 3900 oe4 Erynnis martialis|3900
—" Erynnis pacuvius[9770 = Erynnis pacuvius]9770
f Epynnis scudderi|9725 7 Egynnis scudderi[9/725
yErynnis Tune rally [te0e ;Erynnis funeralis|4208
1 Erynnis zarucco|4753 i Erynnis ZarUCeg Eos
Erynnis persius|6567 Erynnis persius|6567
LErynnis giranius| £71 12A03 1 Erynnis atrantie Tr ta0s
oe Sek Onis lucilius|18014B07 oe Uekynnis lucilius|18014B07
; rynnis baptisiae|3907 rynnis baptisiae|3907
1 Erynnis horatius|3678 , Erynnis herstiis)ie7 6
1 Erynnis tristis]9715 ; Erynnis tristis]9715
Erynnis meridianus|18022E03 1 Erynnis meri janie] 1BOF2E03 Gesta
Erynnis propertius|PAQ21 G Erynnis propertiusi| A021
1 Bryndis Wuvenells4 610/7D08 , Erynnis juvenalis|16107D08
— Erynnis Sec e Erynnis Shean eo
, Gesta austerus|13386B06 , Gesta austerus|13386B06
r -Gesta austerus|13386B07 , -Gesta austerus|13386B07
t~, Gesta heteropterus|13386B04 , Gesta heteropterus|13386B04
1 Gesta heteropterus|13386B05 ,'— Gesta heteropterus|13386B05
Gesta invisus|19015G09 Gesta Invisus|19015G09
Gesta invisus|}6818 , Gesta invisus|6818
yGesta gesta/10417 iGesta gesta/10417
Gesta gesta|19015H06 | Gesta gesta|19015H06__
Hypaurotis crysalus ame ee H Hypaurotis crysalus
F 17117A05 | =
Lo sfavonius querctis| 200 “ofavgnius quercls 20639A04 Hypaurotis
1 abrodais grunus|PAO466 1 rodais grunus|PAO
Minis man Be TOROS M —— Minis prion "anevicroy) | Mi - t
inistrymon janevicro inistrymon janevicro rym
o8 Ministrymon sereslsou os Ministrymon serss(o2t ints on
Pseudonymphidia clearista|19031A07 P —— Pseudonymphidia clearista
1 oa Roeberella fe peas | Tor Ato 1 [es Bechythone welezauer 9HOS Pach thone
ac one velazquezi velazquezi
if Pachythone strati| 79031 09 ah Pachythone Saab S4 hoo y
Pachythone erebia]19129C01 —— Pachythone erebia]19129C01
O78 Emesis lucinda]|18044B02 E Emesis lucinda|18044B02
1 * Emesis poeas|18044G02 1 Emesis poeas|18044G02
Emesis mandanal eg tb09 —— Emesis mandana eo Ebo9 E z
A Emesis brimo|18045E01 Emesis brimo|18045E01 mesis
0-46 Emesis tenedia|18044H06 Emesis tenedia|18044H06
pa. Emesis fatimella|18044G08 1 Emesis fatimella] 18044G08
1 Emesis cereus|18045C06 1 Emesis cereus|18045C06
Curvie emesia|5245 >———. Currvie emesia|5245
Apodemia ares|17114HO1 Apodemia ares|17114HO1
o.ze\podemia arnacis|18045F11 ae podem arnacis|18045F11
ak podemia zela cleis|8217 podemia zela cleis]8217
I Apodemia nais|17066F02 Apodemia nais|17066F02
ns Apodemia nais|PAO145 Apodemia nais[|PAQ145 5
T Apodemia mormo|17107E02 Apodemia mormo|17107E02 Apodemia
L Apodemia multiplaga| 7635 Apodemia multiplaga| 7635
Apodemia hypoglauca|18048C11 A Apodemia hypoglauéa|
i oeberella calvus|18054E06 i, . Roeberella calvus] 18054E06
p.Apodemia hepburni|17066E05 —, Apodemia hepburni|
; ““Apodemia walkeri| a4 “~"Apodemia walkeri|4514
- Apodemia Balinerit| 0226 1
rT Smyrna blomfildia|17117HO9
Smyrna _karwinskil|17118B06
Aglais io| PAOE20
,Aglais milberti|9460
Aglais cca AOE19
olygonia interposita|19122B06
tRglygonia faunus|PAO270
Pol gonia c-album|PAOE
- Apodemia palmenliTo226
Smyrna blomfildia]17117HO9
Sunyrna kane | 7.18B06
Aglais io] PAOE20
,Aglais milberti[9460
Agials orcas | AOEL9
‘olygonia interposita|19122B06
oRglygonia faunus|PAQ270
rol gonia c-album|PAOE08
AOE08
7s E Polygonia interrogationis|6030 olygonia interrogationis|6030
1Polygonia comma|1711/D09 ; Polygonia comma|17117D09 .
Polygonia satyrus|PAO42 Folygania satyrus|PAO42 N m halis
Polygonia haroldii|17115B06 _ Polygonia hatoldil| 17115B06 ymp
1Polygonia gracilis] PAQ246 i ygoma gracilis| PAQ246
;Polygonia progne|17115B04 ,Po! ygouie progne|17115B04
olygonia oreas|17115B05 olygonia operas ity TteO?
1 Nymphalis |-album|17115B03 Nymphalis l-album|17115B03
Nymphalis pol Cho nOe Wate as Nymphalis polychloros|19093E04
1 Nymphalis cali ornlea| 635 1 Nymphalis cali Bence 635
ymphalis cyanomelas|15101E03 rt yenpnalis cyvanome as|15101E03
Nymip alis antio aleese Nye alis antiopa| 8980
, Vanessa caryelt 121H08 , Vanessa carye]19121H08
Vanessa annabella|9614 1 Vanessa annabelialacis
i , Vanessa itea|19122A11 ——_f 1 Vanessa itea|19122A11
Vanessa gonerilla]19122A12 Vanessa gonerilla[i9122A12
ata Vanessa kershawi[19121H09 V Vanessa kershawi[i9121H09 Vanessa
0. Vanessa cardui|8641 o-—— Vanessa cardui|8641
; Vanessa terpsichore]19121H06 ; Manessa terpsichore]19121H06
1 Vanessa virginiensis|3866 1 Vanessa virginiensis|3866
Vanessa tameamea|17115B02 7,, Vanessa tameamea|17115B02
Vanessa atalanta|9826_ Vanessa atalanta|9826_
i Euptoieta hegesia|3374 uptoieta egesia 13374
Euptoieta claudia|3706 Euptoieta claudia|3706
Boloria eunomia|17114HO7 Boloria eunomia|17114HO7
7 Boloria Se en oar a Boloria alaskensis|17115A07
* Boloria astarte|17115A01 Boloria astarte|17115A01
pies ,Boloria polaris|17114H11 ,Boloria polaris|17114H11
: Boloria alberta|17119E11 Boloria alberta/17119E11
Boloria selene|17114HO08 Boloria selene|17114H08 a
_ Boloria chariclea|6356 Boloria chariclea|6356 Boloria
P- , Boloria natazhati|17115A02 , Boloria natazhati]17115A02
076 Boloria freija|18037HOL Boloria freija|18037HO1
1 ‘- Boloria frigga|17114HO9 r- Boloria frigga |1 74140109
,Boloria kriem ee ;Boloria kriemhild|9479
; Boloria epithore|PAO77 ; Boloria epithore|PAO77
oria improba/i7115A09 Boloria improba/17115A09
oloria peroneal ene oloria palahe uae
Argynnis eocioelt 1077C04 Argynnis japdlcat 077C04
——— 7 .Argynnis sagana]19077C06 7. Argynnis sagana 9077C06
0.06 7 Argynnis paphia|PAOQE21 0.06 Argynnis pap Pepe!
Argynnis niobe|PAOE16 A Argynnis niobe|PAOE16
Speyeria idalia|17115A04 Speyeria idalia|17115A04
1
1 Speyeria nokomis|18062B01
ogpeyeria diana|9190
1
8: eyeria aphrodite|PAOQ220
ogpeyeria nese 1628
Speyeria atlantis| 19065C03
oapeyerla mormonia|9380
1
1 Speyeria nokomis|18062B01
oSpeyeria diana|9190
oppeyeria cybele|9191
eyeria ppnre He eee
eyeria hesperis .
# everia atlantis| {9065C03 Argynnis
ogpeyerla mormonie I 0
peyeria edwardsii|PAO218
a
eyeria edwardsii|PAO218
@ peveria Seer aloe eyeria zerene|9626
‘Speyeria carolac [18028402 “‘Speyeria carolae baeerene
eyeria coronis|PAQ143 eyeria coronis|PAQ143
eyeria a aeeliaeess ee oppeyeria adiaste| ee
oapeyeria hycaspe [943
eyeria callippe
Beveria Sere soe
peye
eyeria hydaspe |943
a ss cafione (pate b
Pp
eyeria egleis|9532
Fig. 32. Delineating genera using a tree constructed from nuclear genomes: unmarked (a) and colored by suggested genera (b).
changes in genomic DNA. Short branches correspond to few changes in genomic DNA. Because larger
number of DNA changes are expected to result in larger number of phenotypic changes, longer branches
correspond to more phenotypic changes on average. These are integral changes and some of them may be
in genitalia, others may be in caterpillar morphology. Regardless of where these changes are, longer
branches are more important than shorter branches. In addition to larger number of changes, longer
branches are also more reliable and support clades that are more likely to be correct. The statistical
reliability of every clade is indicated by a number next to each node. This number is a fraction of trees
(out of 100 trees constructed from various subsets of genomic segments) that contain this node, e.g. a
genome was divided into 100 segments and each segment was used to generate a tree. If a particular node
is present in all 100 trees, the number by that node is 1. Therefore, this number measures consistency
between trees constructed from different partitions of the data. If every DNA segment supports a clade, it
33
has a number | next to it. If 94 out of 100 segments support the clade, the number is 0.94.
A genus should be a prominent, major clade in the tree that is above species level and below tribe
and subtribe levels. Phenotypic features are difficult to quantify, and due to the possibly uneven speed of
evolution, it is a challenge to determine which phenotypic changes correspond to major clades. Total
genomic changes can be used as a yardstick to quantify each clade. The number of total genomic changes
is proportional to branch lengths in genomic trees (Fig. 32a). Therefore, the task of identifying genera
may be viewed as a task of identifying prominent (i.e. supported by longer branches compared to
surrounding branches) clades in genomic trees that on average correspond to how genera are defined
currently (to avoid unnecessary taxonomic changes). Additionally, we believe that each genus should not
be very different from another genus in terms of genetic differentiation of species placed in a genus, L.e.
genera could be defined consistently, so that genera correspond to clades of approximately the same
differentiation within. Defined consistently, the genus becomes a level (as meant by this word) of a
classification instead of several varying levels, i.e., we can expect a genus to be a group of species bearing
about the same relatedness among them as that in other genera. It would seem unnatural if one
phylogenetic group is oversplit into genera, i.e. genera in that group correspond to very closely related
species, but another group is undersplit, and genera in it correspond to species that are only distantly
related. The measure of closeness as we use it, is overall genomic divergence.
Looking at the clade of Hesperiidae at the top of the tree (Fig. 32a) we see three major clades, not
two and not four. The first clade is Ephyriades and is sister to all other taxa. Then all others split into two
clades of similar genetic differentiation within each clade. We see that each of these clades resembles a
tight bush or a comb, rather than an evenly bifurcating tree, i.e. the internal branches in either clade are
much shorter than a branch that supports the entire clade. The clade with Gesta bifurcates into two
subclades, one consists of Gesta sensu stricto (s. s.). Species from the other subclade were called
"Erynnis" previously (and are called Erynnis in the tree to facilitate communication): it is a subgenus
Erynnides Burns, 1964 (type species Nisoniades propertius Scudder & Burgess, 1870). If we consider
these two subclades to be major clades, then the Hesperiidae tree would consist of four major clades
(Ephyriades, Erynnis s. s., Erynnides and Gesta). However, the branches supporting the two subclades
(Erynnides and Gesta) are nearly three times shorter than the branches supporting the clades Erynnis s. s.
and a clade combining Erynnides with Gesta. Therefore, the Hesperiidae subtree should not be partitioned
into four major clades, because two of these clades (Erynnides, Gesta) would be minor compared to the
other two, and more importantly, compared to the clade combining Erynnides with Gesta.
The remaining alternative to a three-clade partitioning would be a two major clade partition, where
Erynnis s. s., Erynnides and Gesta are all joined together into Erynnis sensu lato (s. |.) The branch
supporting this clade is only slightly shorter than the branch supporting Erynnis s. s., and therefore this
clade is rather prominent in the tree. We reject this solution for the two reasons. First, Erynnis s. |. is not a
homogenous group of species, which we think a genus should be, i.e. the Erynnis s. |. clade does not look
like a bush or a comb. Instead, it splits into two major clades: Erynnis s. s. and Erynnides + Gesta, (we
call this clade Gesta s. |. from now on) each of which individually looks more like a comb than when they
are combined. In other words, Erynnis s. |. itself is composed of two major clades, and does not represent
a Single group of species, but two major groups of species.
The second reason stems from consistency between different genera, i.e. an idea that different genera
should represent the same level in the classification (Fig. 33). Being a level, genera should be groups of
species with comparable divergence within each genus. In this tree (Fig. 32a), where all branches are to
scale, we can compare divergence between Erynnis s. s. and Gesta s. |. to the divergence in Nymphalidae
previously placed in genera Aglais, Polygonia, Nymphalis, and Vanessa. These two subtrees (Erynnis and
Vanessa) are illustrated in Fig. 33. Genetic differentiation of a clade is proportional to the average
distance (average sum of branch lengths) from the last common ancestor of the clade (=node that supports
the entire clade) to the leaves (=species) in the clade. In other words, it is a linear distance (in horizontal
dimension) from the base of the clade to the tips of the tree. On the one hand, we see that Polygonia
divergence is rather small, perhaps comparable to the divergence of the Erynnides subclade with horatius
and juvenalis, and definitely smaller than the divergence within either Erynnis s. s., or Gesta s. |. On the
34
other hand, the divergence of Erynnis s. 1. is larger than
the divergence of Aglais, Polygonia, Nymphalis and
Vanessa combined. Therefore, having Erynnis s. |. as a
genus is inconsistent with having Polygonia as a genus:
these two groups represent different levels in the
classification. Coming back to Nymphalidae, we see that
branches supporting Aglais, Polygonia and Nymphalis
individually are much shorter than the branches
supporting Erynnis s. s. or Gesta s. 1. Only the branch
supporting Vanessa is somewhat comparable, although
shorter. However, the branch supporting the first three
clades together (Nymphalis s. |.) is more prominent and
is about the same as the branch supporting Vanessa.
In summary, Erynnis s. |. is comparable to Vanessa
s. 1. (Nymphalis s. \. + Vanessa s. s.). A system of two
long,
prominent
branch
~E |
_ Erynnis icelus
Erynnis lacus ra
r o&kynnis brizo|61
rynnis pacuvius
Erynnis scudderi|
i{Erynnis funeralis
+ ‘Erynnis zarucco
- .Erynnis persius|
oo”
prominent
branch
mom
ynnis afranius
‘eeynnis lucilius|
ynnis baptisia
nnis horatius
rynnis tristis|9
rynnis meridian
rynnis propertiu
rynnis juvenalis
elemach
oO
ERu
IT
uA
m
ly ,Gesta gesta
shorter
branches
Gesta gesta|1
sapiuuAlg
1's smuAsg
|~5.5% bp change
__darre ta cs
| _|~4t.7% bp change
genera (Erynnis s. s. and Gesta s. |.) is comparable to two Aglais io|PAQE2O .
genera Nymphalis s. |. and Vanessa s. s. We attempt to Balygonia interposita
choose an internally consistent solution that agrees the 1 Iygonia c-album|PAOE
yy, g Polygonia interrogationis
most with how these species are assigned to genera in the
current classification. Therefore, we choose the 2-genus
solution for both of these cases, as shown in Figs. 32b
(colored clades E: Erynnis, G: Gesta, N: Nymphalis and
V: Vanessa) and 33 (shaded clades). These four genera
represent a similar level in the classification and correlate
with the current classification of these butterflies. The
choice of Erynnis s. |. would correspond to a consistent
choice of joining all four Nymphalidae genera in
Vanessa, which may represent too much of a lump and
more name changes (Fig. 33).
Another point is that genetic differentiation can be
used to estimate divergence times of these clades through
the tree rescaling and calibration with fossils (primary
calibration) (Chazot et al. 2019) or other time-calibrated trees (secondary calibration) (Zhang et al.
2019a). As we have seen in Hesperiidae (Li et al. 2019), the genus level typically corresponds to
divergence between 10 and 15 million years ago (Mya). Divergence of Erynnis s. |. was estimated to be
about 27 Mya, which is larger than the divergence between Vanessa s. s. and Nymphalis s. |., at about 22
Mya (Zhang et al. 2019d). However, divergences within Gesta s. 1. (~16 Mya), Vanessa s. s. (~16 Mya)
and Nymphalis s. |. (~14 Mya) (Zhang et al. 2019d) are very much comparable to each other, and these
genera represent groups of about the same level. It should be noted that the divergence times are only
approximate, should be considered with caution, and may have errors of possibly up to 50%, especially in
groups with large differences in evolutionary rates. However, the relative comparison of divergence times
estimated within the same tree using the same method is expected to be more accurate.
Finally, a question arises about how these considerations of trees, branch lengths, divergence and
geological times correlate with genera definition based on phenotypic characters. Because phenotypic
characters are encoded by the genotype, longer branches in the tree that correspond to more changes in a
genotype (these are integral genomic trees, not based on several gene markers) should translate to more
changes in the phenotype. We advocate a method to delineate genera from genomic trees first, and then
come back to phenotypic analysis to find the phenotypic characters that correspond to these genera. In the
case of Erynnis and Gesta, the retrospective inspection of morphological characters yields substantial
differences in male genitalia that have been noted and illustrated previously (Evans 1953; Burns 1964).
The uncus is asymmetric, terminally broad in Gesta, but is symmetric, extending into a "beak" in Erynnis.
35
syeyduiAn
=
a
©
e
UO
o
<—
cS
o
=
ah
5
S
=
Se
=
.
|
|
rr
|S essoue/,
— Vanessa cardui|8
— Manessa terpsichore
i — Vanessa virginiensis
prominent —
7,, vanessa tameamea
- Vanessa atalantal982
branches
Taxonomic levels:
(correspond to similar
divergence in DNA)
Scale bar
6% bp change
SNUuUSss£) ESSOUE/
snuad peog
Fig. 33. Taxonomic levels gleaned from trees to
correspond to similar levels of divergence between
taxa of the same taxonomic level.
The valvae are strongly asymmetric with at least one extended harpe in Gesta, but are more symmetric
with shorter harpes in Erynnis. Other differences are stated in the diagnosis of Erynnides by Burns (1964).
Comparing the clades of other groups in Fig. 32a with Erynnis/Gesta and Nymphalis/Vanessa we see
that divergence within Speyeria and Roeberella (a clade containing R. clavus and with Apodemia
hypoglauca at its base), and divergence between Hypaurotis, Favonius and Habrodais is much smaller
than that in the groups we define as genera. We also see that the colored clades (with letters denoting
corresponding genera by each clade) in Fig. 32b are more or less equivalent to each other in terms of
genetic differentiation (distance from the base of the clade to its tips) and prominence (length of the
branch supporting the clade). For these reasons, we suggest that these clades can be treated as genera:
they are prominent, consistent, and reasonably well correspond to how genera have been defined
previously. The changes we suggest combine some more compact in terms of genetic (and phenotypic)
differentiation genera into more internally diverse genera that become more consistent with the
differentiation within many classic genera such as Emesis, Ministrymon, Vanessa, and Boloria.
ACKNOWLEDGMENTS
We acknowledge Ping Chen, Leina Song, and Ming Tang for excellent technical assistance. We are
grateful to David Grimaldi and Courtney Richenbacher (AMNH: American Museum of Natural History,
New York, NY, USA), Blanca Huertas, David Lees and Geoff Martin (BMNH: Natural History Museum,
London, UK), Jonathan P. Pelham (BMUW: Burke Museum of Natural History and Culture, Seattle, WA,
USA), Vince Lee and the late Norm Penny (CAS: California Academy of Sciences, San Francisco, CA,
USA), Jim Fetzner and John Rawlins (CMNH: Carnegie Museum of Natural History, Pittsburgh, PA,
USA), Boris Kondratieff (CSUC: C. P. Gillette Museum of Arthropod Diversity, Fort Collins, CO, USA),
Chris Schmidt and Christi Jaeger (CNC: Canadian National Collection of Insects, Arachnids and
Nematodes, Ottawa, Ontario, Canada), Crystal Maier and Rebekah Baquiran (FMNH: Field Museum of
Natural History, Chicago, FL, USA), Weiping Xie (LACM: Los Angeles County Museum of Natural
History, Los Angeles, CA, USA), Andrew D. Warren and Debbie Matthews-Lott (MGCL: McGuire
Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, University of Florida,
Gainesville, FL, USA), Rodolphe Rougerie (Muséum National d'Histoire Naturelle, Paris, France),
Matthias Nuss (MTD: Museum fiir Tierkunde, Dresden, Germany), Helen Vessels (NMSU: New Mexico
State University, Las Cruces, NM), Edward G. Riley, Karen Wright, and John Oswald (TAMU: Texas
A&M University Insect Collection, College Station, TX, USA), Alex Wild (TMMC: University of Texas
Biodiversity Center, Austin, TX, USA), Jeff Smith and Lynn Kimsey (UCDC: Bohart Museum of
Entomology, University of California, Davis, CA, USA), Robert K. Robbins, John M. Burns, and Brian
Harris (USNM: National Museum of Natural History, Smithsonian Institution, Washington, DC, USA),
Wolfram Mey and Viola Richter (ZMHB: Museum fiir Naturkunde, Berlin, Germany) for granting access
to the collections under their care, help with sampling specimens and for stimulating discussions; to
David H. Ahrenholz, Austin Baldini, Ernst Brockmann, Jim P. Brock, Jack S Carter, Matthew J. W. Cock,
Bill R. Dempwolf, Mathew Garhat, Chuck Harp, Greg Kareofelas, Paul Johnson, the late Edward C.
Knudson (TLS: Texas Lepidoptera Survey, specimens now at MGCL), Jeremy J. Kuhn, Tim McNary,
Harry Pavulaan, James A. Scott, John A. Shuey, Jeff R. Slotten, and Mark Walker for specimens,
including those collected in RNAlater for better preservation, and leg samples, to Gerardo Lamas and
Olaf H. H. Mielke for discussions, to Jonathan P. Pelham and Ken Davenport for insightful discussions
and critical review of the manuscript. Evi Buckner-Opler assisted by providing emotional and logistic
support and helped to collect specimens. We are indebted to California Department of Fish and Game for
collecting permit SC13645, Texas Parks and Wildlife Department (Natural Resources Program Director
David H. Riskind) for the research permit 08-02Rev, to U. S. National Park Service for the research
permits: Big Bend (Raymond Skiles) for BIBE-2004-SCI-0011 and Yellowstone (Erik Oberg and Annie
Carlson) for YELL-2017-SCI-7076 and to the National Environment & Planning Agency of Jamaica for
the permission to collect specimens. We acknowledge the Texas Advanced Computing Center (TACC) at
36
The University of Texas at Austin for providing HPC resources. The study has been supported in part by
grants from the National Institutes of Health GM127390 and the Welch Foundation I-1505.
LITERATURE CITED
Aardema, M. L., and P. Andolfatto. 2016. Phylogenetic incongruence and the evolutionary origins of cardenolide-
resistant forms of Na(+) ,K(+) -ATPase in Danaus butterflies. Evolution 70(8): 1913-1921.
Ackery, P. R., and R. I. Vane-Wright. 1984. Milkweed butterflies: their cladistics and biology. British Museum
(Natural History); London. x+425
Aldhebiani, A. Y. 2018. Species concept and speciation. Saudi J Biol Sci 25(3): 437-440.
Allio, R., C. Scornavacca, N. Benoit, A. L. Clamens, F. A. H. Sperling, and F. L. Condamine. 2019. Whole genome
shotgun phylogenomics resolves the pattern and timing of swallowtail butterfly evolution. Systematic Biology
69(1): 38-60.
Austin, G. T., and M. J. Smith. 1998. Revision of the Thessalia theona complex (Lepidoptera: Nymphalidae:
Melitaeinae). Jn: Emmel, T. C. (Ed.). Systematics of Western North American Butterflies. Mariposa Press;
Gainesville, pp. 359-396.
Bland, K. P. 2019. Name-bearing types of butterflies (Lepidoptera, Papilionoidea), in the National Museums of
Scotland, Edinburgh. Zootaxa 4559(1): 57-89.
Burns, J. M. 1964. Evolution in skipper butterflies of the genus Erynnis. University of California Press; Berkeley and
Los Angeles. iv + 214
Burns, J. M., D. H. Janzen, M. Hajibabaei, W. Hallwachs, and P. D. Hebert. 2008. DNA barcodes and cryptic
species of skipper butterflies in the genus Perichares in Area de Conservacion Guanacaste, Costa Rica. Proc
Natl Acad Sci U S A 105(17): 6350-6355.
Burns, J. M., D. H. Janzen, M. Hajibabaei, W. Hallwachs, and P. D. N. Hebert. 2007. DNA barcodes of closely
related (but morphologically and ecologically distinct) species of skipper butterflies (Hesperiidae) can differ by
only one to three nucleotides. J. Lep. Soc. 61(3): 138-153.
Chazot, N., N. Wahlberg, A. V. L. Freitas, C. Mitter, C. Labandeira, J. C. Sohn, R. K. Sahoo, N. Seraphim, R. de
Jong, and M. Heikkila. 2019. Priors and Posteriors in Bayesian Timing of Divergence Analyses: The Age of
Butterflies Revisited. Syst Biol 68(5): 797-813.
Claridge, M. F. 2017. Insect Species — Concepts and Practice. /n: Foottit, R. G., and P. H. Adler (Eds.). Insect
Biodiversity: Science and Society. John Wiley & Sons; Chichester, UK, pp. 527-546.
Cong, Q., D. Borek, Z. Otwinowski, and N. V. Grishin. 2015. Tiger swallowtail genome reveals mechanisms for
speciation and caterpillar chemical defense. Cell Reports 10(6): 910-919.
Cong, Q., J. Shen, D. Borek, R. K. Robbins, P. A. Opler, Z. Otwinowski, and N. V. Grishin. 2017. When COI
barcodes deceive: complete genomes reveal introgression in hairstreaks. Proceedings of the Royal Society B:
Biological Sciences 284(1848): 20161735.
Cong, Q., J. Shen, J. Zhang, W. Li, L. N. Kinch, J. V. Calhoun, A. D. Warren, and N. V. Grishin. 2019a. Genomics
reveals the origins of ancient specimens. bioRxiv BIORXIV/2019/752121.
Cong, Q., J. Zhang, and N. V. Grishin. 2019b. Genomic determinants of speciation. bioRxiv BIORXIV/2019/837666.
de Jong, R., and K. van Dorp. 2006. The African copper connection. Entomologische Berichten. Amsterdam 66(4):
124-129.
De Moya, R. S., W. K. Savage, C. Tenney, X. Bao, N. Wahlberg, and R. I. Hill. 2017. Interrelationships and
diversification of Argynnis Fabricius and Speyeria Scudder butterflies. Systematic Entomology 42(4): 635-649.
Dereeper, A., V. Guignon, G. Blanc, S. Audic, S. Buffet, F. Chevenet, J. F. Dufayard, S. Guindon, V. Lefort, M.
Lescot, J. M. Claverie, and O. Gascuel. 2008. Phylogeny.fr: robust phylogenetic analysis for the non-
specialist. Nucleic Acids Res 36(Web Server issue): W465—W469.
Dictionary.com LLC. 2020. <https://www.dictionary.com/browse/sautoir>. Accessed 1 Nov. 2020.
dos Passos, C. F. 1960. Taxonomic notes on Nearctic Rhopalocera. 1. Hesperioidea. Journal of the Lepidopterists'
Society 14(1): 24-36.
Draudt, M. W. K. 1921. B. Grypocera, breitkopfige Tagfalter. /n: Seitz, A. (Ed.). Die Gross-Schmetterlinge der Erde.
Alfred Kernen; Stuttgart, p. 850, pl. 165f.
Dunford, J. C. 2009. Taxonomic overview of the greater fritillary genus Speyeria Scudder and the atlantis - hesperis
species complexes, with species accounts, type images, and relevant literature (Lepidoptera: Nymphalidae).
Insecta Mundi 0090: 1-74.
Eliot, J. N. 1973. The higher classification of the Lycaenidae (Lepidoptera): a tentative Arrangement. Bulletin of the
British Museum of Natural History (Entomology) 28(6): 373-505.
37
Emmel, T. C., and G. T. Austin. 1998. What is Argynnis carolae? The cytotaxonomy and systematic position of a
Speyeria relic from Nevada (Lepidoptera: Nymphalidae). /n: Emmel, T. C. (Ed.). Systematics of western North
American butterflies. Mariposa Press; Gainesville, pp. 443-450.
Espeland, M., J. Breinholt, K. R. Willmott, A. D. Warren, R. Vila, E. F. A. Toussaint, S. C. Maunsell, K. Aduse-
Poku, G. Talavera, R. Eastwood, M. A. Jarzyna, R. Guralnick, D. J. Lohman, N. E. Pierce, and A. Y.
Kawahara. 2018. A comprehensive and dated phylogenomic analysis of butterflies. Current Biology 28(5):
770-778.
Espeland, M., J. W. Breinholt, E. P. Barbosa, M. M. Casagrande, B. Huertas, G. Lamas, M. A. Marin, O. H. H.
Mielke, J. Y. Miller, S. Nakahara, D. Tan, A. D. Warren, T. Zacca, A. Y. Kawahara, A. V. L. Freitas, and
K. R. Willmott. 2019. Four hundred shades of brown: Higher level phylogeny of the problematic Euptychiina
(Lepidoptera, Nymphalidae, Satyrinae) based on hybrid enrichment data. Mol Phylogenet Evol 131: 116-124.
Evans, W. H. 1952. A catalogue of the American Hesperiidae indicating the classification and nomenclature adopted in
the British Museum (Natural History). Part I. Pyrginae. Section I. British Museum (Natural History). London. v
+ 178 pp., pls. 10-25.
Evans, W. H. 1953. A catalogue of the American Hesperiidae indicating the classification and nomenclature adopted in
the British Museum (Natural History). Part HI. Pyrginae. Section 2. British Museum (Natural History); London.
v + 246 pp., pls. 26-53.
Garth, J. S. 1934. Butterflies of Yosemite National Park. Bulletin of the Southern California Academy of Sciences 34:
37-75.
Gascuel, O. 1997. BIONJ: an improved version of the NJ algorithm based on a simple model of sequence data. Mol Biol
Evol 14(7): 685-695.
Geneva, A. J., C. A. Muirhead, S. B. Kingan, and D. Garrigan. 2015. A new method to scan genomes for
introgression in a secondary contact model. PLoS One 10(4): e0118621.
Godart, J. B. 1819. Pp. 13-328, in: Latreille, P. A., and J. B. Godart (Eds.), Encyclopédie Méthodique. Histoire
naturelle. Entomologie, ou histoire naturelle des crustacés, des arachnides et des insectes. veuve Agasse; Paris,
pp. 328.
Godman, F. D. 1907. Notes on the American species of Hesperiidae described by Plétz. Annals and Magazine of natural
History (7)20(16): 132-155.
Godman, F. D., and O. Salvin. 1896. On the butterflies of St. Vincent, Grenada, and the adjoining islands of the West
Indies. Proceedings of the zoological Society of London 1896(2): 513-520.
Grishin, N. V. 2019. Expanded phenotypic diagnoses for 24 recently named new taxa of Hesperiidae (Lepidoptera). The
Taxonomic Report of the International Lepidoptera Survey 8(1): 1-15.
Hebert, P. D., A. Cywinska, S. L. Ball, and J. R. deWaard. 2003. Biological identifications through DNA barcodes.
Proc Biol Sci 270(1512): 313-321.
Honey, M. R., and M. J. Scoble. 2001. Linnaeus’ butterflies (Lepidoptera: Papilionoidea and Hesperioidea). Zoological
Journal of the Linnean Society 132(3): 277-399.
ICZN. 1999. International Code of Zoological Nomenclature. Fourth edition. The International Trust for Zoological
Nomenclature; London, UK.
Kawahara, A. Y., and J. W. Breinholt. 2014. Phylogenomics provides strong evidence for relationships of butterflies
and moths. Proceedings of the Royal Society B: Biological Sciences 281(1788): 20140970.
Klots, A. B. 1936. The interrelationships of the species of the genus Lycaena Fabricius (Lepidoptera, Lycaenidae).
Bulletin of the Brooklyn Entomological Society 31: 154-170.
Kodandaramaiah, U., T. J. Simonsen, S. Bromilow, N. Wahlberg, and F. Sperling. 2013. Deceptive single-locus
taxonomy and phylogeography: Wolbachia-associated divergence in mitochondrial DNA is not reflected in
morphology and nuclear markers in a butterfly species. Ecol Evol 3(16): 5167-5176.
Kodandaramaiah, U., and N. Wahlberg. 2009. Phylogeny and biogeography of Coenonympha_ butterflies
(Nymphalidae: Satyrinae) - patterns of colonization in the Holarctic. Systematic Entomology 34: 315-323.
Layberry, R. A., P. W. Hall, and J. D. Lafontaine. 1998. The butterflies of Canada. University of Toronto Press;
Toronto, Buffalo & London. 280 pp.
Li, W., Q. Cong, J. Shen, J. Zhang, W. Hallwachs, D. H. Janzen, and N. V. Grishin. 2019. Genomes of skipper
butterflies reveal extensive convergence of wing patterns. Proceedings of the National Academy of Sciences of
the United States of America 116(13): 6232-6237.
Mallet, J. 1995. A species definition for the modern synthesis. Trends Ecol Evol 10(7): 294-299.
Mallet, J., N. Besansky, and M. W. Hahn. 2016. How reticulated are species? Bioessays 38(2): 140-149.
Maynard, C. J. 1889. Description of a new species of butterfly from the West Indies. Contributions to Science
(Newtonville) 1(2): 88-92.
Merian, M. S. 1705. Metamorphosis insectorum surinamensium. In qua erucae ac vermes surinamenses, cum omnibus
suis transformationibus, ad vivum delineantur et describuntur, singulis eorum in plantas, flores et fructus
38
collocatis, in quibus reperta sunt; tunc etiam generatio ranarum, bufonum rariorum, lacertarum, serpentum,
araneorum et formicarum exhibetur; omnia in America ad vivum naturali magnitudine picta atque descripta.
Gerard Valk; Amsterdam. [iv] + 60 pp., 60 pls.
Merriam-Webster. 2020. <https://www.merriam-webster.com/dictionary/sautoir>. Accessed | Nov. 2020.
Michener, C. D. 1942. A review of the subspecies of Agraulis vanillae (Linnaeus) (Lepidoptera: Nymphalidae).
American Museum Novitates 1197: 1-8.
Mielke, O. H. H., and M. M. Casagrande. 2002. Notas taxondmicas em Hesperiidae neotropicais, com descri¢des de
novos taxa (Lepidoptera). Revista brasileira de Zoologia 19(Suplemento 1): 27—76.
Miller, L. D., and F. M. Brown. 1979. Studies in the Lycaeninae (Lycaenidae). 4. The Higher Classification of the
American Coppers. Bulletin of the Allyn Museum 51: 1-30.
Minh, B. Q., H. A. Schmidt, O. Chernomor, D. Schrempf, M. D. Woodhams, A. von Haeseler, and R. Lanfear.
2020. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol Biol
Evol 37(5): 1530-1534.
Mutanen, M., N. Wahlberg, and L. Kaila. 2010. Comprehensive gene and taxon coverage elucidates radiation patterns
in moths and butterflies. Proc Biol Sci 277(1695): 2839-2848.
Nelis, M., T. Esko, R. Magi, F. Zimprich, A. Zimprich, D. Toncheva, S. Karachanak, T. Piskackova, I. Balascak,
L. Peltonen, E. Jakkula, K. Rehnstrom, M. Lathrop, S. Heath, P. Galan, S. Schreiber, T. Meitinger, A.
Pfeufer, H. E. Wichmann, B. Melegh, N. Polgar, D. Toniolo, P. Gasparini, P. D'Adamo, J. Klovins, L.
Nikitina-Zake, V. Kucinskas, J. Kasnauskiene, J. Lubinski, T. Debniak, S. Limborska, A. Khrunin, X.
Estivill, R. Rabionet, S. Marsal, A. Julia, S. E. Antonarakis, S. Deutsch, C. Borel, H. Attar, M. Gagnebin,
M. Macek, M. Krawezak, M. Remm, and A. Metspalu. 2009. Genetic structure of Europeans: a view from
the North-East. PLoS One 4(5): e5472.
Newton, I. 2003. Speciation and biogeography of birds Academic Press; Amsterdam, pp. xii + 668.
Oberthiir, C. 1897. Description de lépidopteres nouveaux. Bulletin de la Société entomologique de France 1897(11):
173-180.
Opler, P. A., and V. Malikul. 1992. A field guide to eastern butterflies. Houghton Mifflin Co.; Boston, New York &
London.
Pelham, J. P. 2008. Catalogue of the Butterflies of the United States and Canada. Journal of Research on the
Lepidoptera 40: 1-658.
Pelham, J. P. 2020. Catalogue of the Butterflies of the United States and Canada. Revised 7 Aug. 2020. Accessed 1
Nov. 2020. http://www. butterfliesofamerica.com/US-Can-Cat.htm.
Pefia, C., N. Wahlberg, E. Weingartner, U. Kodandaramaiah, S. Nylin, A. V. Freitas, and A. V. Brower. 2006.
Higher level phylogeny of Satyrinae butterflies (Lepidoptera: Nymphalidae) based on DNA sequence data. Mol
Phylogenet Evol 40(1): 29-49.
Pfeiler, E. 2018. DNA barcoding and taxonomic challenges in describing new putative species: examples from
sootywing and cloudywing butterflies (Lepidoptera: Hesperiidae). Diversity 10(4): 111.
Pfeiler, E., M. Ramirez, and T. A. Markow. 2016. Polyphyly in Urbanus and Astraptes (Hesperiidae: Eudaminae)
assessed using mitochondrial DNA barcodes, with a reinstated status proposed for Achalarus. J. Lep. Soc. 70(2):
85-95.
Pohl, G. R., G. G. Anweiler, B. C. Schmidt, and N. G. Kondla. 2010. An annotated list of the Lepidoptera of Alberta,
Canada Zookeys 38: 1-549.
Ratnasingham, S., and P. D. Hebert. 2007. BOLD: The Barcode of Life Data System (http://www. barcodinglife.org).
Molecular Ecology Notes 7(3): 355-364.
Remington, C. L. 1968. Suture-zones of hybrid interaction between recently joined biotas. /n: Dobzhansky, T., M. K.
Hecht, and W. C. Steere (Eds.). Evolutionary Biology. Springer; Boston, pp. 321-428.
Savela, M. 2020. Lepidoptera and some other life forms.
Sayers, E. W., M. Cavanaugh, K. Clark, J. Ostell, K. D. Pruitt, and I. Karsch-Mizrachi. 2020. GenBank. Nucleic
Acids Res 48(D1): D84—D86.
Scott, J. A., K. E. Davenport, N. G. Kondla, P. A. Opler, and M. S. Fisher. 2017. New taxa and geographic variation
of western North American butterflies: based on specimens in the C. P. Gillette Museum of Arthropod Diversity,
Colorado State University. Papilio (New Series) 26: 1-54.
Scott, J. A., and M. S. Fisher. 2014. Argynnis (Speyeria) nokomis nokomis : geographic variation, metapopulations, and
the origin of spurious specimens (Nymphalidae). Papilio (New Series) 21: 1-31.
Scudder, S. H. 1876. Synonymic list of the butterflies of North America, north of Mexico. Part 2, Rurales. Bulletin of
the Buffalo Society of Natural Sciences 3: 98-129.
Sibatani, A. 1974. A new genus for two new species of Lycaenidae (s. str.) (Lepidoptera: Lycaenidae) from Papua New
Guinea. Journal of Australian Entomological Society 13: 95-110.
39
Simonsen, T. J. 2006. Fritillary phylogeny, classification and larval hostplants: reconstructed mainly on the basis of
male and female genitalic morphology (Lepidoptera: Nymphalidae: Argynnini). Biological Journal of the
Linnean Society 89: 627-673.
Simonsen, T. J., N. Wahlberg, A. V. Z. Brower, and R. de Jong. 2006. Morphology, molecules and Fritillaries:
approaching a stable phylogeny for Argynnini (Lepidoptera: Nymphalidae). Insect Systematics & Evolution 37:
405-418.
Smith, M. J., and J. P. Brock. 1988. A review of the 7hessalia leanira complex in the southwestern United States with
a description of two new subspecies of 7hessalia fulvia. Bulletin of the Allyn Museum 118: 1-21.
Sperling, F. A. H. 2003. Butterfly molecular systematics: from species definitions to higher level phylogenies. /n:
Boggs, C., P. Erlich, and W. Watt (Eds.). Ecology and Evolution Taking Flight: Butterflies as model study
systems. University of Chicago Press; Chicago, USA, pp. 431-458.
Steinhauser, S. R. 1989. Taxonomic notes and descriptions of new taxa in the Neotropical Hesperiidae. Part I. Pyrginae.
Bulletin of the Allyn Museum 127: 1-70.
Talavera, G., V. A. Lukhtanov, N. E. Pierce, and R. Vila. 2012. Establishing criteria for higher-level classification
using molecular data: the systematics of Polvommatus blue butterflies (Lepidoptera, Lycaenidae). Cladistics 29:
166-192.
Trujano-Ortega, M., U. O. Garcia-Vazquez, C. J. Callaghan, O. Avalos-Hernandez, M. A. Luis-Martinez, and J.
E. Llorente-Bousquets. 2018. Two new genera of metalmark butterflies of North and Central America
(Lepidoptera, Riodinidae). Zookeys 729: 61-85.
Trujano-Ortega, M., U. O. Garcia-Vazquez, C. J. Callaghan, O. Avalos-Hernandez, M. A. Luis-Martinez, and J.
E. Llorente-Bousquets. 2020. Challenges for organismic taxonomical revisions in the age of phylogenomics: A
response to Zhang et al. (2019). Zookeys 4838(3): 436-440.
van Dorp, K. 2004. Molecular systematics of Lycaena F., 1807 (Lepidoptera: Lycaenidae) — some preliminary results.
Proceedings of the Netherlands Entomological Society 15: 65—70.
Wall, J. D., and D. Yoshihara Caldeira Brandt. 2016. Archaic admixture in human history. Curr Opin Genet Dev 41:
93-97.
Warren, A. D., K. J. Davis, E. M. Stangeland, J. P. Pelham, K. R. Willmott, and N. V. Grishin. 2016. Illustrated
Lists of American Butterflies. [21-XI-2017].
Wells, C. N., L. Edwards, R. Hawkins, L. Smith, and D. Tonkyn. 2011. A rearing method for Argynnis (Speyeria)
diana (Lepidoptera: Nymphalidae) that avoids larval diapause. Psyche: A Journal of Entomology 2011: 940280:
1-6.
Zacca, T., M. M. Casagrande, O. H. H. Mielke, B. Huertas, E. P. Barbosa, A. V. L. Freitas, L. M. Magaldi, M.
Espeland, S. Nakahara, and K. R. Willmott. 2018. Systematics of the butterfly genus Cissia Doubleday, 1848
(Lepidoptera: Nymphalidae: Satyrinae) using an integrative approach. Arthropod Systematics & Phylogeny
76(2): 349-376.
Zacca, T., M. M. Casagrande, O. H. H. Mielke, B. Huertas, M. Espeland, A. V. |. Freitas, K. R. Willmott, S.
Nakahara, and G. Lamas. 2020. Revalidation of Vareuptychia Forster, 1964, description of Vanima gen. nov.,
and notes on Euptychia cleophes Godman & Salvin, 1889 (Lepidoptera: Nymphalidae: Satyrinae). Zootaxa
4858(1): 1-34.
Zakharov, E. V., N. F. Lobo, C. Nowak, and J. J. Hellmann. 2009. Introgression as a likely cause of mtDNA
paraphyly in two allopatric skippers (Lepidoptera: Hesperiidae). Heredity (Edinb) 102(6): 590-599.
Zhan, S., W. Zhang, K. Niitepold, J. Hsu, J. F. Haeger, M. P. Zalucki, S. Altizer, J. C. de Roode, S. M. Reppert,
and M. R. Kronforst. 2014. The genetics of monarch butterfly migration and warning colouration. Nature
514(7522): 317-321.
Thang, J., Q. Cong, J. Shen, E. Brockmann, and N. V. Grishin. 2019a. Genomes reveal drastic and recurrent
phenotypic divergence in firetip skipper butterflies (Hesperiidae: Pyrrhopyginae). Proceedings of the Royal
Society B: Biological Sciences 286(1903): 20190609.
Thang, J., Q. Cong, J. Shen, E. Brockmann, and N. V. Grishin. 2019b. Three new subfamilies of skipper butterflies
(Lepidoptera, Hesperiidae). Zookeys 861: 91-105.
Thang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2019c. Changes to North American butterfly names. The
Taxonomic Report of the International Lepidoptera Survey 8(2): I-11.
Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2019d. Genomics of a complete butterfly continent.
bioRxiv BIORXIV/2019/829887.
Thang, J., J. Shen, Q. Cong, and N. V. Grishin. 2019e. Genomic analysis of the tribe Emesidini (Lepidoptera:
Riodinidae). Zootaxa 4668(4): 475-488.
Zuckerkandl, E., and L. Pauling. 1965. Molecules as documents of evolutionary history. J Theor Biol 8(2): 357-366.
40
The Taxonomic Report
is a publication of
The International Lepidoptera Survey (TILS)
The International Lepidoptera Survey is registered as a non-profit Limited Liability Company (LLC) in
the state of Virginia, U.S.A. The Taxonomic Report (TTR) is published for the purpose of providing a
public and permanent scientific record. It appears in digital, open-access form, is regularly disseminated
in hardcopy form to select institutional repositories and is also available as printed copy upon request at
the discretion of authors and/or the editor. Printing and postage costs may apply. Contents are peer-
reviewed but not necessarily through the anonymous review and comment process preferred by some
publishers of serial literature. Copies of all TTR papers are available via the following digital
repositories: Internet Archive (https://archive.org/), Biodiversity Heritage —_ Library
(hitps://www.biodiversitylibrary.org), Zobodat (https://www.zobodat.at/) and at the archival TTR website:
(http://lepsurvey.carolinanature.com/report.html).
TILS Purpose
TILS is devoted to the worldwide collection of Lepidoptera for the purpose of scientific discovery,
determination, and documentation, without which there can be no preservation.
TILS Motto
“As a world community, we cannot protect that which we do not know”
Articles for publication are sought
They may deal with any area of research on Lepidoptera, including faunal surveys, conservation topics,
methods, etc. Taxonomic papers are especially welcome. There are no page charges for authors. Before
sending a manuscript, simply write to TTR editor, Harry Pavulaan, 606 Hunton Place NE, Leesburg,
VA, 20176, USA to initiate discussion on how to best handle your material for publication, and to discuss
peer review options; or email to intlepsurve mail.com.
Visit The International Lepidoptera Survey on the World Wide Web at:
http://lepsurvey.carolinanature.com
&
Join the discussion at our list servers on Yahoo! Groups.io at:
http://groups.yahoo.com/group/TILS-leps-talk/
http://groups.yahoo.com/group/TILS-moth-rah/
https://groups.io/g/TILS
or subscribe by sending an email to: [email protected]
&
Join The International Lepidoptera Survey on Facebook at:
https://www.facebook.com/groups/1072292259768446
4]